Skip to main content
Advertisement
  • Loading metrics

Ets1-Related Protein Is a Key Regulator of Vasculogenesis in Zebrafish

  • Saulius Sumanas,

    Affiliation Department of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, United States of America

  • Shuo Lin

    To whom correspondence should be addressed. E-mail: shuolin@ucla.edu

    Affiliation Department of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, United States of America

Abstract

During embryonic development, multiple signaling pathways control specification, migration, and differentiation of the vascular endothelial cell precursors, angioblasts. No single gene responsible for the commitment of mesenchymal cells to the angioblast cell fate has been identified as yet. Here we report characterization and functional studies of Etsrp, a novel zebrafish ETS domain protein. etsrp embryonic expression is only restricted to vascular endothelial cells and their earliest precursors. Morpholino knockdown of Etsrp protein function resulted in the complete absence of circulation in zebrafish embryos. Angioblasts in etsrp–morpholino-injected embryos (morphants) failed to undergo migration and differentiation and did not coalesce into functional blood vessels. Expression of all vascular endothelial molecular markers tested was severely reduced in etsrp morphants, whereas hematopoietic markers were not affected. Overexpression of etsrp RNA caused multiple cell types to express vascular endothelial markers. etsrp RNA restored expression of vascular markers in cloche mutants, defective in hematopoietic and endothelial cell formation, arguing that etsrp functions downstream of cloche in angioblast formation. etsrp gene function was also required for endothelial marker induction by the vascular endothelial growth factor (vegf) and stem cell leukemia (scl/tal1). These results demonstrate that Etsrp is necessary and sufficient for the initiation of vasculogenesis.

Introduction

Vasculogenesis, or formation of vascular endothelial cells de novo, begins very early after the initiation of gastrulation in a vertebrate embryo. In a mammalian embryo, vasculogenesis starts with the formation of the blood islands in the yolk sac and angioblast precursors in the head mesenchyme [1]. In the zebrafish, the first angioblasts arise from the lateral plate mesoderm, migrate to the trunk midline between ten- and 15-somite stages in response to hedgehog signaling, and coalesce to form the primary axial vessels of the trunk, the dorsal aorta, and the cardinal vein [24]. During subsequent angiogenesis, the axial vessels sprout to form secondary vessels in the trunk region of a zebrafish embryo [5]. In the zebrafish, as well as the mammalian yolk sac, there is a close association between the primitive hematopoietic cells and the developing endothelium, suggestive of a common precursor, the hemangioblast [6]. Zebrafish cloche mutants lack nearly all blood and endothelial cells suggesting that the hemangioblast lineage has been affected [7,8]. A basic helix-loop-helix transcription factor Scl/tal1 is expressed in hematopoietic and endothelial cells in both mouse and zebrafish suggesting a possible role in specification of the hemangioblast [912]. Recent knockdown analysis has demonstrated its essential function in blood and dorsal aorta formation in zebrafish embryos [13,14].

Members of the Ets family of transcription factors play multiple roles during vasculogenesis, angiogenesis, and hematopoiesis [15]. They share a conserved DNA-binding domain of 85 amino acids which folds into a winged helix-turn-helix motif. Ets1, the founding member of the family, is expressed in the embryonic endothelial cells as well as putative hemangioblasts, lymphoid precursors, and myeloid hematopoietic cells [1619]. The expression of Ets1 transcripts is associated in vivo with the activation of endothelial cells and the induction of angiogenesis. In vitro, Ets1 is expressed by proliferating and migrating endothelial cells but not after these cells have reached confluence [20,21]. In endothelial cells in vitro, Ets1 has been shown to regulate expression of the two vascular endothelial growth factor (Vegf) receptors Flt1 and Flk1 [22,23], the endothelial cell-specific adhesion protein VE-cadherin [24], the vascular-specific tyrosine kinases Tie1 and Tie2 [25], and numerous other target genes [15]. Ets1 antisense oligonucleotides inhibited angiogenesis in vitro [26,27]. However, no defects in vascular development have been found in the mouse embryos, nearly completely deficient in Ets1 function [28,29]. Therefore, the function of Ets1 in vascular development in vivo, if any, remains unclear.

A different Ets family member Fli1 has been implicated in mouse megakaryopoiesis, hemostasis, and maintenance of vascular integrity [30,31]. Zebrafish fli1 homolog is expressed during early somitogenesis in the putative hemangioblast cells, while later being restricted to vascular endothelial cells [32].

Recently, an endothelial-cell-specific Ets1-related zebrafish protein Etsrp has been identified [33]. In the current study, we demonstrate a critical role of Etsrp during vasculogenesis. In the absence of Etsrp, angioblast precursors fail to migrate, differentiate, and coalesce into functional vessels. Furthermore, ectopic expression of etsrp is sufficient to induce endothelial markers in a variety of different cell types throughout the embryo. These results suggest that Etsrp functions as a critical regulatory gene, directing etsrp-expressing cells to adopt vascular endothelial cell fate during embryonic development.

