Skip to main content
Advertisement
  • Loading metrics

Disruption of small RNAs and mechanistic variation in Segregation Distorter: A sperm-killing drive system in Drosophila melanogaster

  • Logan T. Edvalson ,

    Contributed equally to this work with: Logan T. Edvalson, Xiaolu Wei

    Roles Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation University of Rochester, Department of Biology, Rochester, New York, United States of America

    ⨯
  • Xiaolu Wei ,

    Contributed equally to this work with: Logan T. Edvalson, Xiaolu Wei

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Writing – original draft, Writing – review & editing

    Affiliations University of Rochester, Department of Biology, Rochester, New York, United States of America, University of Rochester Medical Center, Department of Biomedical Genetics, Rochester, New York, United States of America

    ⨯
  • Ching-Ho Chang,

    Roles Methodology, Resources, Writing – review & editing

    Affiliation University of Rochester, Department of Biology, Rochester, New York, United States of America

    ⨯
  • Amanda M. Larracuente

    Roles Conceptualization, Funding acquisition, Investigation, Project administration, Resources, Supervision, Writing – original draft, Writing – review & editing

    alarracu@ur.rochester.edu

    Affiliation University of Rochester, Department of Biology, Rochester, New York, United States of America

    ⨯

Abstract

Meiotic drivers achieve biased transmission to the next generation, often at the expense of their host. Drive is widespread and can shape the evolution of proteins, chromosome structure, and karyotypes. The sperm killer Segregation Distorter (SD) in Drosophila melanogaster is a well-studied driver but like most complex drivers, its mechanism remains elusive. SD is a multigene complex frequently associated with chromosomal inversions where the main driver locus, a truncated duplication of the gene RanGAP, kills wild-type sperm containing a satellite DNA called Responder (Rsp). Small RNAs are frequently implicated in the mechanisms of sperm killers, and we recently showed that Rsp is a source of small RNAs. Here we study the transcriptomes of two SD haplotypes and our results link Rsp expression and/or RNAs to drive. We found that Rsp-derived small RNAs are underrepresented in driving testes of only one of the SD haplotypes. We show that over-expressing Rsp is sufficient to reduce drive strength in the haplotype with downregulated Rsp but not the other. We therefore shed light on the mechanism of SD by making a connection between the target and the drive phenotype. Additionally, our data imply that different haplotypes of complex drivers, like SD, can vary in their mechanism.

Author summary

Most meiotic drive systems are complex and molecularly enigmatic. Here, we ask whether small RNA pathways, which are implicated in several other drive systems, underlie drive in a sperm killer system in Drosophila melanogaster called Segregation Distorter (SD) using repeat-optimized transcriptomics and genetic experiments. SD targets sperm containing a repetitive array of satellite DNA called Responder (Rsp). We found that small RNAs corresponding to Rsp are reduced in driving genotypes containing one haplotype of SD (SD-Mad), but not another (SD-5). We also found that overexpressing Rsp reduces the efficacy of sperm killing in driving SD-Mad genotypes but not driving SD-5 genotypes. These results imply that RNAs originating at complex satellites, like Rsp, may have a role in sperm development and that SD-Mad perturbs them as a part of its mechanism. This also suggests that although the many haplotypes of SD share a driver, target, and phenotype, they may not share exact mechanisms. The study of SD’s many haplotypes could reveal multiple ways that spermatogenesis is vulnerable to selfish elements like meiotic drivers.

Introduction

Meiosis facilitates key principles of inheritance, including the fair segregation of alleles to gametes. However, selfish genetic elements called meiotic drivers [1] can subvert fair segregation and bias their transmission to the next generation. Although some target meiosis in the strict sense, meiotic drivers can act through a diversity of mechanisms during any stage of gametogenesis [2]. Meiotic drive is widespread across species and can have major consequences for genome evolution, gametogenesis, and even speciation (reviewed in [3–5]). Meiotic drivers can impose fitness costs on their hosts directly as a consequence of drive (e.g., fertility costs) or indirectly through linked deleterious mutations (e.g., [6–9]). The costs of drive apply selective pressure on the host to evolve suppressors that restore fair segregation, which then in turn can prompt drivers to evolve ways to circumvent host suppression [4]. This tit for tat dynamic can result in perennial arms races between meiotic drivers and host genomes, triggering rapid evolution and innovation of sequences involved in the conflict. As a consequence, drive systems can be complex, involving enhancers and suppressors across the genome [10]. Male systems often involve similar phenotypes (e.g., defective sperm chromatin) and frequently target repeat-rich heterochromatin, suggesting that they may exploit common vulnerabilities in spermatogenesis [11].

One emerging theme across meiotic drive systems is the involvement of RNA interference (RNAi) pathways that mediate gene and repeat silencing across organisms [11]. RNAi is implicated in several drive systems on both sides of the genetic conflict. For example, small interfering RNAs with sequence complementarity to drivers can act as drive suppressors: Sex ratio distorters like Stellate in D. melanogaster, and the Winters and Durham systems in D. simulans, involve loci that produce either piwi-interacting RNAs (piRNAs) [12] or hairpin RNAs (hpRNAs) [13] that act as drive suppressors. Similarly, the kinesin driver (Kindr) complex in maize promotes the biased segregation of heterochromatic knobs and is suppressed by small interfering RNAs (siRNAs) [14]. RNAi pathways are also implicated beyond drive suppression. For example, in the Paris sex ratio system of D. simulans, driving X chromosomes disrupt Y chromosome segregation. One of the essential drive loci in this system is HP1D2, a paralog of Rhino—a gene important for producing piRNAs [15]. More broadly, duplications of RNAi-related genes appear common on sex chromosomes across taxa [16,17], suggesting that dose-sensitive genetic conflicts involving RNAi may be widespread and play important roles in sex chromosome evolution [18,19].

While some common themes are emerging from studies across meiotic drive systems (reviewed in [11]), we currently know little about the precise molecular mechanisms of drive. Many drive systems are complex—involving multiple loci, gene duplications, and repetitive DNA—and are often associated with regions of suppressed recombination [19], making it difficult to identify and study how key components of drive systems interact.

Here we use a classical system that shares common features with other male drivers (e.g., defects in sperm chromatin, gene duplication, and repetitive DNA) to gain new insights into drive mechanisms: the Segregation Distorter (SD) of D. melanogaster. We use SD to study molecular features of male meiotic drive at the RNA level. SD is a complex autosomal sperm-killing driver segregating on the second chromosome of populations across the globe [20]. SD biases its transmission by killing sperm bearing sensitive alleles of its target, a repetitive array of tandem satellite DNA repeats in the pericentromeric heterochromatin called Responder (Rsp) [21,22]. The main drive locus corresponds to a partial tandem duplication of Ran GTPase Activating Protein (Sd-RanGAP; [23,24]). RanGAP is a GTPase activating protein involved in the Ran cycle, which is important for multiple cellular processes, including nuclear transport, spindle assembly, and nuclear envelope assembly [25]. SD is a multi-gene complex: all drive haplotypes carry Sd-RanGAP, an insensitive allele of the Rsp target locus, and multiple enhancers that strengthen drive across different SD haplotypes, e.g., Enhancer of SD (E(SD)) [26], Modifier of SD (M(SD)) [27], and Stabilizer of SD (St(SD)) [28]. We do not yet know the molecular identity of any drive modifiers. To enhance linkage between Sd-RanGAP and its enhancers, most SD chromosomes acquire specific chromosomal inversions that suppress recombination (reviewed in [29]). Despite sharing the Sd-RanGAP locus, SD chromosomes may differ in their inversions and modifiers, and thus show different levels of distortion and cytological defects [30].

The classic SD drive phenotype manifests as a post-meiotic chromatin defect [31,32], but the mechanism is unknown. The driver, Sd-RanGAP, is enzymatically active, but appears mislocalized to the nucleus, which may disrupt Ran-mediated nuclear transport [23]. In contrast, we know little about the role of the target in drive. Rsp is a pericentromeric satellite DNA array on chromosome 2R consisting of tandemly repeated dimers of two related ~120-bp repeats: L-Rsp and R-Rsp [21,22]. The sensitivity of a chromosome to drive correlates positively with the copy number of Rsp [21,22,33]. The drive sensitivity of 2nd chromosomes range from insensitive (<100 copies of Rsp), to sensitive (~300 to ~1500 copies), or super sensitive (> ~2000 copies) [22]. However, we do not know the features of Rsp that make it a target of drive. Satellite DNAs may also be targets of other drive systems. For example, many sex ratio distorters target Y chromosomes, which are rich in satellite repeats that vary in copy number and composition (reviewed in [11]). A deeper understanding of the roles that satellite DNAs play in drive may reveal a common vulnerability in spermatogenesis, one that selfish genetic elements repeatedly exploit.

While previously regarded as inert components of the genome, complex satellite DNAs like Rsp are transcribed during gametogenesis by specialized heterochromatin-dependent transcriptional machinery [34,35]. Transcripts from Rsp are primarily processed into small 23–30 bp piRNAs in both ovaries and testes and may contribute to heterochromatin formation in the early embryo [34]. Others have identified potential functions for other satellite DNA-derived RNAs in gametogenesis (AAGAG; [36,37]) and X chromosome recognition in dosage compensation [38] but we know little about what functions, if any, Rsp-derived piRNAs may have during gametogenesis, particularly spermatogenesis.

Several lines of evidence set the precedent that Rsp-derived RNAs may have a role in drive. First, piRNAs are involved in chromatin remodeling in the germline [39], and the SD phenotype involves a chromatin defect [30–32]. Second, mutations in the piRNA pathway component, Aubergine, enhance SD drive [40]. Finally, non-coding RNAs originating from pericentromeric satellite DNAs can play a role in sperm development [36,37]. Knocking down [36] or disrupting the transcription [37] of an abundant simple satellite, AAGAG, affects a post-meiotic sperm chromatin and morphological defect [37], similar to the defect in SD-targeted sperm [30–32]. While the role of satellite DNA-derived RNAs is still unclear, they may contribute to chromatin regulation during spermatogenesis. We propose that meiotic drivers like SD may exploit these features of satellite DNA to bias their transmission.

Here we test the hypothesis that Rsp-derived RNAs are involved in drive by exploring the total and small RNA transcriptomes of driving testes with two different SD haplotypes that differ in their chromosomal inversions (SD-Mad and SD-5). We discovered a significant dearth of Rsp-derived small RNAs in driving genetic backgrounds associated with one drive haplotype (SD-Mad) but not another (SD-5). To confirm that Rsp small RNAs are involved in SD-Mad drive, we overexpress Rsp and show corresponding changes in drive strength. Our results are consistent with a haplotype-specific role for Rsp-derived RNAs in drive and suggest a potential role for complex satellite-derived RNA in spermatogenesis. We propose that different drive haplotypes may vary in their modifiers, giving rise to molecular variation in drive.

