Species-specific coevolution of RecA–RecN interfaces governs DNA double-strand break repair in Escherichia coli

Mizuki Inoue; Genki Akanuma; Masafumi Hayashi; Takashi Hishida

doi:10.1371/journal.pgen.1012169

Abstract

DNA double-strand breaks (DSBs) threaten genome stability and cell survival but can be faithfully repaired through homologous recombination (HR). RecN, a bacterial protein closely related to the structural maintenance of chromosomes family, cooperates with RecA in HR-dependent DSB repair, yet the molecular basis and physiological relevance of their interaction remain unclear. Here, we investigated the functional interplay between RecA and RecN during DSB repair by heterologously expressing Pseudomonas aeruginosa RecA (paRecA) and RecN (paRecN) in Escherichia coli. We found that in E. coli ∆recA ∆recN cells, co-expression of paRecA and paRecN fully restored MMC resistance, whereas co-expression of E. coli RecA (ecRecA) with paRecN conferred partial resistance to mitomycin C (MMC), demonstrating species-specific compatibility. Expression analysis revealed that paRecN was poorly expressed in E. coli, but codon optimization significantly enhanced its abundance and repair activity. We further identified gain-of-function paRecN mutants (I73T and R453H) that restored repair without increased expression. These mutants displayed species-specific adaptation, which improved compatibility with ecRecA but reduced functionality with paRecA. Fluorescence microscopy revealed that MMC-induced nucleoid localization was increased in paRecN^I73T and paRecN^R453H compared with paRecN. Collectively, these findings demonstrate that coevolution optimizes the RecA–RecN interface to ensure efficient DSB repair.

Author summary

DNA double-strand breaks (DSBs) pose a serious threat to genomic integrity, and their accurate repair is essential for cell survival. In bacteria, DSB repair largely depends on homologous recombination mediated by the RecA recombinase and supported by the SMC-like protein RecN. Although RecA and RecN are known to cooperate, how their interaction contributes to efficient repair has remained unclear. Here, we investigated the functional relationship between RecA and RecN by expressing proteins from Pseudomonas aeruginosa in Escherichia coli. We found that P. aeruginosa RecN (paRecN) exhibits limited activity in E. coli but regains full functionality when co-expressed with its cognate RecA, revealing strong species-specific compatibility. Furthermore, we identified gain-of-function paRecN mutants that restore compatibility with E. coli RecA while losing compatibility with their native partner. These findings demonstrate that the RecA–RecN interaction interface is shaped by species-specific coevolution. Our study provides mechanistic and evolutionary insights into how protein–protein interactions involved in genome maintenance are optimized within each species.

Citation: Inoue M, Akanuma G, Hayashi M, Hishida T (2026) Species-specific coevolution of RecA–RecN interfaces governs DNA double-strand break repair in Escherichia coli. PLoS Genet 22(5): e1012169. https://doi.org/10.1371/journal.pgen.1012169

Editor: Jue D. Wang, University of Wisconsin-Madison, UNITED STATES OF AMERICA

Received: January 17, 2026; Accepted: May 14, 2026; Published: May 28, 2026

Copyright: © 2026 Inoue et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: This study was financially supported by a grant from the Japan Society for the Promotion of Science KAKENHI grant JP24K09330 and JP21K06280 (to T. H.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

DNA double-strand breaks (DSBs) arising from exogenous agents such as ionizing radiation or chemical mutagens or from endogenous processes such as replication fork blockage are among the most cytotoxic forms of DNA damage [1]. When left unrepaired or repaired inappropriately, DSBs can lead to deleterious genetic alterations and cell death. Homologous recombination (HR) is an evolutionarily conserved mechanism essential for accurate DSB repair that uses an intact double-stranded DNA molecule as a template [2–4].