Results

Etsrp Encodes a Novel Ets1-Related Protein

A novel Ets1-related protein Etsrp has been identified in a recent microarray study of the zebrafish cloche mutants [33]. We performed detailed analysis of the protein sequence and its developmental expression pattern. Etsrp-predicted protein sequence contains 366 amino acids and displays 29% identity (37% similarity) to the human Ets1 protein and 26% identity (34% similarity) to the human Ets2 (Figure 1A) (unpublished data). Although Etsrp and hEts1 proteins are 88% similar within the ETS domain region (Figure 1A), there is little similarity between the two proteins within the rest of the sequence, therefore Etsrp may not be a functional ortholog of the Ets1 protein. Supporting this idea, a recently published protein sequence of the zebrafish, Ets1 homolog, was found to be highly similar to the Ets1 subfamily throughout most of the protein sequence (Figure 1A) [34]. No other homology domains were found outside the ETS domain of Etsrp. We were unable to find an apparent Etsrp ortholog in other species. As evident from the homology tree, Etsrp is the most closely related to Ets1 and Ets2 subfamilies (Figure 1B). We performed synteny analysis of human, mouse, and zebrafish ets1 or etsrp chromosomal regions. Human and mouse ets1 genes are positioned next to fli1 genes, which encode related ETS domain proteins (Figure 1C). ets1 and fli1 genes are transcribed in opposite directions and are likely to have originated from the same ancestral precursor via gene duplication. Zebrafish etsrp is also positioned in the opposite direction and next to a fli1-related gene fli1b [34]. This analysis suggests that etsrp is evolutionarily related to the mammalian ets1 genes. As the zebrafish genome has undergone an additional duplication [35], etsrp and ets1 may have diverged from each other and acquired separate functions. Alternatively, it is possible that ets1 duplicated prior to the divergence of teleosts and tetrapods, and etsrp was subsequently lost in the tetrapod lineage.

thumbnail
Figure 1. Sequence Analysis of the Zebrafish Ets1-Related Protein Etsrp

(A) Shows alignment of Etsrp and its closest human and zebrafish homologs Ets1 proteins. Etsrp and hEts1 share 88% homology within the ETS DNA-binding domain (underlined in red), and a very limited homology within the rest of the sequence. Identical and similar amino acids are shaded in grey. (B) The homology tree of Etsrp and its closest human, mouse, and zebrafish homologs. Length of horizontal branches is directly proportional to the evolutionary distance between the proteins. Zebrafish Ets1 and Ets2 protein sequences have been predicted using the available EST sequences TC282499 and TC270146 (http://www.tigr.org). GeneWorks 2.5 has been used to build the alignment and the homology tree. (C) Chromosomal location of the zebrafish etsrp, mouse, and human ets1 genes. In all cases, they are positioned next to a fli1 homolog.

https://doi.org/10.1371/journal.pbio.0040010.g001

Etsrp Expression Pattern Analysis

We analyzed the expression pattern of etsrp RNA in early embryos using in situ hybridization. No expression was observed prior to the one-somite stage (unpublished data). From the two-somite stage onward, etsrp RNA was localized to two stripes of cells within the lateral mesoderm (five-somite embryo, Figure 2A). Two distinct expression domains, in the anterior and posterior parts of an embryo, were apparent. The anterior stripes merged at the prechordal plate. The etsrp-expressing cells are likely endothelial cell precursors based on the expression of the gene at later stages. At the 15-somite stage, expression in two bilateral stripes of cells within the lateral mesoderm in the anterior and middle/posterior parts of an embryo, was apparent (Figure 2B–2D). In addition, a stripe of etsrp-expressing cells was noted at the midline and extended through the trunk and posterior parts of an embryo. The middle stripe likely represents the endothelial precursor cells that have already migrated to the future intermediate cell mass (ICM) region. By 26 hours-post-fertilization (hpf), etsrp was expressed in vascular endothelial cells in the embryo marking main axial, head, and intersegmental vessels (Figure 2E). In addition, a group of etsrp-expressing cells was located in the intermediate mesoderm region (Figure 2E and 2F). These cells which by 36 hpf were located close to the pronephros (Figure 2G), and appeared to migrate posteriorly, may represent endothelial cell precursors of pronephric vessels and/or gut vessels. By 36 hpf etsrp expression had mostly disappeared from the axial vessels and was prominent in a subset of head vessels, aortic arches, the cardinal vein plexus region, posterior intersomitic vessels, and the dorsal longitudinal anastomotic vessel (Figure 2G). At 52 hpf, etsrp expression was observed in a subset of head vessels, the common cardinal vein, blood vessels of the pectoral fin, the cardinal vein plexus region, and weakly in posterior intersegmental vessels and the dorsal vessel (Figure 2H).

thumbnail
Figure 2. Expression Pattern of etsrp as Analyzed by In Situ Hybridization

Anterior is to the left except as noted. (A) five-somite stage. etsrp is expressed within lateral mesoderm in two distinct expression domains, in the anterior and posterior parts of an embryo. (B) 15-somite stage, lateral view. (C) dorsal view. (D) transverse section. etsrp is expressed in two bilateral stripes of presumptive angioblasts within the lateral mesoderm in the anterior and the trunk and posterior parts of an embryo (arrows, D). In addition, a stripe of etsrp-expressing cells is apparent at the midline and extends through the middle and posterior parts of an embryo (arrowhead, C and D). (E) 26 hpf stage. etsrp is expressed in vascular endothelial cells of the axial, head, and intersomitic vessels. Note a group of etsrp-expressing cells bilaterally located in the intermediate mesoderm (arrowhead). (F) Transverse section through the trunk region of a 30 hpf embryo. Arrowhead shows one of the etsrp-expressing cells located within the lateral/intermediate mesoderm. Expression of etsrp in the axial vessels is weak at this stage and not apparent in this section. nt, neural tube; n, notochord; y, yolk. (G) 36 hpf stage. etsrp is expressed in a subset of head vessels, the aortic arches (aa), the cardinal vein plexus (pl) region, posterior intersomitic vessels, and the dorsal longitudinal anastomotic vessel (dlav). Note a group of etsrp-expressing cells located in the endodermal region (arrowhead). (H) 52 hpf stage. etsrp expression is observed in a subset of head vessels, common cardinal vein, pectoral fin bud blood vessels (fb), cardinal vein plexus region, and weakly in posterior intersegmental vessels and the dorsal vessel.