Results

Rsp-derived small RNAs are underrepresented in the small RNA transcriptome of SD-Mad testes

Because there is evidence that satellite-derived small RNAs (smRNAs) are important for sperm development [36,37], we hypothesized that SD may interact with these smRNAs as part of its mechanism. We explored the small RNA transcriptome of testes heterozygous for combinations of two different driving SD haplotypes (SD-Mad and SD-5) (Fig 1A) and wild type chromosomes with different Rsp alleles (Fig 1A). Because our previous work found a correlation between Rsp copy number and RNA abundance [34], all of our comparisons are relative to Rsp copy number controls (R16/Gla or R16/Iso1 where R16 contains a Rsp deletion allele and Iso1 and Gla contain sensitive and super-sensitive Rsp alleles, respectively; Fig 1A) [26]. The SD haplotypes we use differ by their inversion types (Fig 1A) but both exhibit strong drive, measured as k, or the proportion of SD offspring from a cross with SD heterozygous males (Table A in S1 Appendix).

thumbnail
Fig 1. Analysis of small RNAs in SD-Mad heterozygotes show a lower abundance of small RNAs corresponding to Rsp.

A) A schematic of the 2nd chromosomes used in this study. Iso1 and Gla are sensitive backgrounds with varying copy number of Rsp. Iso1 contains ~1100 copies of Rsp making it sensitive and Gla contains >3000 making it super sensitive. R16 is a copy number control for SD and does not drive. SD-Mad and SD-5 are driving chromosomes containing different inversions (highlighted in colored boxes). They contain the main drive locus, Sd-RanGAP and show perfect or near perfect drive against sensitive chromosomes. SD-MadRev is a haplotype control for SD-Mad. It is identical to SD-Mad except for a deletion of Sd-RanGAP. B) A comparison of the DESeq2 normalized counts of Rsp in each comparison shows that Rsp smRNAs are less abundant in SD-Mad heterozygotes relative to R16 heterozygotes (Log2FC = -0.95, Padj = 5.1e − 9). Rsp smRNAs are apparently unaffected in SD-MadRev heterozygotes indicating that the reduction of smRNAs in SD-Mad heterozygotes is correlated with drive. Rsp RNAs are also unaffected in the SD-5 background indicating that SD-5 does not perturb Rsp smRNA abundance. C) A heatmap showing the differential abundance of smRNAs for major piRNA source loci in the genome. 1.688, flamenco, and 38C2 are differentially expressed in this background.

https://doi.org/10.1371/journal.pgen.1012235.g001

We found significantly fewer Rsp-derived smRNAs (piRNAs and endo-siRNAs) in some driving testes. Rsp-derived smRNAs are significantly less abundant in the testes of SD-Mad/Iso1 heterozygotes relative to the non-driving copy number control (R16/Iso1) (Fig 1B; Log2FC = -0.95, Padj = 5.1e-9, DESeq2). To confirm that the low abundance of Rsp smRNAs correlates with drive rather than non-drive related factors in the genetic background, we created a revertant SD-Mad background (SD-MadRevertant or SD-MadRev, Fig 1A). We used CRISPR/Cas9 to delete the Sd-RanGAP duplication from SD-Mad, leaving one full length copy of RanGAP and the rest of the chromosome with putative drive modifiers intact. This chromosome is therefore identical to SD-Mad outside of Sd-RanGAP but no longer exhibits strong drive (k* = 0.54). We expect that any differences in smRNA abundance between SD-Mad/Iso1 and SD-MadRev/Iso1 are therefore due to drive or Sd-RanGAP itself. Indeed, we found that Rsp smRNAs are more abundant in SD-MadRev/Iso1 relative to SD-Mad/Iso1 (Log2FC = 0.66, Padj = 0.004, DESeq2) and at similar levels as the copy number control, R16/Iso1 (Fig 1; Log2FC = -0.21, Padj = 0.19, DESeq2). This indicates that the difference in Rsp smRNA abundance in SD-Mad/Iso1 is likely due to the drive phenotype. We see a similar dearth of Rsp-derived smRNA in driving testes in an independent background with a super-sensitive Rsp allele (SD-Mad/Gla) compared to its non-driving copy number control (R16/Gla) (S1 Fig; Log2FC = -0.68, Padj = 2.6e-14, DESeq2). This suggests that the effects on Rsp smRNA abundance are related to the driving SD-Mad chromosome rather than the target chromosome.

To determine if the effect on Rsp smRNAs is specific to SD-Mad, we explored the small RNA transcriptome in driving testes with another SD haplotype (SD-5) that differs in its chromosomal inversions [29]. Intriguingly, Rsp smRNA abundance is similar between SD-5 and R16 in an Iso1 background (Fig 1; Log2FC = -0.07, Padj = 0.79, DESeq2) and higher than expected levels in the Gla background (S1 Fig; Log2FC = 0.33, Padj = 2.3e-11, DESeq2). Therefore, the disruption of Rsp RNAs is not a universal feature of SD chromosomes.

Outside of Rsp, we see shifts in many repeat-derived smRNAs in driving testes of both SD haplotypes: for example, 30% (12/40) and 27.5% (11/40) of repeat annotations (satellite DNAs, piRNA clusters, and TEs) were differentially expressed (Padj ≤ 0.01) in SD-Mad and SD-5, respectively (S2 Fig; with similar—56.4% (22/39) and 50% (20/40)—effects in the Gla background; S1 File). There are only a few notable patterns that arise from these comparisons (Table B in S1 Appendix). We found that another complex satellite DNA on the X chromosome unrelated to Rsp, 1.688, is significantly less abundant in all SD heterozygote testes in the Iso1 background comparisons (Fig 1C, Table B in S1 Appendix; Log2FCSD-Mad = -1.1, PadjSD-Mad = 4.8e-14; Log2FCSD-MadRev = -0.64, PadjSD-MadRev = 1.16e-12; Log2FCSD-5 = -0.71, PadjSD-5 = 0.02, DESeq2) and in SD-Mad/Gla testes (S1 Fig; Log2FCSD-Mad = -0.28, PadjSD-Mad = 0.001). SmRNAs derived from a piRNA cluster linked to Sd-RanGAP on chromosome 2L, 38C2, and the X-linked somatic piRNA cluster, flamenco, is differentially expressed for all genotypes in both backgrounds except for flamenco in SDMad/Gla (Figs 1C, S1). 38C2 and flamenco are not known to be involved in SD-mediated drive.

Our results demonstrate that SD-Mad and SD-5 haplotypes, despite sharing the same main drive locus, have different effects on smRNAs derived from repetitive loci such as complex satellites (including Rsp), transposable elements, and piRNA clusters. Since these SD chromosomes differ in their inversions, we propose other linked loci might affect the drive mechanisms and phenotypes.

The dearth of Rsp smRNAs in SD-Mad heterozygotes could be due to a disruption in transcription of the locus or subsequent processing steps. Many factors can influence piRNA production. For example, the piRNA pathway can amplify piRNAs independently of transcription, such as the ping pong cycle, [41]. Notably, Rsp piRNAs do not have a strong ping pong signature in testes [34,42]. To distinguish between a disruption in transcription or some downstream process, we examined total RNA.

Broad differences in the long RNA transcriptome of different driving backgrounds

We performed total RNAseq to determine how the expression landscape of coding and non-coding sequences differs in testes with drive. We found that 24.2% (3359/13825) of the total RNA transcriptome is differentially expressed (Padj ≤ 0.01) in the SD-Mad background (SD-Mad/Gla vs R16/Gla; S3B Fig). Driving testes with SD-5 had similarly divergent transcriptomes compared to copy number controls (24.3% (3352/13747) DEG in SD-5/Gla vs R16/Gla; S3E Fig). Repetitive loci were more frequently differentially expressed (Padj ≤ 0.01) in SD-Mad heterozygotes compared to SD-5 heterozygotes (41% (16/39) vs 23% (8/40), S4 Fig, Table C in S1 Appendix). Despite the effect on Rsp smRNA abundance in SD-Mad heterozygotes, the abundance of Rsp long non-coding RNAs (lncRNAs) does not show any consistent pattern between the backgrounds (S5A-S5B Fig, Table C in S1 Appendix). This could be due to low counts for Rsp. On the other hand, we did find some differences in repetitive elements related to rDNA (R1, R2, and IGS) and Tc1-Mariner family TEs (all backgrounds; S6 Fig). Interestingly, there was no correlation between the expression of TEs and the expression of piRNA clusters that contain fragments of these TEs in the total RNA, nor was there any correlation between the small RNAs from piRNA clusters and the total RNAs for those TEs. PiRNA clusters are usually defined in one isolate of Iso1: rapid turnover of TEs and piRNA sources could explain why we do not see a correlation between piRNA cluster expression and TE expression in our backgrounds.

The reduction in Rsp smRNAs without any corresponding change in the lncRNA in SD-Mad-mediated drive is intriguing, as piRNA precursors should be among these RNAs. Because previous studies based on immunofluorescence in testes showed that Sd-RanGAP is mislocalized in driving spermatocytes [23], we asked if the difference in smRNAs could be due to a mislocalization of the lncRNA. We performed RNA FISH for Rsp and the 1.688 satellite as a fluorescence control in testes of SD-Mad heterozygotes. The most abundant variant of 1.688 is the 359-bp satellite on the X chromosome, which is controlled for in our comparisons. Curiously, we do see some apparent differences in the pattern of 1.688 and, to a smaller extent, Rsp signals between driving and non-driving genotypes. However, the signals are nuclear (S7 Fig), which suggests that mislocalization of the lncRNA, at least at a gross scale, may not explain the reduction in Rsp smRNAs.

We performed complementary analyses to identify patterns in gene expression. Genes make up 99.6 – 99.8% of the differentially expressed sequences in driving testes (S1 File). However, many of these differences likely reflect divergence among the second chromosomes used in each condition rather than the drive phenotype itself. To address this, we focused on pathway-level changes and coordinated gene expression rather than individual genes.

We conducted gene set enrichment analyses using PANGEA [43], and compared all differentially expressed genes (P ≤ 0.01) to Reactome gene sets [44] (S2 File). These analyses revealed a consistent enrichment in terms related to metabolism, the immune system, and the Rho GTPase cycle across driving testes (S8 Fig). In addition, genes involved in sperm individualization (e.g., asp, didum, bug22, chic, ctp, jar, nsr) [45] were differentially expressed in both SD-Mad/Gla and SD-5/Gla (Fig 2A, S3 File), which is consistent with the hallmark chromatin defect [30–32].

thumbnail
Fig 2. Analysis of total RNA from SD heterozygotes shows a broad dysregulation of genes involved in individualization and the cell cycle.

A) A heatmap showing the direction and significance of differential expression for genes whose perturbation has been shown to result in defects at the individualization stage [45]. Boxes outlined in red are genes that are differentially expressed in both SD haplotypes and in the same direction. B) WGCNA analysis of the total RNA identified modules of genes that are upregulated or downregulated in SD heterozygotes relative to the R16/Gla control. These modules were enriched for genes in Reactome gene sets. Module B contained genes that are downregulated and which are in gene sets related to metabolism, the immune system, and the Rho GTPase cycle. Module H contained genes that are upregulated and which are in gene sets related to the cell cycle and post translational modification.

https://doi.org/10.1371/journal.pgen.1012235.g002

To further identify coordinated expression patterns, we performed weighted gene co-expression network analysis (WGCNA) [46]. WGCNA identified modules of co-expressed genes that distinguish driving genotypes from R16/Gla (Fig 2B, Table D in S1 Appendix, S2 File). Gene set enrichment analysis of these modules using PANGEA [43] revealed that the drive phenotype is negatively correlated with several terms related to metabolism, the Rho GTPase cycle, and the immune system (Module B, Fig 2B).

