Fig 1.
Ih mutant lines exhibit ERG baseline oscillation.
(A) Annotated transcriptions of the Ih gene. Two piggyBac insertion sites are marked with triangles. The RNAi recognized site and coding region used for antibody generation are labeled at the top. (B) Ih mutant lines exhibit ERG baseline oscillation. For ERG traces throughout all figures, event markers represent 5-s orange light pulses, and scale bars are 5 mV. (C) Fraction of flies that exhibit the ERG oscillation phenotype in each genotype. The numbers of recorded flies for each genotype are listed. (D) RT-PCR shows Ih mRNAs are transcripted in wild-type flies but are absent in Ih mutant flies. Primer pair CACGCGACCAATCTCATCC/ TCATGGAGTGTTACCCTCG, which can amplify all transcriptional variants, was used in RT-PCR analysis. The tubulin gene was used as a loading control. (E) Western blotting revealed four major Ih channel variants (indicated by arrows) expressed in wild-type flies but absent in Ih mutant flies. Note that the low-intensity bands presented in Ih mutant flies are nonspecific.
Fig 2.
Ih mutant photoreceptors undergo rhythmic depolarization without light stimulation.
(A) Intracellular recording traces of wild-type and Ih mutant photoreceptors. For intracellular recording traces, event markers represent 5-s orange light pulses, and scale bars are 5 mV. Measurements of the amplitude (Am), frequency (Fr), rise time (Rt), and decay time (Dt) of rhythmic depolarization are provided at the top. (B) The fraction of photoreceptors (R-cells) that exhibit oscillation phenotype. The numbers of photoreceptors recorded for each genotype are listed. (C) Measurement of the amplitude of light-induced depolarization (middle) and the time (t3/4) required for a 3/4 recovery from the responses upon stimulation cessation (right). n = 10.
Fig 3.
Ih mutant flies show normal rhabdomeral structure, normal protein levels, and normal distribution of phototransduction components.
(A) EM images show normal rhabdomeral structure in 1-day-old Ih mutant flies. (B) Western blotting shows normal protein levels of phototransduction components in Ih mutant flies. (C) Immunostaining images show normal distribution of phototransduction components in Ih mutant flies. (D) ERG traces of norpA and norpA;Ih flies. The fraction of flies that exhibit ERG oscillation phenotype are shown in the right panel, and the number of recorded flies for each genotype are listed. WT = wild type.
Fig 4.
Expression patterns of endogenous Ih channels.
(A) Localization of endogenous Ih channels in the adult fly head. Dissected whole heads were double stained with anti-Ih (green) and 24B10 (red, for photoreceptor membrane) antibodies. The images show a longitudinal view of the retina (R), lamina (L), and medulla (M). (B) Distribution of Ih channels in the lamina region. Images show a longitudinal view. (C) Ih channels expressed in L1 neurons. L1 neurons were labeled with mCD8-GFP under the control of the L1-GAL4 driver. Two L1 somata are indicated by arrows. (D). Ih channels were highly expressed in L2 neurons. L2 neurons were labeled with mCD8-GFP under the control of the L2-GAL4 driver. The upper panel shows a longitudinal view of the lamina, and the lower panel shows a cross view of the lamina. L2 somas are indicated by arrows. (E) Ih channels were expressed in ACs. ACs (arrows) are labeled with mCD8-GFP under the control of the Lai-GAL4 driver. The upper panel shows a longitudinal view of the retina (R), lamina (L) and medulla (M), and the middle and lower panels show a longitudinal and cross-sectional view of AC processes.
Fig 5.
Depletion of Ih channels in ACs results in rhythmic depolarization in photoreceptors.
(A) Ih channel expression levels in flies with Ih channel depletion using UAS-Ih-RNAi driven by anatomically restricted GAL4 drivers. A single copy of the GAL4 driver was used for each GAL4 line. Each lane was loaded with two fly heads. The Ih channel bands are indicated with arrows. (B) ERG traces of flies with Ih channels depletion using UAS-Ih-RNAi driven by anatomically restricted GAL4 drivers. A single copy of the GAL4 driver was used for each GAL4 line. (C) The fraction of flies that exhibit ERG oscillation phenotype in each genotype. The numbers of recorded flies for each genotype are listed. (D) Expression of Ih channels in UAS-mCD8-GFP,UAS-Ih-RNAi/Lai-Gal4 (bottom) and control (top) flies. Dissected whole brains were stained with anti-Ih (red) and anti-GFP (green) antibodies. Note that Ih channel distribution in UAS-mCD8-GFP,UAS-Ih-RNAi/Lai-Gal4 flies is comparable to control flies except in ACs.
Fig 6.
Transcriptional and translational profiles of Ih channels.
(A) Western blotting shows the Ih variants expressed in isolated retina/lamina and head without retina/lamina. Each lane was loaded with retina/lamina or head without retina/lamina from two flies. The Ih channel bands are indicated with arrows. (B) RT-PCR shows the transcriptional profile of Ih channels (arrow) in the isolated retina/lamina. Primer pairs used to amplify each transcriptional variants are Ih-RJ: GGCACCGCTTGTCACTGCTC/GGATCGAAAGTTGGAGCG; Ih-RI: GGCACCGCTTGTCACTGCTC/CTAGACCAGGACAGACAGAC; Ih-RL: GGCACCGCTTGTCACTGCTC/GCACGCTTCCAGACTTCTACG; Ih-RK: GGCACCGCTTGTCACTGCTC/GCCAGCCAATTTCGGAAGCG. Quantification of relative transcriptional variants of the Ih gene in the isolated retina/lamina is shown at the bottom. The ekar gene was used as a loading control. (C) Expression level of Ih channels in rescue flies. A single copy of the GAL4 driver was used. The Ih channel bands are indicated with arrows.