https://doi.org/10.1371/journal.pbio.0040010.g002

Morpholino Knockdown of Etsrp Function Results in Loss of Circulation

We used antisense morpholino (MO) oligonucleotides [36,37] to knockdown the function of Etsrp. Etsrp–MO-injected embryos (morphants) showed no apparent circulation. While red blood cells were actively circulating in wild-type (wt) embryos at 34 hpf, in etsrp morphants they stayed at their formation site, the ICM region (Figure 3A and 3B). This observation was confirmed by the o-dianisidine staining of heme in the red blood cells (Figure 3C–3E). We performed microangiography analysis by injecting fluorescein-labeled high molecular weight dextran into the sinus venosus of the 2-day-old embryos. Lower doses of etsrp MOs caused partial loss of circulation in the intersegmental and axial vessels, particularly, in the posterior part of the embryo (Figure 3F and 3G). Head circulation was not affected at this dose (Figure 3G). Higher doses of etsrp MOs resulted in the complete loss of functional blood vessels (Figure 3H and 3I, Table 1). Other than the described defects, etsrp morphants appeared morphologically normal (Figure 3B). At 2–3 days-post-fertilization (dpf), etsrp morphants developed pericardial edema and eventually became necrotic and died (unpublished data). Injection of two different etsrp-specific translation-blocking MOs resulted in similar circulatory defects, demonstrating specificity of the observed phenotype (Table 1). To confirm that etsrp MOs were specifically inhibiting synthesis of Etsrp protein, we generated etsrp–green fluorescent protein (GFP) modified bacterial artificial chromosome (BAC). BAC construct of approximately 250 kilobases containing etsrp gene was modified using recA-mediated homologous recombination to replace etsrp coding sequence with GFP [38]. Microinjection of etsrp-GFP BAC resulted in the mosaic GFP expression (Figure S1A). Etsrp MO2, directed against the 5′ UTR of etsrp, completely inhibited this transient GFP expression (Figure S1B). Control injection of a 5-base mismatch MO had no effect on GFP expression (Figure S1C). These results confirm that etsrp MOs specifically inhibit etsrp gene function. Microinjection of a low dose of etsrp MO into flk1-GFP transgenic embryos [39] resulted in partial loss of flk1 expression in intersegmental vessels (Figure 3J–3L). High doses of etsrp MOs resulted in nearly complete loss of flk1 expression in axial vessels and strong downregulation of its expression in head vessels (Figure 3M).

thumbnail
Figure 3. MO Knockdown of Etsrp Protein Function Disrupts Blood Vessel Formation in the Zebrafish Embryos

(A,B) Morphological analysis of live etsrp morphants at 34 hpf. (A) Uninjected control embryo. (B) 5 ng of etsrp MO1-injected embryo. Notice that red blood cells are scattered throughout the circulatory system in the control uninjected embryo while they accumulate at their formation site within the intermediate cell mass (arrow, B) in the etsrp morphant. (C–E) o-dianisidine staining of heme in the red blood cells of uninjected control (C), 5 ng of etsrp MO1-injected (D) and 5 ng of etsrp MO2-injected (E) embryos at 34 hpf. While many circulating blood cells are apparent within the common cardinal vein before entering the heart in the control embryo (arrow, C), they stay at their formation site within the ICM region in etsrp morphants (arrows). (F–I) Microangiography analysis of the circulatory system by injecting fluorescein-labeled dextran into the sinus venosus of etsrp morphants at 55 hpf. (F) Control uninjected, (G) 1 ng of etsrp MO1-injected (H) 2.5 ng of etsrp MO1-injected (I) 5 ng of etsrp MO1-injected embryos. Note that the embryo in (G) has lost circulation in the posterior vessels, the embryo in (H) has lost circulation in most vessels, and the embryo in (I) has no circulation at all. (J–M) Analysis of blood vessels in live flk1-GFP transgenic embryos at 26 hpf. (J) Control uninjected, (K) 1 ng of etsrp MO1-injected, (L) 2.5 ng of etsrp MO1-injected, (M) 15 ng of etsrp MO1+MO2 (1:1) mix-injected embryos. Note the gaps in formation of intersegmental vessels in (K) (arrowhead), the missing (arrowhead) and abnormally branched, (arrow) intersegmental vessels in (L), and the nearly completely eliminated flk1 expression from axial vessels (arrow) in (M).

https://doi.org/10.1371/journal.pbio.0040010.g003

thumbnail
Table 1. Dose Dependence of Etsrp MO Phenotype

https://doi.org/10.1371/journal.pbio.0040010.t001

Vascular Endothelial Markers Are Lost in Etsrp Morphants

We performed analysis of different molecular markers in etsrp morphants using high doses of etsrp MOs. Kinase insert domain receptor (kdr, flk1) [40], cadherin 5 (cdh5, VE-cadherin) [41], adrenomedullin receptor (admr) [42], dual specificity phosphatase 5 (dusp5) [42], and C1qR-like (crl) [42] genes are expressed in all vascular endothelial cells while fms-related tyrosine kinase 4 (flt4) [40] is restricted to the venous vessels in early zebrafish embryos. Expression of all of these markers in axial and intersegmental vessels was nearly completely abolished in etsrp morphants at 24 hpf (Figure 4A–4L). Head vessel expression, however, was reduced but still apparent even at high MO doses (Figure 4A–4D) (unpublished data). We were unable to use even higher MO doses to attempt to completely eliminate Etsrp function due to mild toxic effects observed at doses above 15 ng (unpublished data).

thumbnail
Figure 4. Molecular Analysis of Vascular Endothelial and Hematopoietic Markers in etsrp Morphants