Together, both pathway-level and network-based analyses implicate disruptions in cytoskeletal organization and/or sperm individualization. Whether these effects are directly related to drive mechanisms or downstream consequences remains unclear, but they are consistent with known phenotypes of spermiogenic failure.

WGCNA also identified two modules that were upregulated in driving genotypes. Our gene set enrichment analysis with PANGEA showed that one module (Module A) was not associated with any enriched pathways, whereas the other (Module H) was enriched for genes involved in the cell cycle and post-translational protein modification (Fig 2B).

Rsp is expressed well before individualization [34], during the period when male germ cells are actively dividing. If Rsp RNAs indeed contribute to the SD mechanism, the enrichment of cell cycle-related genes in Module H is consistent with a mechanism that originates earlier in spermatogenesis, around or before meiosis. Although the phenotype manifests after meiosis, temperature shift experiments suggest that the critical window for SD activity occurs before or during meiosis [47]. Together, these results further support a model in which SD acts early in spermatogenesis, with defects only becoming apparent later, during individualization.

To identify genes that might interact to cause drive, we compared the gene expression of SD-Mad/Iso1 to SD-MadRev/Iso1. These genotypes only differ by the presence of the main drive locus, Sd-RanGAP. We performed both totRNA and 3’ Digital Gene Expression (DGE) RNA sequencing and examined the overlap in differential expression between the totRNA and DGE sequencing. There are 69 differentially expressed genes where the DGE comparison is significant (PDGE ≤ 0.01), and the sign of the Log2FC of the totRNA matches that of the DGE. Among this set of differentially expressed genes, 57 show at least a 50% difference in gene expression (absolute Log2FC value of at least 0.58 in DGE). These genes are not enriched in any Reactome gene sets. The top 20 most differentially expressed genes consists of 9 lncRNAs (3 anti-sense RNAs) and 11 protein coding genes: 8 of which are uncharacterized. The 3 characterized genes are Artemis (Arts), Gr61a, and Tono (S9 Fig, S1 File).

Loss of Kipferl results in the upregulation of satellite DNAs and weaker SD-Mad drive

Our RNA seq analysis suggests that the reduction in Rsp smRNAs in SD-Mad/Iso1 may be involved in the mechanism of drive. To test this hypothesis, we sought to determine if overexpressing Rsp is sufficient to rescue wild-type spermatids from SD. If drive is a consequence of reducing Rsp smRNAs in an SD-Mad background, then overexpressing Rsp RNAs in SD-Mad/Iso1 testes may reduce drive strength. To overexpress Rsp, we took advantage of a recently-discovered component of the piRNA pathway called Kipferl (kipf) [48]. In ovaries, kipf recruits piRNA transcriptional machinery to so-called kipf-dependent piRNA clusters. In its absence, the piRNA machinery becomes enriched at complex satellite DNAs, including Rsp and an unrelated repeat called 1.688, leading to their upregulation [48] (Fig 3A-3B). While previous studies did not detect evidence for kipf expression in testes [49,50] (S10 Fig), we found that kipf transcripts are indeed present in testes, albeit at low levels (S10 Fig). We also found that, like in ovaries, satellite DNAs are overexpressed in kipf knock out (KO) testes, as demonstrated by reverse transcription quantitative polymerase chain reaction (RT-qPCR) (Fig 3B; testis fold change: 359-bp, a component of the 1.688 complex satellite = 2.85, P = 0.064; Rsp = 1.94, P = 0.038, t-test).

thumbnail
Fig 3. Satellite DNA overexpression via kipf-KO is sufficient to rescue drive in SD-Mad heterozygotes.

A) A schematic of how we expect the localization of the RDC complex, the piRNA transcriptional machinery, to change upon knockout of kipf in testes. Typically, kipf recruits the RDC complex to specific piRNA source loci throughout the genome. Data from ovary suggests that knocking out kipf leads to an enrichment of the RDC complex at satellite DNAs. B) qRT-PCR in kipf KO homozygotes (kipf/kipf) and heterozygotes (kipf/TM3) shows that complex satellites, and specifically Rsp, is upregulated in both ovaries and testes when kipf is knocked out. C) Drive strength assays show that kipf-KO individuals exhibit much lower drive strength when compared to the heterozygote in an SD-Mad background. We see a mild but significant reduction in drive in the SD-5 genotype despite not seeing a Rsp smRNA phenotype in the smRNA seq.

https://doi.org/10.1371/journal.pgen.1012235.g003

To determine if a loss of kipf (and thus overexpression of Rsp) is sufficient to rescue wild-type sperm from SD-Mad, we used a knockout generated by deleting the genomic locus [48]. We examined the effects of kipf-KO on the drive strength of SD-Mad and SD-5 in an Iso1 background. We estimate drive strength as k: the proportion of the progeny of SD heterozygotes that contain the SD chromosome. A k value of 1 represents perfect drive and a k value of 0.5 represents fair Mendelian segregation. We found that knocking out kipf was sufficient to reduce the strength of drive in SD-Mad heterozygotes from ~0.975 to ~0.815 (P < 0.00001, arcsine transformation then t-test (asin-t), Fig 3C, S4 File). We observed a similar reduction in drive strength (from k = 0.98 to k = 0.88; P < 0.00001, asin-t, S11A Fig) when we knock down kipf (kipf-KD) compared to a white shRNA control using RNA interference [48]. We also tested kipf-KD in a semi-sensitive Rsp deletion line (Iso1ΔC8, hereafter C8) derived from the Iso1 chromosome but with ~50% of the Rsp locus deleted using CRISPR/Cas9 [51]. In a SD-Mad/C8 background, kipf-KD reduced drive from k = ~0.85 to k = ~0.72 (P < 0.00001, asin-t, S11B Fig). Kipf-KO had a mild but statistically significant effect on the drive of SD-5 heterozygotes (from k = ~1 to k = ~0.94, P < 0.00001, asin-t, Fig 3C).

The reduction in drive strength in the absence of kipf is consistent with the hypothesis that Rsp transcription, transcripts, or their processed products (i.e. piRNAs) are involved in the mechanism of SD-Mad and are somehow important for the development of Rsp-bearing sperm. However, the loss of kipf also overexpresses other satellite DNAs, like 1.688 (Fig 3B), and likely dysregulates kipf-dependent piRNA clusters [48].

Overexpression of Rsp piRNAs and weaker drive in SD-Mad heterozygotes

To specifically overexpress the Rsp repeat, we inserted 3 copies of the Rsp monomer into the abundantly expressed piRNA cluster, 38C1, in an Iso1 2nd chromosome (Iso1Rsp>38C1) (Fig 4A). This insertion results in the overexpression of Rsp in both SD backgrounds (SD-Mad background: Log2FC = 0.45, Padj = 1.6e-10, DESeq2; SD-5 Log2FC = 0.47, Padj = 0.008, DESeq2) (Figs 4B-4C, S12, Table E in S1 Appendix, S1 File). We detect a mild effect on the expression of 38C1 (Fig 4B; SD-Mad: Log2FC = -0.34, Padj = 2.3e-11, SD-5: Log2FC = -0.37, Padj = 4.3e-5, DESeq2) but the Rsp insertion generally does not influence transcription at other piRNA clusters (Fig 4B).

thumbnail
Fig 4. Overexpression of Rsp via 38C1 insertion is sufficient to reduce drive strength of SD-Mad heterozygotes but has no effect on SD-5 heterozygotes.

A) Schematic of the overexpression construct. Three copies of Rsp were inserted roughly 1/3 of the way into the piRNA cluster 38C1 of Iso1 using CRISPR/Cas9-mediated homology directed repair. The construct included a floxed 3xP3-DsRed reporter which was removed using Cre after the insertion was validated. AttP sites were also included to facilitate additional insertions of Rsp. B) Rsp is significantly overexpressed in the RspOE strain for both SD heterozygotes relative to the same genetic background with the unmodified 2nd chromosome. 38C1 on the other hand was significantly downregulated. Other piRNA clusters were largely unaffected. C) A comparison of the DESeq2 normalized counts from SD/Iso1 and SD/RspOE smRNA. Rsp is significantly overexpressed in both conditions. D) Drive strength assay for SD-Mad in an RspOE background relative to Iso1. Drive is significantly and substantially reduced the SD-Mad/RspOE genotype. E) Drive in SD-5/RspOE was unaffected. These observations demonstrate that SD-Mad and SD-5 appear to interact with Rsp differently.

https://doi.org/10.1371/journal.pgen.1012235.g004

We tested the transgenic flies with the full Rsp overexpression construct including the 3xP3-DsRed reporter (Iso1Rsp-DsRed>38C1 and did not see a change in drive strength, Figs 4A,4D, S13, S4 File). We suspect that the insertion of a strong euchromatic promoter into an otherwise heterochromatic locus may affect the RNA species produced from the locus, so we removed the 3xP3-DsRed reporter via recombination using Cre (Figs 4A, S13, S4 File).

When we tested the drive sensitivity of Iso1Rsp>38C1 in an SD-Mad heterozygote, we found that drive strength is significantly lower relative to Iso1 (Fig 4D, S4 File). This provides further evidence that SD-Mad somehow perturbs Rsp RNAs in the presence of Sd-RanGAP.

In contrast, Rsp overexpression had no effect on drive strength in SD-5 heterozygotes in an otherwise identical background (Fig 4E, S4 File), consistent with the smRNA results suggesting that Rsp RNAs are not perturbed in SD-5. Taken together, these results suggest that SD-Mad and SD-5 have diverged in the factors and features involved in their drive.

Discussion

We make two major observations in our study of molecular phenotypes of SD testis transcriptomes. First, we show that Rsp-derived smRNAs are downregulated in the driving testes of SD-Mad heterozygotes and that overexpressing Rsp RNAs affects drive strength. This work therefore links RNAs complementary to the target satellite with the drive phenotype. Second, we revealed mechanistic variation in drive haplotypes—while SD-Mad and SD-5 affect similar pathways, only SD-Mad affects Rsp smRNA. These results suggest that, while SD chromosomes share a target and main drive locus (Sd-RanGAP), the modifiers accumulated on each haplotype may influence the drive mechanisms, either by creating new pathways to drive or acting as tuning knobs on drive strength.

smRNAs derived from the target satellite DNA affect drive

Our data indicate that SD-Mad, but not SD-5, disrupts the abundance of Rsp-derived smRNAs and that this phenotype correlates with drive. Our observations add SD to the growing list of meiotic drive systems that involve smRNAs [11]. We observed an effect on drive strength—and the increased survival of wild-type Rsp-bearing sperm—even with a modest overexpression of Rsp RNA (~2 fold with kipf KO or KD and ~1.5-fold with Iso1Rsp>38C1). The ability of the Iso1Rsp>38C1 transgene to rescue wild-type sperm may depend on transcription of the source RNAs and genetic background: we did not see an effect on drive without removing 3xP3-DsRed from the 38C1 insertion (Figs 4D-4E, S13). The difference in drive suppression phenotypes between Iso1Rsp>38C1 and Iso1Rsp-DsRed>38C1 may suggest that although transcription is taking place at the Rsp > 38C1 locus in Iso1Rsp-DsRed>38C1 (Fig 4B), the transcripts may not be shunted into any functional RNA pathways. Nonetheless, the kipf experiments (Fig 3) overexpress Rsp from the endogenous locus rather than a transgene in a piRNA cluster, albeit not specifically, and therefore bolsters our conclusions that Rsp RNAs are involved in SD-Mad drive. Future studies that focus on how different species of RNA might protect sperm and influence drive phenotypes may provide important clues about drive mechanisms and the functions of these RNAs.

