Skip to main content
Advertisement
  • Loading metrics

Meis1 isoform diversity orchestrates neural progenitor differentiation by regulating ATOH1 degradation at distinct subcellular compartments

  • Tomoo Owa ,

    Contributed equally to this work with: Tomoo Owa, Toma Adachi

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    owa@ncnp.go.jp (TO); hoshino@ncnp.go.jp (MH)

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Toma Adachi ,

    Contributed equally to this work with: Tomoo Owa, Toma Adachi

    Roles Investigation, Writing – review & editing

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Ryo Shiraishi,

    Roles Conceptualization, Investigation, Resources, Writing – review & editing

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Kentaro Ichijo,

    Roles Investigation, Writing – review & editing

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Department of Otolaryngology and Head and Neck Surgery, Faculty of Medicine, The University of Tokyo, Tokyo, Japan

  • Kaiyuan Ji,

    Roles Investigation, Writing – review & editing

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Graduate School of Medical and Dental Sciences, Institute of Science Tokyo, Tokyo, Japan

  • Minami Mizuno,

    Roles Writing – review & editing, Investigation

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Graduate School of Medical and Dental Sciences, Institute of Science Tokyo, Tokyo, Japan, Department of Biomolecular Science, Faculty of Science, Toho University, Chiba, Japan

  • Kyoka Suyama,

    Roles Investigation, Writing – review & editing

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Graduate School of Medical and Dental Sciences, Institute of Science Tokyo, Tokyo, Japan

  • Kayo Nishitani,

    Roles Investigation

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Ikuko Hasegawa,

    Roles Investigation

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Masaki Sone,

    Roles Investigation, Writing – review & editing

    Affiliation Department of Biomolecular Science, Faculty of Science, Toho University, Chiba, Japan

  • Daisuke Kawauchi,

    Roles Investigation, Resources, Writing – review & editing

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Department of Neuro-oncology, Institute of Brain Science, Graduate School of Medical Sciences, Nagoya City University, Aichi, Japan

  • Tomoki Nishioka,

    Roles Investigation, Writing – review & editing

    Affiliation International Center for Brain Sciences, Fujita Health University, Aichi, Japan

  • Shinichiro Taya ,

    Roles Investigation, Writing – review & editing

    Deceased on May 10, 2024.

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  • Yutaka Suzuki,

    Roles Investigation, Writing – review & editing

    Affiliation Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan

  • Kozo Kaibuchi,

    Roles Investigation, Writing – review & editing

    Affiliation International Center for Brain Sciences, Fujita Health University, Aichi, Japan

  • Satoshi Miyashita,

    Roles Investigation, Supervision, Writing – review & editing

    Affiliation Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan

  •  [ ... ],
  • Mikio Hoshino

    Roles Funding acquisition, Investigation, Project administration, Supervision, Writing – original draft, Writing – review & editing, Conceptualization

    owa@ncnp.go.jp (TO); hoshino@ncnp.go.jp (MH)

    Affiliations Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry (NCNP), Tokyo, Japan, Graduate School of Medical and Dental Sciences, Institute of Science Tokyo, Tokyo, Japan

  • [ view all ]
  • [ view less ]

Abstract

The development of the complex nervous system is strictly controlled by diverse isoforms produced from individual genes, but the underlying machinery remains unclear. Our long-read cDNA sequencing of mouse cerebellar granule cell progenitors (GCPs) identifies more than 700 genes with high isoform diversity. One such gene, Meis1, produces MEIS1-FL and MEIS1-HdL isoforms, which include and lack the homeodomain, respectively. Our previous study showed that MEIS1-FL localizes to nuclei and promotes ATOH1 protein degradation through transcriptional regulation, thereby promoting GCP differentiation. In contrast, our in vivo electroporation experiments in the postnatal mouse cerebellum show that MEIS1-HdL inhibits GCP differentiation. MEIS1-HdL localizes in the cytoplasm and inhibits the degradation of ATOH1 mediated by CUL3, which is a newly identified E3 ligase for ATOH1. MEIS1-HdL enhances the binding of the COP9 signalosome to CUL3, which suppresses ATOH1 polyubiquitination. This study demonstrates that functionally antagonistic isoforms derived from a single gene cleverly control neural progenitor differentiation.

Introduction

The complex and intricate central nervous system is constructed through many developmental steps. Its blueprint is thought to be largely encoded in genes, but the overall view of the genetic mechanisms of neural development remains largely unclear. Mammals, including humans, have only around 20,000 genes, but considering the number and types of neurons/glia and the complexity of neural network construction, this number may not be sufficient. Therefore, it is expected that multiple isoforms are produced from a single gene through alternative splicing and alternative transcription start sites, and play distinct roles [1,2]. Each isoform has a different molecular structure and is produced at different developmental stages, in different cell types, or in different subcellular locations, enabling extremely complex control of neural development [35]. However, the isoforms registered in databases do not cover all actual isoforms, and it is believed that only a small fraction of isoforms have been identified so far. To capture all isoforms, conventional short-read RNA-sequencing (RNA-seq) is insufficient, and long-read RNA-seq is necessary [6,7]. However, long-read analyses in this context remain limited.

The development of the nervous system involves multiple stages, including the proliferation and differentiation of neural progenitors, neuronal migration, axon outgrowth and pathway exploration, and synapse formation, with many genes involved in each stage. To address the first step, the machinery for the proliferation/differentiation of neural progenitors, we investigated granule cell progenitors (GCPs) and granule cells (GCs) in the cerebellar development. During cerebellar development, GCPs located in the outer external granular layer (oEGL) initially express the transcription factor ATOH1 which maintains them in a more undifferentiated and proliferative state [8]. However, the ATOH1 protein is subject to precise degradation control, and as development progresses, GCPs lose ATOH1 expression and begin to express NEUROD1, becoming slightly differentiated with reduced proliferative capacity (ATOH1-nonexpressing GCPs). Although these cells were referred to as NEUROD1-positive GCPs, we call them ATOH1-nonexpressing GCPs in this study. ATOH1-nonexpressing GCPs subsequently become postmitotic and differentiate into GCs [9]. This transition from ATOH1-expressing GCPs to ATOH1-nonexpressing GCPs is strictly controlled by the degradation of the ATOH1 protein, but the mechanism controlling ATOH1 degradation has not yet been fully elucidated [8,10,11].

In this study, we perform long-read RNA-seq on cerebellar GCPs to reveal extensive isoform diversity, identifying more than 700 genes with multiple isoform variants. Among genes showing high diversity, we selected Meis1 as a model gene, investigating its two distinct isoforms. One is the full-length isoform (MEIS1-FL), which has been studied extensively as a transcription factor with a homeodomain, and the other is a functionally unknown isoform (MEIS1-HdL) that lacks a homeodomain. MEIS1 (MEIS1-FL) is a homeodomain transcription factor belonging to the TALE family and is known to play an important role in stem cell maintenance, organ formation, and cell differentiation in various developmental processes [1215]. Our previous gene-level analysis using the loss-of-function mutant mice for Meis1 showed that MEIS1-FL activates Pax6 transcription, enhances the BMP signaling, and promotes ATOH1 degradation, thereby enhancing the differentiation of GCPs into GCs [16]. However, these investigations did not distinguish between the functions of its specific isoforms, leaving their individual roles unexplored. The two major Meis1-derived protein isoforms show striking differences in their temporal profiles and subcellular localization: MEIS1-FL is detected in both GCPs and GCs, and is localized in the cell nuclei, whereas MEIS1-HdL is detected in GCPs but not in GCs, and is localized in the cytoplasm. Therefore, we hypothesized that MEIS1-HdL might have significantly different functions from MEIS1-FL in GCP proliferation and differentiation.

Here, we investigate the roles of these MEIS1 isoforms in the regulation of GCP proliferation and differentiation, with a particular focus on the degradation control of ATOH1. Our in vivo experiments show that the two isoforms play opposite roles in precise regulation of GCP proliferation and differentiation. Each isoform functions in a distinct intracellular location and thereby exerts an opposite effect on ATOH1 degradation. This study provides an example of how multiple isoforms derived from a single gene precisely control neurogenesis and contributes to our further understanding of the molecular mechanisms of neurogenesis, as well as the degradation control mechanisms of critical proteins.

Results

Comprehensive long-read cDNA sequencing of cerebellar granule cell progenitors reveals extensive isoform diversity

To comprehensively investigate the isoform landscape in cerebellar GCPs, we performed long-read cDNA sequencing on GCP samples using a Nanopore sequencer [17] (Fig 1A). Our analysis identified a total of 99,010 transcripts (Fig 1B). Among the identified transcripts, known isoforms accounted for a total of 58.3%, comprising 47.7% Full Splice Match (FSM) isoforms that perfectly matched existing annotations, and 10.6% Incomplete Splice Match (ISM) isoforms (Fig 1B). We also detected a substantial number of novel isoforms, with 14.8% being Novel In Catalog (NIC) and 17.8% being Novel Not In Catalog (NNIC) (Fig 1B). The remaining transcripts included categories such as Genic Genomic, Antisense, Fusion, Intergenic, and Genic Intron. This broad range of isoform categories highlights the extensive complexity of the GCP transcriptome captured by long-read sequencing.

thumbnail
Fig 1. Comprehensive long-read cDNA sequencing unveils extensive isoform diversity and key transcription factors in cerebellar GCPs.

A. Schematic diagram of the cDNA long-read sequencing analysis workflow using cerebellar granule cell progenitors (GCPs). The analysis is based on data from n = 3 independent biological replicates. Created in BioRender. Hoshino, M. (2026) https://BioRender.com/22hzij1. B. Classification of all identified transcripts (99,010 in total) based on Sqanti3 [59] categories, displaying the proportion of Full Splice Match (FSM), Incomplete Splice Match (ISM), Novel In Catalog (NIC), Novel Not In Catalog (NNIC), and other categories. C. Distribution of isoform counts per gene among genes with at least one transcript meeting the TPM > 1 screening criterion in all three replicates. The graph shows the percentage of genes with 1, 2, 3, 4, or ≥5 detected isoforms (11,836 genes in total). D. Gene Ontology (GO) enrichment analysis for genes with high isoform diversity (defined as ≥5 isoforms with TPM > 1 in all three replicates; 749 genes total), performed using Enrichr [6365] (GO Biological Process 2025). E. Venn diagram showing the intersection of three gene lists to identify key transcription factors relevant to cerebellar development: (1) genes with high isoform diversity, (2) known transcription factors (from Mus musculus TFDB v4.0), and (3) genes associated with “Brain Development” term (GO:0007420) from the Enrichr. The analysis identified three common transcription factors: Meis1, Pax6, and Nfib. The complete list of high-diversity genes is provided in the S1 Data. F. Structures and expression levels of identified Meis1 transcript isoforms. Top: Isoform structures visualized with ggtranscript [66]. Bottom: Corresponding expression levels in Transcripts Per Million (TPM). G. Predicted protein domain structures of coding Meis1 isoforms. At the top, the full-length protein-coding exons are aligned, with numbers indicating the corresponding amino acid residues encoded by each exon to clarify the relationship between exons and protein domains. Protein sequences were obtained via Sqanti3, with domains predicted by InterPro [67] and visualized using drawProteins [68]. Key conserved domains are shown. Locations of the putative Nuclear Export Signal (NES; blue) and Nuclear Localization Signal (NLS; red) were manually annotated. Some isoforms lack the C-terminal homeodomain containing the NLS. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g001

To define a transcript set for downstream analysis based on expression level, we next assessed their expression levels. A histogram of Transcript Per Million (TPM) values revealed that a substantial fraction of transcripts, particularly the novel isoforms, were expressed at low levels (S1C Fig). Since low-abundance transcripts can represent either rare, functional isoforms or transcriptional noise, we applied an expression threshold to define a working dataset for downstream analysis.

To understand the extent of isoform diversity per gene, we analyzed the number of isoforms produced by each gene. Initially, without filtering by expression level, we found that a substantial proportion of genes (30.86%) expressed five or more isoforms (S1D Fig). To examine isoform diversity using a consistent expression criterion, we applied a screening criterion, retaining only those transcripts with a TPM value greater than 1 in each of our three replicates. This analysis identified 11,836 genes with at least one transcript meeting this criterion. Of these, 48.5% expressed a single isoform, while a notable 6.33% of genes (749 genes) expressed five or more isoforms, highlighting a subset of genes with particularly high isoform diversity (Fig 1C and S1 Data).

We then performed Gene Ontology (GO) enrichment analysis for the 749 genes exhibiting high isoform diversity (≥5 isoforms with TPM > 1), focusing on Biological Process terms (Fig 1D). The top enriched GO terms were predominantly related to mRNA splicing (e.g., “mRNA Splicing via Spliceosome,” “RNA Processing,” “Regulation of mRNA splicing”) and protein–RNA complex assembly. This enrichment suggests that genes with high isoform diversity are themselves enriched in functions related to the regulation and execution of transcript diversification, indicating a self-reinforcing mechanism of complexity in the transcriptome.

Identification of transcription factors with extensive isoform diversity in GCPs

To understand how this extensive isoform diversity regulates GCP differentiation, we focused on transcription factors, as they are the master regulators that orchestrate the gene expression programs driving this process. We therefore performed a Venn diagram analysis (Fig 1E). This analysis combined the 749 high isoform diversity genes with a list of transcription factors and 171 genes annotated with the “Brain Development” GO term (GO:0007420). This intersection revealed three common transcription factors: Meis1, Pax6, and Nfib. All of these transcription factors have been implicated in cerebellar development, with their disruption leading to structural or developmental abnormalities [16,1820].

