Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Loss of Pol III repressor Maf1 in neurons promotes longevity by preventing the age-related decline in 5S rRNA and translation

  • Bowen Xu,

    Roles Conceptualization, Investigation, Methodology, Writing – original draft

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Alexander Hull,

    Roles Investigation

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Olivia N. M. Hill,

    Roles Investigation

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Naja Kobal,

    Roles Investigation

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Enric Ureña,

    Roles Investigation

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Linda Partridge ,

    Roles Conceptualization, Methodology, Supervision, Writing – original draft, Writing – review & editing

    linda.partridge@ucl.ac.uk (LP); n.alic@ucl.ac.uk (NA)

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯
  • Nazif Alic

    Roles Conceptualization, Methodology, Supervision, Writing – original draft, Writing – review & editing

    linda.partridge@ucl.ac.uk (LP); n.alic@ucl.ac.uk (NA)

    Affiliation Department of Genetics, Evolution and Environment, Institute of Healthy Ageing, University College London, London, United Kingdom

    ⨯

Abstract

Attenuating protein synthesis promotes longevity in multiple species. However, numerous studies indicate that aging drives a decrease in protein synthetic capacity. These observations hint at potential, unexplored benefits of stimulating protein synthesis in old age. In this work, we focus on Maf1, a repressor of protein synthesis genes transcribed by RNA Polymerase (Pol) III, such as the 5S rRNA and tRNAs, and its role in aging. We show that the knockdown of Maf1 extends lifespan in Drosophila. Maf1 limits longevity specifically from adult neurons in both female and male fruit flies. In older females, adult neuron-specific knockdown of Maf1 improves neuromuscular function as well as the function of a distal organ, the gut. We find that the extension of female lifespan upon Maf1 knockdown requires Pol III initiation on the 5S rRNA. Indeed, reducing neuronal Maf1 activity rescues the age-related decline in 5S expression and protein synthesis in the brain of female flies. Hence, our findings show that stimulating neuronal protein synthesis can promote healthy aging.

Citation: Xu B, Hull A, Hill ONM, Kobal N, Ureña E, Partridge L, et al. (2025) Loss of Pol III repressor Maf1 in neurons promotes longevity by preventing the age-related decline in 5S rRNA and translation. PLoS Biol 23(7): e3003250. https://doi.org/10.1371/journal.pbio.3003250

Academic Editor: Josh Dubnau, Stony Brook University Medical Center: Stony Brook University Hospital, UNITED STATES OF AMERICA

Received: October 3, 2024; Accepted: June 6, 2025; Published: July 15, 2025

Copyright: © 2025 Xu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting information files.

Funding: The work was funded in part by Biotechnology and Biological Sciences Research Council (BBSRC) grant BB/S014357/1 to NA, BBSRC grant BB/V006541/1 to LP, Medical research Council and BBSRC BLAST Ageing Research network’s funding BB/W01825X/1 to BW and Genetic Society Summer Studentship to ONMH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Abbreviations: ALS, amyotrophic lateral sclerosis; FTD, frontotemporal dementia; Pol, Polymerase; RNAi, RNA interference; TAGs, triacylglycerols; TFs, transcription factors

Introduction

The proportion of older people is steadily increasing in many parts of the world, making it important to uncover new innovations to improve health into older age [1]. The rate of protein synthesis naturally declines in many tissues during aging. This decline has been extensively documented in different tissues and cell types of multiple species, including humans [2–4]. While this decline may be beneficial in certain cell types, [5], it is also likely to compromise cellular function, especially in cell types such as neurons, where de novo protein synthesis underpins crucial cellular tasks [3,6,7], thus contributing to organismal aging. However, the potential health benefits of increasing the capacity for protein synthesis during aging, to combat this natural decline, have not received much attention. Rather, the focus of research into the role of protein synthesis in aging has been on the longevity-promoting effects of reduced translation: decreased provision of ribosomal components or translation initiation factors, as well as pharmacological inhibition of protein synthesis, and in fruit flies this is specifically relevant in early adulthood, can all boost late-life health and extend lifespan across animal models [4,5,8–11], with evidence of relevance to mammals including humans [12,13]. The underlying mechanisms are not fully elucidated but are likely to be indirect, i.e., not resulting from decreased protein synthesis per se. Recent research has started extending this narrow focus: increasing the fidelity of translation directly has also been shown to promote longevity [14]. However, and despite the decades of evidence for an age-related decline in translation capacity, the longevity-promoting potential of increased translation remains unexplored.

Maf1 is an evolutionarily conserved, global repressor of RNA polymerase (Pol) III [15], which transcribes short, non-coding RNAs including the 5S rRNA and tRNAs required for protein translation [16–18]. Initially implicated in nutrient and stress responses in budding yeast [19], the role of Maf1 in animal development and physiology is becoming increasingly appreciated [15,20]. For example, in fruit flies, dMaf1 limits organismal growth [21], while in mice Maf1 restricts futile, energetically costly cycles of tRNA synthesis and degradation [22–24], regulates adipocyte and osteoblast differentiation and reduces cardiac hypertrophy [25–27]. Specifically in neurons, Maf1 limits dendritic outgrowth, axonal regeneration and supresses neural repair [27–30]. Interestingly, mice lacking Maf1 activity have several improved health parameters and females are long-lived [22,23], a phenotype similarly observed in Maf1 mutant worms [31]. However, the mechanisms underlying this longevity have not been directly examined.

To understand how the loss of Maf1 promotes longevity, we studied the role of Maf1 in aging, mainly in female fruit flies. We find that Drosophila Maf1 (dMaf1) knockdown specifically in adult neurons extends lifespan. We present evidence that neuronal dMaf1 knockdown acts by counteracting the loss of 5S rRNA expression with age and the resulting loss of protein synthetic capacity. This neuronal increase in translation promotes health both in wild type flies and in a model of C9Orf72-repeat neurotoxicity. Our study establishes a paradigm where enhancing translation capacity, specifically in neurons, promotes healthy aging.

Results

dMaf1 knockdown extends lifespan but does not protect against obesity in flies

Previous work has demonstrated that loss of function in the Maf1 gene can promote longevity in worms and mice [22,31]. We set out to investigate whether the effect of Maf1 on aging is evolutionarily conserved in the fruit fly Drosophila melanogaster. We chose to perform our experiments mainly in females, since female fruit flies show greater plasticity of lifespan (e.g., [32,33]) and the longevity due to Maf1 loss-of-function was observed in female but not male mice [22]. We used the RU486 inducible GeneSwitch system together with RNA interference (RNAi) to knock down dMaf1 specifically in adulthood (unless otherwise noted, all knockdowns started from day two post-eclosion). We validated a dMaf1RNAi line (V109142) by driving it with a constitutive, ubiquitous Daughterless-gal4 (Da-gal4) driver: dMaf1 mRNA levels were halved in females (Fig 1A). There was a concomitant increase in pre-tRNA levels indicating that this level of dMaf1 knockdown was sufficient to induce Pol III activity (Fig 1B). This increase was large and similar in magnitude to those observed by others [22,34]. Driving the expression of this RNAi line ubiquitously from day 2 post-eclosion with Actin5c-GeneSwitch (Act5c-GS) (Fig 1C) or Daughterless-GeneSwitch (Da-GS) (Fig 1D) was sufficient to significantly extended female lifespan, indicating dMaf1 acts in adulthood to curtail longevity in the female fruit fly.

thumbnail
Download:
Fig 1. Loss of dMaf1 extends lifespan but may not protect against obesity.

A, qPCR quantification normalized to Actin5C of dMaf1 mRNA (n = 4 biologically independent samples, p = 0.0137, Student t test), and B, pre-tRNAs [n = 4 biologically independent samples, genotype effect, p < 1 × 10−4, pre-tRNAs effect, p = 0.1909, genotype-by-pre-tRNAs interaction, p = 0.1909, Linear Model (LM)] in female flies expressing dMaf1RNAi(V109142) at day 14. C, Lifespan of females with adult-specific, ubiquitous induction of dMaf1RNAi(V109142) driven by Act5C-GS (−RU486: n = 122 dead/26 censored flies, +RU486: n = 120/19, p = 2.72 × 10−19, log-rank test). D, Lifespan of females with adult-specific, ubiquitous induction of dMaf1RNAi(V109142) driven by Da-GS (−RU486: n = 123/26, +RU486: n = 114/35, p = 5.02 × 10−10, log-rank test). E, TAG levels of females at day 21 after feeding a high sugar diet or standard diet and combined with adult-specific, ubiquitous induction of dMaf1RNAi(V109142) with Da-GS (n = 8 biologically independent samples, sugar effect, p = 0.0371, RU486 effect, p = 0.6370, RU486-by-sugar interaction, p = 0.9916, LM) or F, Act5C-GS (n = 8 biologically independent samples, sugar effect, p < 1 × 10−4, RU486 effect, p = 0.1842, RU486-by-sugar interaction, p = 0.5901, LM). Bar charts indicate mean ± SEM with points showing individual values. For induction with GeneSwitch drivers, RU486 was supplied in the food from day 2 of adulthood. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.g001

In mice, null mutation of Maf1 confers resistance to diet-induced obesity [22]. To investigate whether it is the same case in Drosophila, we measured the levels of triacylglycerols (TAGs) in females fed an obesogenic, high-sugar diet [35], while ubiquitously inducing dMaf1RNAi from adulthood. Lowering of dMaf1 during adulthood did not counter the increased TAG levels observed after high-sugar feeding (Fig 1E and 1F). Furthermore, and consistent with the lack of effect on obesity, ubiquitous suppression of dMaf1 was unable to combat the lifespan shortening effect of the high-sugar diet (S1A and S1B Fig), and indeed may even exacerbate it. Note, however, that the effect on obesity demonstrated in mice may also be observed in Drosophila with a more severe loss of Maf1 function, e.g., resulting from a gene deletion. Overall, we found that the function of Maf1 in aging was conserved in flies and could be uncoupled from an effect on obesity.