In Escherichia coli, DSB ends are processed by the RecBCD complex, whose helicase and nuclease activities resect the broken DNA to produce 3′ single-stranded (ss)DNA overhangs [5–7]. Subsequently, RecA is loaded onto the ssDNA to form a nucleoprotein filament that mediates homology searching, homologous pairing, strand invasion, and strand exchange, ultimately generating a recombination intermediate between the broken DNA and an intact homologous template [8–14]. In addition, RecA-bound ssDNA acts as an SOS response signal by triggering the autocleavage of the transcriptional repressor LexA, activating the transcription of SOS genes involved in DNA repair, recombination, and cell division arrest [15]. Given the central role of RecA in DSB repair, the series of reactions it catalyzes must be closely related to the mechanism that controls chromosome integrity; however, how chromosome dynamics are coordinated through RecA-mediated DSB repair remains incompletely understood.

Structural maintenance of chromosomes (SMC) proteins are conserved from bacteria to humans and play essential roles in chromosome dynamics, including sister chromatid cohesion, chromosome condensation, transcription, and DNA repair [16–18]. The E. coli recN gene encodes an SMC-like protein that is induced as part of the SOS regulon [19]. recN mutants exhibit high sensitivity to ionizing radiation, I-SceI-induced DSBs, and mitomycin C (MMC), but not to UV irradiation [20–22]. Moreover, ∆recN cells display abnormal nucleoid morphology characterized by fragmentation and/or decondensation in the presence of MMC [23], indicating a specific role for RecN in DSB repair. Consistent with this, we recently demonstrated that MMC-treated recN-deficient cells undergo a loss of chromosomal integrity and reduced survival, both of which are restored to wild-type levels upon subsequent induction of RecN expression [24]. Thus, the aberrant nucleoid structures observed in MMC-treated ∆recN cells do not represent irreversible chromosome disruption but rather a failure to complete RecA-mediated HR process. Fluorescence microscopy has shown that RecN is recruited to MMC-induced DSB sites in a RecA-dependent manner and plays a role in nucleoid compaction and sister chromatid interactions following DNA damage [23,25,26]. Recent live-cell imaging studies have demonstrated that RecA forms long elongated filaments on ssDNA (RecA bundles) that mediate pairing between DSBs and homologous donor strands located at distant sites, and that RecN modulates RecA filament dynamics to facilitate the search for homologous sequences [11,13,27]. In vitro studies have shown that RecN interacts with RecA to stimulate D-loop formation and strand-exchange activity [28,29]. As a cohesin-like protein, RecN can promote intermolecular DNA interactions and topologically entrap two DNA molecules in an ATP-dependent manner [29,30]. Together, these findings support that the SMC-like RecN plays structural and functional roles in HR-dependent DSB repair by coordinating RecA activity with high-order chromosome dynamics. Despite these advances, how RecN-mediated regulation of nucleoid dynamics contributes to the promotion of RecA-dependent HR, including the coordination of homology searching and strand exchange, remains poorly understood. Identifying the RecA–RecN interaction interface is therefore essential for elucidating the precise role of RecN in DSB repair.

In this study, we investigated the interaction between RecA and RecN in DSB repair using a cross-species functional complementation assay, expressing Pseudomonas aeruginosa RecA (paRecA) and RecN (paRecN) in E. coli ∆recN strain. paRecN displayed reduced DSB repair activity compared with E. coli RecN (ecRecN), but its activity was restored when co-expressed with paRecA. Furthermore, we isolated several paRecN mutants with enhanced DNA repair activity in E. coli, all of which carried mutations in either the N-terminal or the C-terminal domain. Interestingly, paRecN^I73T and paRecN^R453H showed repair activity comparable to that of ecRecN but lost their enhanced repair function when co-expressed with paRecA. These findings suggest that RecA–RecN interfaces are optimized through coevolution and highlight adaptive mechanisms restoring HR activity across species.