We know relatively little about the rules that govern transcription at satellite DNAs. Previously, we found that the Rsp satellite is regulated by non-canonical heterochromatin-dependent transcription machinery, similar to dual-stranded piRNA clusters [34,35]. There may be specific transcription factors important for licensing transcription at Rsp, similar to the role of HP2 in regulating the transcription of AAGAG [52]. Identifying potential proteins that interact with Rsp may fill in an important piece of the puzzle linking satellite transcripts to drive phenotypes. SSatellite transcripts and their interacting proteins could provide important clues about why satellites like Rsp are targets of drive.

Several drive systems involve smRNAs as suppressors of drive [12–14,53]. Rsp smRNAs on the other hand appear to, either directly or indirectly, be targets of drive. The protective effect of increased Rsp RNAs in SD-Mad-mediated drive suggests that these smRNAs may play a role in chromatin regulation but these Rsp-derived smRNAs are not required for spermatogenesis in the absence of the Rsp genomic locus. Spermatogenesis normally proceeds without issue for chromosomes with Rsp deletions [34]. Interestingly, despite being a target of SD drive, large Rsp loci are abundant in natural populations [33] and there is some evidence that there may even be a fitness advantage associated with large Rsp alleles [54], which could explain its persistence.

We propose a model where satellite DNAs require epigenetic regulation by smRNAs in a dose-dependent manner during spermatogenesis and SD exploits this feature to bias its transmission. The epigenetic profile of male germ cells is dynamic. Histones experience multiple post-translational modifications before ultimately being replaced by protamines [55,56]. We hypothesize that the smRNAs direct H3K9 trimethylation at satellite DNAs. Without proper coordination, we propose that the satellite cannot be correctly repackaged with the rest of the pericentromere during meiosis or the histone to protamine transition, triggering a checkpoint on sperm chromatin quality that leads to an individualization failure. In SD-Mad drive, disrupting Rsp smRNA would affect the wild type locus with the large block of repeats, but SD-Mad chromosomes would be unaffected because they lack the repeat.

Alternatively, if a lack of smRNA regulation makes Rsp more accessible, it may become a sink for transcription factors or other proteins. For example, the pioneering factor GAF binds to the simple satellite, AAGAG, during embryogenesis and is required for its transcriptional silencing [57]. Either of these defects could be the cause for the eventual elimination of the affected spermatids. Without a better understanding of the dynamic epigenetics at the Rsp locus during spermatogenesis, it is difficult to infer why small RNAs are important for spermatids that contain large Rsp loci. Identifying proteins that interact with Rsp DNA and RNA will be important for understanding its regulation during spermatogenesis.

It is intriguing that while SD-Mad involves Rsp-derived RNAs, we do not detect any effects of SD-5 on Rsp-derived RNAs, and we see no effect on the strength of drive upon overexpressing Rsp RNA in an SD-5 background using Iso1Rsp>38C1. This suggests that SD-Mad and SD-5 drive via different specific mechanisms. It is interesting that although SD-5 heterozygotes did not affect Rsp RNA, the kipf-KO experiments revealed a small but significant effect on drive strength. This suggests that other piRNA clusters, transposons, or satellite DNAs can affect drive. This also suggests that, while SD-5 and SD-Mad have different effects on smRNAs, the SD-5 associated drive mechanism may operate downstream of Rsp piRNAs.

Mechanistic variation in drive haplotypes

We suggest that the mechanistic variation between SD-Mad and SD-5 arises from molecular differences in the haplotypes. The most conspicuous differences between these and other SD haplotypes are in their chromosomal inversions (Fig 2A). These inversions may link different genetic variants, including enhancers of drive, to the main drive locus, creating different co-adapted gene complexes. While there is abundant genetic evidence for linked modifiers that enhance SD (i.e., Enhancer of SD (E(SD)) [26], Modifier of SD (M(SD)) [27], and Stabilizer of SD (St(SD)) [28]) on some well-studied SD haplotypes, none have been molecularly identified. The suppression of recombination under chromosomal inversions and around the centromere, preventing us from mapping putative modifiers precisely. SD-Mad may contain a modifier that influences Rsp smRNA abundance that is absent in SD-5. Further experimentation is required to molecularly characterize the differences between these chromosomes and whether the effects on drive arise from a single locus or epistatic interactions between loci.

All SD chromosomes share the main drive locus, Sd-RanGAP, which is a duplication of an essential component of the Ran cycle [25]. We suspect that there are myriad ways to induce sperm dysfunction involving the Ran cycle, and that while different SD haplotypes share the Sd-RanGAP duplication, they may recruit different modifiers. This system-level property of SD might affect its population dynamics. SD drive prompts the evolution of drive suppressors [19]. SD chromosomes that acquire new modifiers that help escape suppression may gain a transmission advantage over SD haplotypes targeted by suppressors [10,33]. These dynamics could explain the rapid turnover of SD haplotypes in populations across the globe [58–61].

Drive-correlated transcriptional changes

Our differential expression analysis did not suggest specific modifier candidates. However, we identified potentially interesting genes among those most differentially expressed between SD-Mad testes with and without the main drive locus that may highlight processes involved in drive mechanisms.

First, Tono, a BTB zinc finger-containing transcription factor is upregulated (Log2FCDGE = 1.7) in all SD-Mad comparisons. Tono plays a role in regulating transcription in muscle cells in response to mechanical pressure [62] but also shows enrichment in male germ cells [63]. The putative DNA-binding capacity and ability to form nuclear condensates [62] makes this an interesting candidate gene for interacting with the Rsp satellite. Second, the importin-4 ortholog, Artemis (Arts), which facilitates Ran-mediated import of H3 and H4 is overexpressed in SD-Mad (Log2FCDGE = 2.5). Interestingly, Arts expression is antagonistic to male fertility [64]. Also of note, Apollo, a paralog of Arts which supports male fertility [64] is downregulated (Log2FCDGE = -0.6) though it is not in the top-most differentially expressed genes.

Many of the differentially expressed genes in the transcriptomes of driving testes may be more related to the drive phenotype than the mechanism. First, we found that multiple repetitive loci are differentially expressed with little evidence that they influence drive. While this could be due to the different 2nd chromosomes in the comparison, it could also be due to incidental effects from the drive mechanism on the Rsp locus. Second, we found that genes related to individualization and the cell cycle are broadly differentially expressed (Figs 2, S8). Third, we detect a consistent differential expression in genes involving cytoskeleton dynamics. SD-targeted sperm experience a delay in protamine loading and can have nuclear morphology defects [30] leading to SD-targeted sperm being eliminated around the individualization stage. Elongation and individualization heavily rely on actin and microtubule dynamics [65] and appears to be a common point of sperm elimination (reviewed in [45]). As SD-mediated drive eliminates wild type sperm at the individualization stage, the enrichment of genes involved in cytoskeleton-related processes in our analyses could be related to the drive phenotype rather than its proximal cause. We suspect that the timing of the proximal cause of SD-mediated drive may align with early spermatogenetic processes; perhaps where cell cycle-related genes are active and appear to be broadly differentially expressed (Fig 2B, Module H). This earlier timing is consistent with temperature shift experiments that place the critical period for SD at or before meiosis [47].

Regardless of the precise mechanism, different SD chromosomes may converge on similar phenotypes if the dysfunctional sperm targeted by SD trigger a sperm quality checkpoint that eliminates spermatids [30,66]. Many have proposed the existence of such a checkpoint. Events that take place during prophase/metaphase may be linked with late-stage sperm elimination [67,68]. A recent study identified a component of this putative checkpoint [66]. The enrichment of genes related to cytoskeleton pathways found in our gene set analysis could be associated with the common elimination mechanism of this putative checkpoint. Alternatively, the SD-induced defect may not trigger this putative checkpoint and instead, the spermiogenic failure at individualization is simply the end point of a cascade of perturbations that begins prior to meiosis.

In this paper, we make significant progress toward understanding molecular mechanisms of SD in connecting Rsp RNA to SD. Future studies of SD-related phenotypes and effects on satellite DNA transcription and chromatin, may have general implications for understanding how spermatogenesis is vulnerable to drive and other cheaters.

Drive is widespread across species and has significant consequences for the fundamental process of gametogenesis and its evolution (reviewed in [3,69,70]). Revealing drive mechanisms could help us understand fundamental aspects of spermatogenesis, with implications for our understanding of male infertility, and the development of efficacious and safe synthetic drivers to control vectors of human disease, address agricultural challenges, and species conservation.

Methods

Fly stocks

We maintained all fly stocks and crosses at 25°C on cornmeal medium. Iso1 [71], R16 [26], CyO/Gla, SD-Mad and SD-5 [72]. Iso1 chromosomes are typically sensitive to drive (Rsps allele with ~1100 copies) and Gla chromosomes are typically super-sensitive to drive (Rspss allele with >2000 copies), although the Gla chromosome we use here has lower drive strength in the SD-Mad background (Table A in S1 Appendix). R16 is a complete deletion of Rsp and the surrounding sequences [26].

The stocks for the kipf knockdown experiments were provided as a generous gift from Julius Brennecke [48] and are now available from the Vienna Drosophila Stock Center: Kipf-sh VDRC# 314048, w-sh VDRC# 313772.

The Sd-RanGAP deletion line SD-MadRev is a transgenic line that we made using CRISPR. We generated a gRNA-expressing construct by inserting the gRNA sequence (AGGAGGATTTGGAATAGTC) into pCFD3 vector following the protocol in [73]. This gRNA sequence matches the sequence near the breakpoint between the Sd-RanGAP and wild type RanGAP gene. We also generated a repair construct with the homology arms matching the sequence around the CRISPR cut site and a tag. To perform CRISPR on the SD-Mad chromosome, we generated a fly stock with the X chromosome from the Bloomington Drosophila Stock Center #51323 (y[1] M{vas-Cas9}ZH-2A w[1118]), and the 2nd chromosome from SD-Mad. The injection of the pCFD3 gRNA construct into this Cas9;SD-Mad fly was done by GenetiVision. The transgenic flies were screened, and the deletion of Sd-RanGAP was verified by PCR.