Neuron-specific loss of dMaf1 extends lifespan

Consistent with the longevity effects of reduced protein synthesis observed across species, we have shown that partial inhibition of Pol III extends chronological lifespan in budding yeast, as well as organismal lifespan in worms and female but not male flies [10,36]. In female fruit flies, the beneficial effects arise from specific cell types: attenuating the activities of Pol III in the gut, including its resident stem cells, promotes organismal longevity [10]. In contrast, loss of dMaf1 increases Pol III activity. This prompted us to consider the possibility that dMaf1 knockdown could be promoting longevity from a different organ. Publicly available mRNA single-cell expression data [37] indicate dMaf1 is highly expressed in neurons, more highly than in other cell types, including the enterocytes, enteroendocrine cells, stem cell and enteroblasts in the gut (Fig 2A). Similarly, Maf1 expression is high in the mouse nervous system [28]. We also noted that age-related changes in Pol III activity were different between the brain and the gut. When the two organs were isolated from the same female flies, and the transcript levels detected were scaled to total DNA to avoid confounding effects of the substantial, known, age-related change in total cellular RNA content in the brain [38], we observed that the levels of pre-tRNAHis, pre-tRNAIle, pre-tRNALeu and pre-tRNATyr all decreased in concert from day 7 to day 42 in the brain, indicating a reduction in Pol III activity (Fig 2B). In contrast, in the gut, we did not detect a concerted downregulation of these four pre-tRNA: although there was an age-related decrease in the levels of pre-tRNAHis and pre-tRNAIle, we observed a marked upregulation of pre-tRNALeu and a subtle increase in pre-tRNATyr, indicating a tRNA-specific effect of aging on Pol III activity in that organ (Fig 2C). Similar results were obtained when Actin5C expression was used for normalization (S2A Fig). All this led us to consider whether suppression of dMaf1 specifically in adult neurons would increase lifespan.

thumbnail
Download:
Fig 2. Loss of dMaf1 specifically in neurons extends lifespan.

A, dMaf1 mRNA expression in adult cell types, as normalized counts per million (CPM) from single cell RNA-sequencing experiments in SCope shown for neurons (red) and other cell types (gut cells - gray, all others - black). B, qPCR quantification normalized by total DNA of pre-tRNAs in female brains [n = 6 biologically independent samples, age effect, p < 1 × 10−4, pre-tRNAs effect, p = 0.5499, age-by-pre-tRNAs interaction, p = 0.5499, Linear Model (LM)] or C, guts (n = 6 biologically independent samples, age effect, p = 0. 0.5194, pre-tRNAs effect, p < 1 × 10−4, age-by-pre-tRNAs interaction, p < 1 × 10−4, LM) from same wild-type flies that were either 7 or 42 days old. D, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire (−RU486: n = 90 dead/6 censored flies, +RU486: n = 112/7, p = 2.12 × 10−9, log-rank test). E, Lifespan of females with adult-specific, whole gut induction of dMaf1RNAi(V109142) driven by Ti-GS (−RU486: n = 132/33, +RU486: n = 137/9, p = 0.5231, log-rank test). F, Lifespan of females with later-life (from day 21), pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 (−RU486: n = 146/0, +RU486: n = 147/0, p = 1 × 10−4, log-rank test). For induction with GeneSwitch drivers, RU486 was supplied in the food from day 2 of adulthood except in F. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.g002

We induced dMaf1RNAi in neurons of adult female flies using the Elav-GSTricoire driver, starting from day 2 of adulthood. This resulted in a reduction of dMaf1 mRNA levels within the brain (~40% reduction, S2B Fig) and a significant lifespan extension (Fig 2D). This longevity phenotype was highly robust: we observed it in additional independent trials (S2C and S2D Fig), using two additional drivers (S2E and S2F Fig) as well as another, independent RNAi line (RNAi line validated in S2G and S2H Fig; S2I and S2J Fig). Interestingly, we found that neuronal dMaf1 knockdown could also extend lifespan in male flies, albeit more modestly (S2K and S2L Fig; note that these are the only experiments we performed in males). Furthermore, late-onset (day 21), neuronal dMaf1 knockdown was sufficient to extend female lifespan (Fig 2F). Longevity was not observed in driver- or RNAi-alone controls, indicating it is not an artifact of RU486 feeding (S2M, S2N, S2O, S2P, and S2Q Fig). Neuronal dMaf1 knockdown also improved resistance to H2O2 (S2R Fig), a Maf1 loss-of-function phenotype previously observed in C. elegans [31], with no such effect observed in the driver alone control (S2S Fig). Note that the longevity of the pan-neuronal dMaf1 knockdown could not be recapitulated by driving dMaf1RNAi in insulin-producing cells in the brain, whose role in aging is well documented [39] (S2T Fig). The reduction in neuronal dMaf1 did not affect feeding behavior or egg laying (S2U and S2V Fig). The longevity effect appeared to arise specifically from neurons: knockdown of dMaf1 in the female fat body (S2W Fig), or the gut (Figs 2E, S2X and S2Y) did not extend lifespan irrespective of the driver used, even though the increases in pre-tRNA levels in the gut and the fat body were similar to those observed in the brain upon Maf1 knockdown (S2Z Fig). Still, it is possible that a different level of knockdown in those organs could provide some benefit. Note that the expression of neuronal drivers used in our study is restricted to neurons due to well-characterized, neuron-specific expression of the Elav or nSyb gene promoters [40,41]; indeed we confirmed that ElavGS301 was not active in glia, the other cell type in the Drosophila brain (S3A Fig). Additionally, published single cell RNA-Seq data indicate Maf1 expression is low in glia [42] (S3B Fig). Thus, dMaf1 appears to act specifically in neurons to promote aging.

Loss of dMaf1 within neurons delays age-related loss of organismal function

To further examine the effects of neuronal Maf1 on aging, we first tested if adult-onset (from day 2), neuronal-specific dMaf1 knockdown can guard against the age-related changes in the function of the neuromuscular system. We measured the ability of female flies to climb a vertical surface at different times in their lifeusing a negative geotaxis (climbing) assay and analyzed the data using a linear model (LM). Adult-onset, neuronal dMaf1 knockdown delayed the age-related decline in climbing ability in females (Fig 3A). The statistical significance of this delay was confirmed as a significant age-by-RU486 interaction in the LM (p = 0.0046). Indeed, even a later-onset knockdown (from day 21) appeared sufficient to counteract the loss in climbing ability (S4A Fig). RU486 treatment started either early or late did not affect the climbing ability of the driver-alone control (S4B and S4C Fig).

thumbnail
Download:
Fig 3. Loss of dMaf1 in neurons improves old-age health.

A, Height climbed during negative geotaxis assays by female flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire [n = 44–70 flies, RU486 effect, p = 0.0081, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.0046, Linear Model (LM)]. B, Quantification of females’ night sleep (n = 32 individual flies, age effect, p = 0.2739, RU486 effect, p = 0.0799, RU486-by-age interaction, p = 0.0101, LM) and C, night bouts (n = 32 individual flies, age effect, p = 0.1160, RU486 effect, p = 0.2604, RU486-by-age interaction, p = 0.0102, LM) of 7- and 42-day old females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with the Elav-GS301driver. D, Cumulative proportion of partial and complete smurfs in female flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire (n = 92–380 flies, RU486 effect, p = 0.0160, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.3833, ordinal logistic regression). For induction with GeneSwitch drivers, RU486 was supplied in the food from day 2 of adulthood. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.g003

During aging, Drosophila’s sleep fragments: the length of sleep decreases and the number of sleep bouts increases [43]. Next, we monitored activity and sleep patterns in young and old females over 24 h (one 12 h:12 h day:night cycle). Neuronal dMaf1 knockdown did not affect day or night activity, day sleep or day sleep bouts (S4D, S4E, S4F, and S4G Fig), but it prevented the decline in the length of total night sleep and the increase in night sleep bouts during aging, indicating greater sleep consolidation (Fig 3B; age-by-RU486 interaction p = 0.0101 and 3C; age-by-RU486 interaction p = 0.0102). There was no effect of RU486 on these sleep phenotypes in the driver alone control (S4H and S4I Fig).

Changes in one organ can affect the aging of others [11,44]. The gut of older flies loses its ability to act as a barrier and this phenotype can be easily scored with a “smurf” assay where gut leakage is assessed with a blue food dye. Neuron-specific dMaf1 knockdown reduced the loss of gut barrier function during aging in females (Fig 3D). No such effect was observed in the driver-alone control (S4J Fig). The beneficial effects on both neuromuscular performance and gut health of the neuronal dMaf1 knockdown were confirmed with an independent RNAi line (S4K Fig; age-by-RU486 interaction p = 0.0413 and S4L Fig). Overall, our analyses show that a reduction in neuronal dMaf1 is sufficient to improve the health of multiple organ systems, including distal organs such as the gut.

Reduction in neuronal Maf1 requires Pol III initiation on the 5S rRNA to extend lifespan

Maf1 is a global Pol III repressor, but in certain contexts it has been shown to regulate Pol II-transcribed genes [15,20,24]. To examine if dMaf1 acts via Pol III to impact aging in female fruit flies, we co-induced a validated RNAi line against the largest Pol III subunit Polr3A (previously named dC160, see [45]) together with dMaf1 RNAi in neurons. We found that Polr3A knockdown abolished the lifespan extension of a dMaf1 knockdown (Fig 4A), and Polr3A knockdown alone did not affect lifespan (S5A Fig). We confirmed a significant difference in the response to the RU486 inducer in the presence or absence of the Polr3A knockdown using Cox Proportional Hazards (CPH) analysis (RU486-by-genoype interaction, p = 1 × 10−4). Hence, dMaf1 acts through Pol III for longevity.

thumbnail
Download:
Fig 4. Loss of neuronal dMaf1 extends lifespan by maintaining 5S rRNA expression during aging.

A, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with or without co-induction of Polr3ARNAi, driven by Elav-GSTricoire [dMaf1RNAi(V109142) alone, −RU486: n = 134 dead/2 censored flies, +RU486: n = 131/3, p = 1.18 × 10−10, log-rank test; dMaf1RNAi(V109142) with Polr3ARNAi, −RU486: n = 149/1, +RU486: n = 145/5, p = 0.3164, log-rank test; genotype effect, p = 8.62 × 10−5, RU486 effect, p = 3.35 × 10−10, genotype-by-RU486 interaction, p = 1.02 × 10−4, Cox Proportional Hazards (CPH)]. B, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with or without co-induction of GTF3C3RNAi, driven by Elav-GS301 (dMaf1RNAi(V109142) alone, −RU486: n = 151/1, +RU486: n = 145/4, p = 2.41 × 10−9, log-rank test; dMaf1RNAi(V109142) with GTF3C3RNAi, −RU486: n = 143/4, +RU486: n = 145/7, p = 0.0371, log-rank test; genotype effect, p = 6.50 × 10−4, RU486 effect, p = 9.78 × 10−10, genotype-by-RU486 interaction, p = 0.0029, CPH). C, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with or without co-induction of GTF3ARNAi, driven by Elav-GS301 (dMaf1RNAi(V109142) alone, −RU486: n = 143/0, +RU486: n = 140/7, p = 4.23 × 10−9, log-rank test; dMaf1RNAi(V109142) with GTF3ARNAi, −RU486: n = 144/5, +RU486: n = 138/6, p = 0.2169, log-rank test; genotype effect, p = 0.7240, RU486 effect, p = 2.84 × 10−8, genotype-by-RU486 interaction, p = 1.86 × 10−6, CPH). D, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with or without conduction of Pbp95RNAi, driven by Elav-GS301 (dMaf1RNAi(V109142) alone, −RU486: n = 151/1, +RU486: n = 145/4, p = 2.41 × 10−9, log-rank test; dMaf1RNAi(V109142) with Pbp95RNAi, −RU486: n = 135/0, +RU486: n = 142/10, p = 7.42 × 10−13, log-rank test; genotype effect, p = 0.0050, RU486 effect, p = 8.65 × 10−10, genotype-by-RU486 interaction, p = 0.1710 CPH). E, qPCR quantification of 5S rRNA in female brains of wild-type flies (n = 6 biologically independent samples, p < 1 × 10−4, Student t test) or F, those with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301, relative to total DNA, at 7 and 42 days. [n = 14 and 8 biologically independent samples respectively, age effect, p = 0.1503, RU486 effect, p = 0.0026, RU486-by-age interaction, p = 0.0385, Linear Model (LM)]. G, qPCR quantification of 5S rRNA in female brains at 42 days after dMaf1RNAi(V109142) was induced alone or with GTF3ARNAi by Elav-GS301, relative to total DNA (n = 5−6 biologically independent samples, genotype effect p = 0.017, RU486 effect p = 0.22, genotype-by-RU486 interaction p = 7 x 10−4, LM). For induction with GeneSwitch drivers, RU486 was supplied in the food from day 2 of adulthood. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.g004

Pol III transcribes a number of different genes with different cellular functions [17]. To gain a better understanding of how neuronal dMaf1 impacts female lifespan, we used RNAi lines targeting transcription factors (TFs) required for Pol III initiation, namely TFIIIA, TFIIIC, and SNAPc, as these define specific subsets of Pol III transcribed genes. TFIIIA is required for transcription of the 5S rRNA, TFIIIC for both 5S and tRNAs, and SNAPc for other RNAs such as the U6 [17,46]. The knockdown of either GTF3A (CGCG9609, the Drosophila orthologue of the human GTF3A gene encoding TFIIIA), GTF3C3 (CG8950, the Drosophila orthologue of the human GTF3C3 gene encoding a subunit of TFIIIC) or Pbp95 (a SNAPc subunit) in adult neurons alone did not affect fly lifespan (S5B, S5C, and S5D Fig). Knockdown of either GTF3C3 or GTF3A abolished the lifespan extension resulting from dMaf1 knockdown (Fig 4B and 4C), whereas loss of Pbp95 did not (Fig 4D). Note that all the RNAi lines used resulted in a significant knockdown of the target transcript and the expected pre-adult lethality when combined with a ubiquitous, constitutive driver (Da-gal4, S5E–S5I Fig); knockdown of TFIIIA reduced 5S levels (S5J Fig). In summary, the genetic analysis revealed TFIIIA and TFIIIC as essential for the longevity benefit of dMaf1 knockdown.

As both TFIIIC and TFIIIA are required for the transcription of 5S rRNA, we focused our attention on this rRNA and examined what happens to its expression with age in female flies. To avoid the potential confounding effects of the age-related reduction in neuronal RNA concentration previously observed [38], we normalized 5S rRNA expression to total DNA extracted from the same samples. We found that 5S rRNA levels were significantly reduced during aging in wild-type, female brains (Figs 4E and S5K). Interestingly, 5S rRNA expression was not changed in the gut during aging (S5L and S5M Fig), consistent with the differential effect of aging on Pol III activity in the two organs. In the brain, we found that Maf1 mRNA levels were not altered by age, but the levels of two Pol III subunits, Polr3A and Polr3D, were reduced, indicating that the loss of 5S expression may have been due to lower Pol III expression (S5N and S5O Fig). In concordance with lifespan results of the genetic epistasis analysis, loss of neuronal dMaf1 resulted in slightly increased 5S rRNA expression in young flies and provided substantial protection against the age-related decline in 5S levels (Fig 4F, age-by-RU486 interaction p = 0.0385). Similar results were observed when 5S expression was normalized to Act5C mRNA (S5P Fig). As expected, induction of GTFIIIARNAi in neurons substantially reduced 5S levels (S5Q Fig) and prevented the Maf1 knockdown from rescuing the expression of 5S rRNA in older flies (Fig 4G, genotype-by-RU486 interaction p = 7 × 10−4; see S5R Fig for 5S relative to Actin5C). Overall, our findings are consistent with neuronal dMaf1 knockdown increasing lifespan by countering an age-related loss in 5S expression though Pol III activation.

Loss of dMaf1 protects against a decline in protein synthesis and C9orf72 repeat toxicity

The 5S rRNA is an essential constituent of the ribosome [47]. Our observations prompted us to further examine the role of the neuronal protein synthetic capacity in the longevity attained by neuronal dMaf1 knockdown. We monitored the rates of protein synthesis in isolated female fly brains using puromycin incorporation; we chose to assess protein synthesis in the whole brain rather than isolated neurons to ensure robustness and because ~90% of cells in the fly brain are neurons [38]. Consistent with extensive previous work in a number of species [4], we found that protein synthesis in female Drosophila brains was significantly reduced with age (Figs 5A and S6A). Loss of neuronal dMaf1 slightly increased protein synthesis rates in young flies and, importantly, significantly rescued the decline in protein synthesis in older brains; this rescue was observed both when we assayed young and old flies at the same time (Figs 5B and S6B) as well as when we followed a cohort of flies though time (S7A–S7C Fig). Note that this rescue of protein synthesis appeared less pronounced than the rescue of 5S expression, indicating that additional factors or processes required for protein synthesis are compromised with age. To validate the physiological relevance of this increase in translation in older flies, we combined the neuronal dMaf1 knockdown with RNAi against RpS5a encoding an essential ribosomal protein. This loss of function in a ribosomal protein was sufficient to abolish the longevity effects of neuronal dMaf1 knockdown (Fig 5C), while RpS5a knockdown alone did not affect lifespan (S7D Fig). Overall, our data indicate that attenuated dMaf1 function in neurons extends female lifespan by preserving neuronal protein synthesis against the effects of aging. This increase in protein synthesis could also increase protein turnover, and indeed autophagy is induced in Maf1 knockout mice [22]. Consistent with this, we observed an increase in lysotracker staining in brains upon Maf1 knockdown (S7E Fig), indicating an increased lysosomal compartment, which suggests an increase in autophagy in Drosophila females as in mice. However, further work is required to directly demonstrate an increase in autophagic flux.

thumbnail
Download:
Fig 5. Loss of neuronal dMaf1 extends lifespan through increased protein synthesis and partially rescues the toxicity of the C9Orf72 repeat RNA.

A, Representative western blot of puromycin incorporation in female brains of wild-type flies at 7 and 42 days of age (n = 4 biologically independent samples, p < 1 × 10−4, Student t test). B, Representative western blots and quantification of puromycin incorporation in brains of female flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 at 7 and 42 days of age (n = 4 biologically independent samples; −RU486 vs. +RU486 7 days p = 0.062, 42 days p = 0.012, Student t test; effect of age p = 7.2 × 10−3, effect of RU486 p = 1.4 × 10−3, RU486-by-age interaction p = 0.37, LM). The flies of the two different ages were assayed at the same time. C, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with or without conduction of RpS5aRNAi, driven by Elav-GS301 [dMaf1RNAi(V109142) alone, −RU486: n = 151 dead/1 censored flies, +RU486: n = 143/4, p = 2.05 × 10−9, log-rank test; dMaf1RNAi(V109142) with RpS5aRNAi, −RU486: n = 150/1, +RU486: n = 147/2, p = 0.9793, log-rank test; genotype effect, p = 0.0033, RU486 effect, p = 6.17 × 10−10, genotype-by-RU486 interaction, p = 8.74 × 10−6, Cox Proportional Hazards (CPH)]. D, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) with 36R driven by Elav-GSTricoire (36R alone: n = 134/5, 36R with dMaf1RNAi(V109142): n = 141/1, p = 8.98 × 10−5, log-rank test). E, Model of how Maf1 activity in neurons impacts aging. For induction with GeneSwitch drivers, RU486 was supplied in the food from day 2 of adulthood. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.g005

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are neurodegenerative diseases whose most common genetic cause is a hexanucleotide repeat expansion within the C9orf72 gene [48]. The C9orf72 repeat RNA is translated into toxic dipeptide repeats that can interact with ribosomal proteins and inhibit translation [49]; this inhibition of translation is an important mechanism of toxicity. Since neuronal dMaf1 knockdown could rescue the loss in translation capacity in aged but otherwise healthy female flies, we examined its ability to reduce the toxicity of the C9orf72 repeat RNA in Drosophila. Indeed, loss of dMaf1 also partially rescued the short lifespan of flies expressing the expanded 36 GGGGCC (G4C2) repeats (36R) in adult neurons (Fig 5D). Interestingly, we found that the induction of the repeats caused an increase in Maf1 levels in the fly head, potentially mediating toxicity of 36 GGGGCC (S7F Fig). Hence, loss of dMaf1 within neurons promotes neuronal protein synthetic capacity to improve organismal health during both normal aging and in a disease context.

