Skip to main content
Advertisement
  • Loading metrics

Piezo1-mediated spontaneous calcium transients in satellite glia impact dorsal root ganglia development

  • Jacob P. Brandt,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliations Department of Biological Sciences, University of Notre Dame, Notre Dame, Indiana, United States of America, The Center for Stem Cells and Regenerative Medicine, University of Notre Dame, Notre Dame, Indiana, United States of America

  • Cody J. Smith

    Roles Funding acquisition, Project administration, Supervision, Writing – original draft, Writing – review & editing

    csmith67@nd.edu

    Affiliations Department of Biological Sciences, University of Notre Dame, Notre Dame, Indiana, United States of America, The Center for Stem Cells and Regenerative Medicine, University of Notre Dame, Notre Dame, Indiana, United States of America

Abstract

Spontaneous Ca2+ transients of neural cells is a hallmark of the developing nervous system. It is widely accepted that chemical signals, like neurotransmitters, contribute to spontaneous Ca2+ transients in the nervous system. Here, we reveal an additional mechanism of spontaneous Ca2+ transients that is mechanosensitive in the peripheral nervous system (PNS) using intravital imaging of growing dorsal root ganglia (DRG) in zebrafish embryos. GCaMP6s imaging shows that developing DRG satellite glia contain distinct spontaneous Ca2+ transients, classified into simultaneous, isolated, and microdomains. Longitudinal analysis over days in development demonstrates that as DRG satellite glia become more synchronized, isolated Ca2+ transients remain constant. Using a chemical screen, we identify that Ca2+ transients in DRG glia are dependent on mechanical properties, which we confirmed using an experimental application of mechanical force. We find that isolated spontaneous Ca2+ transients of the glia during development is altered by manipulation of mechanosensitive protein Piezo1, which is expressed in the developing ganglia. In contrast, simultaneous Ca2+ transients of DRG satellite glia is not Piezo1-mediated, thus demonstrating that distinct mechanisms mediate subtypes of spontaneous Ca2+ transients. Activating Piezo1 eventually impacts the cell abundance of DRG cells and behaviors that are driven by DRG neurons. Together, our results reveal mechanistically distinct subtypes of Ca2+ transients in satellite glia and introduce mechanobiology as a critical component of spontaneous Ca2+ transients in the developing PNS.

Introduction

It is widely accepted that spontaneous activity is a critical feature of the developing nervous system [13]. This activity has been visualized by measuring Ca2+ transients. For years, such spontaneous Ca2+ transients have been investigated in neurons and are identified as neuronal firing or activity, but recent studies have also revealed an important role for spontaneous Ca2+ transients in glia. These glial Ca2+ transients can be in response to neuronal activity or independent of neuronal activity and can be characterized into distinct subtypes [47]. For example, glial cells exhibit whole cell and microdomain Ca2+ transients, which are mechanistically and functionally distinct [810]. Glial cells can also exhibit synchronous Ca2+ transients in physically connected networks [11,12]. Regardless of Ca2+ transient subtype and unique from neurons, immature glia and their progenitors also proliferate throughout life [13]. How glial Ca2+ transients, proliferation, and physically connected networks are related or regulated, remains largely unexplored. The importance of these concepts is underscored by the prevalence of such processes during normal brain development and in gliomas [4,5,1416]. If glial Ca2+ transients are critical for nervous system function, we need more investigation into how distinct Ca2+ transients change over development, whether different molecular components control distinct transient subtypes, and if distinct Ca2+ transients are linked to proliferation and/or network formation. Lastly, these concepts need to be explored in both the central nervous system and peripheral nervous system (PNS).

What we do know is that spontaneous Ca2+ transients in the nervous system have largely been characterized as dependent on chemical signals. In neurons, Ca2+ spontaneous activity is promoted by neurotransmitters and their receptors [17,18]. Similarly, glutamate and NMDA drive spontaneous Ca2+ transients of glial cells like oligodendrocytes and astrocytes [1922]. We also know chemical signals like ATP can induce purinergic receptors to drive Ca2+ changes in glia, akin to activity of the glia [2325]. Each of these chemical signals causes changes to ion channels that drive spontaneous Ca2+ transients. However, in addition to ion channels that are induced by chemical signals, mechanosensitive ion channels are also present in the nervous system [26,27]. For example, Piezo proteins are mechanosensitive channels that are expressed in the nervous system [26,28,29]. These mechanosensitive channels are essential for evoking a subset of peripheral sensory neurons in response to mechanical stimulation [30,31]. Peripheral mechanosensitive glia are also present at the skin to ensure response to mechanical stimuli [32]. However, the role of mechanosensitive properties in the development of glia is less understood, especially in peripheral glia. This is despite knowledge that mechanical components can have profound effects on cell differentiation and tissue organization and that Trp channels, some of which are at least partially mechanosensitive, are important for Ca2+ transients in glia like astrocytes [4,8,29,3336].

Here, we use imaging of GCaMP6s in satellite glia of the dorsal root ganglia (DRG) in zebrafish as a model to investigate the role of glial activity in the developing PNS. The DRG is required for somatosensory stimuli in the PNS and contains somatosensory neurons and satellite glia that ensheath those neurons. We identify that satellite glia display at least 3 types (microdomain, isolated, and simultaneous) of spontaneous Ca2+ transients in early phases of development. By mapping the GCaMP6s events, we identify that the DRG transitioned to synchronized Ca2+ transients early in development, demonstrating the formation of glial networks within the first 3 days of DRG construction. In a pilot screen and follow-up experimental manipulations, we identify mechanosensitive ion channel Piezo1 as a modulator of the isolated Ca2+ transients of satellite glia in development and identify that these satellite glia are mechanosensitive. Perturbation of Piezo1 causes not only changes in isolated Ca2+ transients of DRG satellite glia but also in their expansion and function, demonstrating a potential consequence to altering isolated glial Ca2+ transients during development. Together, we introduce the role of mechanosensitive ion channels in the spontaneous Ca2+ transients of the developing PNS.

Results

DRG satellite glia exhibit distinct Ca2+ transients

To understand if DRG satellite glia display spontaneous Ca2+ transients, we first explored the Ca2+ transients of DRG cells in intact ganglia using intravital imaging in zebrafish. To do this, we imaged transgenic animals expressing GCaMP6s in distinct DRG cell populations. It is known that the DRG has both a population of neurons and satellite glia. To image both of these populations, we used animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP). Cells expressing RFP were identified as neurons, while the glial population expressed GCaMP6s with the absence of RFP (Fig 1A). To further confirm that these sox10+ neurod- cells were satellite glia, we investigated the morphology of these cells (S1A and S1B Fig). Using these triple transgenics and identifying morphological features of DRG cells, we found that both neurons and glia that ensheathed those neurons were present in the DRG during the developmental window examined. We define satellite glia in this report as sox10+ neurod- cells located in the DRG with ensheathing phenotypes [37,38]. In addition to these transgenics, we also imaged neurons in the DRG using Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s), which uses regulatory sequences of neurod that are expressed in DRG neurons. This allowed for another approach in which we only investigate the neuronal population. We imaged 3 dpf (days post fertilization) animals expressing GCaMP6s at a 15-s interval for 1 h, which allowed us to capture a 3D view of 3–4 DRG. To define a Ca2+ transient event in a cell, we calculated the z score of the integrated density of fluorescence of each individual cell during that 1-h time period. Time points with a z score greater than 2.58 (represents 99% confidence interval) were considered Ca2+ transient event-containing time points. If a Ca2+ transient event lasted for consecutive time points, it was still considered one Ca2+ transient event. Scoring of the z score of GCaMP6s integral density of fluorescence over the 1-h period revealed that all DRG displayed cells with spontaneous Ca2+ transients, with remarkable activity in satellite glia (Fig 1B and 1C). Within individual DRG, satellite glia displayed on average 3.600 ± 1.78 Ca2+ transient events in a 1-h period (n = 25 cells, 14 DRG, 5 animals) (S2A Fig). We also measured 2.364 ± 1.12 Ca2+ transient events in the neuronal population in a 1-h period (n = 11 cells, 9 DRG, 4 animals) (S2A Fig), indicating that both neurons and glia display Ca2+ transients during DRG construction. Ca2+ transients can be quick in cells, so it is possible that a 15-s imaging interval underrepresented the number of Ca2+ transients. To address this, we imaged smaller z-stacks but with short time intervals of 5 s. These results revealed that Ca2+ transients in sox10+ cells lasted on average 2.21 time points using 5-s imaging intervals and therefore were generally captured with 15-s intervals (n = 412 Ca2+ transient events, 97 cells, 20 DRG, 5 animals) (S2B Fig). We therefore utilized 15-s imaging intervals throughout this manuscript, allowing us to image z-stacks that covered the entire DRG at each time point. With the lack of knowledge about glial activity in the DRG, we further investigated the developmental, molecular, and functional features of Ca2+ transients in sox10+ satellite glia.

thumbnail
Fig 1. DRG exhibit distinct calcium activity and increase synchronous activity.

(A) Confocal z-projections of DRG in a 3 dpf animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP). Arrow notes satellite glia and asterisk notes neuron. (B) Confocal z-projections of DRG in a 3 dpf animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). Images presented as heated scale (reds-more activity, blues-less activity). (C) Line graphs depicting z scores of integrated density of fluorescence for individual cells expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) over a 1-h period. A z score greater than 2.58 indicates a Ca2+ transient event. Red scale bar is a z score of 2.58. (D) Confocal z-projection of DRG in 3 dpf animal expressing Tg(sox10:gal4+myl7); uas:GCaMP6s-caax. Red colors indicate a higher intensity of fluorescence and blue colors indicate a lower intensity of fluorescence. Arrows indicate active Ca2+ microdomains. (E) Line graphs depicting z scores of integrated density of fluorescence for Ca2+ microdomains in 3 dpf animals expressing Tg(sox10:gal4+myl7); uas:GcaMP6s-caax over a 10-min period. A z score greater than 2.58 indicates an active Ca2+ event. Red scale bar is a z score of 2.58. (F) Confocal z-projection of DRG in a 3 dpf animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). Left image depicts an isolated Ca2+ event and the right image depicts a simultaneous Ca2+ event. Arrows indicate active cells. (G) Average number of isolated Ca2+ transient events per sox10+ cell at 2, 3, and 4 dpf in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) (2 dpf: n = 6 animals, 10 DRG, 46 cells, 3 dpf: n = 4 animals, 6 DRG, 27 cells, 4 dpf: n = 4 animals, 7 DRG, 34 cells). (H) Average number of simultaneous Ca2+ transient events per sox10+ cell at 2, 3, and 4 dpf in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) (2 dpf: n = 6 animals, 10 DRG, 46 cells, 3 dpf: n = 4 animals, 6 DRG, 27 cells, 4 dpf: n = 4 animals, 7 DRG, 34 cells). (I) Average number of seconds for Ca2+ microdomains duration in 3 dpf animals (n = 7 animals, 8 DRG, 15 microdomains). (J) Average volume (μM3) of Ca2+ microdomains in 3 dpf animals (n = 7 animals, 8 DRG, 15 microdomains). (K–M) Three (K) and 4 (L) dpf DRG in an animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). ROIs are traced for individual cells. Line graphs of the z score of the integrated density of fluorescence correspond to the individual ROIs. (M) A corresponding network map for 3 and 4 dpf DRG (K, L) indicates both the number of isolated Ca2+ transient events and the high correlation coefficients present in the DRG. (N) Percent of high correlation coefficient per sox10+ cell in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) at 2, 3, 4 dpf (2 dpf: n = 6 animals, 10 DRG, 50 cells 3 dpf: n = 4 animals, 6 DRG, 27 cells 4 dpf: n = 4 animals, 7 DRG, 34 cells). (O) Immunohistochemistry for Cxn43 in DRG of animals expressing Tg(sox10:meGFP) at 2, 3, 4 dpf. Magenta indicates Tg(sox10:meGFP) and cyan indicates Cxn43. (P) Quantification of the average number of Cxn43 puncta present in DRG at 2, 3, and 4 dpf (2 dpf: n = 6 animals, 18 DRG 3 dpf: n = 10 animals, 29 DRG 4 dpf: n = 8 animals, 24 DRG). (Q) Quantification of the average percent of high correlation coefficients per sox10+ cell following treatment with DMSO or CBX (DMSO: n = 4 animals, 7 DRG, 26 cells CBX: n = 3 animals, 5 DRG, 34 cells). (R) Depiction of targeted cellular processes for molecular screen. (S) Quantification of the average number of Ca2+ events per DRG following pharmacological screen (DMSO: n = 19 animals, 64 DRG, HMR1556: n = 5 animals, 15 DRG Apyrase: n = 5 animals, 15 DRG Thaps: n = 4 animals, 13 DRG, GsMTx4: n = 5 animals, 13 DRG CBX: n = 5 animals, 14 DRG). Scale bar is 10 μM (A, B, D, F, K, L, O). Ca2+ transient events are time points containing a z score of the integrated density of fluorescence greater than 2.58 (C, E, G, H, I, J, K, L). Statistical tests: one-way ANOVA followed and represented by post hoc Tukey test: (I, J, N, P), unpaired Student t tests: (Q), one-way Brown–Forsythe ANOVA followed and represented by post hoc Dunnett test: (S), correlation coefficient test: (M, N, Q). The data underlying this figure can be found in S1 Data. dpf, days post fertilization; DRG, dorsal root ganglia; ROI, regions of interest.

https://doi.org/10.1371/journal.pbio.3002319.g001

Neural cells can exhibit distinct spontaneous Ca2+ transient events. To explore if DRG satellite glia exhibit distinct subtypes of Ca2+ transients, we created activity profiles for each cell in a given DRG from z-score calculations in 1 h movies of Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) 3 dpf animals. Using this data, we could then compare when each individual cell in a DRG was active compared to the other cells in the DRG. We found that individual sox10+ cells displayed Ca2+ transients simultaneously with other sox10+ cells in the DRG (Fig 1F), consistent with previous descriptions of simultaneous Ca2+ transients in glial networks [11,39,40]. However, we also identified a subset of Ca2+ transients that occurred in cells when no neighboring cell is active (Fig 1F). We define these Ca2+ transients in this report as isolated Ca2+ transients.