Rsp overexpression transgenic fly

We used the CRISPR/Cas9 system to insert Rsp sequences into the 38C1 piRNA cluster to generate the RspOE_DsRed line. We generated a gRNA expressing construct by inserting the gRNA sequence (GATTCGATCTCAAGACCCAC) into a pCFD3 vector following the protocol in [73]. The designed gRNA targets position 20,154,890 on contig 2L_1 in the heterochromatin-enriched genome assembly [74]. To generate the repair construct, we synthesized two gBlock fragments (Integrated DNA Technologies, IDT) based on the homology arms around the CRISPR cut site. We inserted the gBlock with the left homology arm into the pDsRedattp (Addgene #51019) vector with SphI and NdeI (New England biolabs, NEB), and then inserted the gBlock with the right homology arm with BglII and XhoI (NEB). We synthesized a Rsp trimer sequence by PCR using primers (forward: GGAAAATCACCCATTTTGATCGC, reverse: CCGAATTCAAGTACCAGAC) described before in [34], and inserted it into the repair construct with AvrII and SacII (NEB). All insertions were verified with Sanger sequencing. To accomplish CRISPR on the Iso1 chromosome 2, we generated a fly stock with the X chromosome from the Bloomington Drosophila Stock Center #51323 (y[1] M{vas-Cas9}ZH-2A w[1118]), and the 2nd chromosome from Iso1. The injection of the pCFD3 gRNA construct and the repair construct into this Cas9;Iso1 fly was done by GenetiVision. The transgenic flies were screened using the DsRed visible marker and we verified the DsRed insertion by PCR. To remove the DsRed marker, we crossed the RspOE_DsRed line to a Cre-expressing line y[1] w[67c23]; sna[Sco]/CyO, P{w[+mC]=Crew}DH1 (BDSC #1092) following the cross scheme described in section 3.1.3 in [75]. The removal of the DsRed sequence was verified by PCR.

gBlock sequence with the left homology arm: GCACATgcatgctagcTTAATTATTAAGTACAAAAGGAAAAATTTATCTAGTTATTAATTACTTAATGTGTAATAATATATTACTATCTTACTATCCTCCGGGTAGGGAGATCGCTGGGGTGTACCCTCTTCAGCCTTCGAAGGGAGATGGGATTAACTAGGATATTTGCCAGTCGGTTCGGGTGGACCATAAGCCTGCCGTCTGCAGAAGCAACAATCACTTCAACAACGAGAAGACAGTAATCGACAGCACAGATTTCTTGATGTAAAATCGCTTCTGGAGCAACAACAACAACAATTTCAGCAATGGCAACAGCAATTTCGCTTGTGGCTTCGACAGGAAAATCAACAGCAAAACAAACATGTCAACCAGCGCTTAAAAAAGCTTGAAATATCGTATTTGAAATCGCTAATAATATAAAACAATGAGCTGGAGCTAAACACCAGTCTCATGACAAAGTTTCGGCCTTGCAATGATCCATCTTAAGGTTCTTATATGGAGTGTCAATGGCATTTCATGCAAAGCCAGAGAAATTGAGCGCTTCGCAACTGACCTTGGTGACATGGAGTTCAGTGCCATTTACTGCCCTCCAATGAACAGATTAGAAGAAAGACATTTCACTAATCTACTCCGTGCTTGCAGGCAAAGGTACTTGGTAGATAGTGACTGGAATGCGCGACACTGGCTGTGGGGAGATAGATACAACTCACCCAGGGGGCGAGAACTAGCTAAAGCCATTTCTAGCTGTGGGGCTAATATTCTTGCAGACGTGCGATTCGATCTCAAGACCCACgcggccgcgagctcCCCAGGTCAGAAGCGGTTTTCGGGAGTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAGGGCCGCCGACATGACACAAGGGGTTGTGACCGGGGTGGACACGTACGCGGGTGCTTACGACCGTCAGTCGCGCGAGCGCGAcctaggTCCccgcggAGGCATTcatatgGAATTCC

gBlock sequence for the right homology arm: GGAagatctggcgcgccTCGCGCTCGCGCGACTGACGGTCGTAAGCACCCGCGTACGTGTCCACCCCGGTCACAACCCCTTGTGTCATGTCGGCGGCCCTACGCCCCCAACTGAGAGAACTCAAAGGTTACCCCAGTTGGGGCACTACTCCCGAAAACCGCTTCTGACCTGGGaggcctgtcgacggtaccATGACTTCTTTGGAACCGGGCGGCAAATCAGCTAAAAAACTTGCTAAGACTTAGAAACGAATTCTTTGAGCAAAAGTTGACGTCGCTGGACTAGACTAGTGGGCATAAGTATTTGGACAAGAAATATTTTCAATATATTTGTTTGTAACTCATTTTTTACTTAAAGCAAAATTGGTTAATTATTTTGTTGATTTAACAAAAATTACTTTCTACAAATTAGCAGTGGCATAAGTACTTGGACAAATTATTTAAATGTTATAAATTGAAAAAAAAAGTCAACTACAAAATTATGACAAATTAATAAAAAATATACACTCCCTCAGCGTCTATCACCTTTTGCAGACGTTTTGGTACAGACTGTACCAAGCTGTGGATATAATAATCTATAATCTATAATCTATTGAAATATCCTTCCATAAGGTTTGAATTTCCAAAATCGTTTATTCGCGACTTTTAGATAAGTTTGCACTCCATTTTCTTTTTAAATATGACCAGAGGTTTTCTATTATGTTGAGGTCTGGACTTTGAGGTGGCCAATCCAATGTGTTTACGCCAACATCTTTCAGAAACTTCGTAATCAGTTTGGCCTTATGACAGGGAGCATTATCCTGCTGGAGTATGAAGGACTCTCCAATCAATTTATCACCAGAGGGGAATGCATGATTATTAAGGACATCTAAATATTTTCCTTGATTCATGGTTCCATCAACAGGAACCAAATCTCCCAAGCCAGTGAAAGGATATTTTGCTGTTCACAAAGCTTCTTATAAGCAAATATTGGTTTTTAGACgctcgaggggcgccAAA

Rsp PCR product sequence: CCGAATTCAAGTACCAGACAAACAGAAGATACCTTCTACAGATTATTTAAACCTGGTACACAAAAACAATAAATTGACTAAGTTATGTCATTTTAAGCGGTCAAAATTGGTGATTTTTCGATTTCAAGTACCAGGCGAACAGAAGACACCTTCTAGAGATTCTGTTCAACTGGTAAGCAAAAACAGTAAATTGCCTAAGTTTTACATTTTAAGCGGTCAAAATGGGTGATTTTCCGATTTCAAGTACCAGACAAACAGAAGATACCTTCTACAGATTATTTAAACCTGGTACACAAAAACAATAAATTTACTAAGTTATGTCATTTTAAGCGATCAAAATGG GTGATTTTCC

Testis RNA extraction for (q)RT-PCR

10-15 pairs of testes per replicate from 3-5 day old flies were dissected in cold PBS and immediately placed in 300ul of 1X RNA Protect from the Monarch Total RNA Miniprep kit (New England Biolabs Cat # T2010S). The tissues were stored in a -80C freezer until all replicates were dissected. When RNA was to be isolated, we added proteinase K and buffer to the sample and incubated the testes at 55C for 20–30 minutes. Genomic DNA was removed using a gDNA removal column and one volume of 95% EtOH was added to the eluent (the fraction containing the RNA). The RNA was run through an RNA capture column and was subsequently treated with on-column DNAse I for 45–60 mins at RT (extended DNase treatment allows more time to degrade repetitive DNA). The RNA was then primed with RNA Prime buffer and washed twice. After the second wash, the tubes were spun for an additional 2 minutes to dry the membrane. RNA was then eluted in 40–50 ul of RNase free water.

cDNA generation for RT-PCR

200 ng of total RNA mixed with oligo(dT), satellite DNA-specific primer, and nucleotides was brought up to 13 ul with water and incubated at 65C for 5 minutes and allowed to cool on ice for at least 1 min. After cooling the RNA, we added 4 ul 5X reaction buffer, 1 ul DTT, 1 ul RNaseOUT Recombinant Ribonuclease Inhibitor (ThermoFisher Cat # 10777019), and 1 ul SuperScript III reverse transcriptase (ThermoFisher Cat # 18080093) (water was added for no RT controls) up to 20 ul total reaction volume. The reaction was then incubated at 25C for 5 min, 55C for 1 hr, and 75C for 15 min. If the sample was going to be used for RT-PCR the cDNA was frozen at -80C until use. If the cDNA was to be used for qRT-PCR it was diluted 3X by adding 40 ul RNase-free water and then stored at -80C until use.

RT-PCR

1 ul of cDNA was added to 5 ul Q5 High-Fidelity DNA Polymerase rxn buffer, 2.5 ul of dNTPs, 2.5 ul of 6 uM primers, 13.5 ul of water, and 0.5 ul of Q5 High-Fidelity DNA Polymerase (New England Biolabs Cat # M0491S) for a total reaction volume of 25 ul. The samples were then cycled between 98C, 60C, and 72C 38 times and the amplicons were run on a DNA gel. Primers for kipf: FWD: ACCAGCGAAACGGGATTATTA REV: CAAGGCGTAGACACTACTGAAC and RP49: FWD: GCTTCTGGTTTCCGGCAAGGTATGT REV: ACGTTTACAAATGTGTATTCCGACCACGTT.

qRT-PCR

4 ul of cDNA was added to 7.5 ul of PerfeCTa SYBR Green FastMix (Quantabio Cat # 95072-012), 1.5 ul 6 mM primers (Rsp For: GGAAAATCACCCATTTTGATCGC Rev: CCGAATTCAAGTACCAGAC, 359 bp. For: TACGATCTCAGCGAGGTATGA Rev: TTCCAAATTTCGGCCATCAAAT), and 2 ul water for a reaction volume of 15 ul. The reactions were then run on a BioRad C1000 thermal cycler (BioRad Cat # 1851196) equipped with a BioRad CFX96 attachment (BioRad Cat # 1845097). The program consists of a 98C melting temp, 60C annealing temp, and a 10 second extension at 72C.

qRT-PCR data were analyzed using the ΔΔCt method [76] and represented using fold change (FC) relative to a housekeeping gene (rbp4. For: CAATCCCAACTACAATCCCTATCT Rev: CTTGGGTGCCATCGGAATTA or rps3. For: AGTTGTACGCCGAGAAGGTG Rev: TGTAGCGGAGCACACCATAG).

RNA FISH

To image Rsp and 1.688 we used a custom Stellaris probe set for the former and a previously described probe labeled with Cy5, (5’-Cy5TTTTCCAAATTTCGGTCATCAAATAATCAT-3’) [77] for the latter.

Testes were dissected in cold PBS and fixed using 4% FA in PBST (0.1% Tween or Triton, either produced good results) for 30 minutes on a nutator at RT. After the fixative was removed, the tissues were washed with 1 ml PBS twice, 5 minutes each on a nutator. The tissues were prehybridized for 5 minutes using 2X SSC with 10% formamide. The probe was diluted in Stellaris hybridization buffer mix (final concentration of probes: 0.1 uM for oligo probes and 0.125 uM for stellaris probes) to the samples and placed them at 37C on a nutator overnight.

After overnight incubation we washed the tissues with 1 ml of 2X SSC with 10% formamide for 30 min twice at 37C. The tissues were then mounted using SlowFade Diamond Antifade mountant (ThermoFisher, cat # S36963). The DAPI was allowed to soak into the tissue overnight at 4C before imaging within 1 week.