Discussion

Protein synthesis underlies many fundamental neuronal functions: for example, it is required for long-term memory formation [3] and plays a role in neural plasticity [7]; it is also elaborately controlled, with translation of specific mRNAs localized to subcellular regions such as axons [6,7]. During aging, the capacity to synthesize proteins declines in many tissues and organs, including the brain [2–4]. This decline is conserved across different animals, such as flies and mammals [4], and may be due, at least in part, to an inappropriate or insufficient provision of ribosomal components (e.g., [50,51]). Our work shows that counteracting this decline in neurons of the adult female fruit fly, specifically by reducing the activity of the Pol III inhibitor Maf1 and consequently increasing the Pol III transcription, can be beneficial for old-age health and longevity of the entire organism. The effects on the overall organismal health may be both direct, e.g., preventing a life- or health-limiting neuronal pathology such as caused by C9orf72 repeat RNA, and indirect, e.g., hormonal or metabolic. Our data pinpoint the neuronal 5S rRNA as a key player in this mechanism (Fig 5E), but the potential contribution from other Pol III-transcribed RNAs, such as tRNAs, cannot be excluded. Interestingly, reduced translation has been implicated in pathology of neurodegenerative disease [49,52]. Our work supports the notion that this reduction in neuronal translation capacity is a link between physiological aging and disease.

Ubiquitous loss of function in Maf1 also extends mouse lifespan [22]. We consider that it is likely that mammalian Maf1 is also acting from neurons to impact aging of the whole animal. Indeed, a role for Maf1 in neuronal physiology has recently been described [27–30]. In this context, it is interesting that Maf1 cell-intrinsically limits neuronal repair, so that a loss-of-function in Maf1 significantly enhances neuronal plasticity and functional recovery after injury, probably through increased transcription of the components of the protein synthetic machinery [30]. Reduced Maf1 function may act simply by allowing cells to synthetize more proteins required for appropriate cellular function. For example, it has been suggested that the decline in neuronal protein synthesis contributes to age-related memory impairments, due to the requirement for de novo protein synthesis in memory formation [3]. Indeed, high hippocampal Maf1 levels negatively impact mouse learning and memory [28]. Additionally, increasing protein synthetic capacity may affect protein turnover rates, which have been documented to decline in the aging brain [53]: increasing synthesis may accelerate protein turnover, allowing clearance of damaged or misfolded proteins, thus, improving proteostasis, a key determinant of neuronal health [54]. Indeed, autophagy is induced in Maf1 knockout mice [22] and appears similarly impacted by a reduction in Maf1 in flies. Additionally, Maf1 knockdown may impact translational fidelity, which can have positive effects on fruit fly lifespan [14]. Overall, we propose that reduced function of Maf1 is likely to boost health of mammalian neurons during aging, through the same or similar mechanisms as we describe here for the fruit fly.

Maf1 loss-function has been reported to extend female but not male lifespan [22]. Sexual dimorphism in the effects of longevity interventions is often observed in fruit flies and other animals, but we are only now starting to understand its molecular and physiological bases [32,33]. In this study, we focused on female flies and only examined the lifespan effect of neuronal Maf1 knockdown in males. The lifespan of the males was extended, albeit more modestly than in females; however, a more pronounced sexual dimorphism may be revealed in other traits by subsequent studies, allowing for further investigation. Such subsequent investigation will allow for the important understanding of the root of the likely sexually dimorphic effects of Maf1 in mammals.

It is interesting to note that the increase in protein synthesis by inhibition of Maf1 and consequent Pol III activation appears beneficial in neurons while the opposite is true in the fly gut, where the inhibition of Pol III in the resident stem cells promotes organismal longevity [10]. Curiously, the converse interventions, knockdown of Maf1 in the gut or of a Pol III subunit in the brain, are not detrimental. This is likely due to other, unrelated and parallel processes that also drive aging. It can also explain why the ubiquitously implemented interventions, e.g., ubiquitous knockdown of Maf1 or the heterozygous Polr3D mutant [10], show a lifespan extension phenotype. The differing requirements for Pol III activity in neurons and intestinal stem cells during aging also parallel the different effect age has on expression of Pol III-transcribed genes in the two cell type we describe in this study.

Furthermore, while the two interventions are reciprocal, the increased neuronal protein synthetic capacity and attenuated translation in intestinal stem cells may not be acting on aging by opposing mechanisms. Indeed, there is increasing evidence that a reduction in translation acts by triggering a stress response or by modulating gene expression, rather than by simply reducing bulk translation [55–59]. For example, impairments in protein translation result in the activation of Gcn4 and Atf-4 TFs, in yeast and worms, respectively. These factors, in turn, activate pro-longevity transcriptional programmes that enhance stress resistance and improve proteostasis [55,58]. Indeed, attenuation of Pol III activity induces a proteostatic response and an increased tolerance of a proteostatic challenge in worms, flies, and mice, where the beneficial effects appear to derive from changes in tRNA expression [60]. As an additional example of mechanism, attenuation of translation early in fruit fly adulthood appears to provide organism-wide benefits by altering intercellular communication: during Drosophila adulthood, protein synthesis rates peak in early youth and drive the subsequent, later-age decline in health via hormonal signals that impact proteostasis [5].

Loss of proteostasis is a fundamental feature of aging and directly enhancing proteostasis extends organismal lifespan [54,61,62]. Decelerating translation may also, for example, enhance co-translational proteostasis, a process that is compromised with age [63]. This is consistent with recent suggestions that the observed reduction in translation later in fruit fly adulthood may be “adaptive” [5], at least in some cell types. Interestingly, attenuation of translation needs to be implemented in early adulthood to prevent the burst in protein translation that occurs in Drosophila youth to result in subsequent health benefits later in life [5], whereas neuronal Maf1 knockdown and the consequent increase in neuronal translation are effective even at older ages, indicating that the two interventions may act in a temporally distinct manner. Again, they may both impact proteostasis as increased translation may in effect increase protein turnover, as discussed above. Indeed, they may represent two mechanisms to ensure proteostasis, one important for non-dividing and other for dividing cells.

Our ongoing work on Pol III in flies highlights how different interventions may benefit different cells: reduced Pol III activity is beneficial in the proliferative stem cells in the fly gut, while enhanced Pol III activity is beneficial in the non-proliferative neurons. Importantly, complementing a wealth of studies showing the benefits of attenuated protein synthesis for aging, this study uncovers a cell-type-specific benefit of increased translation capacity that is likely to be relevant in the context of mammalian, including human, aging.

Materials and methods

Fly husbandry

Fly stocks and experiments were maintained on a 12 h:12 h light/dark cycle at 25°C with 60% humidity, on the standard sugar/yeast/agar (SYA) medium containing 10% (w/v) brewer’s yeast, 5% (w/v) sucrose and 1.5% (w/v) agar [64]. The outbred Dahomey background wild-type stock was obtained in Dahomey (now Benin) in 1970 and has been maintained in large population cages. The white Dahomey (wDah) or vermillion Dahomey (vDah) stocks were derived by incorporating the w1118 or v1 mutation, respectively, into the Dahomey background by extensive backcrossing. All fly stocks in this study were backcrossed for six or more generations into the outbred wDah or vDah background. Fly stocks used were Actin5c-GS, Da-GS, Elav-GSTricoire, Elav-GS301, nSyb-GS, Dilp2-GS, Ti-GS, 5966-GS, 5961-GS, S1106-GS, Da-Gal4 (Bloomington #55850), UAS-dMaf1RNAi (VDRC #109142), UAS-dMaf1RNAi (Bloomington #64603), UAS-nls-GFP (a gift from Bruce Edgar), UAS-Polr3ARNAi (VDRC #30512), UAS-GTF3C3RNAi (Bloomington #58079), UAS- GTF3ARNAi (Bloomington #34030), UAS-Pbp95RNAi (Bloomington #67281), UAS-RpS5aRNAi (VDRC #101472), UAS-36R.

Lifespan assays

Lifespan assays were performed as described previously in detail [65]. In brief, crosses were set up in cages containing grape juice agar and live yeast, and eggs were collected within a 24-h window. Emerged adult flies were allowed to mate for 48 h and were subsequently lightly anesthetised with CO2 and separated by sex to a density of 15 per vial. Females were used unless otherwise noted. Experimental vials contained either SYA food with 200 μM RU486 (Sigma, M8046) or the control food containing equivalent volume of the ethanol vehicle. Flies were transferred to fresh food three times a week with deaths/censors recorded. Vials were kept in DrosoFlippers (https://www.drosoflipper.com/). For later life induction, RU486 food was supplied from day 21. Data were collected and analyzed by log-rank test in Excel (template available at http://piperlab.org/resources/). Details of statistical analyses and number of flies per condition (n) are provided in figure legends. CPH analysis was performed using the survival package [66,67] in R [68].

Triacylglycerol (TAG) and weigh measurements

A single female fly was weighed and then homogenized with 400 µl of 0.05% Tween-20 and TAG measured with Infinity TAG Reagent (Thermo Scientific). The highest/lowest measurements for each condition were removed to protect against potential outliers. Data were analyzed with JMP.