For Meis1, we detected seven transcripts (five novel), predicted to encode several protein variants. Most notably, these included a canonical full-length isoform and a major novel isoform lacking the DNA-binding homeodomain (Fig 1F and 1G; S2 Data) [21]. The absolute read counts for each Meis1 transcript variant identified in Fig 1F are provided in S2 Data. For Pax6, we identified 10 transcripts (four novel). Our data captured its well-established diversity, including known isoforms like Pax6(5a) that arise from subtle variations within the paired domain to alter DNA-binding specificity [22,23]. In addition to these, our analysis revealed more drastically altered novel variants, including the one that lacks the paired domain entirely while retaining the homeodomain, and another predicted to be a short protein lacking both canonical domains (S1E and S1F Fig). For Nfib, we detected 14 transcripts (eight novel). This aligns with the known strategy for Nfib, where functional diversity often arises from variations in the C-terminal transactivation domain while the N-terminal DNA-binding domain is conserved, generating proteins such as dominant-negative isoforms [24,25]. Our analysis expanded this repertoire, uncovering novel variants with more substantial changes, including one completely lacking the CTF/NFI C-terminal domain itself, and another lacking all predicted domains (S1G and S1H Fig). Among these three factors, we chose to focus on Meis1 for our in-depth functional analysis. This decision was based on two key points. First, in contrast to the isoforms of Pax6 and Nfib that primarily suggest changes in transcriptional activity, the diversity of Meis1 isoforms pointed to a novel regulatory mechanism based on subcellular localization. Specifically, we found that a canonical full-length isoform containing a nuclear localization signal (NLS) and a major homeodomain-less variant that lacks the NLS but retains domains associated with a nuclear export signal (NES) were detected in GCPs [12]. Second, Meis1’s established role as an upstream regulator of Pax6 placed this potential mechanism in a critical biological context. Therefore, we proceeded to use Meis1 as a model to understand how the structural diversity of its isoforms orchestrates the process of neural progenitor differentiation.

Meis1 gene produces two major, spatially separated protein isoforms in GCPs

To examine the protein expression of MEIS1 isoforms in GCPs, we performed Western blotting with a pan-MEIS1 antibody (Fig 2A, left panel). We observed a major band around 50 kDa, consistent with the predicted size of the full-length protein, together with a lower-molecular-weight band. As these were the only major protein products robustly detected, our subsequent functional analysis focused on these forms. The lower-molecular-weight band was consistent with a previously described homeodomain-less isoform, “MEIS1D,” reported in colorectal cancer [21]. Based on this, we hypothesized that the lower-molecular-weight band in GCPs represents homeodomain-less isoform. To identify this lower-molecular-weight band as the homeodomain-less isoform, we generated a specific antibody against its unique 5-amino acid C-terminus (S2A Fig). When the same membrane was re-probed with this newly generated antibody, the upper band corresponding to MEIS1-FL was no longer detected, whereas the lower-molecular-weight band was specifically recognized (Fig 2A, middle panel). To further exclude the possibility of background reactivity, we performed immunoprecipitation followed by Western blotting. Immunoprecipitation of GCP lysates with the MEIS1-HdL-specific antibody followed by immunoblotting with a pan-MEIS1 antibody detected a single band that matched the mobility of the lower-molecular-weight band observed in whole-cell lysates (S2B Fig). Based on this protein evidence, we hereafter refer to the full-length protein as MEIS1-FL (NCBI: NP_001180200.1; Ensembl: ENSMUST00000068264.14) and the homeodomain-less isoform as MEIS1-HdL (transcript10374.11.nic in Fig 1G). Thus, western blot and RT-PCR analyses collectively demonstrate that GCPs co-express two major Meis1 isoforms, FL and HdL, at both the protein and transcript levels (Fig 2A and 2B).

thumbnail
Fig 2. Meis1 isoforms exhibit distinct expression patterns and subcellular localizations in GCPs.

A. Immunoblotting of P7 GCP lysates using the indicated antibodies. A major band at ~50 kDa corresponds to MEIS1-FL. A lower-molecular-weight band is detected by the pan-MEIS1 antibody and is specifically recognized by the MEIS1-HdL-specific antibody upon re-probing of the same membrane. B. Meis1 PCR amplification using a negative control (RT), plasmids coding for Meis1-FL or Meis1-HdL, or P6 GCP cDNA (RT+) templates. Upper panel: RT-PCR performed with a primer pair that amplifies only Meis1-FL (primers recognizing exon8 and exon11). Lower panel: RT-PCR was performed using primer pairs that amplify only Meis1-HdL (primers recognizing the start codon and the junction of exon7-9). Both Meis1 isoforms are detected by RT-PCR. C. Representative immunofluorescence images showing the subcellular localization of MEIS1-FL-EGFP and MEIS1-HdL-EGFP in P9 cerebellar GCPs electroporated in vivo at P8. Sections were immunostained for GFP (green, MEIS1 isoforms), N-cadherin (magenta, cell boundaries), and counterstained with DAPI (blue, nuclei). D. Quantification of the cytosolic-to-total GFP signal ratio in individual electroporated cells from (C). The cytosolic region was defined as the N-cadherin-positive cellular area excluding the DAPI-stained nucleus. (n = 25 cells from 3 mice for MEIS1-FL; n = 25 cells from 4 mice for MEIS1-HdL). E. Schematic of GCP separation via FACS, using Atoh1AtGFP/+; Ki67KiRFP/+ mice. This method isolates three distinct populations used for subsequent analysis: ATOH1-expressing GCPs (GFP+RFP+), ATOH1-nonexpressing GCPs (GFP−RFP+), and postmitotic granule cells (GCs; GFP−RFP−). F. Relative mRNA expression of Meis1-FL and Meis1-HdL (norm. to 18s rRNA) in the cell populations defined in (E), as quantified by qRT-PCR. (n = 3 samples from 3 mice). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g002

Next, we investigated the subcellular localization of MEIS1 isoforms in GCPs. Subcellular fractionation of GCP lysates followed by Western blotting with a pan-MEIS1 antibody revealed that the ~50 kDa band (MEIS1-FL) was predominantly localized in the nuclear fraction, while the lower band (MEIS1-HdL) was found primarily in the cytoplasmic fraction (S2C Fig). This observation aligns with our structural prediction that MEIS1-FL contains an NLS within its homeodomain, whereas MEIS1-HdL, lacking the homeodomain, retains an NES (Fig 1G). To investigate this differential localization in the developing cerebellum, we introduced plasmids encoding MEIS1-FL-EGFP and MEIS1-HdL-EGFP fusion proteins into GCPs in the postnatal day 8 (P8) cerebellum via in vivo electroporation, and analyzed them at P9. Immunofluorescence staining showed that MEIS1-FL-EGFP localized strongly to the nucleus, while MEIS1-HdL-EGFP exhibited robust cytoplasmic localization (Fig 2C and 2D). We obtained consistent results in N2a cells. Subcellular fractionation of N2a cells overexpressing untagged constructs revealed that MEIS1-FL was largely nuclear but also present in the cytoplasm, whereas MEIS1-HdL was predominantly cytoplasmic (S2D Fig). Consistent with this, immunofluorescence staining of N2a cells overexpressing EGFP-tagged constructs (S2E Fig) further confirmed that MEIS1-FL-EGFP localized strongly to the nucleus, while MEIS1-HdL-EGFP showed robust cytoplasmic localization. Taken together, these results demonstrate that MEIS1 isoforms occupy distinct subcellular compartments in GCPs, and this physical separation strongly suggests they have distinct functional roles.

Differential expression profiles of Meis1-FL and Meis1-HdL during GCP differentiation

We next examined the developmental stage-specific expression of Meis1-FL and Meis1-HdL in GCPs. Our previous work has shown a two-step amplification model for GCP differentiation, where highly proliferative, ATOH1-expressing GCPs give rise to an intermediate, transit-amplifying population that is ATOH1-negative and NEUROD1-positive, before finally exiting the cell cycle to become GCs [9]. To distinguish and isolate these distinct progenitor populations, we utilized Atoh1AtGFP/+; Ki67KiRFP/+ knock-in mice [26,27]. We validated these reporter mice by demonstrating that GFP signal largely overlapped with Atoh1 immunostaining (S3A Fig), and RFP signal overlapped with KI67 immunostaining (S3B Fig). The combined GFP and RFP expression patterns showed that GFP was more restricted to the oEGL, while RFP was expressed more broadly but still predominantly in the oEGL (S3C Fig). This finding is consistent with the known restricted localization of endogenous ATOH1 to the oEGL [8], further validating our reporter mice. We used FACS to isolate three populations based on our model: ATOH1-expressing GCPs (GFP+RFP+), ATOH1-nonexpressing GCPs (GFP−RFP+), and postmitotic GCs (GFP−RFP−) (Figs 2E and S3D). The specificity of our sorting strategy was further validated by qRT-PCR for Atoh1, which showed Atoh1 expression exclusively in GFP+RFP+ sorted cells (S3E Fig). Quantitative RT-PCR analysis of Meis1 isoforms across these sorted populations revealed that Meis1-HdL expression was highly enriched in GFP+RFP+ sorted cells (ATOH1-expressing GCPs), with minimal expression in GFP−RFP+ sorted GCPs (ATOH1-nonexpressing, NEUROD1-expressing GCPs) and GFP−RFP− sorted cells (GCs) (Fig 2F, lower graph). In contrast, Meis1-FL transcript levels remained relatively constant across ATOH1-expressing GCPs, ATOH1-nonexpressing GCPs, and postmitotic GCs (Fig 2F, upper graph). Taken together with our localization data, these findings reveal a clear spatio-temporal partitioning of the two major MEIS1 protein products. MEIS1-HdL is confined to the cytoplasm, and its transcript levels are highest at the earliest, most proliferative stage of GCP development. This physical and developmental segregation suggests they have distinct functional roles.

Opposing functions of MEIS1-FL and MEIS1-HdL in regulating GCP fate in vivo

To examine the functions of MEIS1-FL and MEIS1-HdL in cerebellar granule cell development, we performed in vivo overexpression experiments in GCPs. We introduced expression vectors encoding either Meis1-FL or Meis1-HdL into ATOH1-expressing GCPs via electroporation into the P8 cerebella. At 72 hours post-electroporation (P11), the cerebella were collected, fixed, and immunostained. Electroporated cells were identified by co-electroporated histone H3.1-GFP.

In control animals, the GFP+ cells comprised approximately 50% GCPs (Ki67+ cells) and 50% differentiating/differentiated GCs (p27+ cells) (Figs 3A, 3D, 3E, and S4A). Overexpression of Meis1-FL significantly decreased the proportion of GCPs (Ki67+ cells) and increased the proportion of GCs (p27 + cells) (Figs 3B, 3D, 3E, and S4B). Conversely, Meis1-HdL overexpression led to an increase in the proportion of GCPs (Ki67+ cells) and a decrease in the proportion of GCs (p27+ cells), indicative of maintaining an undifferentiated, proliferative state (Figs 3C, 3D, 3E, and S4C). Similarly, MEIS1-FL overexpression decreased the proportion of ATOH1-expressing GCPs, whereas MEIS1-HdL overexpression increased ATOH1-expressing GCPs (Fig 3A3C and 3F). These results indicate that MEIS1-FL and MEIS1-HdL have opposing effects on GCP differentiation. This promotion of GCP differentiation by MEIS1-FL is consistent with our previous observation that conditional deletion of Meis1, an allele that disrupts all homeodomain-containing isoforms (most notably the full-length MEIS1-FL), delayed GCP differentiation [16].

thumbnail
Fig 3. MEIS1-HdL maintains the undifferentiated state of GCPs, while MEIS1-FL promotes GC differentiation.

A–C. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Cerebellar sections were immunostained for ATOH1 (magenta) and KI67 (cyan). Electroporated cells, identified by co-electroporated H3.1-EGFP (yellow), were transfected with a control vector (A), Meis1-FL (B), or Meis1-HdL (C). D–F. Quantification of electroporated cell differentiation status. The percentage of GFP+ cells expressing KI67 (D), p27 (E), or ATOH1 (F) was quantified from sections described in (A–C). (n = 4 mice per group). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g003

To further investigate the physiological function of MEIS1-HdL, we performed loss-of-function experiments using shRNA. We first generated a Meis1-HdL-specific knockdown vector (sh-Meis1-HdL), which effectively suppressed Meis1-HdL expression without affecting Meis1-FL (S5A Fig, left panel). For comparison, we also utilized a previously established pan-Meis1 knockdown vector (sh-Meis1-all) [16], which suppressed the expression of both Meis1-FL and Meis1-HdL (S5A Fig, right panel).

These shRNA vectors, along with co-electroporated histone H3.1-GFP to identify electroporated cells, were introduced into GCPs in the P8 cerebella via in vivo electroporation. Cerebellar sections were analyzed by immunostaining 72 hours post-electroporation (P11). Specific knockdown of Meis1-HdL significantly reduced the proportion of proliferative GCPs (Ki67+ cells) and increased the proportion of postmitotic GCs (p27+ cells) (Figs 4A, 4D, 4E, and S5B). A similar trend was observed for ATOH1-expressing GCP population (Fig 4A and 4F). These findings suggest that the endogenous function of MEIS1-HdL is to suppress GCP differentiation. Crucially, the phenotypes induced by sh-Meis1-HdL were rescued by co-electroporation with a knockdown-resistant Meis1-HdL expression vector (Res-Meis1-HdL), restoring the proportion of KI67+ (Fig 4B and 4D) and ATOH1+ cells (Fig 4B and 4F), and decreasing p27+ cells (Figs 4E and S5C). This rescue demonstrates that the observed effects are due to the loss of MEIS1-HdL, thereby establishing its critical role in suppressing GCP differentiation.

thumbnail
Fig 4. Endogenous MEIS1-HdL participates in maintaining GCPs in an immature and proliferative state.

A–C. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Cerebellar sections were immunostained for ATOH1 (magenta) and KI67 (cyan). Electroporated cells, identified by co-electroporated H3.1-EGFP (yellow), were transfected with sh-Meis1-HdL (A), sh-Meis1-HdL plus a knockdown-resistant rescue construct (Res-Meis1-HdL) (B), or sh-Meis1-all (C). D–F. Quantification of electroporated cell differentiation status. The percentage of GFP+ cells expressing KI67 (D), p27 (E), or ATOH1 (F) was quantified from sections described in (A–C). (n = 4 mice for Control, sh-Meis1-HdL, and Rescue; n = 3 mice for sh-Meis1-all). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g004

Notably, knocking down both isoforms with sh-Meis1-all did not significantly alter the overall proportion of KI67+ or p27+ cells (Figs 4C, 4D, 4E, and S5D). We interpret this lack of phenotype as resulting from mutual cancellation; the pro-differentiative effect of MEIS1-HdL loss is likely balanced by the anti-differentiative effect of MEIS1-FL loss. However, the specific reduction in the ATOH1-expressing GCP population (Fig 4C and 4F) may suggest a dominant role for MEIS1-HdL in maintaining this progenitor state, an effect that is not fully compensated for by the simultaneous loss of MEIS1-FL.