Calcium microdomains are also known to be present in several glial types [10,34,41]. Therefore, we tested if Ca2+ microdomains are also present in the DRG during development. To do this, we imaged animals expressing a membrane localized GCaMP6s by injecting Tg(sox10:gal4+myl7) embryos with uas:GCaMP6s-caax and imaging at 3 dpf. In order to initially capture and identify these quick dynamic events, we imaged animals for a 10-min period with 5-s intervals capturing the entire DRG. We defined Ca2+ microdomains as small regions with significant changes in integrated density of fluorescence of GCaMP6s-caax (Fig 1D and 1E). We quantified the duration of these microdomains and found that they lasted on average for 11.81+/−9.914 s (n = 15 cells, 8 DRG, 7 animals) (Fig 1I). We also quantified the average volume of these microdomains and found that they were on average 30.10+/−18.51 μM3 (n = 15 cells, 8 DRG, 7 animals) (Fig 1J). Together, these results indicate DRG satellite glia exhibit at least 3 distinct Ca2+ transient events during development: isolated, simultaneous, and microdomains.

Satellite glia cell networks are established during early DRG construction

To understand how these types of activity may change over development, we quantified the average amount of isolated and simultaneous Ca2+ transients events in the same animal at 2, 3, and 4 dpf. While we did not see a significant change in isolated Ca2+ transients over this developmental period (2 dpf: n = 46 cells, 10 DRG, 6 animals, 3 dpf: n = 27 cells, 6 DRG, 4 animals, 4 dpf: n = 34 cells, 7 DRG, 4 animals) (Fig 1G), there was a noted significant increase in the number of simultaneous Ca2+ transient events after 2 dpf (2 dpf versus 3 dpf: p = 0.0019, 2 dpf versus 4 dpf: p = 0.0449 post hoc Tukey test) (2 dpf: n = 46 cells, 10 DRG, 6 animals, 3 dpf: n = 27 cells, 6 DRG, 4 animals, 4 dpf: n = 34 cells, 7 DRG, 4 animals) (Fig 1H). This work indicates distinct developmental properties between isolated and simultaneous subtypes.

Current research proposes that DRG satellite glia form networks in vitro [4244]. To further test if this occurs in vivo and to determine when in development it arises, we measured synchronized networks in sox10+ cells. To identify a synchronized network of cells, we compared the Ca2+ transient profiles of individual cells by computing the correlation between 2 Ca2+ transient profiles. To determine how this changed in development, we quantified the percent of high correlation coefficients (>0.5) per cell in each DRG at 2, 3, and 4 dpf. By creating network maps of individual DRG that show how the activity of each cell is related (Fig 1K–1M), we found that sox10+ cells at 2 dpf had an average of 37.48% ± 32.08% high correlation coefficients (n = 50 cells, 10 DRG, 6 animals). At 3 dpf, we measured that sox10+ cells had an average of 39.33% ± 30.61% high correlation coefficients (n = 27 cells, 6 DRG, 4 animals) and by 4 dpf, sox10+ cells had a significant increase in the percent of high correlation coefficients, with an average of 58.26% ± 32.13% high correlation coefficients (n = 34 cells, 7 DRG, 4 animals) (2 dpf versus 4 dpf: p = 0.0044 post hoc Tukey test, 2 dpf n = 46 cells, 3 dpf n = 27 cells, 4 dpf n = 34 cells) (Fig 1N). Additionally, we observed that the percent of cells displaying Ca2+ transients together increased by 4 dpf (S3A–S3C Fig). These data are consistent with the hypothesis that DRG satellite glial networks are present in vivo and form by at least the third day of DRG construction in zebrafish.

If glial networks are forming, we hypothesized that gap junctions may also increase during the time when synchronized Ca2+ transients are present. Cxn43 is known to be present in satellite glia and contribute to gap junctions in synchronized neural networks [4547]. Therefore, we stained for Cxn43 at 2, 3, and 4 dpf in animals expressing Tg(sox10:meGFP), which labels satellite glia in the DRG with membrane-localized GFP. The 2 dpf DRG had an average of 0.500 ± 0.707 Cxn43 puncta (n = 18 DRG, 6 animals). This increased to an average of 1.000 ± 0.845 Cxn43 puncta per DRG at 3 dpf (n = 29 DRG, 10 animals) and by 4 dpf, there was a significant increase in the number of Cxn43 puncta present in the DRG with an average of 2.208 ± 1.062 Cxn43 puncta per DRG (n = 24 DRG, 8 animals) (2 dpf versus 4 dpf: p < 0.0001, 3 dpf versus 4 dpf: p < 0.0001 post hoc Tukey test) (Fig 1O and 1P). These results support the hypothesis that DRG cells begin forming glial connections during its earliest construction.

To determine if there are functional gap junction connections, we treated animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) with either carbenoxolone (CBX), a gap junction inhibitor, or a control treatment of DMSO. Animals treated with CBX at 3 dpf demonstrated a significant decrease in the percent of high correlation coefficients with an average percent of 22.00% ± 22.34% (n = 34 cells, 5 DRG, 3 animals) compared to an average percent of high correlation coefficients of 36.58% ± 31.22% when treated with a DMSO control (n = 26 cells, 7 DRG, 4 animals) (DMSO versus CBX: p = 0.0391 unpaired t test) (Fig 1Q). These results strongly support the idea that functional gap junctions are present in glial networks in DRG during its early construction.

Satellite glia Ca2+ transients are impacted by altering mechanobiology

Our measurements indicated that DRG satellite glia cells demonstrate distinct Ca2+ transients. To identify potential molecular components involved in these Ca2+ transients, we performed a chemical screen targeting various chemical signals shown to affect Ca2+ transients using transgenic animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) (Fig 1R and 1S). Additionally, we included a broad-mechanosensitive ion channel antagonist, GsMTx4, because of the underappreciated role that mechanobiology has during neurodevelopment. We hypothesized that GsMTx4 would reduce the amount of observed Ca2+ transients if mechanobiology had an important role during early development. Each animal was exposed to the pharmacological agent 30 min prior and during the imaging window and then GCaMP6s intensity was measured for 1 h with a 15-s imaging interval. We reasoned that an overall change in the abundance of Ca2+ transients could help us identify molecules that are important for either isolated or simultaneous spontaneous Ca2+ transients. We found that GsMTx4 significantly reduced the amount of Ca2+ transients observed compared to DMSO (Fig 1S) (DMSO versus GsMTx4: p < 0.0001 post hoc Dunnett test). We also measured a significant change following treatment with Thapsigargin (Thaps) (Fig 1S) (DMSO versus Thaps: p = 0.0010 post hoc Dunnett test). While chemical signaling has been widely described in spontaneous Ca2+ transients, the role of mechanobiology in the process is less known, which led us to investigate the potential role of mechanobiology in spontaneous Ca2+ transients in the DRG.

To first explore the possibility that mechanical features impact spontaneous Ca2+ transients in the DRG, we tested if the cells in the developing DRG are sensitive to mechanical perturbation. To do this, we imaged the DRG of transgenic zebrafish expressing GCaMP6s in satellite glial Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) cells during tissue compression (Fig 2A). Tissue compression was administered by bending the animal with a microneedle as they were imaged on the confocal microscope (Fig 2B). At 2 dpf, 57% of DRG expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) responded to tissue compression (n = 7 DRG, 7 animals) (Fig 2C and 2D). In order to better understand how much compression was needed, we measured the distance that the animal was compressed. This compression impacted not just the DRG itself, but also all surrounding tissue. We found that the average amount of compression needed to elicit a response in the DRG was 207.8 μM (n = 16 DRG, 16 fish) (Fig 2H). There was notable variability in this compression assay. This was due to variability in the amount of force, size of the tip of the needle, positioning of the animal, and angle that the microneedle was positioned. It is possible that this response of sox10+ cells was secondary to neuronal firing. We, therefore, tested if neurons fired in response to compression at 2 dpf in Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) animals but could not detect Ca2+ transients in neurons after compression (n = 5 DRG, 5 animals) (Fig 2C). Examining DRG axonal projections in Tg(ngn1:GFP) animals also showed that neurons at 2 dpf did not have peripheral axons at their final targets in the periphery (Fig 2G). It therefore seems unlikely that such Ca2+ transients in sox10+ satellite glia after tissue compression are secondary to neuronal activity. To understand if sox10+ satellite glia continued to be sensitive to mechanical compression, we repeated this assay at 3 dpf. By 3 dpf, 82% (n = 11 DRG, 11 animals) of DRG expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) responded to tissue compression (Fig 2C). At 3 dpf, 100% (n = 5 DRG, 5 animals) of DRG expressing Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) also demonstrated Ca2+ transients after tissue compression (Fig 2C). While the neuronal population of the DRG does respond to tissue compression at a later age, our data suggests satellite glia respond to the mechanical tissue compression at early ages without neuronal activation.

thumbnail
Fig 2. DRG are mechanosensitive and express piezo1.

(A) LEFT Depiction of mechanical compression assay where animal is mounted dorsally on inverted spinning disk confocal with a dextran loaded microneedle mounted above the animal. RIGHT image of mechanical compression assay apparatus. (B) Depiction of mechanical compression assay with needle placing force on DRG. (C) Quantification of the percent of DRG responding to mechanical force in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) (labeled sox10) or expressing Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) (labeled neurod) and treated with either DMSO or GsMTx4 at both 2 and 3 dpf (sox10 2 dpf DMSO: n = 7 animals, 7 DRG, sox10 2 dpf GsMTx4: n = 5 animals, 5 DRG neurod 2 dpf DMSO: n = 5 animals 5 DRG neurod 2 dpf GsMTx4: n = 4 animals, 4 DRG sox10 3 dpf DMSO: n = 11 animals, 11 DRG sox10 3 dpf GsMTx4: n = 4 animals, 4 DRG neurod 3 dpf DMSO: n = 9 animals, 9 DRG neurod 3 dpf GsMTx4: n = 4 animals, 4 DRG). (D) Confocal image taken of the mechanical compression assay in 2 dpf animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). Images show an inactive time point, a time point with tissue compression, and an active time point in response to tissue compression. Inactive and active DRG marked with an arrow. (E) Quantification of the change in integrated density of fluorescence during each phase of mechanical compression assay of a DRG in a 3 dpf animal treated with either DMSO or GsMTx4. Change in integrated density of fluorescence is scored as time point subtracting the initial time point divided by time point (Δf/f). (F) Quantification of the average change in fluorescence during the phases of mechanical compression following treatment with either 2% DMSO or 1 μM GsMTx4 for 30 min (Resting, Compression, and Decompression DMSO: n = 9 DRG, 9 animals, Resting, Compression, and Decompression GsMTx4: n = 4 DRG, 4 animals). (G) Confocal z-projection of peripheral DRG axon in an animal expressing Tg(ngn1:GFP) at 2 and 3 dpf. Arrow notes the end processes of the peripheral axon. Arrowhead denotes peripheral axons from Rohon beard neurons. (H) Average distance (μM) of DRG displacement needed to elicit a response (n = 16 animals, 16 DRG). (I) Confocal images of RNAscope-piezo1 and Immunohistochemistry-GFP in Tg(sox10:meGFP) animals. GFP is shown in magenta and piezo1 is shown in cyan. Arrowheads indicate piezo1 puncta. Arrows indicate autofluorescence. (J) Quantification of DRG at 3 dpf with piezo1 puncta and without piezo1 puncta (n = 8 animals, 24 DRG). (K) Confocal images of 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). Red colors indicate a higher intensity of fluorescence and blue colors indicate a lower intensity of fluorescence. Images depicted are of animals either treated with 2% DMSO, 40 μM Jedi2, or 1 μM GsMTx4. Arrows note active cells. (L) Line graphs of z score of integrated density of fluorescence for a 1-h time period in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) that were treated with either 2% DMSO, 40 μM Jedi2, or 1 μM GsMTx4. A z score greater than 2.58 indicates an active Ca2+ event. Red scale bar shows a z score of 2.58. (M) Heatmaps of the z score of individual sox10+ cells from animals in G and H during a 1-h period of Ca2+ imaging. Yellow notes a high z score (2.58 or greater) (DMSO: n = 8 animals, 17 DRG, 52 cells, Jedi2: n = 7 animals, 18 DRG, 79 cells, GsMTx4: n = 6 animals, 16 DRG, 44 cells). (N) Quantification of the average number of Ca2+ events per sox10+ cell in animals treated with either 2% DMSO, 1 μM GsMTx4, 100 μM Yoda1, or 40 μM Jedi2 (DMSO: n = 8 animals, 17 DRG, 52 cells, Jedi2: n = 7 animals, 18 DRG, 79 cells, GsMTx4: n = 6 animals, 16 DRG, 44 cells, Yoda1: n = 4 animals, 9 DRG, 35 cells). (O) Quantification of the average number of Ca2+ events per neurod+ cell in 3 dpf animals expressing Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) that were treated with either 2% DMSO, 1 μM GsMTx4, 40 μM Jedi2, or 100 μM Yoda1 (DMSO: n = 10 animals, 24 DRG, 33 cells, Jedi2: n = 5 animals, 18 DRG, 35 cells, GsMTx4: n = 4 animals, 8 DRG, 8 cells, Yoda1: 4 animals, 7 DRG, 8 cells). (P) Quantification of the average number of Ca2+ events per sox10+ cell following genetic manipulation via injection of uas:cas9mkate-u6:piezo1gRNA or uas:cas9mkate-u6:emptygRNA into animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) at 3 dpf. Additionally, a group of Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) injected with uas:cas9mkate-u6:piezo1gRNA and treated with 40 μM Jedi2 treatment was also included in the experiment (u6:emptygRNA: n = 6 animals, 16 DRG, 40 cells, u6:piezo1gRNA: n = 4 animals, 13 DRG, 57 cells, u6:piezo1gRNA+Jedi2: n = 4 animals, 4 DRG, 7 cells). Scale bar is 10 μM (D, G, I, K). Statistical tests: unpaired t test (H, N, O), Fisher’s exact (C), multiple unpaired t tests (F). The data underlying this figure can be found in S1 Data. dpf, days post fertilization; DRG, dorsal root ganglia.