(A, C, E, G, I, K, M, O, Q, S) Uninjected control embryo; (D, H, J, L, P, R, T) 8 ng etsrp MO2-injected embryo; (B, F, N) 12 ng etsrp MO1+MO2 (1:1) mix-injected embryos for the maximum knockdown. All embryos are at 24 hpf, except as noted. Scale bar, 0.2 mm. (A,B) flk1 expression; (C,D) admr expression; (E,F) cdh5 expression; (G,H) dusp5 expression; (I,J) flt4 expression; (K,L) crl expression. Note that the vascular expression of the markers in (A–L) is almost absent in etsrp morphants. (M,N) fli1 expression; (O,P) etsrp expression. Note the more intense etsrp expression and reduced fli1 expression in angioblasts which remain dispersed and fail to coalesce into blood vessels in etsrp morphants. Inset, (P) DIC image of scattered angioblasts in etsrp morphants. (Q,R) scl expression, 22 hpf. Note that scl expression appears unaffected at this stage except for more intense staining in a subset of head vessels in etsrp morphants (arrowhead). (S,T) gata1 expression, 22 somites. Note that no significant difference in hematopoietic gata1 expression is observed between the control embryos and etsrp morphants.

https://doi.org/10.1371/journal.pbio.0040010.g004

Expression of friend leukemia integration 1 (fli1) [40] was downregulated but still apparent in etsrp morphants (Figure 4M and 4N). Interestingly, expression of etsrp itself was upregulated in etsrp morphants, suggesting the presence of a negative autoregulatory loop (Figure 4O and 4P). However, the number of etsrp-expressing angioblasts was reduced in etsrp morphants. These angioblasts remained scattered within the lateral mesoderm failing to coalesce into functional blood vessels (Figure 4P). Formation of hematopoietic precursors appeared unaffected as evident from scl and gata1 expression (Figure 4Q–4T).

We analyzed formation of hematopoietic and vascular progenitors during early somitogenesis stages. A transcription factor scl is expressed in both hematopoietic and vascular endothelial cell precursors [12]. Expression of scl in etsrp morphants was reduced in the anterior domain and absent from the trunk domain while its posterior expression was not affected at the six- and ten-somite stages (Figure 5A–5D). fli1 is expressed in the putative hemangioblast cells while later being restricted to vascular endothelial cells [32]. Anterior expression of fli1 was absent in etsrp morphants while its tail expression was not affected at the six-somite stage (Figure 5E and 5G). At the ten-somite stage, fli1 expression in etsrp morphants was absent from the anterior and trunk domains (Figure 5F and 5H). As described earlier, angioblasts migrate from the lateral mesoderm towards the midline during somitogenesis [2,3]. etsrp-expressing angioblasts were present within the lateral mesoderm but failed to migrate towards the midline in etsrp morphants (Figure 5I–5L). Also, no scl- or fli1-expressing migrating angioblasts were observed in etsrp morphants (unpublished data). etsrp expression level within the angioblasts was strongly increased in etsrp morphants suggesting the presence of negative autoregulation. All of the etsrp-expression domains, including the trunk domain, were present in etsrp morphants (Figure 5I–5L) (unpublished data).

thumbnail
Figure 5. Molecular Analysis of Early Vasculogenesis in etsrp Morphants

(A, B, E, F, I, K) Uninjected control embryo; (C, D, G, H, J, L) 8–10 ng etsrp MO2-injected embryo. Anterior is to the left in all panels. (A–H) Embryos were flat mounted with their yolk removed. (A–D) scl expression; six-somite (A,C) and ten-somite (B,D) stages. Note that the anterior domain of scl expression (arrows) is reduced and the trunk domain (arrowheads) is missing in etsrp morphants. (E–H) fli1 expression; six-somite (E,G) and ten-somite (F,H) stages. Note that the anterior domain of fli1 expression (arrows) is missing in the etsrp morphants, while the posterior domain is not affected. Also note that the trunk domain of fli1 expression (arrowheads, F,H) is missing at the ten-somite stage in etsrp morphants. (I–L) Etsrp knockdown blocks angioblast migration towards the midline as assayed by etsrp expression at the 16-somite (I,J) and 20-somite (K,L) stages. (I,K) Uninjected control embryo; (J,L) 7.5 ng etsrp MO2-injected embryo. Dorsal view, anterior is to the left. Note that the midline stripe of angioblasts (arrows) is missing in etsrp morphants. Also notice more intense etsrp expression in pre-migratory angioblasts (arrowheads) in etsrp morphants as compared to control embryos.

https://doi.org/10.1371/journal.pbio.0040010.g005

Etsrp is Sufficient for the Vascular Endothelial Marker Induction

We analyzed if etsrp mRNA was sufficient for induction of the vascular endothelial markers. Injection of synthetic etsrp mRNA into zebrafish embryos at the 1–16 cell stage resulted in strong ectopic induction of vascular endothelial markers flk1, scl, fli1, and cdh5 during somitogenesis (Figure 6A–6F) (unpublished data). Large patches of intense ectopic flk1 expression were observed within different germ layers including dorsal, lateral, and ventral mesoderm, endoderm and neuroectoderm (Figure 6E and 6F) (unpublished data). No induction of hematopoietic marker gata1 was observed (Figure 6G and 6H). These results indicate that etsrp is sufficient to induce vascular endothelial gene expression in a variety of cell types. Furthermore, etsrp specifically induces vascular markers without affecting closely related hematopoiesis.

thumbnail
Figure 6. etsrp RNA Overexpression Induces Ectopic Expression of Vascular Endothelial Markers