MEIS1-FL and MEIS1-HdL stabilize ATOH1 protein levels

The precise control of ATOH1 protein abundance is critical for regulating the transition of GCPs from proliferation to differentiation [8,10,2830]. Our previous work has shown that MEIS1-FL promotes transcription of Pax6, activates BMP signaling, and acts to promote ATOH1 degradation [16]. However, we found that MEIS1-HdL lacking homeodomain also affects the differentiation of GCPs to GCs (Figs 3 and 4), suggesting that MEIS1 proteins may have additional functions to regulate the amount of ATOH1. To test this, we first examined the effect of Meis1 knockdown on ATOH1 protein levels in vivo by measuring ATOH1 fluorescence intensities. In cerebella electroporated with sh-Meis1-HdL at P8 and fixed at P11, ATOH1 fluorescence intensities in electroporated cells (GFP+) were lower compared to surrounding non-electroporated cells (S6A, S6B, and S6E Fig). In contrast, KI67 fluorescence intensities were not significantly affected by sh-Meis1-HdL (S6A, S6B, and S6D Fig). This suggests that MEIS1-HdL may participate in maintaining ATOH1 protein levels in ATOH1-expressing GCPs (S6A, S6B, and S6D Fig). Similar tendencies were also observed for sh-Meis1-all electroporated cerebella (S6A and S6CS6E Fig). However, because sh-Meis1-all was designed to suppress both MEIS1-HdL and MEIS1-FL, it was unclear whether MEIS1-FL is also capable of maintaining ATOH1 protein levels at this point.

To further investigate the machinery of MEIS1 isoforms to regulate ATOH1 protein levels, we transfected ATOH1 and MEIS1 expression vectors into N2a cells and performed immunoblotting. We used a GST-tagged ATOH1 (GST-ATOH1) expression vector to discriminate between endogenous and exogenous ATOH1 proteins, although it is known that N2a cells do not express endogenous ATOH1 under normal conditions [31]. Administration of MG132, an inhibitor of proteasome-dependent protein degradation, enhanced the ATOH1 signals (S7A Fig, lane 5) relative to the control (S7A Fig, lane 1), consistent with the previous findings that ATOH1 is degraded via proteasome-dependent protein degradation [10,11,32,33]. To determine the specific domains of MEIS1 required for ATOH1 stabilization, we compared the effects of MEIS1-FL, MEIS1-HdL, and a further truncated N-terminal MEIS1 fragment (1–130 aa). MEIS1 possesses a highly conserved Homeobox protein PKNOX/Meis N-terminal domain (71–184 aa), which encompasses the MEIS Homology domains (MH-A, 72–111 aa; and MH-B, 136–180 aa) [34], and a C-terminal Homeodomain (HD, 290–329 aa). While MEIS1-HdL retains the intact Homeobox protein PKNOX/Meis N-terminal domain but is devoid of the HD, the MEIS1(1–130) truncation lacks both the MH-B domain and the HD. Interestingly, ATOH1 signals were also higher following co-transfection with MEIS1-HdL (lane 3 in S7A Fig) or MEIS1-FL (S7A Fig, lane 4), whereas the N-terminal MEIS1 fragment (1–130 aa) did not exhibit such an effect (S7A Fig, lane 2). To further analyze ATOH1 stability, we immunoblotted transfected N2a cells treated with cycloheximide (CHX, a protein synthesis inhibitor) for 0, 4, and 8 h. This revealed that MEIS1-HdL and MEIS1-FL both strongly suppressed ATOH1 degradation to the same extent as MG132 administration (S7B and S7C Fig). These observations suggest that both MEIS1-HdL and MEIS1-FL have the capability to suppress the proteasome-dependent degradation of ATOH1.

MEIS1 inhibits CUL3-mediated ubiquitination of ATOH1

Because the proteasome-dependent degradation is triggered by ubiquitination of proteins, we attempted to assess ATOH1 ubiquitination in cultured cells. N2a cells were co-transfected with GST-ATOH1 and HA-Ub. Then, GST-ATOH1 was pulled down by glutathione beads and immunoblotted with an anti-HA antibody. Consistent with previous findings [10,32], ATOH1 was strongly polyubiquitinated (Fig 5A, lane 1). However, co-transfection with MEIS1-FL or MEIS1-HdL significantly reduced GST-ATOH1 polyubiquitination (Fig 5A, lanes 2 and 3; Fig 5B). These findings suggest that both MEIS1-FL and MEIS1-HdL suppress the functions of molecules related to ATOH1 polyubiquitination, eventually blocking ATOH1 degradation. The fact that not only MEIS1-FL but also MEIS1-HdL does this suggests that this function is not elicited by MEIS1-induced transcriptional regulation.

thumbnail
Fig 5. MEIS1 inhibits CUL3-mediated ATOH1 ubiquitination, leading to ATOH1 stabilization.

A. Immunoblotting of GST pull-down fractions from N2a cells co-transfected with GST-ATOH1, HA-Ub, and either MEIS1-FL or MEIS1-HdL. Polyubiquitinated ATOH1 (upper panel) was detected using an anti-HA antibody, while total GST-ATOH1 levels (middle panel) were detected using an anti-GST antibody. MEIS1 expression in input lysates was confirmed by immunoblotting with an anti-MEIS1 antibody (lower panel). B. Quantification of polyubiquitinated ATOH1 levels, normalized to total GST-ATOH1 levels from (A). C. Schematic illustrating the proteomic analysis strategy to identify ATOH1-binding molecules in the presence or absence of MEIS1 in N2a cells. D. List of ubiquitin-modifying enzymes and related proteins (identified by PANTHER GO analysis) that showed reduced binding to ATOH1 in the presence of MEIS1-FL, as identified by proteomic analysis (as described in C). E. Immunoblotting of GST pull-down fractions from N2a cells transfected with GST-ATOH1 alone or co-transfected with GST-ATOH1 and either MEIS1-FL or MEIS1-HdL. Interaction with endogenous CUL3 was determined by immunoblotting with an anti-CUL3 antibody. The interaction is disrupted by the co-expression of either MEIS1-FL or MEIS1-HdL. MEIS1 expression in input lysates was confirmed by immunoblotting with an anti-MEIS1 antibody (lower panel). F. Immunoblotting of GST pull-down fractions from N2a cells co-transfected with GST-ATOH1, HA-Ub, and either a control scramble shRNA (sh-Scramble) or a Cul3 knockdown shRNA (sh-Cul3). Polyubiquitinated ATOH1 (upper panel) was detected with an anti-HA antibody, and total GST-ATOH1 levels (middle panel) were detected with an anti-GST antibody. CUL3 expression in input lysates was confirmed by immunoblotting with an anti-CUL3 antibody (lower panel). G. Immunoblotting analysis of N2a cell lysates following cycloheximide (CHX) chase assay. N2a cells transfected with GST-ATOH1 and either sh-Scramble or sh-Cul3 were treated with CHX for 0, 4, and 8 hours. ATOH1 protein levels were detected using an anti-ATOH1 antibody, with GAPDH as a loading control. H. Quantification of ATOH1 protein levels from (G), normalized to GAPDH, showing that knockdown of Cul3 inhibits ATOH1 degradation. (n = 3 independent experiments for (B) and n = 4 independent experiments for (H)). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g005

Based on our findings suggesting that MEIS1 isoform proteins affect the function of molecules involved in ATOH1 polyubiquitination, we searched for ATOH1-binding molecules whose binding affinities were altered by the presence of MEIS1 in cultured cells. After transfecting GST-ATOH1 or GST-ATOH1 plus MEIS1-FL into N2a cells, GST-ATOH1 was pulled down, and its binding molecules were subjected to LC–MS/MS (Fig 5C). We obtained many candidate molecules that bind ATOH1 (see S3 Data), identifying several ATOH1-binding molecules whose interaction with ATOH1 was disrupted or much reduced in the presence of MEIS1-FL (Fig 5D). Notably, these included the E3 ubiquitin ligase Cullin-3 (CUL3) and its known partners UBE2M and CAND1 (Fig 5D and S3 Data) [3537], suggesting that CUL3 may act as an E3-ligase for ATOH1. To date, HUWE1 is the only E3-ligase reported to participate in ATOH1 degradation [10,32]. Although we found that HUWE1 binds to GST-ATOH1, its binding ability was not affected by MEIS1-FL, which further focused our attention on CUL3.

To confirm the proteomic finding that MEIS1 disrupts the ATOH1-CUL3 interaction, we performed co-immunoprecipitation experiments. We co-transfected GST-ATOH1 and MEIS1-FL or MEIS1-HdL into N2a cells, followed by pull-down with GST-ATOH1. Similar to the LC–MS/MS results, immunoblotting showed that CUL3 bound ATOH1 in the absence of MEIS1 (Fig 5E, lane 1), but not in the presence of MEIS1-FL or MEIS1-HdL (Fig 5E, lanes 2, 3).

Next, we examined the involvement of CUL3 in ATOH1 polyubiquitination. GST-ATOH1 and HA-Ub were co-transfected with a control or Cul3-knockdown vector (sh-Cul3) into N2a cells, which were subjected to pulldown and immunoblotting with the indicated antibodies (Fig 5F), in the absence of MG132. GST-ATOH1 polyubiquitination was strongly suppressed by Cul3-knockdown (Fig 5F), suggesting that CUL3 is involved in ATOH1 polyubiquitination. To further analyze the effect of Cul3 knockdown on ATOH1 stability, we immunoblotted N2a cells transfected with GST-ATOH1 and control or sh-Cul3 and administered CHX for 0, 4, and 8 h (Fig 5G). This revealed that Cul3-knockdown markedly suppressed ATOH1 degradation in N2a cells (Fig 5H). These observations suggest that CUL3 acts as a key E3 ubiquitin ligase for ATOH1 and that MEIS1-FL and MEIS1-HdL inhibit the interaction between CUL3 and ATOH1, eventually suppressing the polyubiquitination and degradation of ATOH1.

MEIS1 inhibits the degradation of ATOH1 induced by S328 phosphorylation

Previous studies have shown that phosphorylation of ATOH1 regulates its degradation [10,32,38], which led us to the notion that MEIS1 may affect ATOH1 phosphorylation as a part of its stabilization mechanism. To test this, we initially investigated ATOH1 phosphorylation sites by LC–MS/MS using N2a cells transfected with ATOH1 alone or ATOH1 and MEIS1-FL (S8A Fig). We observed that ATOH1 phosphorylation at some sites was increased in the presence of MEIS1-FL (S8B Fig and S4 Data). Particularly, analysis of MS signal intensities indicated that S328 phosphorylation was markedly increased. Consistent with the proteomics data, immunoblot analysis using an antibody against ATOH1 p-S328 indicated that phosphorylation at S328 was much increased in the presence of either MEIS1-FL or MEIS1-HdL (S8C Fig). It has been reported that S328 phosphorylation is involved in the degradation of ATOH1 [10,32]. Accordingly, the CHX chase assay showed that ATOH1-S328A (Ser 328 of ATOH1 was replaced with Ala; an ATOH1-S328 non-phosphorylated form) was stable, whereas ATOH1-S328D (Ser 328 of ATOH1 was replaced with Asp; an ATOH1-S328 phosphomimic form) was unstable (S8DS8H Fig). Consistent with its constitutive degradation, the steady-state baseline protein level of ATOH1-S328D was markedly lower than that of wild-type ATOH1 (S8E and S8F Fig). However, the stability of ATOH1-S328D increased in the presence of MEIS1-FL or MEIS1-HdL (S8G and S8H Fig). These observations suggest that the MEIS1 isoforms suppress ATOH1 degradation induced by phosphorylation at S328 without inhibiting phosphorylation of S328 ATOH1.

Next, GST-ATOH1 or GST-ATOH1-S328A and HA-Ub were co-transfected into N2a cells; pull-down and immunoblotting were subsequently performed with the indicated antibodies (S8I Fig). The polyubiquitination efficiency of S328A was lower than that of the wild-type ATOH1 (S8I Fig upper panel), which is consistent with the observation that ATOH1-S328A is stable (S8D and S8H Fig). Furthermore, the interaction of GST-ATOH1-S328A with CUL3 was much weaker than that of GST-ATOH1 with CUL3 (S8I Fig second panel from the top). These findings indicate that S328 phosphorylation is involved in CUL3 binding and polyubiquitination of the ATOH1 protein. MEIS1 isoforms do not suppress S328 phosphorylation but instead act to inhibit the interaction between S328-phosphorylated ATOH1 and CUL3, leading to the stabilization of ATOH1.

MEIS1 inactivates CUL3 by promoting COP9 signalosome (CSN) and CUL3 complex formation

To understand how MEIS1 inhibits CUL3 activity, we next investigated MEIS1-binding molecules in N2a cells. GST-tagged MEIS1-FL (GST-MEIS1-FL) was transfected into N2a cells, precipitated using glutathione beads, and subjected to LC–MS/MS (S9A Fig). We obtained 1,417 MEIS1-binding candidate molecules (S3 Data). Interestingly, these included several components of the COP9 signalosome (CSN) complex, such as COPS2, COPS3, COPS4, COPS6, COPS7a, and COPS8 (Fig 6A and S3 Data), suggesting that MEIS1-FL interacts with the CSN complex. It is known that the CSN complex, consisting of eight components, suppresses substrate polyubiquitination by the Cullin-family E3 protein ligases. By competitively binding Cullin proteins, the CSN complex masks the substrate-binding regions of Cullin proteins, thus inhibiting their interactions with substrates [37]. The CSN complex also suppresses protein neddylation, thereby inhibiting Cullin protein function.

thumbnail
Fig 6. MEIS1 isoforms promote CUL3–COP9 signalosome complex formation to inactivate CUL3.