https://doi.org/10.1371/journal.pbio.3002319.g002

If this response to mechanical force is mediated by mechanosensitive ion channels, we would hypothesize that it would be reduced upon treatment of GsMTx4, which broadly blocks mechanosensitive ion channels. To test this hypothesis, we imaged animals expressing either Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP), or Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) that were treated with GsMTx4. We found that treatment with GsMTx4 reduced the response to mechanical stimuli to 20% of animals (n = 5 DRG, 5 animals) expressing sox10+ GCaMP6s at 2 dpf (Fig 2C and 2E). At 3 dpf when treated with GsMTx4, there was a significant reduction in response with 0% of animals (n = 4 DRG, 4 animals) expressing sox10+ GCaMP6s responded to mechanical force and 25% of animals (n = 4 DRG, 4 animals) expressing neuronal GCaMP6s responded to mechanical force (sox10 3 dpf DMSO versus GsMTx4: p = 0.0110, neurod 3 dpf DMSO versus GsMTx4: p = 0.0476 Fisher’s exact test) (Fig 2C). Additionally, we investigated the effect of GsMTx4 treatment on 3 phases of this assay. We assessed the change in fluorescence in DRG expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) during the resting state, compression state, and decompression state (Fig 2E). We define these phases as follows: resting phase is the initial fluorescence before compression with the needle, compression phase is when the needle is actively putting force on the animal, and decompression phase is when the needle has been released. We compared the average change in fluorescence during these phases between DMSO and GsMTx4-treated animals at 3 dpf expressing Tg(sox10:gal4); Tg(uas:GCaMP6s). We found that animals treated with DMSO had an average change in fluorescence of 0.003+/−0.006 during resting phase, an average change in fluorescence of 0.010+/−0.010 during compression, and an average change in fluorescence of 0.029+/−0.019 during decompression (n = 9 DRG, 9 animals). We found that animals treated with GsMTx4 had an average change in fluorescence of 0.006+/−0.006 during resting phase, an average change in fluorescence of −0.030+/−0.021 during compression, and an average change in fluorescence of −0.027+/−0.034 during decompression (n = 4 DRG, 4 animals) (Fig 2F). When comparing these phases between DMSO treated and GsMTx4-treated animals, we found a significant difference in the change in fluorescence during the compression and decompression phases (Compression DMSO versus Compression GsMTx4: p = 0.0005, Decompression DMSO versus Decompression GsMTx4: p = 0.0025, multiple unpaired t tests) (Fig 2F). These data support the hypothesis that DRG are responsive to mechanical forces and identify that sox10+ cells are mechanosensitive, at least partially independent of neuronal activity.

Satellite glia Ca2+ transients can be altered by manipulating Piezo1

We next explored the potential molecular determinant of this mechanical component. The mature DRG is known to express mechanosensitive channels Piezo1 and Piezo2; however, Piezo2 is restricted to neurons while Piezo1 is expressed in neurons and satellite glia in mice [31]. To investigate this in zebrafish, we utilized RNAscope to determine spatiotemporal distribution of piezo1 RNA in animals expressing Tg(sox10:meGFP). We found that 79% of DRG (n = 24 DRG, 8 animals) at 3 dpf contained piezo1 RNAscope puncta within sox10+ satellite glia (Fig 2I and 2J). Additionally, we utilized Whole-mount HCR-FISH targeting piezo1 RNA 3 dpf animals expressing Tg(sox10:meGFP) and found similar expression of piezo1 (S4 Fig).

To test if DRG contain functional Piezo1, we treated animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) with Yoda1 and Jedi2, known Piezo1 specific agonists (Fig 2K–2M) [48,49]. We found the average amount of Ca2+ transients per sox10+ cell in a 1-h time-lapse in DMSO controls was 2.69 ± 1.55 Ca2+ transient events, which was significantly less than the average 4.48 ± 1.58 Ca2+ transient events or 4.58 ± 2.54 Ca2+ transient events observed when treated with Yoda1 or Jedi2, respectively (DMSO n = 52 cells, 17 DRG, 8 animals, Yoda1 n = 33 cells, 9 DRG, 4 animals, Jedi2 n = 79 cells, 18 DRG, 7 animals) (DMSO versus Yoda1: p < 0.0001 unpaired t test, DMSO versus Jedi2: p < 0.0001 unpaired t test) (Fig 2N). Furthermore, we repeated this assay treating with GsMTx4 to investigate whether inhibiting mechanosensitive ion channels reduces spontaneous Ca2+ transients. This treatment significantly reduced the average amount of Ca2+ transients per sox10+ cell to an average of 2.05 ± 1.36 Ca2+ transient events (n = 44 cells, 16 DRG, 6 animals) (DMSO versus GsMTx4: p = 0.0342 unpaired t test) (Fig 2K–2N).

One possible explanation for an increase in Ca2+ transients in sox10+ satellite glia is that the sox10+ satellite glia are active in response to neuronal activity. To investigate whether the observed change in Ca2+ transients in sox10+ satellite glia was a consequence of altered neuronal activity, we treated animals expressing Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) with Piezo1 agonists and quantified the amount of Ca2+ transients per DRG neuron. We found following DMSO treatment that DRG neurons exhibited an average of 2.42 ± 1.71 Ca2+ transient events per hour. When animals were treated with either Yoda1 or Jedi2, an average of 3.50 ± 2.39 or 2.57 ± 2.00 Ca2+ transient events per hour, respectively, could be detected. When animals were treated with GsMTx4, there was an observed 3.75 ± 1.67 average number of Ca2+ transient events (DMSO n = 33 neurons, 24 DRG, 10 animals, Yoda1 n = 8 neurons, 7 DRG, 4 animals, Jedi2 n = 35 neurons, 18 DRG, 5 animals, GsMTx4 n = 8 neurons, 8 DRG, 4 animals) (Fig 2O). Overall, we found that Piezo1 agonists did not contribute to an increase in Ca2+ transients in the neurod+ population. These data are most consistent with the hypothesis that sox10+ satellite glia display Ca2+ transients in response to Piezo1 agonists independent of an increase in neuronal activity.

In addition to these pharmacological treatments, we also sought to do a genetic manipulation to identify if the endogenous Piezo1-mediated Ca2+ transient was present in satellite glia. We utilized a uas:cas9mkate-u6:piezo1gRNA construct designed with a verified piezo1 gRNA that produced genetic indels in 86% of animals that were injected and sequenced (S5 Fig) to knockout piezo1 in satellite glia [50]. This construct was injected into animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s). We then imaged animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s); uas:cas9mkate-u6:piezo1gRNA and quantified the average amount of Ca2+ transients in comparison with animals injected with uas:cas9mkate-u6:emptygRNA, a construct containing an empty gRNA cassette. We found in animals injected with uas:cas9mkate-u6:piezo1gRNA, there was an average of 1.579+/−1.117 Ca2+ transients (n = 57 cells, 13 DRG, 4 animals). This was significantly lower than the average amount of Ca2+ transients observed in uas:cas9mkate-u6:emptygRNA injected animals where there was an average of 2.500+/−1.536 Ca2+ transient events (n = 40 cells, 16 DRG, 6 animals) (p = 0.0028, post hoc Tukey test) (Fig 2P). Additionally, we injected animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) with uas:cas9mkate-u6:piezo1gRNA and treated the animals Jedi2. These animals had on average 1.857+/−1.464 Ca2+ transients (n = 7 cells, 4 DRG, 4 animals) that was not significantly different from untreated uas:cas9mkate-u6:piezo1gRNA injected animals (p = 0.8578, post hoc Tukey test) (Fig 2P), supporting that this manipulation is specific to Piezo1. Interestingly, when comparing uas:cas9mkate-u6:emptygRNA injected animals with animals injected with uas:cas9mkate-u6:piezo1gRNA/ treated with Jedi2, we did not see a significant difference (p = 0.4602, post hoc Tukey test). This could be result of multiple different factors including the penetrance of our gRNA. Together, these findings support the idea that piezo1 contributes to spontaneous Ca2+ transients that are observed.

We demonstrated that DRG satellite glial cells have distinct Ca2+ transients (Fig 1F–1H) but the underlying mechanism of those transients is unknown. We therefore tested if subtypes of Ca2+ transients were differentially modulated by Piezo1. To investigate the role of Piezo1 in isolated and simultaneous Ca2+ transient events, we quantified the effect of Yoda1, Jedi2, GsMTx4, and DMSO treatment on these Ca2+ transient events. In DMSO-treated animals, sox10+ cells displayed an average 0.46 ± 0.78 isolated Ca2+ transient events. When treated with Yoda1 or Jedi2, sox10+ cells displayed an average of 2.28 ± 1.72 or an average of 1.31 ± 1.22 isolated Ca2+ transient events, respectively. We found that when treated with GsMTx4, sox10+ cells displayed an average of 0.91 ± 1.2 isolated Ca2+ transient events (DMSO n = 24 cells, 5 DRG, 4 animals, Yoda1 n = 28 cells, 6 DRG, 3 animals, Jedi2 n = 59 cells, 18 DRG, 7 animals, GsMTx4 n = 23 cells, 5 DRG, 3 animals) (Fig 3A–3C). These results show that Piezo1 agonists significantly increased the amount of isolated Ca2+ transients (DMSO versus Yoda1: p < 0.0001, DMSO versus Jedi2: p = 0.0024 unpaired t tests), while mechanosensitive antagonists did not significantly decrease isolated Ca2+ transients (DMSO versus GsMTx4: p = 0.1294 unpaired t test) (Fig 3C). In contrast, simultaneous Ca2+ transient events were not significantly different in Yoda1 or Jedi2-treated animals compared to controls (DMSO n = 24 cells, 5 DRG, 4 animals, Yoda1 n = 28 cells, 6 DRG, 3 animals, Jedi2 n = 59 cells, 18 DRG, 7 animals, GsMTx4 n = 23 cells, 5 DRG, 3 animals) (Fig 3D). In the case of mechanosensitive antagonists, animals displayed a significant decrease in the number of simultaneous Ca2+ transient events compared to DMSO control when treated with GsMTx4 (DMSO versus GsMTx4: p = 0.0003 unpaired t test).

thumbnail
Fig 3. Piezo1 overactivation increases isolated calcium activity in DRG.