Immunostaining

Female brains were dissected from 7-day-old flies in ice-cold PBS and immediately fixed in 4% formaldehyde for 30 min. Brains were washed 3 × 20 min in PBS-T (0.5% Tween20) and blocked for 1 h in 5% horse serum (Gibco) in PBS-T. Brains were then incubated overnight at 4°C in 1:200 anti-REPO (8D12, DSHB) in blocking solution, followed by 1hr of PBS-T washes and a further overnight incubation at 4°C in 1:250 goat-anti-mouse Alexa 568 (A11019, Thermo Fisher). Brains were then mounted in VECTASHIELD mounting medium with DAPI and imaged at 63× on a Zeiss 880 confocal microscope.

Negative geotaxis (climbing) assays

Flies in five vials containing control food and five vials of food containing RU486 (200 µM) were used for climbing assay. At indicated times, flies were transferred to empty vials in DrosoFlippers to allow climbing of two vial heights. After acclimatizing for 30 min, flies were tapped to the bottom of the vials and allowed to climb upwards for 15 s (the time it takes young wild-type flies to nearly reach maximum height) while being video recorded. The final still images were analyzed in Fiji86 to collect the height climbed by individual fly. If the height could not be determined, the fly was not used in the analysis. Data were analyzed with a LM using JMP. The same cohort was continuously assayed.

Activity and sleep analysis

Twnety-four-hour activity and sleep were monitored using the Drosophila Activity Monitor (DAM2) system and DAMSystem3 data acquisition software (Trikinetics). At indicated times, individual female flies form indicated treatment groups were placed in tubes with control food or food containing RU486 (200 µM). Flies were loaded into DAMs and placed into 25°C, 65% humidity incubator (Percival) with 12h:12h light:dark cycle. After one day acclimatization, data were obtained from a 24-h period (beginning at the onset of lights-on). A custom Microsoft Excel workbook [69] was used to calculate total activity counts per fly in the day and night periods, and total sleep minutes and number of sleep bouts per fly during day and night periods. Data from flies that appear dead were not used, and one outlier was removed from day or night activity and bouts after visual inspection. Data were analyzed with a LM using JMP.

Smurf assays

For Smurf assay, the flies of indicated age were placed on SYA food with 2.5% (w/v) blue dye (FD&C blue dye no. 1, Fastcolors) for 48 h. Flies were scored as full smurfs if completely blue or partial smurfs if the dye had leaked out of the gut but not reached the head. The same cohort was continuously assayed. Data were analyzed with ordinal logistic regression using JMP.

Fecundity assay

Six to ten vials with the density of 15 7-day old females kept on control food and food containing RU486 (200 µM) were used to count the eggs laid over a 24-h period. The number of eggs laid per fly per day was calculated. Data were analyzed with LM using JMP.

Capillary Feeder (CAFE) assay

A single fly was added into a 7 mL bijou vial containing 1 mL 1% agar (w/v) sealed with Parafilm (Alpha Laboratories, Hampshire, UK). Holes were made on Parafilm for adequate air circulation, and a 5 ml disposable glass capillary tube (Camag, Muttenz, Switzerland) containing liquid food (5% sucrose (w/v), 2% BD Bacto yeast extract (w/v)) supplemented with 0.5 mg/mL FD&C blue dye no. 1 (Fastcolors) to aid measurement of feeding was provided through the Parafilm. Food ingestion was measured every 24-h at indicated time. Each experiment included an identical, CAFE chamber without flies to determine evaporative losses which were subtracted from experimental readings. Data were analyzed with LM using JMP.

H2O2 stress assay

For H2O2 stress assays, 7-day old flies were transferred onto 5% sugar and agar food containing 5% hydrogen peroxide (Sigma). Data were collected and analyzed by log-rank test using Excel (template available at http://piperlab.org/resources/).

qPCR

RNA and DNA from same samples of whole flies, guts or brains or 3-day larvae were isolated using TRIZOL (Invitrogen) according to manufacturer’s instructions and RNA converted to cDNAs using random hexamers and Superscript II (Invitrogen). Extracted total DNA concentration was measured by NanoDrop Spectrophotometer (Thermo Fisher). qPCR was performed on an Applied Biosystems QuantStudio 6 Flex real-time PCR instrument with Power SYBR Green PCR Master Mix (ABI), relative to a standard curve. Actin5c or total DNA isolated from same samples were used for normalization in expression analysis. Dissection-batch effect was removed by scaling data from each batch with the batch mean, values were expressed relative to a control and the data analyzed with a LM in JMP.

Primers used: dMaf1 forward, ACAAACAAGTGGCATCACGA; dMaf1 reverse CAGCCAAAGTTTGTGGAGGT; pre-tRNAHis forward, CGTGATCGTCTAGTGGTTAG; pre-tRNAHis reverse, CCCAACTCCGTGACAATG; pre-tRNAIle forward, CGCACGGTACTTATAATCAG; pre-tRNAIle reverse, CCAGGTGAGGCTCGAACTC; pre-tRNALeu forward, GCGCCAGACTCAAGATTG; pre-tRNALeu reverse, TGTCAGAAGTGGGATTCG; pre-tRNATyr forward, GAGCGGTGGACTGTAGAAGTT; pre-tRNATyr reverse, CCTATGGATGCCTGCTGGATT; Polr3A forward, CTGCAGCAATGATTCCTG; Polr3A reverse, GTGCCCGAACCCATTGTG; Polr3D forward, GGGTGACCCAGAGTCCCT; Polr3D reverse, GGCGAGCTCAGCGAAGAG; GTF3C3 forward, AACAGGTCATCATGGGTCCAC; GTF3C3 reverse, GTCCACCCTCTTGGCATCC; GTF3A forward, TTGCGACAAGACGTACTCGAT; GTF3A reverse, GGGTCATGTTGCTAACCGAGA; Pbp95 forward, GGGCACGTTTCGCTTCAAG; Pbp95 reverse, CGTAATCCTCGTTGTTAGGACAG; 5S rRNA forward, GCCAACGACCATACCACGCTG; 5S rRNA reverse, AGTACTAACCGCGCCCGACG; Actin5C forward, CACACCAAATCTTACAAAATGTGT; Actin5C reverse, AATCCGGCCTTGCACATG.

Puromycin incorporation assay and western blotting

Brains of female flies of indicated age and from indicated treatment groups were dissected in ice-cold PBS, with wild-type flies from SYA food processed in batches carried out in parallel. Brains were collected in 200 μl of cold Schneider’s medium (Sigma, #S0146) were immediately transferred to a further 800 μl of prewarmed (25°C) Schneider’s medium supplemented with 10 μg of puromycin (GIBCO, #A1113803) and incubated at 25°C for 30 min. Reactions were stopped by adding 333 μl of ice-cold 50% trichloroacetic acid and then placed on ice. Samples were homogenized by microtube pellet pestle rods and centrifuged for 15 min at 14,000 rpm at 4°C. The supernatant was removed, and the pellet washed with 1M Tris base. Twenty μl of Laemmli 2× sample buffer (50% LDS sample buffer, 100 mM DTT, in nuclease-free water) was added to the pellet and the pellet was resuspended at 85°C for 15 min. Protein samples were then separated in NuPAGE 4% to 12%, Bis-Tris Gel (Invitrogen, NP0336BOX) following the manufacturer’s instructions, and transferred to a nitrocellulose membrane. Membranes were blocked in 5% skimmed milk (Millipore, 70166) and left overnight in anti-puromycin antibody (Millipore, 12D10) at 1:2,500, or anti-tubulin antibody (Millipore, T6199) at 1:2,000 in 5% skimmed milk at 4°C, washed and probed with secondary antibodies (1:10,000 dilution) for 1 h at room temperature. Ponceau S (Sigma. 729. Aldrich) staining was used to visualize total protein. The intensity of anti-puromycin staining was quantified from chemiluminescence images (using an Anti-Mouse secondary HRP antibody, Abcam, #ab6789) in Fiji, relative to tubulin. Dissection-batch effect was removed by scaling data from each batch with the batch mean, values were expressed relative to a control and the data analyzed with a LM in JMP.

Experimental design and statistical analysis

Sample size was determined based on past, similar experiments. Flies were randomly assigned to treatment groups. The investigators were not blinded to the conditions. Flies that escaped or were accidentally killed during lifespan experiments were excluded as censors.

Linear model analyses and ordinal logistic regression were performed in JMP (version 14.3.0), Cox Proportional Hazards in R (version 4.2.3) with the survival package, Students t test in GraphPad Prism (version 10.1.2). All regression analyses had a fully factorial design. For linear models, p-values from F-tests are reported. Details of statistical tests are given in figure captions.

Supporting information

S1 Fig. Loss of dMaf1 cannot rescue the detrimental effects of a high-sugar diet on lifespan.

A, Lifespan of females with adult-specific, ubiquitous induction of dMaf1RNAi(V109142) driven by Da-GS fed a high sugar diet (−RU486: n = 130/20, +RU486: n = 138/12, p = 0.0652, log-rank test). B, Lifespan of females with adult-specific, ubiquitous induction of dMaf1RNAi(V109142) driven by Act5C-GS fed a high sugar diet (−RU486: n = 148/2, +RU486: n = 136/14, p = 3 × 10−4, log-rank test). These experiments were done at the same time as lifespans in Fig 1. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.s001

(TIF)

S2 Fig. Pan-neuronal dMaf1 knockdown decreases dMaf1 mRNA level in brains and consistently extends lifespan.