Fig 7.
Expression of Ih channels in ACs restores a normal ERG response.
(A) Expression of Ih channels in ACs suppresses ERG baseline oscillation. Ih channels were expressed using anatomically restricted GAL4 drivers. Flies possessed one copy of the indicated drivers. (B) The fraction of flies that exhibit the ERG oscillation phenotype in each genotype. The number of recorded flies for each genotype is listed. (C) Expression of Ih channels in Ih mutant (top) and Ih;Lai-GAL4/UAS—Ih (bottom) flies. Dissected whole brains were stained with anti-Ih (green) and anti-24B10 (red) antibodies. L, lamina; M, medulla. (D) Intracellular recordings of photoreceptors show that Ih channels expression in ACs suppresses rhythmical depolarization without light stimulation. The fractions of photoreceptors that exhibit rhythmic depolarization are presented in the right panel, and the numbers of recorded photoreceptors for each genotype are listed.
Fig 8.
Blocking synaptic glutamate release from ACs suppresses the rhythmic depolarization in Ih mutant photoreceptors.
(A) Ultrastructure of lamina cross-sections in wild-type and Ih mutant flies. The left panel shows the organization of the columnar neurons with synaptic connections in the lamina. Photoreceptor cells are shown in gray, L1–L2 neurons in black, and ACs in red. These neurons are present in all lamina columns, and single example profiles are shown arrayed across the lamina. The middle and the right panels show EM images of lamina cross-sections in wild-type and Ih mutant flies, respectively. Photoreceptor axons are colored in yellow and AC processes in blue. (B) Intracellular recording traces of Ih mutant flies with expression of TeTxLC using L1L2-GAL4 and Lai-GAL4 drivers. The fractions of photoreceptors that exhibit rhythmic depolarization are presented in the middle panel, and the time (t3/4) required for a 3/4 recovery from the responses upon stimulation cessation is shown in the right panel. The numbers of recorded flies are listed. (C) Inactivation of ACs via ectopic expression of dORKΔC suppresses rhythmical depolarization in Ih mutant flies. The fractions of flies that exhibit ERG oscillation phenotype and the numbers of recorded flies are presented in the right panel. An ERG trace of flies expressing dORKΔC in wild-type ACs is also presented. (D) Intracellular recording traces of Ih mutant flies expressing UAS-vGluT-RNAi using different drivers. The fractions of photoreceptors that exhibit rhythmical depolarization are presented in the middle panel, and the time (t3/4) required for a 3/4 recovery from the responses upon stimulation cessation are shown in the right panel. The number of recorded flies for each genotype is listed.
Fig 9.
Ih channels regulate synaptic glutamate release by modulating Cac channel activity.
(A) ERG traces of Ca-α1T; Ih and cac; Ih flies. The fractions of flies exhibiting the ERG oscillation phenotype and the number of recorded flies are presented in the right panel. (B) ERG traces of flies with depletion of Ca-α1D or Cac channels. The fraction of flies exhibiting the ERG oscillation phenotype and the number of recorded flies are presented in the right panel. (C) Depolarization of the RMP of ACs via ectopic expression of NaChBac suppresses rhythmical depolarization in Ih mutant flies. The fractions of flies exhibiting the ERG oscillation phenotype and the number of recorded flies are presented in the right panel. An ERG trace of flies expressing NaChBac in wild-type ACs is also shown.
Fig 10.
Identification of glutamate receptor that mediates retrograde glutamate signaling from ACs to photoreceptors.
(A) ERG traces of flies with iGluR depletion in photoreceptors. Photoreceptor-specific Rh1-GAL4 was used for iGluR screening. (B) Fractions of flies exhibit ERG oscillation phenotype and the numbers of recorded flies are presented.
Table 1.
RNAi lines used for iGluR screening.
Fig 11.
The kainate receptor EKAR receives the retrograde glutamate signal in photoreceptor terminals.
(A) Annotated transcriptions of the ekar gene. The transposon insertion site of Mi{ET1}CG9935MB00001 is indicated with a triangle. Recognized sites of two RNAi lines are labeled at the top. (B) RT-PCR analysis reveals an absence of ekar mRNA in Mi{ET1}CG9935MB00001 line. The Glc gene is used as a positive control. (C) Intracellular recordings of light responses in wild-type and ekar mutant photoreceptors. Quantification of light-induced depolarization is presented in the right panel. For each genotype, ten photoreceptors from ten flies were measured, and the data are presented as mean ± SEM. (D) Intracellular recordings of Ih;;ekar photoreceptors show that ekar mutation suppresses rhythmic depolarization in Ih mutant flies. (E) The fractions of photoreceptors exhibiting the oscillation phenotype are presented. The numbers of recorded photoreceptors are listed.
Fig 12.
Feedback regulation facilitates visual signal transmission and motion detection in dim light conditions.
(A) Intracellular recordings show photoreceptor responses to a series of 1.5-s light pulses with increasing intensity in each genotype. (B) Quantification of 10 Lux light-induced depolarization in each genotype. The numbers of recorded photoreceptors are listed for each genotype, and data are presented as mean ± SEM. (C) Schematic representation of the experimental apparatus. Only half of the LEDs are displayed. (D) Full-field stimuli (180°/s corresponding to a temporal frequency of 4 Hz) used in all behavioral experiments. The space-time diagrams illustrate the luminance patterns displayed to the fly in the arena. (E) Performance index of tracking time. More than 15 flies were examined for each genotype and condition, and the data are presented as mean ± SEM. (F) Model of feedback regulation from ACs to photoreceptors.