(A) Confocal z-projection of DRG in 3 dpf animal expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) and treated with either 2% DMSO or 40 μM Jedi2. Individual cells are traced for ROIs and labeled with a number. (B) Line graphs of the z score of the integrated density of fluorescence over a 1 h period. Each numbered line graph corresponds to a numbered ROI. Red scale bar represents a z score of 2.58. Blue arrowheads note simultaneously active time points. Red arrowheads note isolated active time points. (C) Quantification of the average number of isolated Ca2+ transient events per sox10+ cell in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) that were treated with either 2% DMSO, 1 μM GsMTx4, 100 μM Yoda1, or 40 μM Jedi2 (DMSO: 4 animals, 5 DRG, 24 cells, GsMTx4: n = 3 animals, 5 DRG, 23 cells, Jedi2: n = 7 animals, 18 DRG, 59 cells, Yoda1: n = 3 animals, 6 DRG, 28 cells). (D) Quantification of the average number of simultaneous Ca2+ transient events per sox10+ cell in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) that were treated with either 2% DMSO, 1 μM GsMTx4, 100 μM Yoda1, or 40 μM Jedi2 (DMSO: n = 4 animals, 5 DRG, 24 cells, GsMTx4: n = 3 animals, 5 DRG, 23 cells, Jedi2: n = 7 animals, 18 DRG, 59 cells, Yoda1: n = 3 animals, 6 DRG, 28 cells). (E) Quantification of the average number of isolated Ca2+ transient events following genetic manipulation via CRISPR/Cas9 targeting piezo1 or empty gRNA cassette in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) uas:cas9mkate-u6:piezo1gRNA or uas:cas9mkate-u6:emptygRNA (u6:emptygRNA: n = 6 animals, 14 DRG, 38 cells, u6:piezo1gRNA: n = 4 animals, 13 DRG, 57 cells). (F) Quantification of the average number of simultaneous Ca2+ transient events following genetic manipulation via CRISPR/Cas9 targeting piezo1 or empty gRNA cassette in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) uas:cas9mkate-u6:piezo1gRNA or uas:cas9mkate-u6:emptrygRNA (u6:emptygRNA: n = 6 animals, 14 DRG, 38 cells, u6:piezo1gRNA: n = 4 animals, 13 DRG, 57 cells). (G) Quantification of the average number of microdomains per DRG in 3 dpf animals expressing Tg(sox10:gal4+myl7); uas:GCaMP6s-caax that were treated with either 2% DMSO, 1 μM GsMTx4, or 40 μM Jedi2 for 30 min prior to imaging (DMSO: n = 7 animals, 7 DRG, GsMTx4: n = 7 animals, 7 DRG, Jedi2: n = 6 animals, 8 DRG). (H) Quantification of the average duration of microdomains in 3 dpf animals expressing Tg(sox10:gal4+myl7); uas:GCaMP6s-caax that were treated with either 2% DMSO or 40 μM Jedi2 for 30 min prior to imaging (DMSO: n = 8 animals, 8 DRG, Jedi2: n = 5 animals, 7 DRG). Scale bar is 10 μM (A). Statistical tests: unpaired t test (C, D, E, F, H), one-way ANOVA followed and represented by post hoc Dunnett test (G). The data underlying this figure can be found in S1 Data. dpf, days post fertilization; DRG, dorsal root ganglia; ROI, regions of interest.

https://doi.org/10.1371/journal.pbio.3002319.g003

To complement the pharmacological approach, we also quantified these distinct Ca2+ transient events in genetic manipulations following the injection of uas:cas9mkate-u6:piezo1gRNA and uas:cas9mkate-u6:emptygRNA. Animals injected with the empty-gRNA had an average of 1.132+/−1.474 isolated Ca2+ transient events and an average of 1.342+/−0.7453 simultaneous Ca2+ transient events at 3 dpf (n = 38 cells, 14 DRG, 6 animals) (Fig 3E and 3F). Animals injected with the piezo1-gRNA had an average of 0.4912+/−0.7820 isolated Ca2+ transient events and an average of 1.088+/−0.9688 simultaneous Ca2+ transient events at 3 dpf (n = 57 cells, 13 DRG, 4 animals) (Fig 3E and 3F). We found there was a significant reduction in the number of isolated Ca2+ transient events in animals injected with uas:cas9mkate-u6:piezo1gRNA compared to uas:cas9mkate-u6:emptygRNA (p = 0.0071, unpaired t test). The average number of simultaneous Ca2+ transient events were not significantly different following these manipulations (p = 0.1740, unpaired t test). Together, the pharmacological and genetic manipulations support the hypothesis that Piezo1 contributes specifically to isolated Ca2+ transients.

We also quantified the number of Ca2+ microdomains following manipulations of Piezo1 in Tg(sox10:gal4+myl7) animals injected with uas:GCaMP6s-caax. In DMSO-treated animals, sox10+ cells displayed an average number of 0.14 ± 0.38 Ca2+ microdomains at 3 dpf. Animals treated with Jedi2 displayed an average number of 1.38 ± 0.92 Ca2+ microdomains at 3 dpf. When animals were treated with GsMTx4, we observed an average of 0.14 ± 0.38 Ca2+ microdomains at 3 dpf (DMSO n = 7 DRG, 7 animals, Jedi2 n = 8 DRG, 6 animals, GsMTx4 n = 7 DRG, 7 animals) (Fig 3G). Similar to isolated Ca2+ transients, we found a significant increase in the average number of Ca2+ microdomains per DRG when animals were treated with a Piezo1 agonist (DMSO versus Jedi2: p = 0.0025 post hoc Dunnett test) (Fig 3G). We also quantified the average duration of the identified Ca2+ microdomains and did not find a significant difference (Fig 3H). These additional findings suggest that Piezo1-mediated mechanical forces contribute to the number of observable Ca2+ microdomain events in addition to isolated Ca2+ transient events.

Altering Piezo1 has functional consequences to DRG development

The specific function of isolated Ca2+ transients is relatively unknown. We therefore used Piezo1 manipulations to test the potential functional consequence of increasing isolated Ca2+ transients. We first hypothesized that Piezo1-sensitive isolated Ca2+ transients were important for the formation of synchronized glial networks. These glial networks form between 2 and 4 dpf (Fig 1N). Therefore, to first test this hypothesis, we treated animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) with either DMSO, GsMTx4, or Jedi2 for 30 min daily at 2 and 3 dpf. We performed our Ca2+ imaging paradigm on these animals at 4 dpf and first assessed the amount of isolated and spontaneous Ca2+ transient events following consecutive days of treatment. Following consecutive days treated with DMSO, sox10+ cells showed an average of 2.06 ± 1.85 simultaneous Ca2+ transients and an average of 0.63 ± 0.75 isolated Ca2+ transients. Following treatment on consecutive days with Jedi2, sox10+ cells showed an average of 1.56 ± 1.19 simultaneous Ca2+ transients and an average of 1.52 ± 1.85 isolated Ca2+ transients. Taken together, these data confirm that following consecutive days of treatment, Jedi2 significantly increases the amount of isolated Ca2+ transients (DMSO versus Jedi2: p = 0.0132 post hoc Dunnett test). Interestingly, after treatment with the broad-mechanosensitive antagonist, GsMTx4, on consecutive days in development, sox10+ cells displayed an average of 0.86 ± 0.56 simultaneous Ca2+ transient events and an average of 0.68 ± 0.72 isolated Ca2+ transient events, significantly reducing the amount of simultaneous Ca2+ transients (DMSO versus GsMTx4: p = 0.0050 post hoc Dunnett test) (DMSO n = 32 cells, 6 DRG, 4 animals, Jedi2 n = 25 cells, 5 DRG, 4 animals, GsMTx4 n = 22 cells, 4 DRG, 3 animals) (Fig 4D and 4E). To answer whether these changes ultimately impacted synchrony, we quantified the average percent of high correlation coefficients per sox10+ cell following these treatment paradigms. We found that when treated with DMSO, sox10+ cells had an average of 35.88 ± 28.78% of high correlation coefficients. When treated with either GsMTx4 or Jedi2, sox10+ cells had an average of 29.09 ± 31.65% high correlation coefficients or an average of 24.48 ± 27.16% high correlation coefficients, respectively, (DMSO n = 32 cells, 6 DRG, 4 animals, GsMTx4 n = 22 cells, 4 DRG, 3 animals, Jedi2 n = 25 cells, 5 DRG, 5 animals) (Fig 4F). There was no significant change in the average percent of high correlation coefficients when treated with Jedi2 or GsMTx4 and thereby inconsistent with the idea that Piezo1-sensitive isolated Ca2+ transients or Ca2+ microdomains impact the formation of a presumptive glial network, at least as identified by synchronous activity.

thumbnail
Fig 4. Increased isolated activity via Piezo1 decreases DRG cell divisions and reduces response to cold stimulus.

(A) Timeline of experimental process where animals were treated with either 2% DMSO, 1 μM GsMTx4, or 40 μM Jedi2 for 30 min each day at 2 and 3 dpf. (B) Confocal z-projection of DRG in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) following consecutive days of treatment with either DMSO or Jedi2. ROIs are traced individual cells labeled with a number. Arrows denote active cells. (C) Line graphs of the z score of the integrated density of fluorescence over a 1-h period. Numbers correlate with ROIs in (B). Red line signifies a z score of 2.58. Blue arrowheads note simultaneous active time points. Red arrowheads note isolated active time points. (D–F) Quantification of the average number of isolated (D), simultaneous Ca2+ activity events per sox10+ cells (E), or average percent of high correlation coefficient (F) per sox10+ cells in 4 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) that were treated at 2 and 3 dpf with DMSO, GsMTx4, or Jedi2 (DMSO: n = 4 animals, 6 DRG, 32 cells, GsMTx4: n = 3 animals, 4 DRG, 22 cells, Jedi2: n = 4 animals, 5 DRG, 25 cells). (G) Timeline of experimental process where animals were treated with either 2% DMSO, 1 μM GsMTx4, 100 μM Yoda1, or 40 μM Jedi2 for 30 min each day at 2–4 dpf. Animals were then fixed and processed for imaging at 5 dpf. (H) Confocal z-projections of 5 dpf DRG in animals expressing Tg(neurod:tagRFP) and stained for Sox10. Magenta displays Tg(neurod:tagRFP), and cyan displays Sox10. (I, J) Quantification of the average number of neurod+ (I) and Sox10 (J) cells in 5 dpf animals treated with either 2% DMSO, 1 μM GsMTx4, 40 μM Jedi2, or 100 μM Yoda1 for 30 min each day from 2–4 dpf (DMSO: n = 15 animals, 53 DRG, GsMTx4: n = 10 animals, 34 DRG, Jedi2: n = 10 animals, 39 DRG, Yoda1: n = 7 animals, 18 DRG). (K) Timeline of experimental process where animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCamp6s); uas:Chr2-tdTomato were exposed to 488 nm light for 30 min each day during targeted developmental period. Animals were fixed, stained, and processed for imaging at 5 dpf. (L) Confocal z-projections of 5 dpf DRG in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCamp6s); uas:Chr2-tdTomato and stained for HuCD expression. Magenta displays HuCD+ neurons. Cyan displays sox10+ satellite glia. (M, N) Quantification of the average number of HuCD+ neurons (M) and sox10+ satellite glia (N) in 5 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); uas:Chr2-tdTomato and either exposed or not exposed to 488 nm light for 30 min each day during development (exposed: n = 4 animals, 9 DRG, not exposed: n = 4 animals, 4 DRG). (O–Q) Quantification of the percent of DRG with cell divisions (O) and/or cell deaths (P) in 24-h time lapses of Tg(sox10:meGFP); Tg(neurod:tagRFP) animals treated either with 2% DMSO or 40 μM Jedi2 from 2–3 dpf or 2–4 dpf (2 dpf DMSO: 6 animals, 17 DRG, 2 dpf Jedi2: n = 8 animals, 31 DRG, 3 dpf DMSO: n = 8 animals, 24 DRG, 3 dpf Jedi2: n = 8 animals, 24 DRG). (Q) Quantification of the average duration (seconds) of shivering in 5 dpf animals that were treated with 2% DMSO, 1 μM GsMTx4, or 40 μM Jedi2 for 30 min each day from 2–4 dpf (DMSO: n = 12 animals, GsMTx4: n = 11 animals, Jedi2: n = 13 animals). Scale bar is 10 μM (B, H, L). Statistical tests: one-way ANOVA followed and represented by post hoc Dunnett test (D, E, F, I, J), Fisher’s exact: (O, P), unpaired t test: (M, N, Q). The data underlying this figure can be found in S1 Data. dpf, days post fertilization; DRG, dorsal root ganglia; ROI, regions of interest.

https://doi.org/10.1371/journal.pbio.3002319.g004

In addition to the synchronous glial networks that we identify form by 4 dpf, it is also known that the DRG rapidly expands during this developmental time [38]. We, therefore, tested the hypothesis that Piezo1-sensitive events like isolated Ca2+ transients could be important for DRG expansion. To do this, we increased isolated Ca2+ transients via Piezo1 through Jedi2 or Yoda1 treatment and assessed the number of cells present in the DRG at 5 dpf. To assay both neuronal and glial expansion, we treated zebrafish expressing Tg(neurod:tagRFP) with Piezo1 agonists or a mechanosensitive antagonist for 30 min each day from 2 to 4 dpf, and then used immunohistochemistry against Sox10, thereby identifying TagRFP+ neurons and Sox10+ satellite glia at 5 dpf. Animals treated with DMSO on consecutive days displayed an average number of 3.85 ± 1.05 neurod+ cells and an average number of 5.09 ± 1.33 Sox10+ cells. When animals were treated with GsMTx4, DRG also contained an average of 4.18 ± 1.22 neurod+ cells and 4.91 ± 0.99 Sox10+ cells. However, treatment with Jedi2, resulted in DRG with an average of 2.23 ± 0.81 neurod+ cells and average number of 3.36 ± 0.81 Sox10+ cells (Fig 4I and 4J), showing a reduction in the amount of DRG cells (DMSO versus Jedi2: p < 0.0001 post hoc Dunnett test) (DMSO n = 53 DRG, 15 animals, GsMTx4 n = 34 DRG, 10 animals, Jedi2 n = 39 DRG, 10 animals). With treatment with Yoda1, DRG (n = 18 DRG, 7 animals) also displayed a significant reduction in DRG cells, with an average number of 2.50 ± 1.04 neurod+ cells (DMSO versus Yoda1: p < 0.0001, post hoc Dunnett test). To rule out the possibility that the change in DRG cell number after pharmacological treatments was from a nonspecific change in the size of the entire animal, we repeated this assay and measured the length of animals at 5 dpf and found no significant difference (S6 Fig). Taken together, these findings identify that altering Piezo1-sensitive isolated or microdomain Ca2+ transients impacts DRG development through a reduction in the number of cells present.