K value assays

To assay the strength of segregation distortion k values were estimated from heterozygous SD/Rsps males (where Rsps are chromosomes with sensitive Rsp alleles) as described previously [78]. At least 10 replicate crosses of single 3–5-day old males with two 3–5-day old Iso-1 female virgins were prepared. Each cross was transferred to a fresh food vial after 3 days, and the parents discarded after 4 more days. We counted the progeny from each vial through day 18 after the parents were first introduced to the vial. Only replicates with more than 50 total progeny were included in our analysis. The transmission rate of the SD allele depends on not only its distortion strength, but also its viability relative to the other allele. Thus, to correct for viability effects, the transmission rate of the SD chromosome was measured in SD/Rsps females. The SD/Rsps females have a Mendelian segregation ratio with k = 0.5, and any distortion from this equal segregation can be attributed to the difference in the relative viability of the two alleles. 3 replicate crosses of five 3–5-day old females with three 3–5-day old Iso1 males were prepared, and then transferred to a fresh food vial after 4 days and kept for 4 more days. The progeny from each vial were then counted through day 18 after the parents were first introduced to the vial. The relative viability factor w = nSD/nIso1 for each SD/Rsps genotype, where nSD and nIso1 are the numbers of SD and Iso1 bearing progeny produced by the SD/Rsps female, respectively. This viability factor was then used to calculate a corrected strength of segregation distortion k* = NSD/ (w * NGla + NSD), where NSD and NIso1 are the numbers of SD and Iso1 bearing progeny produced by the SD/Rsps male, respectively. The viability corrected k value (k*) was reported where we were able to estimate viability (Table A in S1 Appendix; Figs 4, S11, S12), otherwise the reported value is k (Fig 3).

Imaging

A Leica SP5 laser scanning confocal microscope was used to acquire images of our slides.

Small RNA Seq

Six- to eight-day-old testes were dissected in RNase free PBS buffer. Total RNA was extracted using mirVana miRNA Isolation Kit (Ambion) with procedures for isolating RNA fractions enriched for small RNAs (<200nt), then treated with RNase free DNase I (Promega) at 37°C for 1 hour. Library preparation and sequencing were performed by Genomics Research Center at University of Rochester. Briefly, 2S rRNA was depleted [79], small RNA library was prepared with TruSeq Small RNA Library Prep Kit (Illumina) and sequenced by Illumina platform HiSeq2500 Single-end 50 bp.

Total RNA-seq

Six- to eight-day-old testes were dissected in RNase free PBS buffer. Total RNA was extracted using mirVana miRNA Isolation Kit (Ambion) with procedures for isolating RNA fractions enriched for long RNAs (>200nt), then treated with RNase free DNase I (Promega) at 37°C for 1 hour. Library preparation and sequencing were performed by Genomics Research Center at University of Rochester. Briefly, rRNA was removed and total RNA library was prepared with TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (Illumina) and sequenced by Illumina platform HiSeq2500 Paired end 125 bp. Care was taken when extracting all RNA samples that all chromosomes outside of the 2nd were controlled for to control for copy number of other repetitive elements.

Total RNA Seq analysis

Fastq files were trimmed using trimgalore with a minimum read length of 20 bp. FastQC was used to assess the quality of the remaining reads. Total RNA reads were mapped to a heterochromatin enriched genome using both Bowtie2 (for repeats) [80] and STAR (for genes) [81] and expression was calculated using HTSeq (for genes) [82] or a custom proportional counting script (for repeats; https://github.com/LarracuenteLab/SD-RNAseq). To calculate differentially expressed genes we used DESeq2 [83]. We additionally used PANGEA [43] to find enriched gene sets.

Weighted Gene Correlation Network Analyses (WGCNA) [46] was carried out using the WGCNA package in R using the 50th percentile of variable genes and a minimum R^2 value of 0.8. We used the spearman method for calculating correlations then found the difference between the non-driving genotype (R16/Gla) and the driving genotypes (SD-Mad/Gla, SD-5/Gla). We calculated significance using a t-test with Tukey’s multiple hypothesis correction. We then performed PANGEA gene set analysis on the modules correlating to the drive and SD haplotype. Gene sets were labeled significant if their Benjamin & Hochberg false discovery rate <0.05.

Small RNA Seq analysis

SmRNA seq fastq files were trimmed for quality and length with a minimum length of 18 and a maximum length of 32 using cutadapt. Remaining reads were then mapped to a library of rRNAs and tRNAs and unmapped reads were saved to a separate file. The unmapped reads were then mapped to a heterochromatin enriched genome using Bowtie [84]. Counts for miRNAs and complex satellite repeats were calculated using a custom python script that assigned reads to features according to the proportion of the read mapping to that feature (https://github.com/LarracuenteLab/SD-RNAseq). Differential expression was then calculated using DESeq2 [83].

Supporting information

S1 Appendix. Table A.

Estimated drive strength for SD and “wild type” chromosomes used in the RNAseq analysis. Table B. Differential expression data for piRNA clusters in the small RNA comparisons for SD-Mad, SD-5, or SD-MadRev with an Iso1 or Gla 2nd chromosome. Table C. Differential expression data for piRNA clusters in the total RNA comparisons for SD-Mad and SD-5 with Iso1 or Gla 2nd chromosome. Table D. Difference in Spearman Correlation coefficients for individual WGCNA modules between SD-5/Gla or SD-Mad/Gla versus R16/Gla. Table E. Differential expression data for piRNA clusters in the small RNA comparisons for SD-Mad and SD-5 paired with either RspOE or RspOE-DsRed compared to SD-Mad/Iso1 or SD-5/Iso1.

https://doi.org/10.1371/journal.pgen.1012235.s001

(PDF)

S1 Fig. Small RNA seq analysis in SD/Gla backgrounds shows that small RNAs corresponding to Rsp are significantly less abundant in SD-Mad but not SD-5.

A) A bar chart showing the change in Rsp small RNAs in proportion to R16/Iso1. SD-Mad/Iso1 has ~ 50% fewer Rsp smRNAs than expected. SD-MadRev/Iso1 and SD-5/Iso1 have largely unchanged levels of Rsp relative to R16/Iso1. B) Bargraphs showing the DESeq2 normalized counts of reads corresponding to Rsp. SD-Mad/Gla has significantly less Rsp than the control. SD-5 has a larger count than expected. The apparent overexpression of Rsp in the SD-5/Gla condition is likely due to an epistatic interaction ectopically overexpressing Rsp and not drive because in all SD/Gla backgrounds Rsp is slightly higher than expected relative to R16/Gla. C) A heatmap showing the magnitude and significance of differential expression for Rsp, 1.688, and major piRNA clusters. 38C2 is linked to SD and its upregulation may be due to an epistatic interaction in the background as there is no evidence that 38C2 is involved. The somatic cell specific piRNA cluster on the X-chromosome, 20A, is also upregulated, but it is unclear if or how this is related to drive.

https://doi.org/10.1371/journal.pgen.1012235.s002

(PDF)

S2 Fig. The small RNA seq samples segregate by genotype in the DESeq2 repeat analysis.

A-D) PCA plots that show the two highest principal components contributing to variance between the small RNA samples in the repeat analysis. The samples largely segregate by genotype suggesting that the bulk of the variance between samples comes from the 2nd chromosomes used in the study. It is important to note that the samples in the SD-Mad/Iso1 backgrounds come from two different batches, but that the largest contribution to the variance between replicates is the second chromosome used in the experiment. Also, one replicate from the SD-5/Iso1 comparison didn’t group well with the other two replicates which reduces our power in this comparison. The top 5 most differentially expressed repeat elements are labeled with their common name.

https://doi.org/10.1371/journal.pgen.1012235.s003

(PDF)

S3 Fig. The total RNA seq samples segregate by genotype in the DESeq2 gene analysis.

A-E) PCA plots that show the two highest principal components contributing to variance between the total RNA samples for the gene analysis. The samples largely segregate by genotype suggesting that the bulk of the variance between samples comes from the 2nd chromosomes used in the study. It is important to note that the SD-Mad/Iso1 replicates have a lot of variability which limits the statistical power of comparisons with SD-Mad/Iso1. The volcano plots show the distribution of differentially expressed genes for each comparison with colored dots (green for SD-Mad comparisons, blue for SD-5 comparisons) being upregulated relative to the copy number control (R16/Iso1 or Gla) with a filter of P<=0.01 while the gray dots are downregulated. The 5 genes with the greatest Log2 fold change are labeled with the genes common name.

https://doi.org/10.1371/journal.pgen.1012235.s004

(PDF)

S4 Fig. The total RNA seq samples segregate by genotype in the DESeq2 Repeat analysis.

A-D) PCA plots that show the two highest principal components contributing to variance between the total RNA samples for the repeat analysis. Both SD/Gla backgrounds segregate well by genotype. The SD/Iso1 comparisons do not cluster well by genotype. This limits the statistical power for the SD/Iso1 comparisons. The volcano plots show the distribution of differentially expressed repeats as defined by DESeq2 for each comparison. Colored dots are upregulated features with a filter of P = 0.01 while the gray dots are downregulated relative to the copy number control (R16/Iso1 or Gla). The 5 features with the greatest Log2 fold change are labeled with the repeats common name.

https://doi.org/10.1371/journal.pgen.1012235.s005

(PDF)

S5 Fig. There are no patterns of differential expression in repetitive elements in the total RNA but a broad dysregulation of genes known to cause an individualization defect.

A-B) Heatplots showing the significance and magnitude of differential expression for two satellite DNAs (Rsp and 1.688) and other major piRNA clusters. Rsp precursors appear to be upregulated in the SD-Mad/Gla background. This could be due to an epistatic interaction between the SD chromosomes and the other chromosomes in the Gla crosses. Additionally, the Chr 3 linked piRNA cluster 80F is upregulated in both SD/Gla heterozygotes. C) A heatmap of differentially expressed genes in a set of genes known to cause individualization defects when dysregulated. Fewer genes are significant in this comparison than in the SD/Gla background. This is likely due to reduced power in the Iso1 comparisons.

https://doi.org/10.1371/journal.pgen.1012235.s006

(PDF)

S6 Fig. Few TE families are consistently and significantly differentially expressed in SD backgrounds.

The heatplot shows the magnitude and significance of the change in the expression of TE families. Notably R1, R2, and ribosomal intergenic spacers are significantly less abundant than expected relative to the control. TcMar-Tc1 appears to be upregulated.

https://doi.org/10.1371/journal.pgen.1012235.s007

(PDF)

S7 Fig. Rsp transcripts are not grossly mislocalized in driving backgrounds.

DNA FISH in a wild type non driving background (A), a driving heterozygote (B), and a non-driving SD-Mad homozygote (C). Nuclei are stained with DAPI and fluorescent probes are used to mark 1.688 (yellow) and Rsp (Red). Transcripts are nuclear localized as expected in all stages of expression, from early spermatocytes to late spermatocytes.

https://doi.org/10.1371/journal.pgen.1012235.s008

(PDF)

S8 Fig. Gene set analysis from the total RNA seq of both SD/Gla genotypes shows differences in the immune system and the Rho GTPase cycle when compared to R16/Gla.