Dorsal view, anterior to the left in all panels except for (E,F) which are lateral views. (A, C, E, and G) Control uninjected embryo; (B, D, F, and H) 100 pg of etsrp RNA-injected embryo. (A,B) scl expression at the eight-somite stage; (C,D) flk1 expression at the nine-somite stage. Note the strong ectopic induction of scl and fli1 upon overexpression of etsrp RNA. (E,F) Live flk1-GFP embryo at the 14-somite stage; fluorescent and transmitted light images were overlayed. Note the very strong ectopic induction of GFP expression in different tissues including neuroectoderm (arrow, F) upon etsrp RNA overexpression. Fluorescence in the control uninjected flk1-GFP embryo in (E) is not detectable under the same exposure. (G,H) gata1 expression at the 16-somite stage. Note that gata1 expression is not affected upon etsrp overexpression. (I–L) etsrp RNA induces flk1 expression in clo mutant embryos as analyzed using flk1 probe at the ten- to 12-somite stages. (I) wt (or clo+/−) embryo, (J) wt (or clo+/−) embryo injected with 100 pg of etsrp RNA, (K) clo−/− embryo, (L) clo−/−embryo injected with 100 pg of etsrp RNA. Note that in a clo+/− (or wt) embryo etsrp RNA induces ectopic flk1 (arrow, J) in addition to the endogenous flk1 expression (arrowheads, J) while clo-/− etsrp RNA-injected embryo shows only ectopic flk1 (arrows, L).

https://doi.org/10.1371/journal.pbio.0040010.g006

We tested if etsrp was sufficient for vascular induction in clo−/− mutant embryos. etsrp mRNA was injected into the progeny from clo+/− carriers, and the embryos were analyzed for flk1 expression at the ten- to 12-somite stages. As expected, 25% (23 out of 92) of the uninjected progeny from clo+/− carriers showed no flk1 expression. Among etsrp mRNA injected embryos (n = 110), 29% displayed normal flk1 expression pattern (with minor distortions in some embryos), 45% showed both endogenous and ectopic flk1 expression, 19% showed only ectopic flk1 expression, and 6% showed no detectable flk1 expression (Figure 6I–6L). The last two groups apparently represent clo−/− homozygous mutants. These results show that the induction of flk1 by etsrp is independent of clo function, suggesting that etsrp functions downstream of clo. etsrp mRNA did not fully restore the endogenous pattern of flk1 expression in clo−/− mutants most likely because it was expressed ubiquitously and not localized to vascular progenitors.

Etsrp Function Is Required for flk1 Induction by Vegf and Scl

We analyzed the epistatic relationship between vegf and etsrp. vegf overexpression has been reported to induce strong expression of vascular markers such as flk1 [43] (Figure 7A and 7B). Co-injection of vegf mRNA together with etsrp MO resulted in the loss of flk1 expression, similar to etsrp MO phenotype, indicating that etsrp function is required for flk1 induction by vegf signaling (Figure 7C and 7D). Downregulation of vegf expression resulted in the loss of etsrp expression in the intersegmental vessels (Figure 7E and 7F). etsrp expression in dorsal aorta was also not apparent while cardinal vein seemed expanded. This is consistent with the previous report of vegf involvement in regulating arterial fate in zebrafish [44]. Expression of etsrp was not affected in vegf morphants during mid-somitogenesis stages (unpublished data).

thumbnail
Figure 7. etsrp Is Required for vegf and scl Signaling

(A–D) Etsrp is required for Vegf signaling as assayed for flk1 expression at 26 hpf. (A) Control uninjected embryo, (B) vegf RNA-injected embryo, (C) 7.5 ng of etsrp MO2-injected embryo, (D) vegf RNA- and etsrp MO2-co-injected embryo. Note that vegf RNA induces strong flk1 expression in (B) while vegf RNA and etsrp MO co-injection results in loss of flk1 expression in (D), similar to the etsrp morphant phenotype in (C). (E,F) Etsrp expression analysis in Vegf morphants at 26 hpf. (E) Control uninjected embryo; (F) 10.5 ng of vegf MO-injected embryo. Note that vegf morphants have lost etsrp expression in the intersegmental vessels (arrowhead, E). (G–J) Scl knockdown affects gata1 but not etsrp expression at the 15-somite stage. Dorsal view, anterior is to the left. (G,I) Control uninjected embryo; (H,J) 10 ng scl UTR-MO-injected embryo. (G,H) gata1 expression; (I,J) etsrp expression. (K–N) Etsrp is required for scl signaling in clo mutants as analyzed for flk1 expression at the 15-somite stage. (K) Control uninjected embryo; (L) 7.5 ng etsrp MO2-injected embryo; (M) scl RNA-injected embryo; (N) scl RNA- and etsrp MO2-co-injected embryo. Note that scl RNA causes ectopic flk1 expression in (M) which is lost upon knockdown of Etsrp in (N).

https://doi.org/10.1371/journal.pbio.0040010.g007

Scl has been implicated in the hematopoietic and vascular development in zebrafish [13,14]. Downregulation of Scl function using two different MOs had no significant effect on the etsrp expression in angioblasts while the hematopoietic expression of gata1 was completely eliminated (Figure 7G–7J). Overexpression of scl mRNA has been reported to cause induction of vascular markers [45]. We tested if etsrp MO would block this induction by co-injecting it together with scl mRNA. The embryos were analyzed for flk1 expression at the 15-somite stage (Figure 7K–7N). As expected, no or only extremely weak flk1 expression was observed in etsrp–MO-injected embryos (Figure 7L). Overexpression of scl mRNA caused strong induction of flk1 (Figure 7M). Embryos, co-injected with scl mRNA and etsrp MO showed no or very weak flk1 expression (Figure 7N). These results demonstrate that etsrp function is required for flk1 induction by scl.

Discussion

In this study, we report characterization and functional analysis of a novel zebrafish Ets1-related protein, Etsrp. Knockdown of Etsrp resulted in the complete absence of functional blood vessels and downregulation of all endothelial-specific markers analyzed. In zebrafish, hedgehog signaling is necessary for migration of angioblasts from the lateral mesoderm toward the midline, where they subsequently differentiate within the ICM region [4]. Such migration is not apparent in the anterior region which gives rise to the anterior vessels including head vessels. Interestingly, vasculogenesis defects in etsrp morphants were more pronounced in the posterior region of the embryo which was particularly evident at lower downregulation levels. At high MO doses, endothelial cells were nearly completely absent from axial and intersegmental vessels. However, head expression of endothelial markers was not completely eliminated. It is possible that the remaining amount of Etsrp protein activity is sufficient for the head vasculogenesis. Upregulation of etsrp RNA was particularly strong in the head region in etsrp morphants, which may partially compensate for the MO-mediated translation inhibition. Alternatively, etsrp function may be redundant in the vasculogenesis of head vessels.