To investigate whether this change in cell abundance was a consequence of increased Ca2+ transients nonspecific to Piezo1-mediated activity, we utilized an optogenetic approach to increase Ca2+ transients in the DRG. We injected uas:Chr2-tdTomato into animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) and exposed the animals to 488 nm light for 30 min each day from 2 dpf until 4 dpf (Fig 4K) [51]. Prior to this experiment, we verified that the uas:Chr2-tdTomato injected construct would increase Ca2+ transients by exposing animals over a short period of time to 488 nm light and quantifying the change in fluorescent intensity (S7 Fig). Following the 488 nm exposure from 2 to 4 dpf, we fixed the animals at 5 dpf and stained for the neuronal marker HuCD (Fig 4L). We then quantified the number of HuCD+ cells and sox10+ only cells to compare the number of both populations to a group of injected animals that were not exposed to 488 nm light during development. In animals exposed to 488 nm light, we found an average of 2.556+/−0.527 HuCD+ neurons and an average of 3.778+/−0.667 sox10+ satellite glia (n = 9 DRG, 4 animals). The animals that were not exposed to 488 nm light during development had an average number of 3.000 HuCD+ neurons and an average of 3.500+/−1.000 sox10+ satellite glia (n = 4 DRG, 4 animals). We found no significant difference in the number of neurons or satellite glia present in the DRG following after Chr2 manipulation (Fig 4K–4N). These findings support the hypothesis that increasing Piezo1-mediated isolated Ca2+ transients impacts the DRG via lowering cell abundance.

It is possible that this decrease in cell abundance was caused by a decrease in cell divisions or from an increase in cell death. In order to understand the cause of the decrease in cell abundance, we assessed the number of cell divisions and cell death occurring following consecutive treatment with Piezo1 agonists. To do this, we treated animals expressing Tg(sox10:meGFP) from 2 to 4 dpf with Jedi2 or a DMSO control. We then utilized overnight time lapse imaging to assay cell divisions or cell death. When treated with DMSO at 2 dpf, 88.24% of DRG had cell divisions (n = 17 DRG, 6 animals). At 3 dpf following DMSO treatment, cell divisions occurred in 70.83% of DRG (n = 24 DRG, 8 animals). Following treatment of Jedi2 at 2 dpf, 67.74% of DRG had cell divisions (n = 31 DRG, 8 animals). At 3 dpf following consecutive treatment with Jedi2, 33.33% of DRG had cell divisions (n = 24 DRG, 8 animals) (Fig 4O). We found a significant decrease in the number of cell divisions following consecutive treatment of Jedi2 at 2 and 3 dpf (DMSO versus Jedi2 3 dpf: p = 0.0199 Fisher’s exact test) (Fig 4O). However, we did not observe a significant change in the number of observed cell deaths (Fig 4P). The most likely explanation for this data is that the decrease in cell abundance in Piezo1-manipulated animals is from a reduction in cell divisions.

Lastly, we questioned whether this Piezo1-mediated decrease in cell abundance had functional consequences to the animal’s physiology. To answer this question, we treated animals with Piezo1 agonists and mechanical-channel antagonists during development and then tested the animal’s response to sensory stimuli. We previously demonstrated that larval zebrafish DRG neurons are active after zebrafish larvae are submerged in 4°C water [52,53]. This submersion causes a shivering phenotype that is at least partially dependent on intact DRG neurons and axons [52,53]. We treated animals with Jedi2 or GsMTx4 for 30 min each day from 2 to 4 dpf and then assayed sensory responses at 5 dpf. Following consecutive days of treatment, DMSO control-treated animals had a shivering phenotype average duration of 11.60 ± 5.9 s. When treated on consecutive days with GsMTx4, animals had an average length of shivering of 6.55 ± 6.97 s. Following consecutive days of treatment with Jedi2, animals had an average length of shivering of 6.47 ± 6.01 s. There was a significant decrease in the length of shivering following consecutive days of Jedi2 treatment suggesting that overactivation of Piezo1 during development impacts DRG response to sensory stimulus (DMSO versus Jedi2: p = 0.0427 unpaired t test) (DMSO n = 12 animals, GsMTx4 n = 11 animals, Jedi2 n = 13 animals) (Fig 4Q). The noted nonsignificant decrease to the average length of shivering following GsMTx4 may be due in part from unidentified pathways targeted with this broad mechanosensitive ion channel antagonist. Overall, these results support the hypothesis that impacting DRG development via Piezo1-mediated isolated Ca2+ transients results in a functional consequence to the animal’s physiology.

Discussion

Activity of neural cells during development is well documented. We define this activity in satellite glia as significant changes in Ca2+ transients, which is a separate and different process from known neuronal firing activity. This can be broadly categorized into evoked and spontaneous Ca2+ transients. In glia, spontaneous Ca2+ transients are further divided into subtypes characterized as whole cell and microdomain Ca2+ transients. However, the developmental, molecular, and functional features of these glial Ca2+ transients merits more investigation. Here, we demonstrate that satellite glia in the DRG exhibit distinct subtypes of spontaneous Ca2+ transients during early developmental times. We further reveal that distinct subtypes of Ca2+ transients are sensitive to manipulation of Piezo1. The functional consequence of disrupting such Piezo1-sensitive events is supported by data that shows cell abundance and sensory behavior is impacted by Piezo1-manipulations. Overall, we reveal developmental, molecular, and functional characteristics of glial Ca2+ transients in the DRG.

Despite clear roles of neural Ca2+ transients in development and homeostasis of the nervous system in the animal, it is unclear when and which cells in the DRG show spontaneous Ca2+ transients. It is well appreciated that cultured DRG neurons exhibit spontaneous Ca2+ transients [54,55]. Ca2+ reporters have also demonstrated that satellite glia demonstrate Ca2+ transients in culture [56,57]. These cultured satellite glia also exhibit synchronized Ca2+ transients. Recent work has also shown Ca2+ transients in the vertebrate DRG neurons in vivo [58,59]. However, such work was restricted to mature animals. Our work reveals that both DRG neurons and glia in the animal display Ca2+ transients during the earliest stages of DRG construction. Even on the first day of genesis, DRG cells demonstrate Ca2+ transients. We also identify the molecular mechanisms that mediate some of these Ca2+ transients. What remains unknown is how these Ca2+ transients change as the animal approaches adulthood or in neuropathologies. These are important topics to study because we know altered activity of both glia and neurons has been implicated in neuropathologies. Further, in addition to the spontaneous Ca2+ transients we focus on, neurons in the DRG also are evoked by specific stimuli. How glia respond to evoked stimulation in the animal is almost entirely unknown.

By imaging GCaMP6s in sox10+ cells and probing gap junction components, we reveal that synchronized cellular Ca2+ transients indicative of glial networks form within 3 days of DRG genesis. We know that glial networks are essential in the central nervous system for circuit formation, neuronal health, and signal transduction. However, glial networks in the PNS are less understood. Because of this, whether glial networks exist in developing DRG was not known. Our work identifies that DRG satellite glia are not synchronized initially, but by 4 days of DRG construction, become synchronized. One interesting aspect of this increased synchronization is that it occurs while the population is simultaneously expanding via cell divisions. Further investigation in additional PNS populations will provide an understanding if this is a unique process to the DRG or if it is found in additional areas of the PNS. It will also be important to probe the plasticity of the synchronized glial network and how it could be altered.

While most currently published research has focused on identifying molecules involved in synchronous Ca2+ transients of cells that make up neural circuits, we have identified a mechanism that contributes specifically to what we define as isolated Ca2+ transients within the DRG. We found that mechanobiology via Piezo1 contributes to an increase in isolated Ca2+ transients without altering simultaneous Ca2+ transients. Our findings provide insights into the importance of understanding mechanical forces on the cellular level during development. Recent work has brought the ability to visualize Piezo1 activity into fruition using GenEPi [60]. Using this new toolset would provide great insight into the roles of Piezo, while identifying when and where it is active. GenEPi will allow direct inquisition into the activity of native Piezo1. It is possible that these mechanical forces provide insight to satellite glia regarding whether proliferation is needed. For example, if the mechanical forces acting on a satellite glia are high, this may cause signaling via Piezo1 to halt or promote proliferation [29,35,61]. Alternatively, the ability to sense larger mechanical forces on the level of tissues may be important for DRG expansion. If this were true, an increase in mechanical forces may signal to the DRG that there is no room for further proliferation. One potential signaling cascade that may be involved is YAP/Taz. YAP/Taz is a well-known controller of cellular proliferation and has also been shown to modulate DRG development [13]. So, it is possible that over activating Piezo1 is altering localization of Yap/Taz [62]. Another area of research that would impact these ideas is the utility of Ca2+ microdomains observed in the DRG. If these microdomains are indicative of mechanical forces on the subcellular level, we may hypothesize either an increase or decrease in the amount of these microdomains which would further inform proliferative decisions in DRG satellite glia. Further investigation into the mechanical forces acting on the microenvironment of the DRG needs to be completed.

Our findings highlight the importance of understanding the role of mechanical signals in PNS development and the function of distinct Ca2+ transients in that process.

Limitations of findings

We found a transition from an asynchronous population to a synchronous population during early DRG development. We attribute this transition to an increase in correlation coefficients between cells present in the DRG, which we hypothesize is a result from increased gap junction formation. But, this transition may also be partially explained by other processes. This work only investigates Ca2+ transients in the first 3 days of DRG genesis, so whether the observed synchrony remains through later stages of development is unknown and merits further study. We currently hypothesize that the decrease in cell proliferation is a result of Piezo1 overactivation. Whether Piezo1 controls proliferation only through isolated Ca2+ transients cannot be determined with our experiments. Our pharmacological manipulations also do not distinguish between cell-autonomous and non-autonomous roles of Piezo1 in satellite glia. Because of this, we cannot rule out the possibility that some observed phenotypes are a result of non-autonomous signaling. However, the piezo1 expression in DRG sox10+ cells and response to Piezo1 agonists, as well as our genetic manipulations, suggests a cell-autonomous role. But it remains a possibility that over activating Piezo1 could result in a change in a cell’s ability to communicate unidentified signals to surrounding cells. If this is the case, then non-autonomous roles of Piezo1 could contribute to the reduction in cell abundance. We use an established cell-specific gRNA approach and validate that the gRNA creates indels; however, a caveat is that the nature of those lesions or the portion of cells that have homozygous mutations is not known. Further probing the role of Piezo1 in germline mutants would validate those findings, although, in mice global germline mutations to Piezo1 are embryonic lethal [63]. Throughout this work, we utilize GsMTx4 as a Piezo1 antagonist alongside our other pharmacological treatments. Because GsMTx4 is more broadly inhibitive of mechanosensitive ion channels, further work is needed to test antagonistic effects on Piezo1. We hypothesize that further work utilizing more specific Piezo1 antagonists will complement the data shown here. Our findings support the hypothesis that DRG satellite glia are mechanosensitive, but to further understand the amount of force needed to elicit a response in these cells and the true dynamics of the cells during a response will need additional studies targeting mechanical properties. Lastly, we identify satellite glia as sox10+ neurod- cells residing in the DRG with an ensheathing morphology. It is likely that a subset of progenitor cells exist in the DRG during this developmental time period and potentially into adulthood [37]. If this is the case, our findings would suggest that altering Piezo1-mediated Ca2+ transients in both satellite glia and DRG progenitors likely impact DRG development.

Materials and methods

Ethics statement

Experimental procedures adhered to the NIH guide for the care and use of laboratory animals. All experiments were approved by the University of Notre Dame Institutional Animal Care and Use Committee (IACUC) (protocol 19-08-5464) which is guided by the United States Department of Agriculture, the Animal Welfare Act (USA) and the Assessment and Accreditation of Laboratory Animal Care International.

Experimental procedures

Animal specimens.

Danio rerio (zebrafish) were utilized in this study. The following stable strains were used: AB, Tg(sox10:gal4+myl7:gfp) [64], Tg(uas:GCaMP6s) [65], Tg(neurod:gal4+myl7:gfp) [66], Tg(sox10:meGFP) [67], Tg(neurod:tagRFP) [68], Tg(ngn1:GFP) [69]. All embryos were produced through pairwise matings and grown in 28°C in constant darkness. At 24 hpf, zebrafish were exposed to PTU (0.0003%) to reduce pigmentation for intravital imaging. Age of animals was determined by hour post fertilization and stages of development [70].

In vivo overnight imaging.

Animals were anesthetized using veterinary grade 3-aminobenzoic acid ester (Tricaine) for mounting purposes only. Animals were then mounted laterally on their right side in glass-bottomed 35-mm petri dishes [38] and covered in 0.8% low melt agarose. For overnight time lapse imaging, a mixture of egg water and tricaine was added to the dish. Images were acquired on spinning disk confocal microscopes custom built by 3i technology (Denver, Colorado) that contains: Zeiss Axio Observer Z1 Advanced Mariana Microscope, X-cite 120LED White Light LED System, filter cubes for GFP and mRFP, a motorized X,Y stage, piezo Z stage, 20× Air (0.50 NA), 63× (1.15NA), 40× (1.1NA) objectives, CSU-W1 T2 Spinning Disk Confocal Head (50 μM) with 1× camera adapter, and an iXon3 1Kx1K EMCCD camera or Prime 95B back illuminated CMOS camera, dichroic mirrors for 446, 515, 561, 405, 488, 561, 640 excitation, laser stack with 405 nm, 445 nm, 488 nm, 561 nm, and 637 nm. Overnight time-lapse images were collected every 5 min for 24 h capturing a 40 μM z stack. Adobe Illustrator and ImageJ were used to process images. Only brightness and contrast were adjusted and enhanced for images represented in this study.

In vivo calcium imaging.