A. List of components of the COP9 signalosome (CSN) complex identified as MEIS1-binding partners via proteomic analysis (experimental scheme is shown in S9A Fig). B. Immunoblotting of GST pull-down fractions from N2a cells transfected with GST, GST-MEIS1-FL, or GST-MEIS1-HdL. Interactions with endogenously expressed COPS2 and COPS5 were determined using anti-COPS2 and anti-COPS5 antibodies. Total GST-tagged proteins were detected with an anti-GST antibody. C. Sequential co-immunoprecipitation assay demonstrating a CUL3–MEIS1–COPS6 tripartite complex. N2a cells were co-transfected with Flag-HA-COPS6 and GST-MEIS1-FL or GST-MEIS1-HdL (or GST as control). Lysates were first subjected to immunoprecipitation with an anti-HA antibody, followed by a GST pull-down. The final immunoblot for endogenous CUL3 confirmed its inclusion in a tripartite complex with MEIS1 isoforms and COPS6. D. Co-immunoprecipitation of endogenous proteins from P7 GCP lysates. Endogenous MEIS1 was immunoprecipitated using an anti-MEIS1 antibody, with IgG serving as a negative control. The resulting precipitates were then immunoblotted for the CSN components COPS4 and COPS5 to detect an interaction. E. Co-immunoprecipitation assay to assess the effect of MEIS1 isoforms on the COPS6-CUL3 interaction. Flag-HA-COPS6 was immunoprecipitated using an anti-HA antibody from N2a cells co-expressing a control vector, MEIS1-FL, or MEIS1-HdL. The immunoblots show that co-expression of either MEIS1 isoform enhances the binding of endogenous CUL3 to COPS6. F. Quantification of CUL3 signal intensity from (E). G. In vitro ubiquitination assay demonstrating that COPS6 is required for MEIS1 to inhibit ATOH1 polyubiquitination. N2a cells were co-transfected with GST-ATOH1, HA-Ub, and the indicated constructs (MEIS1-FL, sh-Cops6, or controls). Following a GST pull-down, blots were probed for HA (polyubiquitination, top panel) and GST (total ATOH1, middle panel). MEIS1 expression in input lysates was confirmed by immunoblotting with an anti-MEIS1 antibody (lower panel). The ability of MEIS1-FL to reduce ubiquitination is reversed by the knockdown of Cops6 (see S9D Fig for knockdown efficiency). H. Dose-dependent stabilization of GST-ATOH1 by MEIS1 isoforms. N2a cells were co-transfected with a constant amount of GST-ATOH1 plasmid and increasing amounts (0–5 µg) of plasmids expressing MEIS1-FL or MEIS1-HdL. Cell lysates were immunoblotted for the indicated proteins, with GAPDH as a loading control. I. Quantification of ATOH1 protein levels from (H), normalized to GAPDH and plotted against the concentration of the transfected MEIS1 expression vector. The graph illustrates the apparent difference in dose-dependent ATOH1 stabilization in this assay. Statistical significance between the overall dose-dependent stabilization effects of MEIS1-HdL and MEIS1-FL was determined using two-way ANOVA. J. Immunoblot of cytoplasmic and nuclear fractions from N2a cells co-expressing ATOH1 and HA-Ub. The blot shows that while polyubiquitinated ATOH1 is detected in both fractions, CUL3 is predominantly localized to the cytoplasm. βIII-tubulin and Lamin A/C serve as markers for the cytoplasmic and nuclear fractions, respectively. Note that the cytoplasmic ATOH1 signal is prominent due to overexpression and the long exposure time required to detect polyubiquitinated species. (n = 3 independent experiments). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g006

To confirm whether MEIS1 interacts with the intact, functional CSN complex, we performed GST pull-down assays targeting both COPS2 (identified by LC–MS/MS) and COPS5. We specifically selected COPS5 because it acts as the essential catalytic center of the CSN complex, despite its absence from our initial MS screening due to potential technical limitations. Immunoblotting revealed that not only MEIS1-FL but also MEIS1-HdL interacted with endogenous CSN components, COPS2 and COPS5 (Fig 6B). We conducted similar pull-down and immunoblotting with HA-tagged COPS6 (HA-COPS6) and GST-MEIS1-truncated mutant (1–130 aa) or GST-MEIS1 isoforms in N2a cells. As expected, HA-COPS6 was found to bind GST-MEIS1-FL and GST-MEIS1-HdL (S9B Fig). In contrast, GST-MEIS1-1–130aa did not bind HA-COPS6 (S9B Fig). Given that this N-terminal MEIS1 fragment (MEIS1-1–130aa) does not have the ATOH1-stabilizing ability (S7 Fig), these observations suggest that binding to the CSN complex is crucial for MEIS1 proteins to stabilize ATOH1.

To test whether MEIS1, CSN complex and CUL3 form a tripartite complex, we performed a sequential immunoprecipitation experiment. HA-COPS6 and GST-MEIS1-FL or GST-MEIS1-HdL were transfected into N2a cells, followed by immunoprecipitation with HA and successive pull-down with GST. Immunoblotting revealed a significant signal for endogenous CUL3 in the presence of either MEIS1-FL or MEIS1-HdL (Fig 6C), suggesting that the CSN complex, MEIS1 isoforms, and CUL3 form a tripartite complex in cells. To test the interaction of endogenously expressed MEIS1 and CSN complex, immunoprecipitation was performed on the GCP lysates with the MEIS1 antibody recognizing both MEIS1 isoforms. Immunoblotting with COPS4 or COPS5 suggested that endogenous MEIS1 and the CSN complex interact with each other (Fig 6D). Given that MEIS1-HdL interacts with components of the CSN complex in N2a cells (Figs 6B and S9B), it was suggested that not only MEIS1-FL but also MEIS1-HdL interacts with the CSN complex in GCPs.

We next tested whether the presence of MEIS1 isoforms affects the CUL3-CSN interaction. N2a cells were transfected with HA-COPS6 and MEIS1-FL or MEIS1-HdL, followed by immunoprecipitation with the HA antibody. Immunoblotting showed that the amount of co-precipitated CUL3 was significantly greater in the presence of either MEIS1-FL or MEIS1-HdL, compared to control (Fig 6E and 6F). This suggests that MEIS1 isoforms inactivate CUL3 by enhancing its association with the CUL3-inhibitory complex, CSN. We further tested the possibility that CUL3 is required for the binding between MEIS1 isoforms and the CSN complex. However, it was not likely because the introduction of sh-Cul3 into N2a cells did not affect the binding between HA-COPS6 and MEIS1-FL or MEIS1-HdL (S9C Fig). To investigate whether the CSN complex is involved in the function of MEIS1 to suppress ATOH1 polyubiquitination, GST-ATOH1 and HA-Ub were transfected into N2a cells in the presence of MG132, followed by GST pull-down. Immunoblotting with HA revealed that MEIS1-FL introduction reduced ATOH1 polyubiquitination (Fig 6G, lanes 1 and 2). However, co-introduction of the knockdown vector for Cops6 (sh-Cops6, S9D Fig) ameliorated the effects of MEIS1-FL (Fig 6G, lane 3). These findings suggest that MEIS1 suppresses ATOH1 polyubiquitination and degradation by promoting the CSN complex–CUL3 interaction and by inhibiting the CUL3–ATOH1 interaction. When transfected into N2a cells, the expression of NRF2, NCOA3, and PP2A/C was much higher in the presence of MG132 (S9E Fig, lane 4) than in the control (S9E Fig, lane 1), consistent with previous findings that these proteins are degraded by CUL3-dependent polyubiquitination [3941]. Co-introduction of MEIS1-FL or MEIS1-HdL strongly increased NRF2 and PP2A/C expression and moderately increased that of NCOA3 (S9E Fig, lanes 2 and 3), relative to the control (S9E Fig, lane 1). This suggests that these MEIS1 isoforms may broadly suppress CUL3-dependent degradation of various proteins.

Transfected tagged COPS6 was expressed in both the cytoplasm and nucleus in N2a cells (S9F Fig), consistent with a previous report that the CSN complex localizes in both the cell nucleus and cytoplasm. Similar COPS6 subcellular localization was observed following co-transfection with MEIS1-FL or MEIS1-HdL (S9G and S9H Fig), suggesting that neither MEIS1-FL nor MEIS1-HdL affects CSN-complex subcellular localization.

Thus, MEIS1-FL and MEIS1-HdL have similar functions in that they both inhibit the degradation of ATOH1. However, there may be differences in the strength of their effects. To test this, GST-ATOH1 was co-transfected with MEIS1-FL or MEIS1-HdL, using the indicated quantities of DNA (0–5 μg, Fig 6H). While large amounts of MEIS1-FL vector were required to suppress ATOH1 degradation, this was achieved using very small amounts of MEIS1-HdL vector (Fig 6H and 6I). In this overexpression assay, MEIS1-HdL produced detectable ATOH1 stabilization at lower plasmid inputs than MEIS1-FL. Because construct-dependent technical factors cannot be fully excluded, we interpret this as an apparent difference in dose responsiveness rather than definitive evidence of intrinsically stronger molecular activity.

To validate this spatial requirement, we generated a nuclear-targeted MEIS1-HdL by fusing it with a nuclear localization signal (NLS-Meis1-HdL). Subcellular fractionation confirmed its strong localization to the nucleus, although a minor fraction remained in the cytoplasm (S10A Fig). Crucially, this forced nuclear localization significantly attenuated the dose-dependent ATOH1-stabilizing ability of MEIS1-HdL (S10B and S10C Fig). The residual ATOH1 stabilization observed at higher plasmid dosages is likely attributable to this minor cytoplasmic fraction of NLS-MEIS1-HdL. These results support the importance of cytoplasmic localization for the full ATOH1-stabilizing activity of MEIS1-HdL. Because a minor fraction of NLS-MEIS1-HdL remained detectable in the cytoplasmic fraction, however, minor nuclear contributions cannot be formally excluded. Furthermore, because MEIS1 typically functions as a transcription factor in the nucleus through association with PBX proteins, we examined whether PBX3, one of the MEIS-interacting PBX family members expressed in this system, is detectable in the MEIS1-HdL/CSN complex. Co-immunoprecipitation assays revealed no detectable interaction between PBX3 and the MEIS1-HdL/CSN complex (S10D Fig). Because only PBX3 was directly examined in this assay, these results support a PBX3-independent mechanism for MEIS1-HdL-mediated ATOH1 stabilization, but do not exclude possible contributions from other PBX family members. Taken together, these results support a predominantly cytoplasmic mechanism for MEIS1-HdL-mediated ATOH1 stabilization, while not formally excluding additional nuclear contributions.

Fractionation using N2a cells transfected with ATOH1 and HA-Ub revealed that polyubiquitinated ATOH1 was localized in both the cytoplasm and nucleus (Fig 6J). In contrast, CUL3 was localized abundantly in the cytoplasm and negligibly in the nuclei (Fig 6J), consistent with prior suggestions [42]. These data are therefore consistent with a major role for cytoplasmic CUL3 in ATOH1 polyubiquitination under our assay conditions. Because MEIS1-HdL was localized predominantly in the cytoplasm, whereas MEIS1-FL was localized predominantly in the nucleus (S2C Fig), we interpret the difference between the two isoforms primarily in terms of differential access to the cytoplasmic CUL3/CSN machinery.

The MEIS1-HdL–CSN pathway maintains GCPs in an immature state

We showed that MEIS1-HdL introduction into the EGL suppressed the differentiation from GCPs to GCs: 3 d after electroporation, the proportions of Ki67+ and ATOH1+ GCPs were higher, while those of p27+ GCs were lower (Fig 3C3F). On the other hand, our in vitro experiments revealed that ATOH1 stabilization by MEIS1 was mediated by the CSN complex (Fig 6G). To link these in vivo and in vitro findings, we investigated the role of the CSN complex in GCPs. First, we introduced sh-Cops6 alone into the P8 EGL. This resulted in a reduction of Ki67+ and ATOH1+ GCPs and an increase in p27+ GCs (Figs 7C7E, S11A, and S11B), indicating that the CSN complex is essential for maintaining GCPs in an undifferentiated state. Next, we tested whether the CSN complex is required for the in vivo function of MEIS1-HdL. We co-electroporated sh-Cops6 together with the MEIS1-HdL into the P8 EGL under the experimental conditions shown in Fig 3C. The effects of MEIS1-HdL were cancelled by co-introduction with sh-Cops6 (Fig 7A7E). This suggests that CSN is required for MEIS1-HdL to function in GCPs, and that the CSN complex works with MEIS1-HdL to suppress the GCP differentiation into GCs, during cerebellar development (Fig 7F).

thumbnail
Fig 7. The COP9 signalosome is required for MEIS1-HdL to maintain GCPs in an undifferentiated state.

A. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Sections were immunostained for ATOH1 (magenta) and KI67 (cyan). Electroporated cells are identified by co-electroporated H3.1-EGFP (yellow). These images show GCPs electroporated with MEIS1-HdL and sh-Cops6. B. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Sections were immunostained for p27 (magenta). Electroporated cells are identified by co-electroporated H3.1-EGFP (green). These images show GCPs electroporated with MEIS1-HdL and sh-Cops6. C–E. Quantification of electroporated cell differentiation status. The percentage of GFP+ cells expressing KI67 (C), p27 (D), or ATOH1 (E) was quantified from cerebellar sections electroporated with the indicated vectors. (n = 4 mice for Control, MEIS1-HdL and sh-Cops6; n = 3 mice for MEIS1-HdL + sh-Cops6). F. Schematic diagram of the MEIS1-HdL function. Created in BioRender. Hoshino, M. (2026) https://BioRender.com/qvr6glt; https://BioRender.com/ceqrc9v. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.g007

Discussion

The dynamic switching between isoforms through alternative splicing and alternative transcriptional start site is increasingly recognized as a sophisticated strategy for achieving complex cellular control during neural development [4,5]. While recent long-read RNA-seq technology has revealed the complexity of isoforms, the molecular mechanisms by which these diverse isoforms control complex neurodevelopment remain largely unknown. In this study, we used GCPs as model cells and Meis1 as a model gene to clarify how the proliferation and differentiation of neural progenitor cells are precisely controlled by multiple isoforms produced from a single gene.

Our long-read RNA-seq and immunoblotting revealed that the Meis1 gene produces two protein isoforms in GCPs: MEIS1-FL, which has a homeodomain, and MEIS1-HdL, which lacks the homeodomain. In vivo electroporation revealed that these two isoforms have opposite effects on GCP proliferation and differentiation. MEIS1-FL inhibits the proliferation of GCPs and promotes differentiation, whereas MEIS1-HdL promotes their proliferation and inhibits differentiation. We have previously reported the function of the former, MEIS1-FL [16]. Importantly, the conditional knockout allele used in that study targets an exon specific to homeodomain-containing isoforms, leaving the MEIS1-HdL isoform intact. MEIS1-FL localizes to the nucleus of GCPs and GCs and promotes Pax6 transcription. Then, the transcription factor PAX6 promotes differentiation from GCPs to GCs by activating Smad1 transcription and promoting BMP signal-dependent degradation of ATOH1.