Among the vascular-specific genes analyzed, expression of only fli1 and scl was not globally downregulated in the early embryos. The early fli1 expression, which overlaps with the hematopoietic factor gata2 expression, is unaffected in the clo mutants and scl morphants and has been suggested to mark the common blood and vascular precursors, hemangioblasts [13,32]. fli1 is later expressed specifically in the vascular endothelial cell precursors, and this expression was reduced but not completely eliminated in etsrp morphants. fli1 expression may not be directly regulated by etsrp, therefore undifferentiated angioblasts retain some of fli1 expression in etsrp morphants. scl is expressed in both hematopoietic and vascular progenitors throughout most of the early development. Although we did not see global downregulation of scl expression in etsrp morphants, it is likely that scl expression is lost in angioblasts but retained in hematopoietic precursors. Interestingly, expression of both fli1 and scl genes was lost from the anterior and trunk domains of the lateral mesoderm. Anterior domain contains angioblast and myeloid progenitors, which appear to be absent from the etsrp morphants. The difference between the trunk and posterior lateral mesoderm has not been previously analyzed in great detail. Possibly, the trunk region contains mostly angioblasts, while the tail region contains both angioblasts and hematopoietic precursors.

Overexpression of etsrp induced strong ectopic expression of vascular markers in multiple cell types, including even tissues that normally commit to a very different fate such as neuroectoderm. Furthermore, overexpression of etsrp specifically initiated vascular development without affecting related hematopoiesis, which argues that the observed effects are not caused by an early ventralization of the whole embryo. These results indicate that etsrp is sufficient to initiate vasculogenesis. As a contrast, overexpression of other regulators of vasculogenesis such as vegf and scl induced expression of vascular markers only within the lateral or somitic mesoderm [14,43,45].

Overexpression of vegf and scl did not have an effect on vascular development in the absence of etsrp function, which suggests that etsrp is an essential mediator of vegf and scl signaling, at least in the vascular induction. Loss of vegf or scl did not affect early expression of etsrp within angioblasts. Overexpression of etsrp caused strong scl induction, indicating that etsrp plays an important role in controlling scl expression, at least within angioblasts. This is also supported by the loss of scl expression in the anterior and trunk regions in etsrp morphants. Our data suggest that etsrp is necessary for scl expression within angioblasts, and both genes are then required for induction of multiple vascular endothelial genes.

The current study shows for the first time that a single gene can be necessary and sufficient for initiating vascular development in vertebrates. Our results demonstrate that Etsrp acts as a very early regulator of vasculogenesis. These findings will greatly advance our understanding of vascular development and the general mechanisms of cell fate specification.

Materials and Methods

Microinjection of MOs

Two etsrp-specific MOs (MO1, TTGGTACATTTCCATATCTTAAAGT and MO2, CACTGAGTCCTTATTTCACTATATC; Gene Tools, Inc.) were used to inhibit the function of Etsrp protein. For the dose response curve, 1–6 nl of 1 mg/ml MO solution in the Danieau buffer supplemented with 15 mM Tris-Cl (pH 7.5) was injected into one- to two-cell-stage embryos [36]. For phenotypic and marker analysis, 3–4nl of 2.5 mg/ml MO2 solution was injected. A five-base MO2 mismatch ( CAGTGAGACCTTAATTCAGTATAAC) was used as a control MO. A previously described Vegf-A-1 MO (kindly donated by S.C. Ekker) was used to inhibit Vegf function [46]. Scl translation-blocking UTR-MO ( GCTCGGATTTCAGTTTTTCCATCAT) and previously described splice-blocking MO [13] were used to inhibit the function of Scl protein. Microinjections were performed as described [47].

BAC modification and microinjection

CHORI-211 BAC library from Children's Hospital Oakland Research Institute, Oakland, California, United States was used to identify etsrp-containing–BAC of approximately 250 kilobases. Replacement of Etsrp coding sequence with GFP was essentially performed as described [38]. Purified BAC DNA (100–150 pg) was injected into blastomere at the one-cell stage.

RNA overexpression and epistasis experiments

Etsrp overexpression construct was generated by subcloning the open reading frame of etsrp into the SpeI site of pT3TS [47]. To synthesize mRNA, Etsrp-T3TS was linearized with XbaI and transcribed using T3 mMessage mMachine Kit (Ambion, Austin, Texas, United States). At the two- to 16-cell stage for overexpression studies, 75–15 pg of etsrp mRNA was injected into zebrafish embryos. For epistasis studies, approximately 50 pg of VEGF121 and VEGF165 mRNA 1:1 mixture was injected [43]. Approximately 300 pg of scl mRNA was injected for epistasis studies [12].

In situ hybridization

In situ hybridization was performed as described [48]. The following probes were used: etsrp [42], flk1 [40], fli1 [40], flt4 [40], scl [12], gata1 [49], admr [42], cdh5 [42], crl [42].

Analysis of etsrp knockdown phenotype

o-dianisidine heme staining was performed as described [49]. Microangiography was performed as described [46].

Zebrafish strains

Majority of etsrp knockdown analysis was performed in the wild-type zebrafish from Scientific Hatcheries (Huntington Beach, California, United States). As confirmed by sequencing, no polymorphisms in the etsrp MO-binding sites were detected in this wild-type strain. In addition, flk1-GFP transgenic zebrafish line was used [39]. clom39 line was used in etsrp overexpression experiments [7].