Animals were anesthetized using veterinary grade 3-aminobenzoic acid ester (Tricaine) for mounting purposes only. Animals were then mounted laterally on their right side in glass-bottomed 35-mm petri dishes [38] and covered in 0.8% low melt agarose. For Ca2+ imaging, egg water was added to the dish with no Tricaine. Images were acquired on a spinning disk confocal microscope custom built by 3i technology (Denver, Colorado) microscopes. Ca2+ time-lapse imaging consisted of image collection every 15 s for 1 h capturing a 40 μM z stack. For imaging of Ca2+ microdomains, images were either taken every 5 s for 10 min capturing a 20 μM z stack (Fig 1) or taken every 200 ms in a single plane (Fig 3). Adobe Illustrator and ImageJ were used to process images. Only brightness and contrast were adjusted and enhanced for images represented in this study.

Pharmacological treatments.

For this study, we used chemical treatments of HMR1556 20 μM (Sigma-Aldrich), Thapsigargin 10 μM (Sigma-Aldrich), Apyrase 10U (Sigma-Aldirch), Carbenoxolone 100 μM (Tocris), GsMTx4 1 μM (Tocris), Yoda1 100 μM (Tocris), and Jedi2 40 μM (Tocris). Concentrations were based on previous work and from testing a variety of concentrations of Piezo1 agonists (S6 Fig). HMR1556 was stored at 10 mM concentration at −20°C. Thapsigargin was stored at 10 mM concentration at −20°C. Apyrase was stored at 100U in −20°C. GsMTx4 was stored at 1 mM at −20°C. Yoda1 was stored at 10 mM at 4°C in 100% DMSO. Jedi2 was stored at 10 mM at 4°C. All treatments were done in 2% DMSO. Control groups were treated with 2% DMSO throughout.

Consecutive treatments of pharmacological agents.

For consecutive days of treatment with pharmacological treatments, animals were bathed in a mixture of either 40 μM Jedi2, 1 μM GsMTx4, or 100 μM Yoda1 in egg water with 2% DMSO for 30 min each day. For Fig 4A–4F, only the 40 μM Jedi2 and 1 μM GsMTx4 mixtures or a 2% DMSO egg water control were used. These treatments occurred at 2 dpf and 3 dpf. For Fig 4G–4J and S9 Fig, mixtures of 40 μM Jedi2, 1 μM GsMTx4, and 100 μM Yoda1 mixtures or a 2% DMSO egg water control were used. These treatments occurred at 2 dpf, 3 dpf, and 4 dpf. For Fig 4K and 4L, animals were treated with either 40 μM Jedi2 or 2% DMSO egg water at 2 and 3 dpf. For Fig 4M, animals were treated with 40 μM Jedi2, 1 μM GsMTx4, or 2% DMSO egg water at 2 dpf, 3 dpf, and 4 dpf.

Whole-mount immunohistochemistry.

The primary antibody used to identify formation of gap junctions was Cxn43 (1:500; Cell Signaling Technology) (Fig 1O). The primary antibody used to identify cells expressing Tg(sox10:meGFP) was GFP (1:500; Aves) (Fig 2H) following the listed RNAscope protocol. The primary antibody used to identify non-neuronal cells present in the DRG was Sox10 (1:1,000, Sarah Kucenas Lab) (Fig 4H). The primary antibody used to identify neurons present in the DRG was HuCD (1:500, Thermo Fisher) (Fig 4L). The secondary antibody used in Fig 2H and Fig 4H was Alexa Fluor 488 (1:500; Invitrogen). The secondary antibody used in Fig 4L was Alexa Fluor 561 (1:500; Invitrogen). Animals were fixed in 4% PFA in PBSt (PBS, 0.1% TritonX-100) at 2 dpf (Fig 2G) or 5 dpf (Fig 4H and 4L). Animals were then washed for 5 min in a series of PBSt, DWt (dH2O, 0.1% TritonX-100), and acetone. Following these washes, animals were placed in acetone at −20°C for 10 min. This was then followed by 3 washes of PBSt for 5 min each. Animals were then placed in 5% goat serum in PBSt for a 1 h incubation period. Animals were then incubated in 5% goat serum in PBSt with primary antibody for 1 h at room temperature followed by an overnight incubation at 4°C. This was followed by 3 consecutive 30 min washes of PBSt and one 1 h wash in PBSt. Animals were then placed in 5% goat serum in PBSt with the secondary antibody for 1 h at room temperature followed by an overnight incubation at 4°C. This was then followed by 3 consecutive 1 h washes of PBSt. Animals were then stored in 50% glycerol 50% PBS at 4°C until imaging.

Whole-mount RNAscope.

Animals expressing Tg(sox10:meGFP) were fixed at 2 dpf with 4% PFA in PBS for 30 min. Following fixation animals were placed in new Eppendorf tubes and washed with 25%, 50%, 100% methanol for 10 min each. Animals were then kept in 100% methanol at −20°C overnight. This was followed by a 5-min wash of 50% methanol in PBStw (PBS, 0.1% Tween-20) and an additional 5-min wash of 25% methanol in PBStw. Liquid was removed from the Eppendorf tubes and the animals were air dried for 30 min. This was followed by two 5-min washes with PBStw. Animals were permeabilized with 10 μg/mL proteinase K in PBStw at room temperature for 6 min. This was then followed by 4 consecutive 10-min washes of PBStw. Following removal of PBStw, 2 drops of ACD probes targeting piezo1 were then added to the sample, which was then incubated at 40°C for 15 h (1:50, 80 μL, C1, ACD). In the case of positive and negative controls that were used, Probe-Dr-polr2 was used as a ubiquitous positive control and Probe-Dr-dapB was used as a bacterial negative control. After this incubation period animals were then washed with SSCtw (5× saline-sodium citrate buffer, 0.1% Tween-20) for 10 min at room temperature twice. An additional fixation was then done in 4% PFA in PBS at room temperature for 10 min. Animals were again transferred to a new Eppendorf tube and washed 3 times in SSCtw. Animals were then incubated in a series of 2 drops Amp1 at 40°C for 30 min, 2 drops Amp2 at 40°C for 30 min, 2 drops Amp3 at 40°C for 15 min, 2 drops HRP-C1 at 40°C for 30 min, opal fluorophore 650 (1:500) in PBStw at 40°C for 30 min, and 2 drops of Multiplex FLv2 HRP blocker at 40°C for 30 min. Between each of these incubation periods, animals were washed twice with SSCtw. Following this protocol, animals were then processed following the Whole-mount immunohistochemistry protocol to target GFP.

Whole-mount HCR-FISH.

Animals expressing Tg(sox10:megfp) were fixed at 3 dpf in 4% PFA in PBS for 24 h at 4°C. Fixed larvae were then washed in PBS 3 times for 5 min each. To dehydrate and permeabilize the tissue, samples were then washed in a series of 100% methanol 4 times for 10 min each. Samples were then stored in 100% methanol at −20°C for 24 h. To rehydrate samples, a series of methanol/PBStw washes were utilized. Samples were washed for 5 min in 75% methanol in PBStw, 50% methanol in PBStw, 25% methanol in PBStw, and 100% PBStw. Samples were then treated with 10 μg/mL proteinase K for 30 min. Samples were then washed in PBStw twice for 5 min. A postfix was done on samples in 4% PFA for an additional 20 min. Samples were then washed 5 times for 5 min each with PBStw. Samples were then washed in probe hybridization buffer (Molecular Instruments) for 30 min at 37°C. Samples were then incubated at 37°C overnight in probe hybridization buffer containing HCR-FISH probes targeting piezo1 (Molecular Instruments). Samples were washed following incubation with probe wash buffer (Molecular Instruments) at 37°C 4 times for 15 min each. Samples were then washed twice with SSCtw for 5 min each. Following these washes, samples were then incubated in amplification buffer (Molecular Instruments) for 30 min. Following this incubation, samples were then incubated overnight in amplification buffer containing hairpin b1h1 and hairpin b1h2 (647) overnight. Samples were then washed 5 times in PBStw for 20 min each. Following this protocol, samples then underwent the Whole-mount immunohistochemistry protocol targeting GFP.

Animal behavior in cold stimulus.

Animals were treated at 2, 3, and 4 dpf with 1 μM GsMTx4 in 2% DMSO, 40 μM Jedi2 in 2% DMSO, or 2% DMSO in egg water for 30 min each day. Aside from this treatment protocol, animals were raised under normal procedures in 28°C egg water. Each animal was then taken at 5 dpf and placed in 4°C egg water for 30 s. Video recordings were recorded with 40 ms exposure to bright field white light. The initial 3 s of the movies were not quantified to allow the animal to be placed into the stimulus and for any adjustments to occur. The duration of the shivering was quantified per second starting from the initial shivering phenotype to the cold water stimulus until there was at least 1 s of no shivering.

Mechanical compression assay.

To apply mechanical force to the DRG, we dorsally mounted animals in 0.8% low melt agarose and placed them on the stage of a spinning disk confocal. On either side of the stage 2 vertical stainless steel rods were mounted onto the air table. A horizontal rod was mounted above the stage with a micromanipulator attached. A glass needle filled with dextran was mounted in the micromanipulator above the animals with the needle pointing toward the animal. Prior to bringing into contact with the animal, the needle was calibrated in the X and Y positions in relation to the middle of the imaging window. The needle was slowly brought into contact with the skin of the animals and was then tapped to apply pressure to the DRG and surrounding tissue. To understand if DRG were active in response to the mechanical forces, we quantified GCaMP6s transients as previously described. As a proxy to understand how much force was needed to activate DRG satellite glia, we quantified the response of DRG to a gradient of force measured by the distance (μM) that the tissue was displaced with animal bending in the XY direction.

Microinjections.

In order to label cell membranes with GCaMP6s, animals expressing Tg(sox10:gal4+myl7:GFP) were injected with uas:GCaMP6s-caax at the single-cell stage. In order for cell-specific CRISPR/Cas9, uas:cas9mkate-u6:piezo1gRNA or uas:cas9mkate-u6:emptygRNA were injected into animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s). Injection mixes consisted of either 12 ng/μL uas:GCaMP6s-caax or uas:cas9mkate-u6:piezo1gRNA or uas:cas9mkate-u6:emptygRNA 25 ng/μL tol2 (transposase), and phenol red (visualization). Additional injection mixes consisted of 12 ng/μL uas:Chr2-tdTomato, 25 ng/μL tol1 (transposase), and phenol red. These injections were used for optogenetic manipulations. Animals were screened for the appropriate expression of incorporated transgenes and used in experiments.

Optogenetic manipulation.

For genetic manipulations utilizing channelrhodopsin, we injected a uas:Chr2-tdTomato (Addgene 124237) into animals expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) [51]. Animals were screened for uas:Chr2-tdTomato and either exposed to 488 nm light for 30 min each day from 2 to 4 dpf or not exposed to 488 nm light each day from 2 to 4 dpf.

Global CRISPR Cas9.

In order to validate that our chosen piezo1 gRNA (ACACCCTGAGGATCTTCCAG) was sufficient at creating indels, we injected the chosen piezo1 gRNA with Cas9 (AltR-Cas9 nuclease V3) into embryos at the 1-cell stage. The gRNA was annealed with tracrRNA, and the annealed product was incubated with Cas9 (25 μM) at 37°C for 5 min prior to injection. The injection mix also included phenol red for visualization. After 24 h, animals were collected for DNA isolation and Sanger sequencing.

Cell-specific CRISPR Cas9.

In order to target piezo1 specifically in our cells of interest, we utilized the gal4/uas system. A plasmid was constructed utilizing the Gateway LR Clonease II Plus system (Thermo Fisher). To create uas:cas9mkate-u6:piezo1gRNA, we recombined a p5E-UAS (BseRI cleavage site removed), pME-cas9mkate (Addgene 109547), and p3E-pA constructs into a pDestTol2CG2 containing a U6 promoter sequence flanked with BseRI cleavage sites [50,66]. Following recombination the resulting plasmid, uas:cas9mkate-u6:emptyGRNA was digested with BseRI and annealed primers of piezo1 gRNA (piezo1 forward primer: GCACCCTGAGGATCTTCCAGGT, piezo1 reverse primer: CTGGAAGATCCTCAGGGTGTGA) were ligated into the vector to create uas:cas9mkate-u6:piezo1gRNA. A control plasmid uas:cas9mkate-u6:emptygRNA with an empty gRNA cassette was used.

Assessment of animal length.

Following consecutive days of pharmacological treatment (see method above), animals were imaged at 10.4× magnification with 1 ms of exposure in brightfield to assess the size of the animal. Length in millimeters was used to quantify the size of the animal following consecutive days of pharmacological treatment.

Quantifications and statistical tests

Quantification of GCaMP6s transients.

Before quantifying changes in GCaMP6s intensity, we corrected for motion drift by utilizing the Template Matching plugin in ImageJ. We then traced individual cells in the DRG to create regions of interest (ROI). The integrated density of fluorescence was quantified at every time point for each ROI. We then quantified the z score for each time point for each ROI. Time points with a z score of 2.58 or greater were considered active time points. A single activity event was identified by time points with a z score of 2.58 or greater. If consecutive time points were a z score of 2.58 or greater, this was still considered 1 activity event. This process was used to create activity profiles for each ROI in a given DRG. The average number of active time points was calculated and compared to controls via t tests to determine significance.

Quantification of GCaMP6s transients in pilot screen.

The number of GCaMP6s transients in the pilot screen were quantified in ImageJ. The number of visual changes in GCaMP6s intensity were quantified for each movie. These quantifications were done per whole DRG identified in the imaging window.