Our cell culture experiments revealed that both MEIS1-HdL and MEIS1-FL have functions other than transcription factor activity. These two isoforms have the ability to suppress CUL3-dependent polyubiquitination and degradation of ATOH1. While both isoforms exhibited the ability to suppress CUL3-dependent polyubiquitination and degradation of ATOH1 in our overexpression assays, MEIS1-HdL showed an apparent advantage in dose responsiveness over MEIS1-FL. Because construct-dependent technical factors, including differences in construct size and transfection efficiency, cannot be fully excluded, we interpret this difference cautiously. One possible contributing factor is structural autoinhibition. In MEIS2, the C-terminal homeodomain-containing region has been reported to fold back onto the N-terminus and mask transactivation-related sequences [43]. By analogy, the absence of the C-terminal region in MEIS1-HdL could alter the accessibility of its N-terminal interaction surfaces. However, because we did not directly test the conformational state of MEIS1 in this study, we regard this possibility as speculative rather than demonstrated. More importantly, the distinct subcellular localization of the two isoforms is likely a major determinant of their apparent difference in ATOH1-stabilizing activity. Indeed, forcing the predominantly cytoplasmic MEIS1-HdL into the nucleus (NLS-MEIS1-HdL) attenuated its stabilizing effect, despite only minimal differences in construct size compared with wild-type MEIS1-HdL (S10C Fig). Because CUL3 was detected predominantly in the cytoplasmic fraction, our data are most consistent with a major role for cytoplasmic CUL3 in ATOH1 degradation under these assay conditions. MEIS1-FL is predominantly localized in the nucleus, whereas MEIS1-HdL resides predominantly in the cytoplasm. Thus, MEIS1-HdL is likely better positioned than MEIS1-FL to interfere with the cytoplasmic CUL3-dependent pathway detected in our assay. In line with this notion, although MEIS1-FL shows partial cytoplasmic localization when overexpressed in vitro, it is largely absent from the cytoplasmic fraction of GCPs in vivo. This spatial separation likely limits the access of MEIS1-FL to the cytoplasmic CUL3–ATOH1 machinery under physiological conditions, suggesting that MEIS1-HdL functions as the major cytoplasmic isoform contributing to ATOH1 stabilization in immature GCPs. Furthermore, MEIS1-HdL is detected predominantly in undifferentiated, proliferative GCPs and largely absent from GCs. Together, these findings support a model in which MEIS1-HdL promotes GCP proliferation and suppresses differentiation, at least in part by inhibiting cytoplasmic CUL3-dependent ATOH1 degradation, and in which the decline in Meis1-HdL may contribute to the transition from GCPs to differentiating GCs. At the same time, although our findings support the cytoplasmic CSN–CUL3 axis as a major mechanism for MEIS1-mediated ATOH1 stabilization, they do not formally exclude additional contributions from canonical nuclear functions. In this regard, although we did not detect PBX3 in the MEIS1-HdL/CSN complex, this result should not be interpreted as excluding all PBX family proteins. Other PBX family members expressed in GCPs may contribute to MEIS1-related regulation through mechanisms not captured by our PBX3 co-immunoprecipitation assay. Therefore, our data support a PBX3-independent mechanism for the MEIS1-HdL/CSN complex, while the possible involvement of other PBX proteins remains an open question. Given that MEIS1 classically operates as a transcription factor, it remains possible that MEIS1 also regulates the expression of as-yet-unidentified target genes, such as specific deubiquitinating enzymes (DUBs), that could act in parallel or synergistically to influence ATOH1 stability.

Thus, MEIS1-FL and MEIS1-HdL have opposite effects on ATOH1 degradation and GCP differentiation, and their temporal profiles are also distinct. During cerebellar development, MEIS1-FL is continuously produced from GCPs to GCs, whereas MEIS1-HdL transcripts are enriched in immature GCPs and largely absent from GCs (Fig 2F). In immature GCPs where both are detected, the action of MEIS1-HdL is dominant, leading to the stabilization of the ATOH1 protein. However, as development progresses, MEIS1-FL becomes predominant due to the loss of MEIS1-HdL expression, resulting in the degradation of ATOH1 and progression of differentiation into GCs. Thus, these two MEIS1 isoforms are good examples of a strict control mechanism of neurogenesis by antagonistic isoforms from a single gene.

We identified CUL3 as a novel E3 ligase for ATOH1 and discovered that MEIS1 suppresses its function. It is known that CUL3 activity is suppressed by a large complex called the COP9 signaling complex (CSN) [44]. Previously, it has been shown that the low-molecular-weight compound, inositol hexakisphosphate (IP6), and its phosphorylating enzyme, protein IP6K1, regulate the binding of CULLIN family proteins and CSN [45,46]. This study suggests that MEIS1, especially the cytoplasm-localized MEIS1 isoform (MEIS1-HdL), has a similar function to enhance the binding between CUL3 and CSN, thereby suppressing CUL3 activity, eventually leading to elaborate control of ATOH1 degradation. Furthermore, we showed that MEIS1 has the ability to stabilize CUL3 target proteins other than ATOH1, such as NRF2 and PP2A/C. Moreover, our proteome analyses suggested that MEIS1 binds to CULLIN family proteins other than CUL3, such as CUL1 and CUL4. This raises the possibility that MEIS1 is involved in the degradation control of a wide range of proteins.

These findings have broad biological significance beyond the context of cerebellar development. The dysregulation of key developmental transcription factors like MEIS1 as well as the Cullin-RING E3 ubiquitin ligase machinery, including CUL3 and CSN, is often found in various tumors [47]. For example, MEIS1 and COPS5 (a component of CSN) are overexpressed in some acute myeloid leukemia [48,49]. Transgenic mice overexpressing COPS5 show an enlarged pool of hematopoietic stem cells, exhibiting a myeloproliferative disorder-like phenotype [50]. Similarly, overexpression of MEIS1 promotes aberrant self-renewal and induces differentiation arrest in hematopoietic stem and progenitor cells [51]. Until now, MEIS1 has been thought to cause leukemia and several types of tumors through its transcription regulatory function. However, this study suggests that MEIS1 may also contribute to tumorigenesis by controlling the degradation of relevant proteins through its non-transcriptional regulatory function.

The generation of functionally distinct isoforms from a single gene is a fundamental and evolutionarily conserved strategy, particularly among transcription factors. For instance, homothorax (hth), the Drosophila homolog of mammalian Meis, produces a homeodomain-less isoform that lacks DNA-binding capability but retains critical functions distinct from the full-length protein [52]. Functional diversities are also observed in other MEIS-family proteins, such as the proteolytic generation of a homeodomain-less MEIS2 product [53] and specific MEIS2 splice variants implicated in neuroblastoma [54]. Furthermore, alternative splicing of Pax6, which acts downstream of MEIS1, generates isoforms with altered DNA-binding properties that are essential for normal neural development [23]. Our discovery of the functional MEIS1-HdL isoform in mammalian cerebellar development parallels these mechanisms. It suggests a conserved regulatory logic where alternative splicing dynamically uncouples the protein interaction domains from the DNA-binding domain to diversify a single gene’s function. Further research combining long-read sequencing and single-cell analysis technologies will reveal a higher-resolution blueprint of the brain, showing which transcript isoforms are expressed in individual cells and when.

Materials and methods

Animals

All animal experiments in this study were approved by the Animal Care and Use Committee of the National Institute of Neuroscience, National Center of Neurology and Psychiatry (Tokyo, Japan; project 2019028R2), and were conducted in accordance with relevant Japanese national regulations and guidelines, including the Act on Welfare and Management of Animals, the Standards Relating to the Care and Management of Laboratory Animals and Relief of Pain, and the Guidelines for Proper Conduct of Animal Experiments issued by the Science Council of Japan. Mice were housed under specific pathogen-free conditions with food and water ad libitum. ICR pups were obtained from SLC (Japan). Atoh1AtGFP/+ mice (The Jackson Laboratory: B6.129S-Atoh1tm4.1Hzo/J, Stock No. 013593) and Ki67KiRFP/+ mice (The Jackson Laboratory: Mki67tm1.1Cle/J, Stock No. 029802) were obtained from The Jackson Laboratory.

Long-read cDNA sequencing sample preparation

GCP isolation was performed as previously described [55,56]. For the long-read sequencing samples, isolated P7 GCPs were plated and cultured for 48 h in the presence of 200 nM smoothened agonist. Following the culture period, total RNA was extracted using the Direct-zol RNA MiniPrep Plus kit (Zymo Research). For Nanopore sequencing, cDNA libraries were prepared from 50 ng of total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio USA) according to the manufacturer’s protocol, with 16 PCR cycles for cDNA amplification. Custom primers were utilized for cDNA synthesis:

  1. 3′ SMART-Seq CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN (HPLC-purified)
  2. PCR Primer II A: AAGCAGTGGTATCAACGCAGAGT (HPLC-purified)

The synthesized cDNA was then sequenced on a Nanopore PromethION platform.

Long-read cDNA sequencing data analysis

Raw FASTQ files obtained from Nanopore PromethION sequencing were processed using the IsoQuant [57] pipeline for alignment, transcript quantification, and novel isoform identification. Alignment was performed within the IsoQuant pipeline using Minimap [58]. The quality of the resulting sequencing data was assessed prior to analysis. The reads exhibited a high average quality score of approximately 30 (S1A Fig), and the read length distribution peaked around 1000 base pairs (S1B Fig), confirming the high quality and robust coverage of the dataset. The resulting GTF files, containing quantified and identified transcripts, were then subjected to curation using Sqanti3 [59].

RT-PCR

RNA was extracted from isolated GCP using Direct-zolTM RNA MiniPrep w/TriReagent (ZYMO RESEARCH). The ReverTra Ace qPCR RT Kit (TOYOBO) was used to generate cDNA. The primer sequences used are as following:

  1. Meis1-FL: CACAAAAAGCGTGGCATCTT and TGATGCCCATGTGCTGCTGA,
  2. Meis1-HdL: ATGGCGCAAAGGTACGACGA and TCAGAAGGGTAAGGGTGCTTGC.

Quantitative PCR (qPCR)

Isolated GCPs were suspended in cold DPBS containing 1% BSA. Cell sorting was performed in FACSAria Fusion. Gating of GFP and RFP negative populations was performed using GCPs from WT mice. Fluorescence compensation of RFP and GFP was performed using GCP of Ki67KiRFP/+ or Atoh1AtGFP/+ mice. Cells were sorted into cold DPBS containing 1% BSA and centrifuged at 800g for 3 min.

cDNA was generated with ReverTra Ace qPCR RT Kit (TOYOBO). Relative gene expression was compared with the geometric mean of 18S rRNA. The primer sequences used are as following:

  1. 18S rRNA: CCCGAAGCGTTTACTTTGAA and CCCTCTTAATCATGGCCTCA,
  2. Meis1-FL: ACAGCAGTGAGCAAGGTG and CAGAAGGGTAAGGGTGTGTT,
  3. Meis1-HdL: TGAGCAAGCACCCTTACCCTTCTGAA and GACTGCTCGGTTGGACTG,
  4. Atoh1: AGCTTCCTCTGGGGGTTACT and TTCTGTGCCATCATCGCTGT.

Plasmids

The expression vectors of Atoh1, Meis1 1–130aa and Meis1-FL were cloned from cDNAs from P7 C57/BL6 mouse cerebellum. PCR amplification was performed using the following primers: Atoh1-Fw: 5′-AATTGGATCCATGTCCCGCCTGCTGCATGC-3′ Atoh1-Rv: 5′-AATTGGATCCTTACATGTAGTGCCACTGCC-3′ Meis1 1–130aa-Rv: 5′-AATTGGATCCTTATGCGCGAATCTGTTTGGCGA-3′. For Meis1-FL, we used the forward primer described previously [16] and a specific reverse primer. Meis1-HdL was cloned using the same forward primer as Meis1-FL and the specific reverse primer: 5′-AATTGGATCCGCAAGCACCCTTACCCTTCTGA-3′. Cloned fragments were inserted into a pCAGGS vector or pEF-BOS-GST vectors (gifts from K. Kaibuchi, Fujita Health University, Nagoya, Japan) and cloned sequences were confirmed by sequencing. pCAG-H3.1-EGFP vector was a gift from Dr. N. Masuyama. HA-Ub vector was kindly provided by Dr. S. Wakatsuki (NCNP, Tokyo, Japan). Flag-HA-COPS6 was a gift from Wade Harper (Addgene plasmid #22542; http://n2t.net/addgene:22542; RRID:Addgene_22542) [60]. To generate the NLS-Meis1-HdL vector, a nucleotide sequence encoding a 3x SV40 nuclear localization signal (NLS) with spacers (5′-ATGGGATCAGATCCAAAAAAGAAGAGAAAGGTAGACCCGAAGAAAAAGCGTAAGGTCGATCCCAAAAAGAAACGGAAAGTGGGTAGCGGC-3′) was inserted in-frame immediately upstream of the start codon of the Meis1-HdL sequence. Res-Meis1-HdL and mutated forms of Atoh1 S328A and S328D were generated following the mutagenesis protocol of PrimeSTAR Max (Takara). The primers we used to create Res-Meis1-HdL were GAGCAGGCCCCTTTACCCTTCTGAAGAACA and TAAAGGGGCCTGCTCACTGCTGTTATCCCC. shRNAs were generated by inserting the double-stranded oligonucleotides into a mU6 pro vector. The targeting sequence of each shRNAs was designed by siDirect 2.0 [61] and the target sequences are indicated below.