A, qPCR quantifications normalized by Actin5C mRNA expression of pre-tRNAs in female brains (n = 6 biologically independent samples, age effect, p < 1 × 10−4, pre-tRNAs effect, p = 0.7430, age-by-pre-tRNAs interaction, p = 0.5198, LM), or guts (n = 6 biologically independent samples, age effect, p = 0.4169, pre-tRNAs effect, p < 1 × 10−4, age-by-pre-tRNAs interaction, p < 1 × 10−4, LM) from same wild-type flies with 7- and 42-days’ age. B, qPCR quantification of dMaf1 mRNA in female brains after RU486 induction of dMaf1RNAi(V109142) under Elav-GSTricoire (n = 4 biologically independent samples, p < 1 × 10−4, Student t test). C, D, The second trail of the lifespan assay (−RU486: n = 147/2, +RU486: n = 132/1, p = 8.85 × 10−5, log-rank test), and the third trail (−RU486: n = 154/2, +RU486: n = 132/17, p = 3.65 × 10−7, log-rank test) on flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire. E, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 (−RU486: n = 151/3, +RU486: n = 142/6, p = 6.86 × 10−5, log-rank test). F, Lifespan of females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by nSyb-GS (−RU486: n = 174/0, +RU486: n = 172/2, p = 1.68 × 10−9, log-rank test). G, qPCR quantification of dMaf1 mRNA (n = 4 biologically independent samples, p = 0.0026, Student t test) or H, pre-tRNAs (n = 4 biologically independent samples, genotype effect, p < 1 × 10−4, pre-tRNAs effect, p = 0.2546, genotype-by-pre-tRNAs interaction, p = 0.2546, LM) in female flies expressing dMaf1RNAi(BL64603). I, The first trial of the lifespan assay (−RU486: n = 149/4, +RU486: n = 139/12, p = 2.03 × 10−8, log-rank test), and J, the second trial (−RU486: n = 138/0, +RU486: n = 141/0, p = 7.59 × 10−5, log-rank test) of females with adult-specific, pan-neuronal induction of dMaf1RNAi(BL64603) driven by Elav-GSTricoire. K, Lifespan of males with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) (−RU486: n = 138/9, +RU486: n = 107/41, p = 0.0088, log-rank test) or L, dMaf1RNAi(BL64603) (−RU486: n = 143/12, +RU486: n = 130/19, p = 0.0236, log-rank test) driven by Elav-GSTricoire. M, Lifespan of females with adult-specific, pan-neuronal induction of Elav-GSTricoire(−RU486: n = 140/8, +RU486: n = 151/1, p = 0.1727, log-rank test), N, Elav-GS301(−RU486: n = 114/4, +RU486: n = 122/0, p = 0.5418, log-rank test), or O, nSyb-GS (−RU486: n = 138/2, +RU486: n = 144/0, p = 0.5418, log-rank test) drivers alone. P, Lifespan of females with adult-specific, induction of dMaf1RNAi(V109142) (−RU486: n = 144/4, +RU486: n = 150/3, p = 0.3358, log-rank test) or Q, dMaf1RNAi(BL64603) (−RU486: n = 112/27, +RU486: n = 139/10, p = 0.1786, log-rank test) alone. R, Survival of female flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire under H2O2 stress (−RU486: n = 150/0, +RU486: n = 150/0, p = 5.81 × 10−9, log-rank test). S, Survival of female flies with adult-specific, pan-neuronal induction of Elav-GSTricoire driver-alone control under H2O2 stress (−RU486: n = 90/0, +RU486: n = 90/0, p = 0.5327, log-rank test). T, Lifespan of females with adult-specific, induction of dMaf1RNAi(V109142) in Dilp2 producing cells driven by Dilp2-GS (−RU486: n = 147/2, +RU486: n = 151/1, p = 0.2359, log-rank test). U, Volume of food consumed by flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GSTricoire (n = 15 individual flies, RU486 effect on day 1, p = 0.6518, RU486 effect on day 2, p = 0.8412, Student t test) or driver alone (n = 15 individual flies, RU486 effect on day 1, p = 0.9999, RU486 effect on day 2, p = 0.8273, Student t test). V, Egg laying of females within 24 h at day-7 combined with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) under Elav-GSTricoire-driven (n = 10 biologically independent samples, RU486 effect p = 0.1972, Student t test) or driver alone (n = 6 biologically independent samples, RU486 effect p = 0.2512, Student t test). W, Lifespan of females with adult-specific induction of dMaf1RNAi(V109142) in fat body and gut driven by S1106-GS (−RU486: n = 147/3, +RU486: n = 133/4, p = 0.2929, log-rank test). X, Lifespan of females with adult-specific induction of dMaf1RNAi(V109142) in intestinal stem cells driven by 5961-GS (−RU486: n = 140/10, +RU486: n = 141/12, p = 0.6641, log-rank test). Y, Lifespan of females with adult-specific induction of dMaf1RNAi(V109142) in enterocytes driven by 5966-GS (−RU486: n = 148/0, +RU486: n = 123/9, p = 0.2752, log-rank test). Z, qPCR quantifications of pre-tRNAs normalized by Actin5C mRNA in female brains with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 (n = 12 biologically independent samples, RU486 effect, p = 0.0210, pre-tRNAs effect, p = 0.8660, genotype-by-pre-tRNAs interaction, p = 0.8660, LM),or guts with adult-specific, whole gut induction of dMaf1RNAi(V109142) driven by Ti-GS (n = 6 biologically independent samples, RU486 effect, p < 0.0001, pre-tRNAs effect, p = 0.0229, genotype-by-pre-tRNAs interaction, p = 0.0229, LM), or fat bodies with adult-specific, fat body induction of dMaf1RNAi(V109142) driven by S1106-GS (n = 6 biologically independent samples, RU486 effect, p < 0.0001, pre-tRNAs effect, p = 0.7633, genotype-by-pre-tRNAs interaction, p = 0.7633, LM) at day 14. Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.s002

(TIF)

S3 Fig. ElavGS is active in neurons, and dMaf1 is expressed at low levels within glia.

A, Images from the cell body layer of the central brain show ElavGS + RU486 induced nls-GFP expression in REPO-negative (neuronal) cells. B, Images from the SCope database of adult Drosophila brain reveal dMaf1 mRNA is highly expressed within neurons but lowly within glia.

https://doi.org/10.1371/journal.pbio.3003250.s003

(TIF)

S4 Fig. The effects of an independent dMaf1 RNAi line on health.

A, Height climbed during negative geotaxis assays by female flies with a later-life (from day 21), pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 (n = 50–60 flies, RU486 effect, p = 0.0011, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.4625, LM). B, Height climbed during negative geotaxis assays by females with adult-specific, pan-neuronal induction of Elav-GSTricoire driver alone (n = 43–69 flies, RU486 effect, p = 0.2044, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.9495, LM), and C, later-life (from day 21), pan-neuronal induction of Elav-GS301 driver alone (n = 43–69 flies, RU486 effect, p = 0.1536, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.1020, LM). D, Quantification of day activity (n = 32 individual flies, RU486 effect p = 0.0788, Student t test), E, night activity (n = 32 individual flies, RU486 effect, p = 0.1911, Student t test), F, day sleep (n = 32 individual flies, RU486 effect, p = 0.1201, Student t test), and G, day bouts (n = 32 individual flies, RU486 effect, p = 0.6826, Student t test) of female flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301. H, Quantification of night sleep (n = 32 individual flies, RU486 effect, p = 0.3018, Student t test) and I, night bouts (n = 32 individual flies, RU486 effect, p = 0.6056, Student t test) of female flies carrying Elav-GS301 driver alone. J, Cumulative proportion of partial and complete smurfs in female flies with carrying Elav-GSTricoire driver alone (n = 170–340 flies, RU486 effect, p = 0.8758, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.9229, ordinal logistic regression). K, Height climbed during negative geotaxis assays by female flies with adult-specific, pan-neuronal induction of dMaf1RNAi (BL64603) driven by Elav-GSTricoire (n = 32–72 flies, RU486 effect, p = 3 × 10−4, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.0413, LM). L, Cumulative proportion of partial and complete smurfs of females with adult-specific, pan-neuronal induction of dMaf1RNAi (BL64603) driven by Elav-GSTricoire (n = 167–400 flies, RU486 effect, p = 0.0117, age effect, p < 1 × 10−4, RU486-by-age interaction, p = 0.1310, ordinal logistic regression). Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.s004

(TIF)

S5 Fig. Loss of neuronal Pol III transcription does not affect lifespan, and gut 5S rRNA or brain dMaf1 levels do not change during aging, with decreased Pol III subunits levels within aged brains.

A, Lifespan of females with adult-specific, pan-neuronal induction of Polr3ARNAi driven by Elav-GSTricoire (−RU486: n = 88/1, +RU486: n = 92/0, p = 0.0606, log-rank test). B, Lifespan of females with adult-specific, pan-neuronal induction of GTF3C3RNAi driven by Elav-GS301 (−RU486: n = 134/9, +RU486: n = 143/0, p = 0.3147, log-rank test). C, Lifespan of females with adult-specific, pan-neuronal induction of GTF3ARNAi driven by Elav-GS301 (−RU486: n = 112/0, +RU486: n = 120/0, p = 0.3708, log-rank test). D, Lifespan of females with adult-specific, pan-neuronal induction of Pbp95RNAi driven by Elav-GS301 (−RU486: n = 147/0, +RU486: n = 146/4, p = 0.2031, log-rank test). E, qPCR quantifications of Polr3A mRNA normalized to Actin5C (n = 4 biologically independent samples, p = 0.0001, Student t test). F, qPCR quantifications of GTF3C3 mRNA normalized to Actin5C (n = 4 biologically independent samples, p = 0.0037, Student t test). G, qPCR quantifications of GTF3A mRNA normalized to Actin5C (n = 4 biologically independent samples, p = 0.0096, Student t test). H, qPCR quantifications of Pbp95 mRNA normalized to Actin5C (n = 4 biologically independent samples, p = 0.0004, Student t test). E–H mRNA was obtained from 3-day old larvae of the indicated genotype. I, Percentage of adults emerged after driving Polr3A, GTF3C3, GTF3A, Pbp95, or RpS5a RNAi with Da-gal4 compared to driver alone. J, qPCR quantifications of 5S rRNA normalized to total DNA (n = 4 biologically independent samples, p = 0.0018, Student t test) on 3-day old larvae of the indicated genotype. K, qPCR quantifications of 5S rRNA in female brains normalized to Actin5C mRNA (n = 6 biologically independent samples, age effect, p < 1 × 10−4, Student t test) and L, guts normalized either to total DNA (n = 6 biologically independent samples, age effect, p = 0.5137, Student t test) or M, Actin5C (n = 6 biologically independent samples, age effect, p = 0.5137, Student t test) from same wild-type flies. N, qPCR quantifications of dMaf1 in female brains normalized to Actin5C mRNA (n = 6 biologically independent samples, age effect, p = 0.1722, Student t test). O, qPCR quantifications of Polr3D and Polr3A in female brains normalized to Actin5C mRNA (n = 6 biologically independent samples, age effect, p < 1 × 10−4, Pol III subunits effect, p = 0.1848, age-by-pre-tRNAs interaction, p = 0.1848, LM). P, qPCR quantification of 5S rRNA in brains normalized to Actin5C mRNA in 7-day old (n = 14 biologically independent samples, RU486 effect, p = 0.0212, Student t test) and 42-day old (n = 8 biologically independent samples, RU486 effect, p = 0.0493, Student t test) females with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301. Q, qPCR quantification of 5S rRNA in brains normalized to total DNA in 42-day old females with adult-specific, pan-neuronal induction of GTF3ARNAi driven by Elav-GS301 (n = 5−6 biologically independent samples, RU486 effect, p = 0.0036, Student t test). R, qPCR quantification of 5S rRNA in female brains at 42 days after dMaf1RNAi(V109142) was induced alone or with GTF3ARNAi by Elav-GS301, relative to total Actin5C (n = 5−6 biologically independent samples, genotype effect p = 0.0011, RU486 effect p = 0.0085, genotype-by-RU486 interaction p = 3 × 10−4, LM). Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.s005