Generation of line graphs.

Line graphs were generated using the data obtained from the quantification of GCaMP6s transients. Each cell in the DRG had GCaMP6s transients quantified. The X axis of the line graph is the 1-h period and the Y axis is the Z score. Line graphs were generated in Prism.

Generation of heatmaps.

Heatmaps were generated in Prism. Each row of the heatmap corresponds to an individual cell’s GCaMP6s transience during the 1 h of imaging. Blue colors indicate low z scores and yellow colors indicate high z scores (>2.58).

Quantification of correlation coefficients.

Activity profiles from individual cells were converted to a binary system. Active points where the z score was greater than 2.58 were listed as 1 and inactive time points where the z score was less than 2.58 were listed as 0. These binary activity profiles were then used to quantify the correlation between individual ROIs found in the same DRG; we utilized the cor() function in R to complete this analysis. The results were then used to create a correlation table in R. These functions were part of the Hmisc package in R. Correlation coefficients greater than 0.5 were considered high correlation coefficients. The percent of high correlation coefficients were then quantified per cell and compared with controls via t tests to determine significance.

Quantification of IHC, RNAscope, HCR-FISH.

All quantifications of IHC were completed in ImageJ. The number of Cxn43 puncta that coincided with sox10:megfp expression were quantified per DRG (Fig 1O and 1P). The number of DRG that contained piezo1 within the stained GFP expressed was quantified (Figs 2H, 2I, and S4). This was done by going through each individual optical slice to identify piezo1 puncta within sox10+ cells located in the DRG. In addition to location, puncta were at least 0.45 μM2 in size for all quantifications. The number of Sox10+ cells were quantified per DRG (Fig 4H and 4I). The same approximate location was imaged on multiple fish, capturing between 2 and 4 DRG per fish. The number of HuCD+ cells was quantified per DRG (Fig 4M and 4N).

Quantification of mechanical compression assay.

Response to mechanical compression was quantified in ImageJ. DRG were traced and the integrated density of fluorescence was quantified at each time point. To attempt quantifying only time points in the same z position, the beginning and end time points quantified were in the same z position that were not manually being changed using the microscope. Due to the nature of this experiment, tissue compression would still alter the z position of the DRG being quantified. To further account for this alteration, the change in integrated density of fluorescence was quantified by subtracting the initial time point from each time point being analyzed (Δf = f−fi). This value was then divided by the time point being analyzed (Δf/f). Large increases in this value following tissue compression were then scored as active responses to mechanical compression. Little to no change in this value following mechanical compression were scored as not active in response to tissue compression.

Quantification of satellite glia ensheathment.

The percent of sox10+ ensheathment around neurod+ cells was quantified utilizing ImageJ tracings. These quantifications were taken from overnight time-lapse imaging of animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) at 3 dpf (S2B Fig). The percent of sox10+ cells found in a DRG with a wrapping phenotype were quantified as ensheathing satellite glia. These quantifications were taken from in vivo calcium imaging of animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) at 3 dpf following treatment of 40 μM Jedi2 (S2C Fig).

Statistical analysis

Statistical analysis was completed with Prism. No statistical methods were used to predetermine sample sizes but sample sizes are similar to previous publications. Statistical tests were completed with biological replicates, not technical replicates. No data points were excluded from the analysis. Healthy animals were randomly selected for all experiments. Each experiment was repeated at least with similar results. All data collected and analyzed are presented in the study.

Software

Slidebook, Prism, ImageJ, R, and Adobe Illustrator were used to acquire, analyze and compile figures.

Supporting information

S1 Fig. DRG contain sox10+ satellite glia with ensheathing morphologies.

(A) Confocal z-projections of DRG in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP). Magenta displays neurod+ neurons. Cyan displays sox10+ satellite glia. Red tracing indicates the morphology of a satellite glia during a Ca2+ transient event. (B) Quantification of the average percent of sox10+ satellite glia ensheathment around a neurod+ neuron at 3 dpf (n = 5 animals, 14 DRG, 37 cells). (C) Quantification of the average number of sox10+ cells with an ensheathing morphology following 40 μM Jedi2 treatment at 3 dpf (7 animals, 18 DRG, 74 cells). Scale bar is 10 μM (A). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s001

(TIF)

S2 Fig. DRG cells are spontaneously active.

(A) Quantification of the average number of calcium events per neurod+ cell or per sox10+ cell in 3 dpf animals expressing either Tg(neurod:gal4+myl7); Tg(uas:GCaMP6s) or Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) (neurod: n = 4 animals, 9 DRG, 11 cells, sox10: n = 5 animals, 14 DRG, 25 cells). (B) Quantification of the average number of time points during active events per sox10+ cells in animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s) (n = 5 animals, 20 DRG, 97 cells, 412 calcium transient events). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s002

(TIF)

S3 Fig. Percent of active DRG cells increase during development.

(A) Confocal z-projection of DRG in 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s). Arrows note active cells and demonstrate different percentages of active DRG. (B) Heatmaps of the percent of cells in the DRG active during a 1-h period at 2, 3, and 4 dpf. Darker gradient indicates a higher percent of cells active (2 dpf: n = 6 animals, 10 DRG, 46 cells, 3 dpf: n = 4 animals, 6 DRG, 27 cells, 4 dpf: n = 4 animals, 7 DRG, 34 cells). (C) Quantification of the number of active events with 0%–25%, 26%–50%, 51%–75%, or 76%–100% of DRG cells active at the same time point at 2, 3, and 4 dpf (2 dpf: n = 6 animals, 10 DRG, 46 cells, 3 dpf: n = 4 animals, 6 DRG, 27 cells, 4 dpf: n = 4 animals, 7 DRG, 34 cells). Scale bar is 10 μM (A). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s003

(TIF)

S4 Fig. Whole-mount HCR-FISH targeting piezo1 in 3 dpf DRG.

(A) Confocal images of HCR-FISH-piezo1 and Immunohistochemistry-GFP in 3 dpf Tg(sox10:meGFP) animals. GFP is shown in magenta and piezo1 is shown in cyan. Arrows indicate piezo1 puncta. (B) Quantification of percent of DRG at 3 dpf with piezo1 puncta and without piezo1 puncta (n = 13 animals, 44 DRG). Scale bar is 10 μM (A). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s004

(TIF)

S5 Fig. Selected piezo1 gRNA creates indels in target sequence.

(A) Sanger sequencing of 3 individual animals following injection with a scrambled gRNA along with Cas9 (Top). Sanger sequencing of 3 individual animals following injection with a piezo1 gRNA along with Cas9 (Bottom). Red box indicates target site of piezo1 gRNA. (B) Quantification of the percent of animals with indels according to Sanger sequencing data in animals injected with piezo1 gRNA and Cas9 (n = 22 animals). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s005

(TIF)

S6 Fig. Size of animals following multiple days of pharmacological treatments.

(A) Images of 5 dpf animals following treatments of DMSO, GsMTx4, Yoda1, or Jedi2. (B) Quantifications of the average length of animals (mm) following consecutive days of pharmacological treatment (DMSO: n = 10 animals, GsMTx4: n = 9 animals, Jedi2: n = 10 animals, Yoda1: n = 10 animals). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s006

(TIF)

S7 Fig. Change in fluorescence following cochr2 activation via 488 nm light.

(A) Quantification of the average change in integral density of fluorescence in sox10+ cells over time (seconds) following activation of cochr2 with 488 nm light at 3 dpf. Change in fluorescence was measured by subtracting the initial integral density of fluorescence from each time point (n = 7 animals, 7 DRG, 7 cells). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s007

(TIF)

S8 Fig. Increasing concentrations of Piezo1 agonists.

(A) Quantification of the average number of Ca2+ transient events in sox10+ cells of 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) treated with 10 μM, 40 μM, or 100 μM Yoda1 in 2% DMSO for 30 min prior to imaging (10 μM: n = 2 animals, 7 DRG, 29 cells, 40 μM: n = 3 animals, 9 DRG, 36 cells, 100 μM: n = 2 animals, 5 DRG, 35 cells). (B) Quantification of the average number of Ca2+ transient events in sox10+ cells of 3 dpf animals expressing Tg(sox10:gal4+myl7); Tg(uas:GCaMP6s); Tg(neurod:tagRFP) treated with 10 μM, 40 μM, or 100 μM Jedi2 in 2% DMSO for 30 min prior to imaging (10 μM: n = 3 animals, 9 DRG, 42 cells, 40 μM: n = 3 animals, 8 DRG, 31 cells, 100 μM: n = 5 animals, 14 DRG, 63 cells). The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s008

(TIF)

S9 Fig. Positive and negative controls of RNAscope.

(A) Confocal images of ubiquitous RNAscope probe polr2 and Immunohistochemistry-GFP in 3 dpf Tg(sox10:meGFP) animals. GFP is shown in magenta and polr2 is shown in cyan. Arrows indicate polr2 puncta (scale bar is 10 μM). (B) Confocal images of bacterial RNAscope probe dapB and Immunohistochemistry-GFP in 3 dpf Tg(sox10:meGFP) animals. GFP is shown in magenta and dapB is shown in cyan. Arrows indicate dapB puncta (scale bar is 10 μM).

https://doi.org/10.1371/journal.pbio.3002319.s009

(TIF)

S10 Fig. Additional examples of mechanical compression assay.

(A) Confocal images of 3 dpf animals treated with 2% DMSO expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) during resting phase, compression phase, and decompression phase. Quantifications of the change of fluorescence during each phase is shown below images. (B) Confocal images of 3 dpf animals treated with 1 μM GsMTx4 expressing Tg(sox10:gal4); Tg(uas:GCaMP6s) during resting phase, compression phase, and decompression phase. Quantifications of the change of fluorescence during each phase is shown below images. Arrows in all images identify DRG being measured during the assay. The data underlying this figure can be found in S1 Data.

https://doi.org/10.1371/journal.pbio.3002319.s010

(TIF)

S1 Table. Statistics for Study.

Summary of statistical information for each figure panel.

https://doi.org/10.1371/journal.pbio.3002319.s011

(XLSX)

S1 Data. Summary of all data reported in each figure.

https://doi.org/10.1371/journal.pbio.3002319.s012

(XLSX)

Acknowledgments

We thank members of the Wingert, Patzke and Smith labs for helpful discussions. Thank you to David Lyons for sharing GCaMP6s transgenic zebrafish. We also thank 3i for fielding imaging-related questions and Deborah Bang, Brittany Gervais, and others for zebrafish housing and upkeep.