  1. sh-Meis1-HdL: 5′- CAGTGAGCAAGCACCCTTA-3′,
  2. sh-Meis1-all: 5′- GCACAAGATACAGGACTTACC -3′ [16],
  3. sh-Cul3: 5′- AGCTGCTATAGTGCGAATAAT -3′,
  4. sh-Cops6-1: 5′-ACCAAGGAGGAGCAGTTTAAA -3′,
  5. sh-Cops6-2: 5′-TTGAGTCTGTCATCGATATAA -3′,
  6. sh-Scramble: 5′-TACGCGCATAAGATTAGGG-3′

Generation of the MEIS1-HdL-specific antibody

The custom polyclonal antibody against MEIS1-HdL was generated in rabbits by Eurofins Genomics (Tokyo, Japan). A synthetic peptide corresponding to the frameshift-derived unique C-terminus of MEIS1-HdL (NH2-C-(Ahx)-EQAPLPF-COOH) was conjugated to a carrier protein and used for immunization. To obtain a highly specific antibody, the crude antiserum was purified utilizing a two-step affinity chromatography procedure. First, the antiserum was passed through a TOYOPEARL AF-Tresyl-650 column (Tosoh) coupled with recombinant GST protein to deplete non-specific and anti-GST antibodies (negative selection). The flow-through fraction was subsequently applied to a TOYOPEARL AF-Tresyl-650 column coupled with recombinant GST-MEIS1-HdL protein (positive selection). After extensive washing, the specifically bound antibodies were eluted with 100 mM Glycine-HCl buffer (pH 2.5) and immediately neutralized to pH 7.0–7.5 using 1.0 M Tris-HCl (pH 9.0).

Cell culture, transfection, and drug treatment

N2a cells were obtained from ATCC (Manassas, VA, USA) and cultured in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 100 U/ml penicillin–streptomycin. Transfection of N2a cells was performed using transfection reagent (Bio-Rad, Hercules, CA, USA).

Cycloheximide (100 μM) was diluted in dimethyl sulfoxide (DMSO) and added to N2a cells, as indicated. MG132 diluted in DMSO was administered to the cultured cells indicated, after which cells were harvested at the indicated times.

Immunohistochemistry

Tissues were fixed with 4% paraformaldehyde (PFA) in PBS and cryoprotected with 30% sucrose in PBS. After tissues were embedded in optimal cutting temperature (OCT) compound, cryosections were made at 16 μm. Sections were incubated in blocking buffer containing 1% BSA and 0.1% Triton X-100 in PBS at room temperature (RT between 20 and 25 °C) for 1 h and subsequently immunolabeled using the following primary antibodies in blocking buffer at 4 °C overnight. Specimens were subsequently rinsed with PBS and incubated with secondary antibodies conjugated with Alexa Fluor 488, Alexa Fluor 568, Alexa Fluor 594, or Alexa Fluor 647 (1:400; Invitrogen) and DAPI (1:3,000; Invitrogen) in blocking buffer containing 1% BSA and 0.2% Triton X-100 in PBS at RT for 2 h. Fluorescence images were acquired using a Zeiss LSM 780 confocal microscope system (Carl Zeiss) and ZEN 2009 software. Antibodies used in this study were as follows: anti-ATOH1 antibody (homemade, rabbit), anti-KI67 antibody (eBioscience, 14-5698-82, rat), anti-p27 antibody (MBL, 554, rabbit), anti-HA(C29F4) (CST, 3724S, rabbit), anti-GFP antibody (kind gift from Dr. A. Imura, Foundation for Biomedical Research and Innovation, Kobe, Japan rat), anti-GFP (Aves Labs, GFP-1010, chicken). Fluorescence intensity quantification was performed using ImageJ software (NIH). The nuclear region of interest (ROI) for each cell was manually defined based on the DAPI staining channel. The mean fluorescence intensities of the target proteins (ATOH1, KI67) and DAPI were measured within each ROI. To correct for variations in nuclear volume, chromatin density, and staining efficiency, the intensity of the target protein was normalized to the DAPI intensity of the corresponding nucleus. For in vivo electroporation experiments, the normalized intensity of electroporated cells (GFP-positive) was compared to that of neighboring non-electroporated cells (GFP-negative) within the same field of view. To clearly label the electroporated cells, an H3.1-GFP expression plasmid was co-transfected in all in vivo electroporation experiments. To quantify the proportion of cells expressing specific differentiation or proliferation markers (such as KI67 or p27) within the electroporated population, the number of cells double-positive for nuclear GFP and the target protein was counted using ImageJ software. This value was then divided by the total number of GFP-positive electroporated cells within the analyzed cerebellar layers to calculate the percentage of positive cells. Multiple sections from at least three independent animals were analyzed for each condition.

In vivo electroporation

In vivo electroporation in neonatal mice has been described previously [16]. Expression plasmids were diluted to 1 μg/μl, shRNAs to 2 μg/μl, and pCAG-H2BGFP to 0.5 μg/μl in Milli-Q water (Millipore). Fast Green was added to visualize the plasmid solutions, which were injected into P8 ICR cerebella over the skull. Mice received electric pulses (80 V for 50 ms, with 150 ms intervals) using forceps-type electrodes (NEPA Gene, Chiba, Japan). The pups were kept warm at 37 °C during recuperation and returned to the litter after fully recovering. Pups were fixed with 4% PFA for 3 days after electroporation.

Biochemical analyses

For immunoblotting, cells were harvested and lysed in Cell Lysis Buffer (22352-04, Nacalai Tesque) containing protease inhibitors (11836153,001 Roche). Proteins were transferred to polyvinylidene fluoride membranes, which were incubated with primary antibodies at 4 °C overnight. After the membranes were incubated with secondary antibodies at room temperature for 2 h, horseradish peroxidase substrate (Millipore) was applied, and immuno-signals were detected using a LAS4000 system (Fujifilm) and FUSION SOLO S (Vilber). Antibodies used in this study were as follows: anti-GAPDH (CST, #2118, rabbit), anti-GST (CST, #2622, rabbit), anti-HA (CST, #3724, rabbit), anti- ATOH1 (homemade, rabbit), anti-MEIS1-HdL antibody (homemade, rabbit), anti-MEIS1 (abcam, ab19867, rabbit), anti-MEIS1(MyBioSource, MBS9403588, rabbit), anti-CUL3 (CST, #2759, rabbit), anti-COPS2 (Bethyl Laboratories, A300-028A, rabbit), anti-COPS5 (Bethyl Laboratories, A300-014A, rabbit), anti-SRC-3 (NCOA3; CST, #2126, rabbit), anti-PP2A/C subunit (CST, #2038, rabbit), anti-NRF2 (Novusbio, NBP1-32822, rabbit), anti-Lamin A/C (CST, #4777, mouse), anti-βIII-tubulin (Millipore, MAB1637, mouse), and anti-ATOH1 p-S328 (homemade, rabbit).

For Immunoprecipitation (IP), cells were lysed in Pierce IP Lysis Buffer (Thermo Scientific) containing protease inhibitors. Lysates were incubated with antibodies and captured using the Dynabeads Protein G Immunoprecipitation Kit (Invitrogen) according to the manufacturer’s instructions. To prevent the masking of target protein signals by the heavy and light chains of the immunoprecipitating antibodies during subsequent immunoblotting, TrueBlot ULTRA: Anti-Rabbit IgG HRP (Rockland Immunochemicals, 18-8816-31) or Clean-Blot IP Detection Reagent (HRP) (Thermo Scientific, 21230) was utilized for detection in specific experiments.

For the GST pull-down assay, GST-tagged vectors expressing Atoh1, Atoh1 mutants, Meis1-FL, and Meis1-HdL were transfected into N2a cells. After 48 h, cells were lysed in Cell Lysis Buffer (Nacalai Tesque), and supernatants were incubated with glutathione-conjugated Sepharose beads (GE Healthcare) at 4 °C overnight. Beads were washed twice and resuspended in sample buffer. For protein purification (Fig 6), washed Sepharose beads were incubated with TED buffer (50 mM Tris-HCl pH 8.0, 10 mM reduced glutathione, 1 mM DTT, 1 mM EDTA) at 4 °C for 30 min to elute the GST-fusion proteins. For the sequential precipitation assay (HA-IP followed by GST-PD), lysates were first incubated with anti-HA antibody. The antibody-antigen complexes were precipitated using Protein G Sepharose beads. The immunoprecipitated protein complexes were eluted with HA peptide (Sigma) and subsequently incubated with glutathione-Sepharose beads to pull down GST-tagged interacting partners. All immunoblotting and immunoprecipitation experiments were repeated at least three times independently, and representative images are shown.

Quantification of ubiquitination

For the quantification of ATOH1 polyubiquitination, the signal intensity of the high-molecular-weight smear appearing above the unmodified ATOH1 band was measured using ImageJ software. The background signal was subtracted to determine the final intensity values.

LC–MS/MS analysis

Phospho-MS and LC–MS/MS analysis was performed as previously described [62]. The proteomic screening was performed on a single biological replicate (n = 1), and candidate interactions were subsequently validated by independent co-immunoprecipitation and immunoblotting assays. The complete list of identified proteins is provided in Supplementary Data (S3 Data). Candidate molecules involved in the ubiquitin-proteasome system were selected based on PANTHER GO analysis.

Statistical analyses

Pairwise comparisons between the means of different groups were performed using a Student t test (two-tailed, unpaired). To evaluate statistical significance across multiple groups or variables, such as comparing overall dose-dependent effects between different MEIS1 isoforms, a two-way analysis of variance (ANOVA) was employed. The difference between data sets was considered statistically significant at *p < 0.05, **p < 0.01, or ***p < 0.001. The data are reported as the mean ± SEM.

Supporting information

S1 Fig. Quality control and overview of long-read cDNA sequencing data.

A. Histogram showing the distribution of read quality scores (Q-scores) for Nanopore long-read cDNA sequencing data from GCP samples. B. Histogram showing the distribution of read lengths for Nanopore long-read cDNA sequencing data from GCP samples. C. Histograms showing the distribution of expression levels (Transcripts Per Million, TPM) for known transcripts (left) and novel transcripts (right). D. Distribution of the number of isoforms per gene, including all identified transcripts without TPM filtering. The graph shows the percentage of genes binned by their isoform count (1, 2, 3, 4, or ≥5). E. Transcript isoform structures of Pax6, generated using ggtranscript. F. Predicted protein domain structures of coding PAX6 isoforms. Protein sequences were obtained via Sqanti3, with domains predicted by InterPro and visualized using drawProteins. Key conserved domains are shown. Some isoforms lack the paired domain but retain the homeodomain, and a short isoform lacks all canonical domains. G. Transcript isoform structures of Nfib, generated using ggtranscript. H. Predicted protein domain structures of coding Nfib isoforms. Protein sequences were obtained via Sqanti3, with domains predicted by InterPro and visualized using drawProteins. Some isoforms contain large deletions, including a short variant that lacks all predicted domains. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s001

(TIF)

S2 Fig. Validation of MEIS1-HdL-specific antibody and further confirmation of MEIS1 isoform subcellular localization.

A. Validation of the MEIS1-HdL-specific antibody by immunoblot. Lysates from untransfected N2a cells or cells expressing MEIS1-FL or MEIS1-HdL were analyzed. The left panel, probed with a pan-MEIS1 antibody, detects both isoforms. The right panel shows that the newly generated antibody specifically recognizes MEIS1-HdL and not MEIS1-FL. B. Immunoprecipitation of endogenous MEIS1-HdL from P7 GCP lysates using the MEIS1-HdL-specific antibody, followed by immunoblotting with a pan-MEIS1 antibody. A single band corresponding to endogenous MEIS1-HdL was detected. C. Subcellular localization of endogenous MEIS1 isoforms in P7 GCPs, analyzed by immunoblotting of subcellular fractions. The blot shows that MEIS1-FL is predominantly nuclear, while MEIS1-HdL is primarily cytoplasmic. Lamin A/C and βIII-tubulin were used as nuclear and cytoplasmic fraction markers, respectively. D. Immunoblot analysis showing the subcellular localization of overexpressed MEIS1 isoforms in N2a cells. Following transfection with untagged MEIS1-FL or MEIS1-HdL, cytoplasmic and nuclear fractions were blotted for MEIS1. The results confirm the predominantly nuclear localization of MEIS1-FL (arrowheads) and cytoplasmic localization of MEIS1-HdL (arrows). Lamin A/C and βIII-tubulin serve as nuclear and cytoplasmic fraction markers, respectively. E. Representative immunofluorescence images showing subcellular localization of MEIS1-FL-EGFP and MEIS1-HdL-EGFP in N2a cells. Cells were transfected with MEIS1-FL-EGFP or MEIS1-HdL-EGFP expression vectors and stained for GFP (green) and DAPI (blue, for nuclei). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s002

(TIF)

S3 Fig. Isolation of distinct GCPs using Atoh1AtGFP/+; Ki67KiRFP/+ reporter mice.

A. Validation of the Atoh1-GFP reporter in the P7 cerebellum of an Atoh1AtGFP/+; Ki67KiRFP/+ mouse. Representative images show co-localization of the GFP signal (green) with immunostaining for the endogenous ATOH1 protein (magenta). B. Validation of the Ki67-RFP reporter in the P7 cerebellum of an Atoh1AtGFP/+; Ki67KiRFP/+ mouse. Representative images show co-localization of the RFP signal (magenta) with immunostaining for the endogenous KI67 protein (green). C. Combined expression patterns of ATOH1-GFP (green) and KI67-RFP (magenta) in the P7 cerebellum. The images show that while both reporters are expressed predominantly in the outer external granular layer (oEGL), ATOH1-GFP expression is more tightly restricted to the outermost cell layer compared to the broader expression of KI67-RFP. D. Representative FACS plots demonstrating the gating strategy for isolating distinct granule cell lineage populations from purified GCPs of Atoh1AtGFP/+; Ki67KiRFP/+ mice. Wild-type (WT) GCPs are used for negative control gating. E. Relative expression levels of Atoh1 transcripts, estimated by qRT-PCR, in FACS-sorted GCP populations purified from P6 cerebella. Atoh1 expression is exclusively detected in the GFP+RFP+ fraction, confirming the specificity of this highly proliferative population. (n = 3 samples from 3 mice). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s003

(TIF)

S4 Fig. Meis1 isoforms differentially regulate p27+ cell proportions in vivo.

A–C. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Cerebellar sections were immunostained for p27 (magenta). Electroporated cells, identified by co-electroporated H3.1-EGFP (green), were transfected with a control vector (A), MEIS1-FL (B), or MEIS1-HdL (C). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s004

(TIF)

S5 Fig. Meis1-HdL knockdown promotes GCP differentiation.