Supporting Information

Figure S1. Etsrp MO Blocks GFP Expression in the Embryos Injected with etsrp–GFP-Modified BAC Construct

Mosaic panels have been generated by taking individual images of randomly chosen embryos from each batch. Embryos are at the 90% epiboly stage. (A) Following microinjection, etsrp-GFP BAC is transiently expressed in a mosaic pattern. Note that the transient BAC expression commonly does not recapitulate the endogenous expression pattern. (B) Co-injection of etsrp-GFP BAC and 10 ng of etsrp MO2 completely eliminated GFP fluorescence. (C) Co-injection of etsrp-GFP BAC and 10 ng of 5-base MO2 mismatch had no effect on GFP fluorescence.

https://doi.org/10.1371/journal.pbio.0040010.sg001

(2.5 MB TIF).

Accession Numbers

GenBank (http://www.ncbi.nlm.nih.gov/Genbank) accession number for etsrp is DQ021472.

Acknowledgments

Research was supported by grants from the National Institutes of Health (R01 DK54508 to SL and T32 HL069766 to SS). We thank S. Palencia-Desai and H. Jiang for their help with experiments.

Author Contributions

SL and SS conceived and designed the experiments. SS performed the experiments. SL and SS analyzed the data. SS wrote the paper.

References

  1. 1. Risau W, Flamme I (1995) Vasculogenesis. Annu Rev Cell Dev Biol 11: 73–91.
  2. 2. Zhong TP, Childs S, Leu JP, Fishman MC (2001) Gridlock signaling pathway fashions the first embryonic artery. Nature 414: 216–220.
  3. 3. Fouquet B, Weinstein BM, Serluca FC, Fishman MC (1997) Vessel patterning in the embryo of the zebrafish: Guidance by notochord. Dev Biol 183: 37–48.
  4. 4. Gering M, Patient R (2005) Hedgehog signaling is required for adult blood stem cell formation in zebrafish embryos. Dev Cell 8: 389–400.
  5. 5. Isogai S, Lawson ND, Torrealday S, Horiguchi M, Weinstein BM (2003) Angiogenic network formation in the developing vertebrate trunk. Development 130: 5281–5290.
  6. 6. Robb L, Elefanty AG (1998) The hemangioblast—an elusive cell captured in culture. Bioessays 20: 611–614.
  7. 7. Stainier DY, Weinstein BM, Detrich HW, Zon LI, Fishman MC (1995) Cloche, an early acting zebrafish gene, is required by both the endothelial and hematopoietic lineages. Development 121: 3141–3150.
  8. 8. Parker L, Stainier DY (1999) Cell-autonomous and non-autonomous requirements for the zebrafish gene cloche in hematopoiesis. Development 126: 2643–2651.
  9. 9. Begley CG, Aplan PD, Denning SM, Haynes BF, Waldmann TA, et al. (1989) The gene SCL is expressed during early hematopoiesis and encodes a differentiation-related DNA-binding motif. Proc Natl Acad Sci U S A 86: 10128–10132.
  10. 10. Kallianpur AR, Jordan JE, Brandt SJ (1994) The SCL/TAL-1 gene is expressed in progenitors of both the hematopoietic and vascular systems during embryogenesis. Blood 83: 1200–1208.
  11. 11. Gering M, Rodaway AR, Gottgens B, Patient RK, Green AR (1998) The SCL gene specifies haemangioblast development from early mesoderm. Embo J 17: 4029–4045.
  12. 12. Liao EC, Paw BH, Oates AC, Pratt SJ, Postlethwait JH, et al. (1998) SCL/Tal-1 transcription factor acts downstream of cloche to specify hematopoietic and vascular progenitors in zebrafish. Genes Dev 12: 621–626.
  13. 13. Patterson LJ, Gering M, Patient R (2005) Scl is required for dorsal aorta as well as blood formation in zebrafish embryos. Blood 105: 3502–3511.
  14. 14. Dooley KA, Davidson AJ, Zon LI (2005) Zebrafish scl functions independently in hematopoietic and endothelial development. Dev Biol 277: 522–536.
  15. 15. Lelievre E, Lionneton F, Soncin F, Vandenbunder B (2001) The Ets family contains transcriptional activators and repressors involved in angiogenesis. Int J Biochem Cell Biol 33: 391–407.
  16. 16. Vandenbunder B, Pardanaud L, Jaffredo T, Mirabel MA, Stehelin D (1989) Complementary patterns of expression of c-ets 1, c-myb and c-myc in the blood-forming system of the chick embryo. Development 107: 265–274.
  17. 17. Pardanaud L, Dieterlen-Lievre F (1993) Expression of C-ETS1 in early chick embryo mesoderm: relationship to the hemangioblastic lineage. Cell Adhes Commun 1: 151–160.
  18. 18. Queva C, Leprince D, Stehelin D, Vandenbunder B (1993) p54c-ets-1 and p68c-ets-1, the two transcription factors encoded by the c-ets-1 locus, are differentially expressed during the development of the chick embryo. Oncogene 8: 2511–2520.
  19. 19. Anderson MK, Hernandez-Hoyos G, Diamond RA, Rothenberg EV (1999) Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development 126: 3131–3148.
  20. 20. Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y (1998) Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol 176: 235–244.
  21. 21. Wernert N, Raes MB, Lassalle P, Dehouck MP, Gosselin B, et al. (1992) c-ets1 proto-oncogene is a transcription factor expressed in endothelial cells during tumor vascularization and other forms of angiogenesis in humans. Am J Pathol 140: 119–127.
  22. 22. Wakiya K, Begue A, Stehelin D, Shibuya M (1996) A cAMP response element and an Ets motif are involved in the transcriptional regulation of flt-1 tyrosine kinase (vascular endothelial growth factor receptor 1) gene. J Biol Chem 271: 30823–30828.