(TIF)

S6 Fig. Loss of neuronal dMaf1 stimulates translation.

A, Ponceau S staining and western blots quantifying puromycin incorporation in female brains of wild-type flies at days 7 and 42. B, Ponceau S staining and western blots of puromycin incorporation in female brains of flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 at days 7 and 42. In B, flies of different ages were assayed at the same time.

https://doi.org/10.1371/journal.pbio.3003250.s006

(TIF)

S7 Fig. Loss of neuronal dMaf1 stimulates translation and loss of neuronal RpS5a does not affect lifespan.

A, Ponceau S staining and western blots quantifying puromycin incorporation in female brains of flies with adult-specific, pan-neuronal induction of dMaf1RNAi(V109142) driven by Elav-GS301 at days 7 and 42. The same cohort of flies was followed though time. B, Quantification of puromycin incorporation at 7 days (n = 4 biologically independent samples, p = 0.0015, Student t test). C, Quantification of puromycin incorporation at 42 days age (n = 4 biologically independent samples, p = 5 × 10−4, Student t test). D, Lifespan of females with adult-specific, pan-neuronal induction of RpS5aRNAi driven by Elav-GS301 (−RU486: n = 148/1, +RU486: n = 145/3, p = 0.4988, log-rank test). E, Images from the cell body layer of the female central brain show lysosomes after RU486 induction of dMaf1RNAi(V109142) under Elav-GS301 (n = 12 biologically independent samples, p < 1 × 10−4, Student t test). F, qPCR quantification of dMaf1 mRNA in female heads after RU486 induction of 36R under Elav-GSTricoire (n = 4 biologically independent samples, p = 0.0168, Student t test). Data underlying the graphs in this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3003250.s007

(TIF)

S1 Data. Excel file that contains data underlying all graphs.

https://doi.org/10.1371/journal.pbio.3003250.s008

(XLSX)

S1 Raw Images. Raw, uncropped images of western blot membranes.

https://doi.org/10.1371/journal.pbio.3003250.s009

(PDF)

Acknowledgments

We thank B. Edgar, N. S. Woodling, and T. Niccoli for providing fly stocks; A. Giblin and M. Li for technical assistance; S. Anoar and T. Niccoli for RNA samples (36R heads); J. Labbadia for comments on the manuscript; and the other IHA members for support, comments, and discussion throughout this project. Stocks obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537) were used in this study, and some RNAi lines were made by the TRiP project (Office of the Director R24 OD030002: “TRiP resources for modeling human disease”, PI: N. Perrimon). Additional RNAi lines were obtained from the Vienna Drosophila Resource Center.