A. Immunoblot analysis validating the specificity and efficacy of the indicated shRNAs in N2a cell lysates. Left panel: Specificity test for sh-Meis1-HdL. The blot shows that sh-Meis1-HdL targets Meis1-HdL for knockdown but does not affect Meis1-FL. Right panel: Efficacy test for sh-Meis1-all. The blot confirms that sh-Meis1-all effectively knocks down Meis1-HdL. B–D. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Cerebellar sections were immunostained for p27 (magenta). Electroporated cells, identified by co-electroporated H3.1-EGFP (green), were transfected with (B) sh-Meis1-HdL, (C) sh-Meis1-HdL plus a knockdown-resistant rescue construct (Res-Meis1-HdL), or (D) sh-Meis1-all. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s005

(TIF)

S6 Fig. Meis1 knockdown reduces ATOH1 protein levels in GCPs.

A–C. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Sections were immunostained for ATOH1 (magenta) and KI67 (cyan). Electroporated cell nuclei are identified by H3.1-EGFP (yellow). The images show cells transfected with a control vector (A), sh-Meis1-HdL (B), or sh-Meis1-all (C). Arrows indicate electroporated (GFP+) cells, and arrowheads indicate surrounding non-electroporated (GFP−) cells. D. Quantification of KI67 fluorescence intensity in electroporated (GFP+) and neighboring non-electroporated (GFP−) cells from the outer EGL, as shown in (A–C). The analysis indicates no significant change in KI67 levels following Meis1 knockdown. E. Quantification of ATOH1 fluorescence intensity in electroporated (GFP+) and neighboring non-electroporated (GFP−) cells from the outer EGL, as shown in (A–C). The results show a significant reduction in ATOH1 levels in cells with Meis1 knockdown. (n = 4 mice for Control and sh-Meis1-HdL; n = 3 mice for sh-Meis1-all). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s006

(TIF)

S7 Fig. MEIS1 isoforms stabilize ATOH1 levels in a non-transcriptional manner.

A. Immunoblotting analysis of N2a cell lysates. Cells were transfected with GST-ATOH1 and either no additional plasmid (control), Meis1-1–130aa fragment, Meis1-HdL, or Meis1-FL expression plasmids. Where indicated, cells were treated with MG132 for 6 hours prior to lysis. ATOH1 protein levels were determined using an anti-ATOH1 antibody, with GAPDH as a loading control. Expression of the transfected MEIS1 constructs was confirmed using an anti-MEIS1 antibody. B. Immunoblotting analysis of N2a cell lysates following CHX chase assay. Cells were transfected with GST-ATOH1 and either Meis1-1–130aa fragment, Meis1-HdL, or Meis1-FL expression plasmids. Where indicated, cells were pre-treated with MG132 for 6 hours before CHX administration. Lysates were collected at 0, 4, and 8 hours after CHX treatment. ATOH1 protein levels were determined using an anti-ATOH1 antibody, with GAPDH as a loading control. MEIS1 expression was confirmed by immunoblotting with an anti-MEIS1 antibody. C. Quantification of ATOH1 protein levels from (B), normalized to GAPDH. (n = 4 independent experiments). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s007

(TIF)

S8 Fig. CUL3 recognizes and degrades S328 phosphorylated ATOH1, and MEIS1 inhibits the degradation of phosphorylated ATOH1.

A. Schematic illustration of the proteomic analysis strategy used to identify phosphorylation sites of ATOH1 in N2a cells in the presence or absence of MEIS1. B. Schematic diagram summarizing ATOH1 phosphorylation sites identified by LC–MS/MS analysis. GST-ATOH1 was purified from N2a cells expressing it either alone or with MEIS1. The analysis identified five phosphorylation sites and revealed a marked increase in phosphorylation at the S328 residue in the presence of MEIS1. See S4 Data. C. Immunoblotting analysis of N2a cell lysates. Cells were transfected with GST-ATOH1 alone or in combination with MEIS1-FL or MEIS1-HdL. Samples were loaded to contain equal amounts of total ATOH1. ATOH1-S328 phosphorylation levels were determined by Western blotting with an anti-ATOH1 p-S328 antibody. D. Immunoblotting analysis of N2a cell lysates following CHX chase assay. Cells were transfected with GST-ATOH1-S328A (non-phosphorylated form) or GST-ATOH1-S328D (phosphomimic form) plasmids and harvested at 0, 4, and 8 hours after treatment with CHX. ATOH1 protein levels were detected with an anti-ATOH1 antibody, with GAPDH as a loading control. E. Immunoblotting analysis comparing the baseline steady-state protein levels of WT ATOH1 and ATOH1-S328D. N2a cells were transfected with equal amounts of GST-ATOH1 (wild-type) or GST-ATOH1-S328D plasmids. The blot demonstrates that the phosphomimetic S328D mutant exhibits a markedly lower baseline protein level compared to WT ATOH1. F. Quantification of baseline ATOH1 protein levels from (E), normalized to GAPDH. G. Immunoblotting analysis of N2a cell lysates following CHX chase assay. Cells were transfected with GST-ATOH1-S328D in combination with MEIS1-FL or MEIS1-HdL plasmids and harvested at 0, 4, and 8 hours after treatment with CHX. ATOH1 protein levels were detected with an anti-ATOH1 antibody, with GAPDH as a loading control. MEIS1 expression was confirmed by immunoblotting with an anti-MEIS1 antibody. H. Quantification of ATOH1 protein levels from (D) and (G), normalized to GAPDH. (n = 4 independent experiments). Note that the representative immunoblot for the control condition (GST-ATOH1 only) quantified here is presented in S7B Fig. I. Immunoblotting analysis of GST pull-down fractions from N2a cells co-transfected with HA-Ub and either GST-ATOH1 (wild-type) or GST-ATOH1-S328A. Polyubiquitinated ATOH1 and total GST-ATOH1 levels were determined by immunoblotting with anti-HA and anti-GST antibodies, respectively. The interaction of CUL3 with GST-ATOH1 was assessed by immunoblotting with an anti-CUL3 antibody. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s008

(TIF)

S9 Fig. MEIS1 regulates not only ATOH1 but also other CUL3 target proteins.

A. Schematic illustrating the proteomic analysis strategy used to identify MEIS1-binding molecules. B. Immunoblotting analysis of GST pull-down fractions from N2a cells transfected with GST, GST-MEIS1-1–130aa fragment, GST-MEIS1-HdL, or GST-MEIS1-FL. All cells were also co-transfected with HA-COPS6. The blot, probed for HA, shows that COPS6 binds to MEIS1-FL and MEIS1-HdL, but not to the N-terminal (1–130aa) fragment or the GST control. C. Co-immunoprecipitation assay demonstrating that the MEIS1–COPS6 interaction is independent of CUL3. HA-COPS6 was immunoprecipitated from N2a cells co-expressing a MEIS1 isoform along with either a control scramble shRNA or an shRNA targeting Cul3. The immunoblots show that the amount of co-precipitated MEIS1 is unaffected by the knockdown of Cul3. D. Immunoblotting analysis of N2a cell lysates. Cells were co-transfected with HA-COPS6 and either a control scramble shRNA or one of two shRNAs targeting Cops6 (sh-Cops6-1 and sh-Cops6-2). The blot was probed with an anti-HA antibody and shows that both shRNAs effectively knock down HA-COPS6 expression compared to the control. E. Immunoblot analysis showing that MEIS1 isoforms stabilize known CUL3 target proteins. N2a cells were transfected with the indicated MEIS1 constructs. Treatment with the proteasome inhibitor MG132 was used as a positive control. The blots show that overexpression of either MEIS1-FL or MEIS1-HdL increases the protein levels of CUL3 targets (NRF2, NCOA3, PP2A/C), similar to the effect of MG132. MEIS1 expression was confirmed by immunoblotting with an anti-MEIS1 antibody. F–H. Representative immunofluorescence images showing the subcellular localization of HA-COPS6 in N2a cells. Cells were transfected with HA-COPS6 alone (F), or co-transfected with HA-COPS6 and MEIS1-FL-EGFP (G), or MEIS1-HdL-EGFP (H). Cells were immunostained for HA (magenta), GFP (green, to visualize MEIS1-EGFP fusion proteins), and DAPI (blue, for nuclei). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s009

(TIF)

S10 Fig. Cytoplasmic localization supports ATOH1 stabilization by MEIS1-HdL, without detectable PBX3 interaction.

A. Immunoblot of cytoplasmic and nuclear fractions from N2a cells transfected with NLS-MEIS1-HdL. The blot shows that while NLS-MEIS1-HdL is strongly localized to the nuclear fraction, some protein is also detectable in the cytoplasmic fraction. Lamin A/C and βIII-tubulin serve as markers for the nuclear and cytoplasmic fractions, respectively. B. Dose-dependent stabilization of GST-ATOH1 by non-NLS MEIS1-HdL and NLS-MEIS1-HdL. N2a cells were co-transfected with a constant amount of GST-ATOH1 and increasing amounts (0–5 µg) of the MEIS1-HdL or NLS-MEIS1-HdL expression plasmid. Cell lysates were immunoblotted for the indicated proteins. The non-NLS MEIS1-HdL blot is reproduced from Fig 6H for direct comparison with NLS-MEIS1-HdL. C. Quantification of ATOH1 protein levels from (B). To evaluate the impact of subcellular localization, the stabilization efficacy of NLS-MEIS1-HdL was compared with that of non-NLS MEIS1-HdL. The non-NLS MEIS1-HdL quantification is reproduced from Fig 6I for direct comparison. Statistical significance between the overall dose-dependent stabilization effects of non-NLS MEIS1-HdL and NLS-MEIS1-HdL was determined using two-way ANOVA. D. Co-immunoprecipitation assay in N2a cells expressing HA-COPS6 and MEIS1-HdL. HA-COPS6 was immunoprecipitated using an anti-HA antibody, and the resulting precipitates were then immunoblotted for HA and PBX3 to detect a potential interaction. Note that PBX3 was not detected in the precipitates, indicating its lack of interaction with the MEIS1-HdL/CSN complex. (n = 4 independent experiments). The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s010

(TIF)

S11 Fig. Cops6 knockdown promotes GCP differentiation.

A. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Sections were immunostained for ATOH1 (magenta) and KI67 (cyan). Electroporated cells are identified by co-electroporated H3.1-EGFP (yellow). These images show GCPs electroporated with sh-Cops6. B. Representative immunofluorescence images of P11 cerebella following in vivo electroporation at P8. Sections were immunostained for p27 (magenta). Electroporated cells are identified by co-electroporated H3.1-EGFP (green). These images show GCPs electroporated with sh-Cops6. The data underlying this figure can be found in S5 Data.

https://doi.org/10.1371/journal.pbio.3003897.s011

(TIF)

S1 Data. List of genes with high isoform diversity.

This file contains the list of genes identified as having high isoform diversity after applying the expression criterion used in this study.

https://doi.org/10.1371/journal.pbio.3003897.s012

(XLSX)

S2 Data. Meis1 isoform read counts, nucleotide sequences, and predicted amino acid sequences.

This file contains read count information and sequence information for Meis1 isoforms identified by long-read cDNA sequencing.

https://doi.org/10.1371/journal.pbio.3003897.s013

(XLSX)

S3 Data. Candidate binding molecules identified by proteomic analyses.

This file contains the lists of candidate binding molecules identified in the proteomic analyses performed in this study.

https://doi.org/10.1371/journal.pbio.3003897.s014

(XLSX)

S4 Data. ATOH1 phosphorylation sites identified by phosphoproteomic analysis.

This file contains the list of ATOH1 phosphorylation sites identified by LC–MS/MS analysis.

https://doi.org/10.1371/journal.pbio.3003897.s015

(XLSX)

S5 Data. Underlying numerical data for figures.

This file contains the underlying numerical data used for the graphs and quantitative analyses in the figures.

https://doi.org/10.1371/journal.pbio.3003897.s016

(XLSX)

S1 Raw Images. Uncropped blot and gel images.

This file contains the uncropped blot and gel images underlying the western blot and gel panels presented in the main and supporting figures. Lanes or membrane regions not included in the final figure panels are marked where applicable.

https://doi.org/10.1371/journal.pbio.3003897.s017

(PDF)

Acknowledgments

We thank all members of Department of Biochemistry and Cellular Biology for fruitful comments and discussion.