Results

Functional complementation of the ecRecN defect by RecN derived from other bacteria

RecN is highly conserved among bacteria. A previous study showed that RecN (hiRecN) from Haemophilus influenzae —like E. coli, a member of γ-proteobacteria— restored MMC sensitivity in E. coli ∆recN to wild-type levels [31]. In the present study, we extended this comparative approach to Pseudomonas aeruginosa RecN (paRecN), another γ-proteobacterial RecN homolog but with lower sequence identity with ecRecN than hiRecN. To enable the expression of RecN from different species under comparable transcriptional control, we constructed plasmids in which either H. influenzae recN or P. aeruginosa recN was inserted downstream of the native E. coli SOS-inducible recN promoter. Cells of the BW25113 ∆recN strain were transformed with the plasmids and subjected to spot assays for MMC sensitivity. hiRecN and ecRecN exhibited similar MMC sensitivity, whereas paRecN conferred only partial MMC resistance compared to ecRecN (Fig 1A and 1B). Similar results were obtained in the AB1157 genetic background (S1A Fig). These results indicate that while paRecN retains substantial functionality in E. coli, it fails to achieve full DSB repair proficiency.

Download:

Fig 1. Functional complementation of paRecN in E. coli.

(A) MMC sensitivity of WT and ∆recN strains expressing ecRecN, hiRecN, or paRecN. Ten-fold serial dilutions of cell cultures were spotted onto LB plates containing the indicated concentrations of MMC. Three independent experiments were performed which showed similar trends. (B) Exponentially growing ΔrecN cells carrying the indicated plasmid were exposed to MMC (1.0 µg/mL) for 60 min. Aliquots were collected and plated on LB_Cm plates at appropriate dilutions. The survival rates were calculated as the number of viable cells relative to the control (0 min) samples. The data points represent the average of three independent experiments. Data shown are mean ± SEM. P values were determined using a two-tailed t -test. *P < 0.05, **P < 0.01. (C) Nucleoid morphology in ∆recN cells expressing ecRecN or paRecN following MMC treatment. Exponentially growing cells were treated with MMC (1.0 µg/mL) for 90–120 min, collected at the indicated time points, fixed, stained with DAPI, and observed by fluorescence microscopy. Nucleoids appear light blue. Scale bar = 5 μm. (D) Quantitative analysis of nucleoid morphology in C. The bar graph represents the percentages of cells with no nucleoid, one nucleoid, two nucleoids, and ≥ 3 nucleoids per cell. At least 100 cells were analyzed for each time point. Data are shown as mean ± SD from three independent experiments.

https://doi.org/10.1371/journal.pgen.1012169.g001

Nucleoid morphology in paRecN-expressing ∆recN cells

One phenotypic hallmark of E. coli ∆recN is abnormal nucleoid morphology under DSB-induced genotoxic stress: RecN-deficient cells exposed to MMC exhibit nucleoid fragmentation and a filamentous morphology, reflecting incomplete repair [23,24,32]. To investigate whether paRecN can maintain nucleoid integrity under DNA-damaging conditions, we observed 4′,6-diamidino-2-phenylindole (DAPI)-stained nucleoids in MMC-treated E. coli ∆recN cells expressing ecRecN, paRecN, or an empty vector. Following MMC treatment, ∆recN cells expressing ecRecN exhibited elongated, evenly spaced nucleoids aligned along the cell axis; however, the number of nucleoids per cell remained similar to that in untreated controls, typically with one or two per cell (Fig 1C and 1D). In contrast, ∆recN cells carrying the empty vector exhibited extensive filamentation and nucleoid fragmentation, with 70% of cells having three or more nucleoids per cell after 120 min of MMC treatment (Fig 1C and 1D). In paRecN-expressing cells, this proportion was reduced to 38% (Fig 1C and 1D), indicating a partial loss of functionality in maintaining nucleoid integrity.