  23. 23. Kappel A, Ronicke V, Damert A, Flamme I, Risau W, et al. (1999) Identification of vascular endothelial growth factor (VEGF) receptor-2 (Flk-1) promoter/enhancer sequences sufficient for angioblast and endothelial cell-specific transcription in transgenic mice. Blood 93: 4284–4292.
  24. 24. Lelievre E, Mattot V, Huber P, Vandenbunder B, Soncin F (2000) ETS1 lowers capillary endothelial cell density at confluence and induces the expression of VE-cadherin. Oncogene 19: 2438–2446.
  25. 25. Iljin K, Dube A, Kontusaari S, Korhonen J, Lahtinen I, et al. (1999) Role of ets factors in the activity and endothelial cell specificity of the mouse Tie gene promoter. Faseb J 13: 377–386.
  26. 26. Chen Z, Fisher RJ, Riggs CW, Rhim JS, Lautenberger JA (1997) Inhibition of vascular endothelial growth factor-induced endothelial cell migration by ETS1 antisense oligonucleotides. Cancer Res 57: 2013–2019.
  27. 27. Wernert N, Stanjek A, Kiriakidis S, Hugel A, Jha HC, et al. (1999) Inhibition of angiogenesis in vivo by ets-1 antisense oligonucleotides-inhibition of Ets-1 transcription factor expression by the antibiotic fumagillin. Angew Chem Int Ed Engl 38: 3228–3231.
  28. 28. Barton K, Muthusamy N, Fischer C, Ting CN, Walunas TL, et al. (1998) The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9: 555–563.
  29. 29. Wang D, John SA, Clements JL, Percy DH, Barton KP, et al. (2005) Ets-1 deficiency leads to altered B cell differentiation, hyper-responsiveness to TLR9 and autoimmune disease. Int Immunol 17: 1179–1191.
  30. 30. Hart A, Melet F, Grossfeld P, Chien K, Jones C, et al. (2000) Fli-1 is required for murine vascular and megakaryocytic development and is hemizygously deleted in patients with thrombocytopenia. Immunity 13: 167–177.
  31. 31. Spyropoulos DD, Pharr PN, Lavenburg KR, Jackers P, Papas TS, et al. (2000) Hemorrhage, impaired hematopoiesis, and lethality in mouse embryos carrying a targeted disruption of the Fli1 transcription factor. Mol Cell Biol 20: 5643–5652.
  32. 32. Brown LA, Rodaway AR, Schilling TF, Jowett T, Ingham PW, et al. (2000) Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech Dev 90: 237–252.
  33. 33. Sumanas S, Jorniak T, Lin S (2005) Identification of novel vascular endothelial-specific genes by the microarray analysis of the zebrafish cloche mutants. Blood 106: 534–541.
  34. 34. Zhu H, Traver D, Davidson AJ, Dibiase A, Thisse C, et al. (2005) Regulation of the lmo2 promoter during hematopoietic and vascular development in zebrafish. Dev Biol 281: 256–269.
  35. 35. Hoegg S, Brinkmann H, Taylor JS, Meyer A (2004) Phylogenetic timing of the fish-specific genome duplication correlates with the diversification of teleost fish. J Mol Evol 59: 190–203.
  36. 36. Nasevicius A, Ekker SC (2000) Effective targeted gene knockdown in zebrafish. Nat Genet 26: 216–220.
  37. 37. Sumanas S, Larson JD (2002) Morpholino phosphorodiamidate oligonucleotides in zebrafish: A recipe for functional genomics? Brief Funct Genomic Proteomic 1: 239–256.
  38. 38. Gong S, Yang XW, Li C, Heintz N (2002) Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication. Genome Res 12: 1992–1998.
  39. 39. Cross LM, Cook MA, Lin S, Chen JN, Rubinstein AL (2003) Rapid analysis of angiogenesis drugs in a live fluorescent zebrafish assay. Arterioscler Thromb Vasc Biol 23: 911–912.
  40. 40. Thompson MA, Ransom DG, Pratt SJ, MacLennan H, Kieran MW, et al. (1998) The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev Biol 197: 248–269.
  41. 41. Larson JD, Wadman SA, Chen E, Kerley L, Clark KJ, et al. (2004) Expression of VE-cadherin in zebrafish embryos: A new tool to evaluate vascular development. Dev Dyn 231: 204–213.
  42. 42. Sumanas S, Jorniak T, Lin S (2005) Identification of novel vascular endothelial-specific genes by the microarray analysis of the zebrafish cloche mutants. Blood 106: 534–541.
  43. 43. Liang D, Chang JR, Chin AJ, Smith A, Kelly C, et al. (2001) The role of vascular endothelial growth factor (VEGF) in vasculogenesis, angiogenesis, and hematopoiesis in zebrafish development. Mech Dev 108: 29–43.
  44. 44. Lawson ND, Vogel AM, Weinstein BM (2002) Sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev Cell 3: 127–136.
  45. 45. Gering M, Yamada Y, Rabbitts TH, Patient RK (2003) Lmo2 and Scl/Tal1 convert non-axial mesoderm into haemangioblasts which differentiate into endothelial cells in the absence of Gata1. Development 130: 6187–6199.
  46. 46. Nasevicius A, Larson J, Ekker SC (2000) Distinct requirements for zebrafish angiogenesis revealed by a VEGF-A morphant. Yeast 17: 294–301.
  47. 47. Hyatt TM, Ekker SC (1999) Vectors and techniques for ectopic gene expression in zebrafish. Methods Cell Biol 59: 117–126.
  48. 48. Jowett T (1999) Analysis of protein and gene expression. Methods Cell Biol 59: 63–85.
  49. 49. Detrich HW, Kieran MW, Chan FY, Barone LM, Yee K, et al. (1995) Intraembryonic hematopoietic cell migration during vertebrate development. Proc Natl Acad Sci U S A 92: 10713–10717.