A-B) A dotplot of Reactome gene sets shows a broad dysregulation of genes involved in the immune system and Rho GTPase cycle. In addition to these common gene sets: SD-Mad/Gla also shows a dysregulation in the MAP pathway and in mitotic prophase. SD-5/Gla shows a dysregulation of G-protein coupled receptor signaling which encompasses a broad set of cellular pathways. The color of the dot represents the P-value with blue being smaller P values and red being larger P values. The size of the dot corresponds to the number of genes that overlap with the given gene set. On the X-axis is the percentage of all differentially expressed genes in the comparison that overlap with the given gene set.

https://doi.org/10.1371/journal.pgen.1012235.s009

(PDF)

S9 Fig. The top 20 most differentially expressed genes are consistent between the digital gene expression and total RNA analysis.

A heat plot showing the magnitude and direction of the twenty most differentially expressed genes from the digital gene expression of the SD-Mad/Iso1 vs SD-MadRev/Iso1 comparison side by side with the totRNA results. The direction and significance of the differential expression is largely consistent between the totRNA and DGE.

https://doi.org/10.1371/journal.pgen.1012235.s010

(PDF)

S10 Fig. Kipferl is expressed in the male germline.

A) Genomic PCR for kipferl and rp49 (PCR control) on WT (Ral391) and kipf-KO ovaries and testes. The first two lanes show that the genomic locus is deleted in the knockout. The next two pairs of lanes are RT-PCR reactions from cDNA for ovaries (lane 3–4) and testes (lane 5–6) from the same genotypes. Bands are present in the wild type genotype and absent in the knockout. Quantification of the signal can be found in D. B) Transcripts per million measurements from total RNA seq for various piRNA genes. Kipferl is expressed at a slightly lower level than rhino. C) Schematics of the two transcripts observed upon amplicon sequencing of the wild type testis kipf RT-PCR. They correspond to kipf-RA and kipf-RB on Flybase. D) Quantification of the nucleotide gel in A. Kipferl is expressed at a lower level in testes than in ovaries. E-F) A reanalysis of small RNA seq data from Baumgartner et al. 2024. These single replicate data show an inconsistent effect on the transcription levels of satellite DNA derived small RNAs in a kipf-KO background. 359 bp refers to the most abundant component of 1.688.

https://doi.org/10.1371/journal.pgen.1012235.s011

(PDF)

S11 Fig. Kipf-KD reduces drive strength in both sensitive and semi sensitive backgrounds.

A-B) Drive strength analysis for SD-Mad/Iso1 and SD-Mad/C8. C8 is a Rsp deletion line generated from Iso1 by Eickbush et al and is semi sensitive to SD. Short hairpin RNAs for white (control) or kipf were driven by a Bam-Gal4/UASp expression system. Upon kipf-KD, k value in SD-Mad/Iso1 drops from k = 0.98 to k = 0.89 (P < 0.0001 (asin-t)). K value in SD-Mad/C8 drops from k = 0.85 to k = 0.72 (P < 0.0001 (asin-t)).

https://doi.org/10.1371/journal.pgen.1012235.s012

(PDF)

S12 Fig. Variance between samples of smRNAs from SD/Iso1 and SD/RspOE backgrounds does not necessarily cluster by genotype.

A-B) PCA plots show that the intersample variance between SD/Iso1 and SD/RspOE is largely similar. This is expected as the only difference between these genotypes is a small insertion of Rsp into the piRNA cluster, 38C1.

https://doi.org/10.1371/journal.pgen.1012235.s013

(PDF)

S13 Fig. Insertion of both Rsp and 3xP3-DsRed into 38C1 overexpresses Rsp but does not lower drive strength.

A) A heatplot from small RNA sequencing showing the magnitude and significance of differential expression of satellites and major piRNA clusters between SD-Mad/Iso1 and SD-Mad/Iso1RspDdsRed>38C1 (RspOE-DsRed). Similar to the non-dsRed results, piRNA cluster 38C1, and to a smaller degree, 38C2, are less abundant than expected. B) Bar graphs showing the DESeq2 normalized counts for Rsp for SD/Iso1 and SD/RspOE-DsRed. Rsp is consistently overexpressed when the 3xP3-DsRed marker is present in both SD backgrounds. C) Unlike in the experiments where the 3xP3-DsRed was removed, drive strength shows no difference between the Iso1 background (control) and the RspOE-DsRed background for either SD chromosome. This suggests that something about the 3xP3-DsRed insertion abrogates the effect of the Rsp overexpression on drive.

https://doi.org/10.1371/journal.pgen.1012235.s014

(PDF)

S3 File. List of differentially expressed genes in Iso1 and Gla backgrounds.

https://doi.org/10.1371/journal.pgen.1012235.s017

(XLSX)

Acknowledgments

We thank members of the Larracuente lab for feedback on the project and the manuscript. Special thanks go to Artemis Shung, Gefei Yu, and Natasha Kruelski for discussions related to experiments in the manuscript. We thank Julius Brennecke for providing the fly lines used in our Kipferl experiments. We thank Nathaniel and Helen Wisch for their support. We are grateful for the University of Rochester Messersmith Fellowship for supporting XW. Finally, we are grateful for access to the Center for Integrated Research Computing and the Genomics Research Center at the University of Rochester, for access to computing resources and sequencing services, respectively.