DNA repair activity in paRecA and paRecN co-expressing cells

Given the established biochemical interaction between RecA and RecN in several bacteria [28,29], we speculated that the reduced activity of paRecN in E. coli could result from an inefficient interaction with ecRecA. To explore this possibility, we examined whether co-expression of paRecA and paRecN would restore survival. We first evaluated the ability of paRecA to replace ecRecA function in E. coli. To this end, we generated a paRecA expression plasmid by replacing the E. coli recA coding sequence with that of P. aeruginosa. Expression of ecRecA in ∆recA cells restored survival under MMC exposure to wild-type levels (Fig 2A). In contrast, ∆recA cells expressing paRecA exhibited intermediate resistance (Fig 2A). Because RecA functions in both HR repair and SOS induction, we next examined whether the partial defect of paRecA in MMC resistance reflected an inability to induce the SOS response. We monitored SOS-regulated gene induction by monitoring RecN protein levels after MMC treatment. Strikingly, ∆recA cells expressing either ecRecA or paRecA showed comparable induction kinetics and RecN expression levels following MMC exposure (Fig 2B), indicating that paRecA is proficient in inducing the SOS response. These suggest that paRecA partially loses its HR repair activity in E. coli.

Download:

Fig 2. Functional complementation in cells co-expressing paRecA and paRecN.

(A) MMC sensitivity of ∆recA strains expressing ecRecA or paRecA. Ten-fold serial dilutions were spotted onto LB plates in the presence or absence of MMC (0.5 μg/mL) and incubated at 37 °C. Three independent experiments were performed which showed similar trends. (B) paRecA is proficient in SOS response induction. Cells were treated with MMC (1.0 µg/mL) for 20 min, collected at the indicated time points. Protein extracts were analyzed by western blotting using an anti-RecN antibody. Asterisk indicates a non-specific band (upper panel). Coomassie Brilliant Blue (CBB) stain is used as a loading control (lower panel). Two independent experiments were performed which showed similar trends. (C) MMC sensitivity of ∆recA ∆recN cells co-expressing RecA and RecN from the indicated species. Spot assays were performed as in A. ec, E. coli; pa, P. aeruginosa. Four independent experiments were performed which showed similar trends. (D) Cell morphology and nucleoid organization in MMC-treated ∆recA ∆recN cells co-expressing RecA and RecN. Images of DAPI-stained of cells treated or not with MMC (1.0 μg/mL) for 120 min. Nucleoids appear light blue. Scale bar = 2.5 μm. (E) Quantitative analysis of nucleoid morphology in D. The bar graph represents the percentages of cells with no nucleoid, one nucleoid, two nucleoids, and ≥ 3 nucleoids per cell. At least 100 cells were analyzed per condition. Data are shown as mean ± SD from three independent experiments. (F) ∆recA ∆recN cells expressing GFP-ecRecN and either ecRecA or paRecA were treated with MMC (0.75 μg/mL) for 30 min. Panels show GFP/DAPI/bright-field-merged cell images. Scale bar = 2.5 μm.

https://doi.org/10.1371/journal.pgen.1012169.g002

We next co-expressed RecA and RecN in a ∆recA ∆recN double mutant strain. Two compatible plasmids were employed: (i) pSTV28-based vectors for the expression of either ecRecA or paRecA under the native E. coli recA promoter, and (ii) pSCH19-based vectors for ecRecN or paRecN expression driven by the E. coli SOS-inducible recN promoter. Remarkably, in cells co-expressing paRecA and paRecN, MMC survival was significantly restored when compared with that of cells with heterologous combinations of ecRecA and paRecN or paRecA and ecRecN (Fig 2C). This implies that paRecN interacts more effectively with paRecA than with ecRecA. Identical trends were observed in the AB1157 genetic background (S1B Fig), underscoring the generality of the species-specific interaction effect.