References

  1. 1. Triplett MA, Avitan L, Goodhill GJ. Emergence of spontaneous assembly activity in developing neural networks without afferent input. PLoS Comput Biol. 2018;14:1–22. pmid:30265665
  2. 2. Pietri T, Romano SA, Pérez-Schuster V, Boulanger-Weill J, Candat V, Sumbre G. The Emergence of the Spatial Structure of Tectal Spontaneous Activity Is Independent of Visual Inputs. Cell Rep. 2017;19:939–948. pmid:28467907
  3. 3. Avitan L, Pujic Z, Mo J, Amor R, Scott EK, Goodhill GJ, et al. Spontaneous Activity in the Zebrafish Tectum Reorganizes over Development and Is Influenced by Article Spontaneous Activity in the Zebrafish Tectum Reorganizes over Development and Is Influenced by Visual Experience. 2017;2407–2419. pmid:28781054
  4. 4. Ma Z, Stork T, Bergles DE, Freeman MR. Neuromodulators signal through astrocytes to alter neural circuit activity and behaviour. Nature. 2016;539:428–432. pmid:27828941
  5. 5. Sasaki T, Ishikawa T, Abe R, Nakayama R, Asada A, Matsuki N, et al. Astrocyte calcium signalling orchestrates neuronal synchronization in organotypic hippocampal slices. J Physiol. 2014;592:2771–2783. pmid:24710057
  6. 6. Stobart JL, Ferrari KD, Barrett MJP, Stobart MJ, Looser ZJ, Saab AS, et al. Long-term in vivo calcium imaging of astrocytes reveals distinct cellular compartment responses to sensory stimulation. Cereb Cortex. 2018;28:184–198. pmid:28968832
  7. 7. Kuijlaars J, Oyelami T, Diels A, Rohrbacher J, Versweyveld S, Meneghello G, et al. Sustained synchronized neuronal network activity in a human astrocyte co-culture system. Sci Rep. 2016;6:1–14. pmid:27819315
  8. 8. Ma Z, Freeman MR. Trpml-mediated astrocyte microdomain ca2+ transients regulate astrocyte-tracheal interactions. Elife. 2020;9:1–18. pmid:33284108
  9. 9. Rui Y, Pollitt SL, Myers KR, Feng Y, Zheng JQ. Spontaneous local calcium transients regulate oligodendrocyte development in culture through store-operated ca2+ entry and release. eNeuro. 2020;7:1–16. pmid:32409508
  10. 10. Baraban M, Koudelka S, Lyons DA. Ca 2+ activity signatures of myelin sheath formation and growth in vivo. Nat Neurosci. 2018;21:19–25. pmid:29230058
  11. 11. Hösli L, Binini N, Ferrari KD, Thieren L, Looser ZJ, Zuend M, et al. Decoupling astrocytes in adult mice impairs synaptic plasticity and spatial learning. Cell Rep. 2022;38. pmid:35263595
  12. 12. Weiss S, Clamon LC, Manoim JE, Ormerod KG, Parnas M, Littleton JT. Glial ER and GAP junction mediated Ca2+ waves are crucial to maintain normal brain excitability. Glia. 2022;70:123–144. pmid:34528727
  13. 13. Serinagaoglu Y, Paré J, Giovannini M, Cao X. Nf2-Yap signaling controls the expansion of DRG progenitors and glia during DRG development. Dev Biol. 2015;398:97–109. pmid:25433207
  14. 14. Coronas V, Terrié E, Déliot N, Arnault P, Constantin B. Calcium Channels in Adult Brain Neural Stem Cells and in Glioblastoma Stem Cells. Front Cell Neurosci. 2020;14:1–22. pmid:33281564
  15. 15. Venkatesh HS, Morishita W, Geraghty AC, Silverbush D, Gillespie SM, Arzt M, et al. Electrical and synaptic integration of glioma into neural circuits. Nature. 2019;573:539–545. pmid:31534222
  16. 16. Chen X, Wanggou S, Bodalia A, Zhu M, Dong W, Fan JJ, et al. A Feedforward Mechanism Mediated by Mechanosensitive Ion Channel PIEZO1 and Tissue Mechanics Promotes Glioma Aggression. Neuron. 2018;100:799–815.e7. pmid:30344046
  17. 17. Armstrong DM. Glutamate Receptor Subtypes Mediate Excitatory of Dopamine Neurons in Midbrain Slices Synaptic Currents. 1991;3–4.
  18. 18. Cheramy A, Leviel V, Glowinski J. Dendritic release of dopamine in the substantia nigra. 1981;289:537–542. pmid:6258083
  19. 19. Micu I, Jiang Q, Coderre E, Ridsdale A, Zhang L, Woulfe J, et al. NMDA receptors mediate calcium accumulation in myelin during chemical ischaemia. Nature. 2006;439:988–992. pmid:16372019
  20. 20. Káradóttir R, Cavelier P, Bergersen LH, Attwell D. NMDA receptors are expressed in oligodendrocytes and activated in ischaemia. Nature. 2005;438:1162–1166. pmid:16372011
  21. 21. Rose CR, Felix L, Zeug A, Dietrich D, Reiner A, Henneberger C, et al. Astroglial Glutamate Signaling and Uptake in the Hippocampus. 2018;10:1–20. pmid:29386994
  22. 22. Gonzalez A, Almeida A, Bolaños JP. Astrocyte NMDA receptors ‘ activity sustains neuronal survival through a Cdk5 –Nrf2 pathway. 2015;1877–1889. pmid:25909891
  23. 23. Bowser DN, Khakh BS. ATP Excites Interneurons and Astrocytes to Increase Synaptic Inhibition in Neuronal Networks. 2004;24:8606–8620. pmid:15456834
  24. 24. Zhang J, Wang H, Ye C, Ge W, Chen Y, Jiang Z, et al. ATP Released by Astrocytes Mediates Heterosynaptic Suppression. 2003;40:971–982.
  25. 25. Puerto A, Wandosell F, Garrido JJ. Neuronal and glial purinergic receptors functions in neuron development and brain disease. 2013;7:1–15. pmid:24191147
  26. 26. Koser DE, Thompson AJ, Foster SK, Dwivedy A, Pillai EK, Sheridan GK, et al. Mechanosensing is critical for axon growth in the developing brain. Nat Neurosci. 2016;19:1592–1598. pmid:27643431
  27. 27. Espinosa-Hoyos D, Burstein SR, Cha J, Jain T, Nijsure M, Jagielska A, et al. Mechanosensitivity of Human Oligodendrocytes. Front Cell Neurosci. 2020;14:1–15. pmid:32848617
  28. 28. Song Y, Li D, Farrelly O, Miles L, Li F, Kim SE, et al. The Mechanosensitive Ion Channel Piezo Inhibits Axon Regeneration. Neuron. 2019;102:373–389.e6. pmid:30819546
  29. 29. Pathak MM, Nourse JL, Tran T, Hwe J, Arulmoli J, Le DTT, et al. Stretch-activated ion channel Piezo1 directs lineage choice in human neural stem cells. Proc Natl Acad Sci U S A. 2014;111:16148–16153. pmid:25349416
  30. 30. Hill RZ, Loud MC, Dubin AE, Peet B, Patapoutian A. PIEZO1 transduces mechanical itch in mice. Nature. 2022;607:104–110. pmid:35732741
  31. 31. Wang J, La JH, Hamill OP. PIEZO1 is selectively expressed in small diameter mouse DRG neurons distinct from neurons strongly expressing TRPV1. Front Mol Neurosci. 2019;12:1–15. pmid:31379500
  32. 32. Abdo H, Calvo-Enrique L, Lopez JM, Song J, Zhang MD, Usoskin D, et al. Specialized cutaneous schwann cells initiate pain sensation. Science (80-). 2019;365:695–699. pmid:31416963
  33. 33. Ackerman SD, Perez-Catalan NA, Freeman MR, Doe CQ. Astrocytes close a motor circuit critical period. Nature. 2021;592:414–420. pmid:33828296
  34. 34. Shigetomi E, Tong X, Kwan KY, Corey DP, Khakh BS. TRPA1 channels regulate astrocyte resting calcium and inhibitory synapse efficacy through GAT-3. Nat Neurosci. 2012;15:70–80. pmid:22158513
  35. 35. Rammensee S, Kang MS, Georgiou K, Kumar S, Schaffer D V. Dynamics of Mechanosensitive Neural Stem Cell Differentiation. Stem Cells. 2017;35:497–506. pmid:27573749
  36. 36. Marinval N, Chew SY. Mechanotransduction assays for neural regeneration strategies: A focus on glial cells. APL Bioeng. 2021;5. pmid:33948526
  37. 37. Maniglier M, Vidal M, Bachelin C, Deboux C, Chazot J, Garcia-Diaz B, et al. Satellite glia of the adult dorsal root ganglia harbor stem cells that yield glia under physiological conditions and neurons in response to injury. Stem Cell Reports. 2022;17:2467–2483. pmid:36351367
  38. 38. Nichols EL, Green LA, Smith CJ. Ensheathing cells utilize dynamic tiling of neuronal somas in development and injury as early as neuronal differentiation. Neural Dev. 2018;13:19. pmid:30121077
  39. 39. Mazaud D, Capano A, Rouach N. The many ways astroglial connexins regulate neurotransmission and behavior. Glia. 2021;69:2527–2545. pmid:34101261
  40. 40. Mu Y, Bennett D V., Rubinov M, Narayan S, Yang CT, Tanimoto M, et al. Glia Accumulate Evidence that Actions Are Futile and Suppress Unsuccessful Behavior. Cell. 2019;178:27–43.e19. pmid:31230713
  41. 41. Hughes AN, Appel B. Oligodendrocytes express synaptic proteins that modulate myelin sheath formation. Nat Commun. 2019;10:1–15. pmid:31511515
  42. 42. Hanani M, Spray DC. Emerging importance of satellite glia in nervous system function and dysfunction. Nat Rev Neurosci. 2020;21:485–498. pmid:32699292
  43. 43. Huang T, Belzer V, Hanani M. Gap junctions in dorsal root ganglia: Possible contribution to visceral pain. Eur J Pain. 2010;14:49.e1–49.e11. pmid:19345595
  44. 44. Huang LYM, Gu Y, Chen Y. Communication between neuronal somata and satellite glial cells in sensory ganglia. Glia. 2013;61:1571–1581. pmid:23918214
  45. 45. Retamal MA, Riquelme MA, Stehberg J, Alcayaga J. Connexin43 hemichannels in satellite glial cells, can they influence sensory neuron activity? Front Mol Neurosci. 2017;10:1–9. pmid:29200997
  46. 46. Komiya H, Shimizu K, Ishii K, Kudo H, Okamura T, Kanno K, et al. Connexin 43 expression in satellite glial cells contributes to ectopic tooth-pulp pain. J Oral Sci. 2018;60:493–499. pmid:30587684
  47. 47. Ohara PT, Vit JP, Bhargava A, Jasmin L. Evidence for a role of connexin 43 in trigeminal pain using RNA interference in vivo. J Neurophysiol. 2008;100:3064–3073. pmid:18715894
  48. 48. Syeda R, Xu J, Dubin AE, Coste B, Mathur J, Huynh T, et al. Chemical activation of the mechanotransduction channel Piezo1. Elife. 2015;4:1–11. pmid:26001275
  49. 49. Wang Y, Chi S, Guo H, Li G, Wang L, Zhao Q, et al. A lever-like transduction pathway for long-distance chemical- and mechano-gating of the mechanosensitive Piezo1 channel. Nat Commun. 2018;9. pmid:29610524
  50. 50. Ablain J, Durand EM, Yang S, Zhou Y, Zon LI. A CRISPR/Cas9 vector system for tissue-specific gene disruption in zebrafish. Dev Cell. 2015;32:756–764. pmid:25752963
  51. 51. Antinucci P, Dumitrescu AS, Deleuze C, Morley HJ, Leung K, Hagley T, et al. A calibrated optogenetic toolbox of stable zebrafish opsin lines. Elife. 2020;9:1–31. pmid:32216873
  52. 52. Kikel-Coury NL, Green LA, Nichols EL, Zellmer AM, Pai S, Hedlund SA, et al. Pioneer axons utilize a Dcc signaling-mediated invasion brake to precisely complete their pathfinding odyssey. J Neurosci. 2021;41:6617–6636. pmid:34131031
  53. 53. Nichols EL, Smith CJ. Pioneer axons employ Cajal’s battering ram to enter the spinal cord. Nat Commun. 2019;10. pmid:30718484
  54. 54. Chen Y, Huang LYM. A simple and fast method to image calcium activity of neurons from intact dorsal root ganglia using fluorescent chemical Ca2+ indicators. Mol Pain. 2017;13:1–9. pmid:29212403
  55. 55. Teichert RW, Smith NJ, Raghuraman S, Yoshikami D, Light AR, Olivera BM. Functional profiling of neurons through cellular neuropharmacology. Proc Natl Acad Sci U S A. 2012;109:1388–1395. pmid:22307590
  56. 56. Suadicani SO, Cherkas PS, Zuckerman J, Smith DN, Spray DC, Hanani M. Bidirectional calcium signaling between satellite glial cells and neurons in cultured mouse trigeminal ganglia. Neuron Glia Biol. 2010;6:43–51. pmid:19891813
  57. 57. Zhang X, Chen Y, Wang C, Huang LYM. Neuronal somatic ATP release triggers neuron-satellite glial cell communication in dorsal root ganglia. Proc Natl Acad Sci U S A. 2007;104:9864–9869. pmid:17525149
  58. 58. Chen C, Zhang J, Sun L, Zhang Y, Gan WB, Tang P, et al. Long-term imaging of dorsal root ganglia in awake behaving mice. Nat Commun. 2019;10:1–11. pmid:31300648
  59. 59. Chisholm KI, Khovanov N, Lopes DM, La Russa F, McMahon SB. Large scale in vivo recording of sensory neuron activity with GCaMP6. eNeuro. 2018;5:1–14. pmid:29662940
  60. 60. Yaganoglu S, Kalyviotis K, Vagena-Pantoula C, Jülich D, Gaub BM, Welling M, et al. Highly specific and non-invasive imaging of Piezo1-dependent activity across scales using GenEPi. Nat Commun. 2023;14. pmid:37468521
  61. 61. Segel M, Neumann B, Hill MFE, Weber IP, Viscomi C, Zhao C, et al. Niche stiffness underlies the ageing of central nervous system progenitor cells. Nature. 2019;573:130–134. pmid:31413369
  62. 62. Dasgupta I, McCollum D. Control of cellular responses to mechanical cues through YAP/TAZ regulation. J Biol Chem. 2019;294:17693–17706. pmid:31594864
  63. 63. Ranade SS, Qiu Z, Woo SH, Hur SS, Murthy SE, Cahalan SM, et al. Piezo1, a mechanically activated ion channel, is required for vascular development in mice. Proc Natl Acad Sci U S A. 2014;111:10347–10352. pmid:24958852
  64. 64. Hines JH, Ravanelli AM, Schwindt R, Scott EK, Appel B. Neuronal activity biases axon selection for myelination in vivo. Nat Neurosci. 2015;18:683–689. pmid:25849987
  65. 65. Thiele TR, Donovan JC, Baier H. Descending Control of Swim Posture by a Midbrain Nucleus in Zebrafish. Neuron. 2014;83:679–691. pmid:25066082
  66. 66. Nichols EL, Smith CJ. Synaptic-like Vesicles Facilitate Pioneer Axon Invasion. Curr Biol. 2019;29:2652–2664.e4. pmid:31378609
  67. 67. Kirby BB, Takada N, Latimer AJ, Shin J, Carney TJ, Kelsh RN, et al. In vivo time-lapse imaging shows dynamic oligodendrocyte progenitor behavior during zebrafish development. Nat Neurosci. 2006;9:1506–1511. pmid:17099706
  68. 68. McGraw HF, Snelson CD, Prendergast A, Suli A, Raible DW. Postembryonic neuronal addition in Zebrafish dorsal root ganglia is regulated by Notch signaling. Neural Dev. 2012;7:1–13. pmid:22738203
  69. 69. McGraw HF, Nechiporuk A, Raible DW. Zebrafish dorsal root ganglia neural precursor cells adopt a glial fate in the absence of neurogenin1. J Neurosci. 2008;28:12558–12569. pmid:19020048
  70. 70. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. pmid:8589427