References

  1. 1. Sandler L, Novitski E. Meiotic drive as an evolutionary force. Am Nat. 1957;91(857):105–10.
  2. 2. Zimmering S, Sandler L, Nicoletti B. Mechanisms of meiotic drive. Annu Rev Genet. 1970;4:409–36. pmid:4950062
  3. 3. Lindholm AK, Dyer KA, Firman RC, Fishman L, Forstmeier W, Holman L. The ecology and evolutionary dynamics of meiotic drive. Trends Ecol Evol. 2016;31:315–26.
  4. 4. Werren JH. Selfish genetic elements, genetic conflict, and evolutionary innovation. Proc Natl Acad Sci U S A. 2011;108 Suppl 2(Suppl 2):10863–70. pmid:21690392
  5. 5. Meiklejohn CD, Tao Y. Genetic conflict and sex chromosome evolution. Trends Ecol Evol. 2010;25(4):215–23. pmid:19931208
  6. 6. Wu CI. Virility deficiency and the sex-ratio trait in Drosophila pseudoobscura. II. Multiple mating and overall virility selection. Genetics. 1983;105:663–79.
  7. 7. Crow JF. Why is Mendelian segregation so exact? Bioessays. 1991;13(6):305–12. pmid:1909864
  8. 8. Bradshaw SL, Rodríguez E, Wang H, Yu CT, De Villiers De La Noue C, Hafezjee A, et al. The metabolic costs of meiotic drive. Proc R Soc Biol Sci. 2025;292(2050):20250779. pmid:40592454
  9. 9. Zanders SE, Unckless RL. Fertility costs of meiotic drivers. Curr Biol. 2019;29:R512–20.
  10. 10. Hartl DL. Modifier theory and meiotic drive. Theor Popul Biol. 1975;7(2):168–74. pmid:1145501
  11. 11. Courret C, Chang C-H, Wei KH-C, Montchamp-Moreau C, Larracuente AM. Meiotic drive mechanisms: lessons from Drosophila. Proc R Soc Biol Sci. 2019;286(1913):20191430. pmid:31640520
  12. 12. Aravin AA, Klenov MS, Vagin VV, Bantignies F, Cavalli G, Gvozdev VA. Dissection of a natural RNA silencing process in the Drosophila melanogaster germ line. Mol Cell Biol. 2004;24(15):6742–50. pmid:15254241
  13. 13. Tao Y, Masly JP, Araripe L, Ke Y, Hartl DL. A sex-ratio meiotic drive system in Drosophila simulans. I: an autosomal suppressor. PLoS Biol. 2007;5(11):e292. pmid:17988172
  14. 14. Dawe RK, Lowry EG, Gent JI, Stitzer MC, Swentowsky KW, Higgins DM. A kinesin-14 motor activates neocentromeres to promote meiotic drive in maize. Cell. 2018;173:839–850.e18.
  15. 15. Helleu Q, Gérard PR, Dubruille R, Ogereau D, Prud’homme B, Loppin B, et al. Rapid evolution of a Y-chromosome heterochromatin protein underlies sex chromosome meiotic drive. Proc Natl Acad Sci U S A. 2016;113(15):4110–5. pmid:26979956
  16. 16. Ellison C, Bachtrog D. Contingency in the convergent evolution of a regulatory network: Dosage compensation in Drosophila. PLoS Biol. 2019;17(2):e3000094. pmid:30742611
  17. 17. Vedanayagam J, Lin C-J, Papareddy R, Nodine M, Flynt AS, Wen J, et al. Endogenous RNAi silences a burgeoning sex chromosome arms race. bioRxiv; 2022.
  18. 18. Martí E, Larracuente AM. Genetic conflict and the origin of multigene families: implications for sex chromosome evolution. Proc Biol Sci. 2023;290(2010):20231823. pmid:37909083
  19. 19. Presgraves DC, Dawe RK, Dyer KA, Fishman L, Bhide SA, Bradshaw SL, et al. The evolutionary genomics of meiotic drive. Mol Biol Evol. 2026;43(2):msag020. pmid:41589062
  20. 20. Sandler L, Hiraizumi Y, Sandler I. Meiotic drive in natural populations of Drosophila Melanogaster. I. the cytogenetic basis of segregation-distortion. Genetics. 1959;44(2):233–50. pmid:17247821
  21. 21. Pimpinelli S, Dimitri P. Cytogenetic analysis of segregation distortion in Drosophila melanogaster: the cytological organization of the Responder (Rsp) locus. Genetics. 1989;121(4):765–72. pmid:2470640
  22. 22. Wu CI, Lyttle TW, Wu ML, Lin GF. Association between a satellite DNA sequence and the Responder of Segregation Distorter in D. melanogaster. Cell. 1988;54(2):179–89. pmid:2839299
  23. 23. Kusano A, Staber C, Ganetzky B. Nuclear mislocalization of enzymatically active RanGAP causes segregation distortion in Drosophila. Developmental Cell. 2001;1:351–61.
  24. 24. Merrill C, Bayraktaroglu L, Kusano A, Ganetzky B. Truncated RanGAP encoded by the Segregation Distorter locus of Drosophila. Science. 1999;283(5408):1742–5. pmid:10073941
  25. 25. Dasso M. The Ran GTPase: theme and variations. Curr Biol. 2002;12(14):R502–8. pmid:12176353
  26. 26. Ganetzky B. On the components of segregation distortion in Drosophila melanogaster. Genetics. 1977;86(2 Pt. 1):321–55. pmid:407128
  27. 27. Hiraizumi Y, Martin DW, Eckstrand IA. A modified model of segregation distortion in Drosophila Melanogaster. Genetics. 1980;95(3):693–706. pmid:17249048
  28. 28. Sandler L, Hiraizumi Y. Meiotic drive in natural populations of Drosophila melanogaster. IV. Instability at the Segregation-Distorter locus. Genetics. 1960;45:1269–87.
  29. 29. Larracuente AM, Presgraves DC. The selfish Segregation Distorter gene complex of Drosophila melanogaster. Genetics. 2012;192(1):33–53. pmid:22964836
  30. 30. Herbette M, Wei X, Chang C-H, Larracuente AM, Loppin B, Dubruille R. Distinct spermiogenic phenotypes underlie sperm elimination in the Segregation Distorter meiotic drive system. PLoS Genet. 2021;17(7):e1009662. pmid:34228705
  31. 31. Tokuyasu KT, Peacock WJ, Hardy RW. Dynamics of spermiogenesis in Drosophila melanogaster. VII. Effects of segregation distorter (SD) chromosome. J Ultrastruct Res. 1977;58:96–107.
  32. 32. Hauschteck-Jungen E, Hartl DL. Defective Histone Transition during Spermiogenesis in Heterozygous Segregation Distorter males of Drosophila melanogaster. Genetics. 1982;101(1):57–69. pmid:17246082
  33. 33. Chang C-H, Handler T, Fuda N, Pascua D, Mouton T, Larracuente AM. Pervasive suppressors halt the spread of selfish Segregation Distorter in a natural population. Genetics. 2026. pmid:42057709
  34. 34. Wei X, Eickbush DG, Speece I, Larracuente AM. Heterochromatin-dependent transcription of satellite DNAs in the Drosophila melanogaster female germline. eLife. 2021;10.
  35. 35. Chen P, Luo Y, Aravin AA. RDC complex executes a dynamic piRNA program during Drosophila spermatogenesis to safeguard male fertility. PLoS Genet. 2021;17(9):e1009591. pmid:34473737
  36. 36. Mills WK, Lee YCG, Kochendoerfer AM, Dunleavy EM, Karpen GH. RNA from a simple-tandem repeat is required for sperm maturation and male fertility in Drosophila melanogaster. eLife. 2019;8:e48940.
  37. 37. Kumon T, Nakamizo-Dojo M, Raz AA, Lannes R, Fingerhut JM, Yamashita YM. Defective transcription of AAGAG satellite DNA causes sex-ratio meiotic drive in Drosophila. Nat Commun. 2026;17(1):5701. pmid:42034642
  38. 38. Menon DU, Coarfa C, Xiao W, Gunaratne PH, Meller VH. siRNAs from an X-linked satellite repeat promote X-chromosome recognition in Drosophila melanogaster. Proc Natl Acad Sci U S A. 2014;111(46):16460–5. pmid:25368194
  39. 39. Le Thomas A, Rogers AK, Webster A, Marinov GK, Liao SE, Perkins EM, et al. Piwi induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state. Genes Dev. 2013;27(4):390–9. pmid:23392610
  40. 40. Gell SL, Reenan RA. Mutations to the piRNA pathway component aubergine enhance meiotic drive of segregation distorter in Drosophila melanogaster. Genetics. 2013;193(3):771–84. pmid:23267055
  41. 41. Czech B, Hannon GJ. One Loop to Rule Them All: The Ping-Pong Cycle and piRNA-Guided Silencing. Trends Biochem Sci. 2016;41(4):324–37. pmid:26810602
  42. 42. Chen P, Kotov AA, Godneeva BK, Bazylev SS, Olenina LV, Aravin AA. piRNA-mediated gene regulation and adaptation to sex-specific transposon expression in D. melanogaster male germline. Genes Dev. 2021;35(11–12):914–35. pmid:33985970
  43. 43. Hu Y, Comjean A, Attrill H, Antonazzo G, Thurmond J, Chen W, et al. PANGEA: a new gene set enrichment tool for Drosophila and common research organisms. Nucleic Acids Res. 2023;51(W1):W419–26. pmid:37125646
  44. 44. Croft D, Mundo AF, Haw R, Milacic M, Weiser J, Wu G, et al. The Reactome pathway knowledgebase. Nucleic Acids Res. 2014;42(Database issue):D472–7. pmid:24243840
  45. 45. Steinhauer J. Separating from the pack: molecular mechanisms of Drosophila spermatid individualization. Spermatogenesis. 2015;5(2):e1041345. pmid:26413413
  46. 46. Langfelder P, Horvath S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559. pmid:19114008
  47. 47. Mange EJ. Temperature sensitivity of segregation-distortion in Drosophila melanogaster. Genetics. 1968;58(3):399–413. pmid:5662627
  48. 48. Baumgartner L, Handler D, Platzer SW, Yu C, Duchek P, Brennecke J. The Drosophila ZAD zinc finger protein Kipferl guides Rhino to piRNA clusters. Elife. 2022;11:e80067. pmid:36193674
  49. 49. Chen P, Aravin AA. Genetic control of a sex-specific piRNA program. Curr Biol. 2023;33(9):1825–1835.e3. pmid:37059098
  50. 50. Baumgartner L, Ipsaro JJ, Hohmann U, Handler D, Schleiffer A, Duchek P, et al. Evolutionary adaptation of an HP1-protein chromodomain integrates chromatin and DNA sequence signals. Elife. 2024;13:RP93194. pmid:38995818
  51. 51. Eickbush DG, Rahmat J, Lindsay M, Bowers J, Fuda NJ, Larracuente AM. Targeted editing of pericentromeric satellite DNA alters sensitivity to meiotic drive. bioRxiv; 2026.
  52. 52. Kumon T, Raz AA, Fingerhut JM, Yamashita YM. Testing the function of widespread transcription of the testis. bioRxiv; 2025.
  53. 53. Chen P, Pan KC, Park EH, Luo Y, Lee YCG, Aravin AA. Escalation of genome defense capacity enables control of an expanding meiotic driver. Proc Natl Acad Sci U S A. 2025;122(2):e2418541122. pmid:39772737
  54. 54. Wu CI, True JR, Johnson N. Fitness reduction associated with the deletion of a satellite DNA array. Nature. 1989;341(6239):248–51. pmid:2506453
  55. 55. Rathke C, Baarends WM, Jayaramaiah-Raja S, Bartkuhn M, Renkawitz R, Renkawitz-Pohl R. Transition from a nucleosome-based to a protamine-based chromatin configuration during spermiogenesis in Drosophila. J Cell Sci. 2007;120(Pt 9):1689–700. pmid:17452629
  56. 56. Anderson JT, Henikoff S, Ahmad K. Chromosome-specific maturation of the epigenome in the Drosophila male germline. Elife. 2023;12:RP89373. pmid:38032818
  57. 57. Gaskill MM, Soluri IV, Branks AE, Boka AP, Stadler MR, Vietor K, et al. Localization of the Drosophila pioneer factor GAF to subnuclear foci is driven by DNA binding and required to silence satellite repeat expression. Dev Cell. 2023;58(17):1610-1624.e8. pmid:37478844
  58. 58. Navarro-Dominguez B, Chang C-H, Brand CL, Muirhead CA, Presgraves DC, Larracuente AM. Epistatic selection on a selfish Segregation Distorter supergene - drive, recombination, and genetic load. Elife. 2022;11:e78981. pmid:35486424
  59. 59. Brand CL, Larracuente AM, Presgraves DC. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster. Evolution. 2015;69(5):1271–83. pmid:25828399
  60. 60. Presgraves DC, Gérard PR, Cherukuri A, Lyttle TW. Large-scale selective sweep among Segregation Distorter chromosomes in African populations of Drosophila melanogaster. PLoS Genet. 2009;5(5):e1000463. pmid:19412335
  61. 61. Temin RG, Marthas M. Factors Influencing the Effect of Segregation Distortion in Natural Populations of Drosophila melanogaster. Genetics. 1984;107(3):375–93. pmid:17246219
  62. 62. Zhang X, Avellaneda J, Spletter ML, Lemke SB, Mangeol P, Habermann BH, et al. Mechanoresponsive regulation of myogenesis by the force-sensing transcriptional regulator Tono. Curr Biol. 2024;34(18):4143–4159.e6. pmid:39163855
  63. 63. Li H, Janssens J, De Waegeneer M, Kolluru SS, Davie K, Gardeux V, et al. Fly cell atlas: a single-nucleus transcriptomic atlas of the adult fruit fly. Science. 2022;375(6584):eabk2432. pmid:35239393
  64. 64. VanKuren NW, Long M. Gene duplicates resolving sexual conflict rapidly evolved essential gametogenesis functions. Nat Ecol Evol. 2018;2(4):705–12. pmid:29459709
  65. 65. Tokuyasu KT, Peacock WJ, Hardy RW. Dynamics of spermiogenesis in Drosophila melanogaster. Z Zellforsch. 1972;124:479–506.
  66. 66. Ridges JT, Bladen J, King TD, Brown NC, Large CRL, Cooper JC, et al. Selfish chromosomes exploit a germline checkpoint to eliminate competing gametes. Nat Commun. 2026;17(1):1532. pmid:41519863
  67. 67. McKee BD, Wilhelm K, Merrill C, Ren X. Male sterility and meiotic drive associated with sex chromosome rearrangements in Drosophila: role of X-Y pairing. Genetics. 1998;149:143–55.
  68. 68. Titen SWA, Lin H-C, Bhandari J, Golic KG. Chk2 and p53 regulate the transmission of healed chromosomes in the Drosophila male germline. PLoS Genet. 2014;10(2):e1004130. pmid:24586185
  69. 69. Edvalson LT, Larracuente AM. Consequences of drive on the evolution of genomes and species. G3 (Bethesda). 2025;15(6):jkaf076. pmid:40272862
  70. 70. Courret C, Wei X, Larracuente AM. New perspectives on the causes and consequences of male meiotic drive. Curr Opin Genet Dev. 2023;83:102111. pmid:37704518
  71. 71. Brizuela BJ, Elfring L, Ballard J, Tamkun JW, Kennison JA. Genetic analysis of the brahma gene of Drosophila melanogaster and polytene chromosome subdivisions 72AB. Genetics. 1994;137(3):803–13. pmid:7916308
  72. 72. Brittnacher JG, Ganetzky B. On the components of segregation distortion in Drosophila melanogaster. III. Nature of the enhancer of SD. Genetics. 1984;107:423–34.
  73. 73. Port F, Chen H-M, Lee T, Bullock SL. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014;111(29):E2967–76. pmid:25002478
  74. 74. Chang CH, Larracuente AM. Heterochromatin-enriched assemblies reveal the sequence and organization of the Drosophila melanogaster Y chromosome. Genetics. 2019;211:333–48.
  75. 75. Maggert KA, Gong WJ, Golic KG. Methods for Homologous Recombination in Drosophila. In: Dahmann C, editor. Drosophila: Methods and Protocols. Totowa, NJ: Humana Press; 2008. pp. 155–74. https://doi.org/10.1007/978-1-59745-583-1_9
  76. 76. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. pmid:11846609
  77. 77. Ferree PM, Barbash DA. Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila. PLoS Biol. 2009;7(10):e1000234. pmid:19859525
  78. 78. Powers PA, Ganetzky B. On the components of segregation distortion in Drosophila melanogaster. V. Molecular analysis of the Sd locus. Genetics. 1991;129:133–44.
  79. 79. Wickersheim ML, Blumenstiel JP. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries. Biotechniques. 2013;55(5):269–72. pmid:24215643
  80. 80. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–9. pmid:22388286
  81. 81. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29(1):15–21. pmid:23104886
  82. 82. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31(2):166–9. pmid:25260700
  83. 83. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15(12):550. pmid:25516281
  84. 84. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. pmid:19261174
  85. 85. Edvalson L, Wei X, Chang C-H, Larracuente A. Dataset for: Disruption of small RNAs and mechanistic variation in Segregation Distorter--a sperm killing drive system in Drosophila melanogaster. University of Rochester; 2026. https://doi.org/10.60593/UR.D.32969174.V1