References

  1. 1. Wright CJ, Smith CWJ, Jiggins CD. Alternative splicing as a source of phenotypic diversity. Nat Rev Genet. 2022;23(11):697–710. pmid:35821097
  2. 2. Marasco LE, Kornblihtt AR. The physiology of alternative splicing. Nat Rev Mol Cell Biol. 2023;24(4):242–54. pmid:36229538
  3. 3. LaForce GR, Philippidou P, Schaffer AE. mRNA isoform balance in neuronal development and disease. Wiley Interdiscip Rev RNA. 2023;14(3):e1762. pmid:36123820
  4. 4. Patowary A, Zhang P, Jops C, Vuong CK, Ge X, Hou K, et al. Developmental isoform diversity in the human neocortex informs neuropsychiatric risk mechanisms. Science. 2024;384(6698):eadh7688. pmid:38781356
  5. 5. Joglekar A, Hu W, Zhang B, Narykov O, Diekhans M, Marrocco J, et al. Single-cell long-read sequencing-based mapping reveals specialized splicing patterns in developing and adult mouse and human brain. Nat Neurosci. 2024;27(6):1051–63. pmid:38594596
  6. 6. De Paoli-Iseppi R, Gleeson J, Clark MB. Isoform Age - Splice Isoform Profiling Using Long-Read Technologies. Front Mol Biosci. 2021;8:711733. pmid:34409069
  7. 7. Monzó C, Liu T, Conesa A. Transcriptomics in the era of long-read sequencing. Nat Rev Genet. 2025;26(10):681–701. pmid:40155769
  8. 8. Miyashita S, Owa T, Seto Y, Yamashita M, Aida S, Sone M, et al. Cyclin D1 controls development of cerebellar granule cell progenitors through phosphorylation and stabilization of ATOH1. EMBO J. 2021;40(14):e105712. pmid:34057742
  9. 9. Miyashita S, Hoshino M. Transit Amplifying Progenitors in the Cerebellum: Similarities to and Differences from Transit Amplifying Cells in Other Brain Regions and between Species. Cells. 2022;11(4):726. pmid:35203375
  10. 10. Forget A, Bihannic L, Cigna SM, Lefevre C, Remke M, Barnat M, et al. Shh signaling protects Atoh1 from degradation mediated by the E3 ubiquitin ligase Huwe1 in neural precursors. Dev Cell. 2014;29(6):649–61. pmid:24960692
  11. 11. Zhao H, Ayrault O, Zindy F, Kim J-H, Roussel MF. Post-transcriptional down-regulation of Atoh1/Math1 by bone morphogenic proteins suppresses medulloblastoma development. Genes Dev. 2008;22(6):722–7. pmid:18347090
  12. 12. Schulte D, Geerts D. MEIS transcription factors in development and disease. Development. 2019;146(16):dev174706. pmid:31416930
  13. 13. Heine P, Dohle E, Bumsted-O’Brien K, Engelkamp D, Schulte D. Evidence for an evolutionary conserved role of homothorax/Meis1/2 during vertebrate retina development. Development. 2008;135(5):805–11. pmid:18216174
  14. 14. Tucker ES, Lehtinen MK, Maynard T, Zirlinger M, Dulac C, Rawson N, et al. Proliferative and transcriptional identity of distinct classes of neural precursors in the mammalian olfactory epithelium. Development. 2010;137(15):2471–81. pmid:20573694
  15. 15. Azcoitia V, Aracil M, Martínez-A C, Torres M. The homeodomain protein Meis1 is essential for definitive hematopoiesis and vascular patterning in the mouse embryo. Dev Biol. 2005;280(2):307–20. pmid:15882575
  16. 16. Owa T, Taya S, Miyashita S, Yamashita M, Adachi T, Yamada K, et al. Meis1 Coordinates Cerebellar Granule Cell Development by Regulating Pax6 Transcription, BMP Signaling and Atoh1 Degradation. J Neurosci. 2018;38(5):1277–94. pmid:29317485
  17. 17. Wang Y, Zhao Y, Bollas A, Wang Y, Au KF. Nanopore sequencing technology, bioinformatics and applications. Nat Biotechnol. 2021;39(11):1348–65. pmid:34750572
  18. 18. Engelkamp D, Rashbass P, Seawright A, van Heyningen V. Role of Pax6 in development of the cerebellar system. Development. 1999;126(16):3585–96. pmid:10409504
  19. 19. Swanson DJ, Goldowitz D. Experimental Sey mouse chimeras reveal the developmental deficiencies of Pax6-null granule cells in the postnatal cerebellum. Dev Biol. 2011;351(1):1–12. pmid:21126516
  20. 20. Steele-Perkins G, Plachez C, Butz KG, Yang G, Bachurski CJ, Kinsman SL, et al. The transcription factor gene Nfib is essential for both lung maturation and brain development. Mol Cell Biol. 2005;25(2):685–98. pmid:15632069
  21. 21. Crist RC, Roth JJ, Waldman SA, Buchberg AM. A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. PLoS One. 2011;6(8):e23665. pmid:21858198
  22. 22. Xie Q, Ung D, Khafizov K, Fiser A, Cvekl A. Gene regulation by PAX6: structural-functional correlations of missense mutants and transcriptional control of Trpm3/miR-204. Mol Vis. 2014;20:270–82. pmid:24623969
  23. 23. Azuma N, Tadokoro K, Asaka A, Yamada M, Yamaguchi Y, Handa H, et al. The Pax6 isoform bearing an alternative spliced exon promotes the development of the neural retinal structure. Hum Mol Genet. 2005;14(6):735–45. pmid:15677484
  24. 24. Liu Y, Bernard HU, Apt D. NFI-B3, a novel transcriptional repressor of the nuclear factor I family, is generated by alternative RNA processing. J Biol Chem. 1997;272(16):10739–45. pmid:9099724
  25. 25. Chen L, Kostadima M, Martens JHA, Canu G, Garcia SP, Turro E, et al. Transcriptional diversity during lineage commitment of human blood progenitors. Science. 2014;345(6204):1251033. pmid:25258084
  26. 26. Rose MF, Ren J, Ahmad KA, Chao H-T, Klisch TJ, Flora A, et al. Math1 is essential for the development of hindbrain neurons critical for perinatal breathing. Neuron. 2009;64(3):341–54. pmid:19914183
  27. 27. Basak O, van de Born M, Korving J, Beumer J, van der Elst S, van Es JH, et al. Mapping early fate determination in Lgr5+ crypt stem cells using a novel Ki67-RFP allele. EMBO J. 2014;33(18):2057–68. pmid:25092767
  28. 28. Flora A, Klisch TJ, Schuster G, Zoghbi HY. Deletion of Atoh1 disrupts Sonic Hedgehog signaling in the developing cerebellum and prevents medulloblastoma. Science. 2009;326(5958):1424–7. pmid:19965762
  29. 29. Helms AW, Gowan K, Abney A, Savage T, Johnson JE. Overexpression of MATH1 disrupts the coordination of neural differentiation in cerebellum development. Mol Cell Neurosci. 2001;17(4):671–82. pmid:11312603
  30. 30. Chang C-H, Zanini M, Shirvani H, Cheng J-S, Yu H, Feng C-H, et al. Atoh1 Controls Primary Cilia Formation to Allow for SHH-Triggered Granule Neuron Progenitor Proliferation. Dev Cell. 2019;48(2):184-199.e5. pmid:30695697
  31. 31. Wu C, Macleod I, Su AI. BioGPS and MyGene.info: organizing online, gene-centric information. Nucleic Acids Res. 2013;41(Database issue):D561-5. pmid:23175613
  32. 32. Cheng Y-F, Tong M, Edge ASB. Destabilization of Atoh1 by E3 Ubiquitin Ligase Huwe1 and Casein Kinase 1 Is Essential for Normal Sensory Hair Cell Development. J Biol Chem. 2016;291(40):21096–109. pmid:27542412
  33. 33. Aragaki M, Tsuchiya K, Okamoto R, Yoshioka S, Nakamura T, Sakamoto N, et al. Proteasomal degradation of Atoh1 by aberrant Wnt signaling maintains the undifferentiated state of colon cancer. Biochem Biophys Res Commun. 2008;368(4):923–9. pmid:18275842
  34. 34. Reichlmeir M, Elias L, Schulte D. Posttranslational Modifications in Conserved Transcription Factors: A Survey of the TALE-Homeodomain Superclass in Human and Mouse. Front Cell Dev Biol. 2021;9:648765. pmid:33768097
  35. 35. Baek K, Scott DC, Schulman BA. NEDD8 and ubiquitin ligation by cullin-RING E3 ligases. Curr Opin Struct Biol. 2021;67:101–9. pmid:33160249
  36. 36. Chua YS, Boh BK, Ponyeam W, Hagen T. Regulation of cullin RING E3 ubiquitin ligases by CAND1 in vivo. PLoS One. 2011;6(1):e16071. pmid:21249194
  37. 37. Petroski MD, Deshaies RJ. Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol. 2005;6(1):9–20. pmid:15688063
  38. 38. Tsuchiya K, Nakamura T, Okamoto R, Kanai T, Watanabe M. Reciprocal targeting of Hath1 and beta-catenin by Wnt glycogen synthase kinase 3beta in human colon cancer. Gastroenterology. 2007;132(1):208–20. pmid:17241872
  39. 39. Jaramillo MC, Zhang DD. The emerging role of the Nrf2-Keap1 signaling pathway in cancer. Genes Dev. 2013;27(20):2179–91. pmid:24142871
  40. 40. Ferry C, Gaouar S, Fischer B, Boeglin M, Paul N, Samarut E, et al. Cullin 3 mediates SRC-3 ubiquitination and degradation to control the retinoic acid response. Proc Natl Acad Sci U S A. 2011;108(51):20603–8. pmid:22147914
  41. 41. Xu J, Zhou J-Y, Xu Z, Kho D-H, Zhuang Z, Raz A, et al. The role of Cullin3-mediated ubiquitination of the catalytic subunit of PP2A in TRAIL signaling. Cell Cycle. 2014;13(23):3750–8. pmid:25551360
  42. 42. Cullinan SB, Gordan JD, Jin J, Harper JW, Diehl JA. The Keap1-BTB protein is an adaptor that bridges Nrf2 to a Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol Cell Biol. 2004;24(19):8477–86. pmid:15367669
  43. 43. Hyman-Walsh C, Bjerke GA, Wotton D. An autoinhibitory effect of the homothorax domain of Meis2. FEBS J. 2010;277(12):2584–97. pmid:20553494
  44. 44. Schulze-Niemand E, Naumann M. The COP9 signalosome: A versatile regulatory hub of Cullin-RING ligases. Trends Biochem Sci. 2023;48(1):82–95. pmid:36041947
  45. 45. Rao F, Xu J, Khan AB, Gadalla MM, Cha JY, Xu R, et al. Inositol hexakisphosphate kinase-1 mediates assembly/disassembly of the CRL4-signalosome complex to regulate DNA repair and cell death. Proc Natl Acad Sci U S A. 2014;111(45):16005–10. pmid:25349427
  46. 46. Scherer PC, Ding Y, Liu Z, Xu J, Mao H, Barrow JC, et al. Inositol hexakisphosphate (IP6) generated by IP5K mediates cullin-COP9 signalosome interactions and CRL function. Proc Natl Acad Sci U S A. 2016;113(13):3503–8. pmid:26976604
  47. 47. Lee M-H, Zhao R, Phan L, Yeung S-CJ. Roles of COP9 signalosome in cancer. Cell Cycle. 2011;10(18):3057–66. pmid:21876386
  48. 48. Liu J, Qin Y-Z, Yang S, Wang Y, Chang Y-J, Zhao T, et al. Meis1 is critical to the maintenance of human acute myeloid leukemia cells independent of MLL rearrangements. Ann Hematol. 2017;96(4):567–74. pmid:28054140
  49. 49. Liu G, Claret FX, Zhou F, Pan Y. Jab1/COPS5 as a Novel Biomarker for Diagnosis, Prognosis, Therapy Prediction and Therapeutic Tools for Human Cancer. Front Pharmacol. 2018;9:135. pmid:29535627
  50. 50. Mori M, Yoneda-Kato N, Yoshida A, Kato J. Stable form of JAB1 enhances proliferation and maintenance of hematopoietic progenitors. J Biol Chem. 2008;283(43):29011–21. pmid:18667426
  51. 51. Thorsteinsdottir U, Kroon E, Jerome L, Blasi F, Sauvageau G. Defining roles for HOX and MEIS1 genes in induction of acute myeloid leukemia. Mol Cell Biol. 2001;21(1):224–34. pmid:11113197
  52. 52. Noro B, Culi J, McKay DJ, Zhang W, Mann RS. Distinct functions of homeodomain-containing and homeodomain-less isoforms encoded by homothorax. Genes Dev. 2006;20(12):1636–50. pmid:16778079
  53. 53. Müller T, Reichlmeir M, Hau A-C, Wittig I, Schulte D. The neuronal transcription factor MEIS2 is a calpain-2 protease target. J Cell Sci. 2024;137(4):jcs261482. pmid:38305737
  54. 54. Groß A, Schulz C, Kolb J, Koster J, Wehner S, Czaplinski S, et al. Tumorigenic and Antiproliferative Properties of the TALE-Transcription Factors MEIS2D and MEIS2A in Neuroblastoma. Cancer Res. 2018;78(8):1935–47. pmid:29382709
  55. 55. Adachi T, Miyashita S, Yamashita M, Shimoda M, Okonechnikov K, Chavez L, et al. Notch Signaling between Cerebellar Granule Cell Progenitors. eNeuro. 2021;8(3):ENEURO.0468-20.2021. pmid:33762301
  56. 56. Kutscher LM, Okonechnikov K, Batora NV, Clark J, Silva PBG, Vouri M, et al. Functional loss of a noncanonical BCOR-PRC1.1 complex accelerates SHH-driven medulloblastoma formation. Genes Dev. 2020;34(17–18):1161–76. pmid:32820036
  57. 57. Prjibelski AD, Mikheenko A, Joglekar A, Smetanin A, Jarroux J, Lapidus AL, et al. Accurate isoform discovery with IsoQuant using long reads. Nat Biotechnol. 2023;41(7):915–8. pmid:36593406
  58. 58. Li H. New strategies to improve minimap2 alignment accuracy. Bioinformatics. 2021;37(23):4572–4. pmid:34623391
  59. 59. Pardo-Palacios FJ, Arzalluz-Luque A, Kondratova L, Salguero P, Mestre-Tomás J, Amorín R, et al. SQANTI3: curation of long-read transcriptomes for accurate identification of known and novel isoforms. Nat Methods. 2024;21(5):793–7. pmid:38509328
  60. 60. Sowa ME, Bennett EJ, Gygi SP, Harper JW. Defining the human deubiquitinating enzyme interaction landscape. Cell. 2009;138(2):389–403. pmid:19615732
  61. 61. Naito Y, Yoshimura J, Morishita S, Ui-Tei K. siDirect 2.0: updated software for designing functional siRNA with reduced seed-dependent off-target effect. BMC Bioinformatics. 2009;10:392. pmid:19948054
  62. 62. Nagai T, Nakamuta S, Kuroda K, Nakauchi S, Nishioka T, Takano T, et al. Phosphoproteomics of the Dopamine Pathway Enables Discovery of Rap1 Activation as a Reward Signal In Vivo. Neuron. 2016;89(3):550–65. pmid:26804993
  63. 63. Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics. 2013;14:128. pmid:23586463
  64. 64. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 2016;44(W1):W90-7. pmid:27141961
  65. 65. Xie Z, Bailey A, Kuleshov MV, Clarke DJB, Evangelista JE, Jenkins SL, et al. Gene Set Knowledge Discovery with Enrichr. Curr Protoc. 2021;1(3):e90. pmid:33780170
  66. 66. Gustavsson EK, Zhang D, Reynolds RH, Garcia-Ruiz S, Ryten M. ggtranscript: an R package for the visualization and interpretation of transcript isoforms using ggplot2. Bioinformatics. 2022;38(15):3844–6. pmid:35751589
  67. 67. Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, et al. InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res. 2025;53(D1):D444–56. pmid:39565202
  68. 68. Brennan P. drawProteins: a Bioconductor/R package for reproducible and programmatic generation of protein schematics. F1000Res. 2018;7:1105. pmid:30210791