References

  1. 1. Partridge L, Deelen J, Slagboom PE. Facing up to the global challenges of ageing. Nature. 2018;561(7721):45–56. pmid:30185958
  2. 2. Ward WF. The relentless effects of the aging process on protein turnover. Biogerontology. 2000;1(3):195–9. pmid:11707896
  3. 3. Schimanski. Neural protein synthesis during aging: effects on plasticity and memory. Fronti Aging Neurosci. 2010.
  4. 4. Kim HS, Pickering AM. Protein translation paradox: implications in translational regulation of aging. Front Cell Dev Biol. 2023;11:1129281. pmid:36711035
  5. 5. Kim HS, Parker DJ, Hardiman MM, Munkácsy E, Jiang N, Rogers AN, et al. Early-adulthood spike in protein translation drives aging via juvenile hormone/germline signaling. Nat Commun. 2023;14(1):5021. pmid:37596266
  6. 6. Holt CE, Martin KC, Schuman EM. Local translation in neurons: visualization and function. Nat Struct Mol Biol. 2019;26(7):557–66. pmid:31270476
  7. 7. Perrone-Capano C, Volpicelli F, Penna E, Chun JT, Crispino M. Presynaptic protein synthesis and brain plasticity: from physiology to neuropathology. Prog Neurobiol. 2021;202:102051. pmid:33845165
  8. 8. Kennedy BK, Kaeberlein M. Hot topics in aging research: protein translation, 2009. Aging Cell. 2009;8(6):617–23. pmid:19747234
  9. 9. Steffen KK, Dillin A. A ribosomal perspective on proteostasis and aging. Cell Metab. 2016;23(6):1004–12. pmid:27304502
  10. 10. Filer D, Thompson MA, Takhaveev V, Dobson AJ, Kotronaki I, Green JWM, et al. RNA polymerase III limits longevity downstream of TORC1. Nature. 2017;552(7684):263–7. pmid:29186112
  11. 11. Martínez Corrales G, Filer D, Wenz KC, Rogan A, Phillips G, Li M, et al. Partial inhibition of RNA polymerase I promotes animal health and longevity. Cell Rep. 2020;30(6):1661-1669.e4. pmid:32049000
  12. 12. Selman C, Tullet JMA, Wieser D, Irvine E, Lingard SJ, Choudhury AI, et al. Ribosomal protein S6 kinase 1 signaling regulates mammalian life span. Science. 2009;326(5949):140–4. pmid:19797661
  13. 13. Javidnia S, Cranwell S, Mueller SH, Selman C, Tullet JMA, Kuchenbaecker K, et al. Mendelian randomization analyses implicate biogenesis of translation machinery in human aging. Genome Res. 2022;32(2):258–65. pmid:35078808
  14. 14. Martinez-Miguel VE, Lujan C, Espie-Caullet T, Martinez-Martinez D, Moore S, Backes C, et al. Increased fidelity of protein synthesis extends lifespan. Cell Metab. 2021;33(11):2288-2300.e12. pmid:34525330
  15. 15. Willis IM. Maf1 phenotypes and cell physiology. Biochim Biophys Acta Gene Regul Mech. 2018;1861(4):330–7. pmid:29248739
  16. 16. Vannini A, Cramer P. Conservation between the RNA polymerase I, II, and III transcription initiation machineries. Mol Cell. 2012;45(4):439–46. pmid:22365827
  17. 17. Kessler AC, Maraia RJ. The nuclear and cytoplasmic activities of RNA polymerase III, and an evolving transcriptome for surveillance. Nucleic Acids Res. 2021;49(21):12017–34. pmid:34850129
  18. 18. Girbig M, Misiaszek AD, Müller CW. Structural insights into nuclear transcription by eukaryotic DNA-dependent RNA polymerases. Nat Rev Mol Cell Biol. 2022;23(9):603–22. pmid:35505252
  19. 19. Upadhya R, Lee J, Willis IM. Maf1 is an essential mediator of diverse signals that repress RNA polymerase III transcription. Mol Cell. 2002;10(6):1489–94. pmid:12504022
  20. 20. Zhang S, Li X, Wang H-Y, Steven Zheng XF. Beyond regulation of pol III: Role of MAF1 in growth, metabolism, aging and cancer. Biochim Biophys Acta Gene Regul Mech. 2018;1861(4):338–43. pmid:29407795
  21. 21. Rideout EJ, Marshall L, Grewal SS. Drosophila RNA polymerase III repressor Maf1 controls body size and developmental timing by modulating tRNAiMet synthesis and systemic insulin signaling. Proc Natl Acad Sci U S A. 2012;109(4):1139–44. pmid:22228302
  22. 22. Bonhoure N, Byrnes A, Moir RD, Hodroj W, Preitner F, Praz V, et al. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance. Genes Dev. 2015;29(9):934–47. pmid:25934505
  23. 23. Willis IM, Moir RD, Hernandez N. Metabolic programming a lean phenotype by deregulation of RNA polymerase III. Proc Natl Acad Sci U S A. 2018;115(48):12182–7. pmid:30429315
  24. 24. Bonhoure N, Praz V, Moir RD, Willemin G, Mange F, Moret C, et al. MAF1 is a chronic repressor of RNA polymerase III transcription in the mouse. Sci Rep. 2020;10(1):11956. pmid:32686713
  25. 25. Chen C-Y, Lanz RB, Walkey CJ, Chang W-H, Lu W, Johnson DL. Maf1 and repression of RNA polymerase III-mediated transcription drive adipocyte differentiation. Cell Rep. 2018;24(7):1852–64. pmid:30110641
  26. 26. Phillips E, Ahmad N, Sun L, Iben J, Walkey CJ, Rusin A, et al. MAF1, a repressor of RNA polymerase III-dependent transcription, regulates bone mass. Elife. 2022;11:e74740. pmid:35611941
  27. 27. Sun Y, Chen C, Xue R, Wang Y, Dong B, Li J, et al. Maf1 ameliorates cardiac hypertrophy by inhibiting RNA polymerase III through ERK1/2. Theranostics. 2019;9(24):7268–81. pmid:31695767
  28. 28. Chen K, Zhu L, Guo L, Pan Y-B, Feng D-F. Maf1 regulates dendritic morphogenesis and influences learning and memory. Cell Death Dis. 2020;11(7):606. pmid:32732865
  29. 29. Chen D, Sun Y-Y, Zhou L-Y, Yang S, Hong F-Y, Liu X-D, et al. Maf1 regulates axonal regeneration of retinal ganglion cells after injury. Exp Neurol. 2022;348:113948. pmid:34902358
  30. 30. Tsang CK, Mi Q, Su G, Hwa Lee G, Xie X, D’Arcangelo G, et al. Maf1 is an intrinsic suppressor against spontaneous neural repair and functional recovery after ischemic stroke. J Adv Res. 2023;51:73–90. pmid:36402285
  31. 31. Cai Y, Wei Y-H. Stress resistance and lifespan are increased in C. elegans but decreased in S. cerevisiae by mafr-1/maf1 deletion. Oncotarget. 2016;7(10):10812–26. pmid:26934328
  32. 32. Regan JC, Khericha M, Dobson AJ, Bolukbasi E, Rattanavirotkul N, Partridge L. Sex difference in pathology of the ageing gut mediates the greater response of female lifespan to dietary restriction. Elife. 2016;5:e10956. pmid:26878754
  33. 33. Regan JC, Lu Y-X, Ureña E, Meilenbrock RL, Catterson JH, Kißler D, et al. Sexual identity of enterocytes regulates autophagy to determine intestinal health, lifespan and responses to rapamycin. Nat Aging. 2022;2(12):1145–58. pmid:37118538
  34. 34. Sriskanthadevan-Pirahas S, Deshpande R, Lee B, Grewal SS. Ras/ERK-signalling promotes tRNA synthesis and growth via the RNA polymerase III repressor Maf1 in Drosophila. PLoS Genet. 2018;14(2):e1007202. pmid:29401457
  35. 35. Al Saud SN, Summerfield AC, Alic N. Ablation of insulin-producing cells prevents obesity but not premature mortality caused by a high-sugar diet in Drosophila. Proc Biol Sci. 2015;282(1800):20141720. pmid:25520354
  36. 36. Kulaberoglu Y, Malik Y, Borland G, Selman C, Alic N, Tullet JMA. RNA polymerase III, ageing and longevity. Front Genet. 2021;12:705122. pmid:34295356
  37. 37. Li H, Janssens J, De Waegeneer M, Kolluru SS, Davie K, Gardeux V, et al. Fly cell atlas: a single-nucleus transcriptomic atlas of the adult fruit fly. Science. 2022;375(6584):eabk2432. pmid:35239393
  38. 38. Davie K, Janssens J, Koldere D, De Waegeneer M, Pech U, Kreft Ł, et al. A single-cell transcriptome atlas of the aging Drosophila brain. Cell. 2018;174(4):982-998.e20. pmid:29909982
  39. 39. Broughton SJ, Slack C, Alic N, Metaxakis A, Bass TM, Driege Y, et al. DILP-producing median neurosecretory cells in the Drosophila brain mediate the response of lifespan to nutrition. Aging Cell. 2010;9(3):336–46. pmid:20156206
  40. 40. Robinow S, White K. The locus elav of Drosophila melanogaster is expressed in neurons at all developmental stages. Dev Biol. 1988;126(2):294–303. pmid:3127258
  41. 41. Riabinina O, Luginbuhl D, Marr E, Liu S, Wu MN, Luo L, et al. Improved and expanded Q-system reagents for genetic manipulations. Nat Methods. 2015;12(3):219–22, 5 p following 222. pmid:25581800
  42. 42. Janssens J, Aibar S, Taskiran II, Ismail JN, Gomez AE, Aughey G, et al. Decoding gene regulation in the fly brain. Nature. 2022;601(7894):630–6. pmid:34987221
  43. 43. Metaxakis A, Tain LS, Grönke S, Hendrich O, Hinze Y, Birras U, et al. Lowered insulin signalling ameliorates age-related sleep fragmentation in Drosophila. PLoS Biol. 2014;12(4):e1001824. pmid:24690889
  44. 44. Schaum N, Lehallier B, Hahn O, Pálovics R, Hosseinzadeh S, Lee SE, et al. Ageing hallmarks exhibit organ-specific temporal signatures. Nature. 2020;583(7817):596–602. pmid:32669715
  45. 45. Marygold SJ, Alic N, Gilmour DS, Grewal SS. In silico identification of Drosophila melanogaster genes encoding RNA polymerase subunits. MicroPubl Biol. 2020;2020:10.17912/micropub.biology.000320. pmid:33274328
  46. 46. Yeganeh M, Hernandez N. RNA polymerase III transcription as a disease factor. Genes Dev. 2020;34(13–14):865–82. pmid:32611613
  47. 47. Ciganda M, Williams N. Eukaryotic 5S rRNA biogenesis. Wiley Interdiscip Rev RNA. 2011;2(4):523–33. pmid:21957041
  48. 48. Balendra R, Isaacs AM. C9orf72-mediated ALS and FTD: multiple pathways to disease. Nat Rev Neurol. 2018;14(9):544–58. pmid:30120348
  49. 49. Moens TG, Niccoli T, Wilson KM, Atilano ML, Birsa N, Gittings LM, et al. C9orf72 arginine-rich dipeptide proteins interact with ribosomal proteins in vivo to induce a toxic translational arrest that is rescued by eIF1A. Acta Neuropathol. 2019;137(3):487–500. pmid:30604225
  50. 50. D’Aquila P, Montesanto A, Mandalà M, Garasto S, Mari V, Corsonello A, et al. Methylation of the ribosomal RNA gene promoter is associated with aging and age-related decline. Aging Cell. 2017;16(5):966–75. pmid:28625020
  51. 51. Anisimova AS, Meerson MB, Gerashchenko MV, Kulakovskiy IV, Dmitriev SE, Gladyshev VN. Multifaceted deregulation of gene expression and protein synthesis with age. Proc Natl Acad Sci U S A. 2020;117(27):15581–90. pmid:32576685
  52. 52. Skariah G, Todd PK. Translational control in aging and neurodegeneration. Wiley Interdiscip Rev RNA. 2021;12(4):e1628. pmid:32954679
  53. 53. Kluever V, Russo B, Mandad S, Kumar NH, Alevra M, Ori A, et al. Protein lifetimes in aged brains reveal a proteostatic adaptation linking physiological aging to neurodegeneration. Sci Adv. 2022;8(20):eabn4437. pmid:35594347
  54. 54. Labbadia J, Morimoto RI. The biology of proteostasis in aging and disease. Annu Rev Biochem. 2015;84:435–64. pmid:25784053
  55. 55. Steffen KK, MacKay VL, Kerr EO, Tsuchiya M, Hu D, Fox LA, et al. Yeast life span extension by depletion of 60s ribosomal subunits is mediated by Gcn4. Cell. 2008;133(2):292–302. pmid:18423200
  56. 56. Steffen KK, McCormick MA, Pham KM, MacKay VL, Delaney JR, Murakami CJ, et al. Ribosome deficiency protects against ER stress in Saccharomyces cerevisiae. Genetics. 2012;191(1):107–18. pmid:22377630
  57. 57. Howard AC, Rollins J, Snow S, Castor S, Rogers AN. Reducing translation through eIF4G/IFG-1 improves survival under ER stress that depends on heat shock factor HSF-1 in Caenorhabditis elegans. Aging Cell. 2016;15(6):1027–38. pmid:27538368
  58. 58. Statzer C, Meng J, Venz R, Bland M, Robida-Stubbs S, Patel K, et al. ATF-4 and hydrogen sulfide signalling mediate longevity in response to inhibition of translation or mTORC1. Nat Commun. 2022;13(1):967. pmid:35181679
  59. 59. Maitra N, He C, Blank HM, Tsuchiya M, Schilling B, Kaeberlein M, et al. Translational control of one-carbon metabolism underpins ribosomal protein phenotypes in cell division and longevity. Elife. 2020;9:e53127. pmid:32432546
  60. 60. Malik Y, Kulaberoglu Y, Anver S, Javidnia S, Borland G, Rivera R, et al. Disruption of tRNA biogenesis enhances proteostatic resilience, improves later-life health, and promotes longevity. PLoS Biol. 2024;22(10):e3002853. pmid:39436952
  61. 61. López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G. The hallmarks of aging. Cell. 2013;153(6):1194–217. pmid:23746838
  62. 62. López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G. Hallmarks of aging: an expanding universe. Cell. 2023;186(2):243–78. pmid:36599349
  63. 63. Stein KC, Morales-Polanco F, van der Lienden J, Rainbolt TK, Frydman J. Ageing exacerbates ribosome pausing to disrupt cotranslational proteostasis. Nature. 2022;601(7894):637–42. pmid:35046576
  64. 64. Bass TM, Grandison RC, Wong R, Martinez P, Partridge L, Piper MDW. Optimization of dietary restriction protocols in Drosophila. J Gerontol A Biol Sci Med Sci. 2007;62(10):1071–81. pmid:17921418
  65. 65. Piper MDW, Partridge L. Protocols to study aging in Drosophila. Methods Mol Biol. 2016;1478:291–302. pmid:27730590
  66. 66. Terry MT. A package for survival analysis in R. 2023.
    • 67. Terry MT, Patricia MG. Modeling survival data: extending the Cox model. Springer. 2000.
      • 68. Team RC R. R: A language and environment for statistical computing. 2023.
        • 69. Chen K-F, Lowe S, Lamaze A, Krätschmer P, Jepson J. Neurocalcin regulates nighttime sleep and arousal in Drosophila. Elife. 2019;8:e38114. pmid:30865587