Nucleoid structure in paRecA and paRecN co-expressing cells

Next, we investigated nucleoid organization in E. coli ∆recA ∆recN cells co-expressing RecA and RecN. Cells were treated with MMC for 120 min, stained with DAPI and examined using fluorescence microscopy. Cells co-expressing ecRecA and ecRecN became highly filamentous, with elongated and evenly spaced nucleoids (Fig 2D), closely resembling the morphology of wild-type cells after MMC treatment. In contrast, ecRecA-paRecN co-expressing cells displayed an increased proportion of fragmented nucleoids, resembling the phenotype of ∆recN cells (Fig 2D and 2E). Cells co-expressing paRecA and ecRecN exhibited features similar to those of ∆recA cells, including an increased proportion of anucleate cells and cells containing only a single nucleoid (Fig 2E). However, in contrast to ∆recA cells, which did not exhibit cell elongation, paRecA-ecRecN co-expressing cells became filamentous, and the nucleoids were centrally condensed within the elongated cells (Fig 2D), suggesting the incomplete resolution of recombination intermediates. Similar to ecRecA, paRecA was able to induce nucleoid-associated ecRecN foci in the presence of MMC, (Fig 2F), indicating that it can recruit ecRecN to DSB sites. These results suggest that although paRecA supports a normal SOS response and can promote early HR steps, defects in HR repair compromise the resolution of recombination intermediates (see discussion). Notably, paRecA-paRecN co-expressing cells exhibited nucleoid morphologies largely indistinguishable from those of ecRecA-ecRecN cells (Fig 2D and 2E), supporting that functional interactions are preserved via species-specific associations during the repair process.

Screening and isolation of gain-of-function paRecN mutants

Given the importance of species-specific RecA–RecN interaction for repair efficiency, we reasoned that targeted changes in either paRecN or paRecA could enhance their ability to function in E. coli. We chose to focus on RecN because it is primarily involved in DNA damage repair, whereas RecA is a multifunctional protein essential for homologous recombination, the SOS response, and cell viability. Therefore, we aimed to identify gain-of-function mutations in paRecN that restore DNA repair activity in E. coli. A paRecN mutant library created via PCR random mutagenesis was transformed into ∆recN cells, which were then plated onto Luria–Bertani (LB) agar containing MMC. Growing colonies were isolated as candidate gain-of-function mutants (Fig 3A). To confirm that improved MMC resistance was attributable to changes in paRecN, plasmids were recovered from each resistant clone and reintroduced into fresh ∆recN cells for retesting. We thus obtained 24 independent mutants showing reproducible MMC resistance (S2A Fig). Sequencing of the 24 recN-coding regions revealed 10 single amino-acid substitutions (comprising six unique mutations) and 11 double substitutions (comprising nine unique combinations) (S2A Fig). For three mutants, no mutations were detected in the coding sequence, suggesting possible changes in regulatory regions or extragenic suppressors. Mapping of the six single substitutions onto the primary RecN sequence revealed that five were located in the N-terminal domain, and one in the C-terminal domain. None of the altered residues were conserved between paRecN and ecRecN (S2B Fig), suggesting their potential role in species-specific functional adaptation.

Download:

Fig 3. Screening of gain-of-function paRecN mutants.

(A) Representative screening plates. ∆recN cells transformed with a paRecN mutant library were plated on LB agar in the presence or absence of MMC (0.5 µg/mL). The plates were incubated overnight at 37 °C. (B) Structural mapping of mutation sites on the paRecN model. The structure of paRecN shown in ribbon representation was predicted using AlphaFold2. Gain-of-function mutations identified in this study are highlighted in magenta. N-terminal and C-terminal domains are shown in gold and cyan, respectively. (C) Nucleoid morphology in MMC-treated ∆recN cells expressing paRecN mutants. Exponentially growing cells were treated or not with MMC (1.0 µg/mL), fixed, stained with DAPI, and analyzed using fluorescence microscopy. Panels show DAPI images of cells treated or not with MMC for 120 min. Scale bar = 2.5 μm. (D) Quantitative analysis of nucleoid morphology in C. The bar graph represents the percentages of cells with no nucleoid, one or two nucleoids, and ≥ 3 nucleoids per cell. At least 100 cells were analyzed for each condition. Data are shown as mean ± SD from three independent experiments. (E) MMC sensitivity of ∆recA ∆recN cells co-expressing RecA and RecN from the indicated species. Ten-fold serial dilutions of cell cultures were spotted onto LB plates containing the indicated concentrations of MMC. Four independent experiments were performed which showed similar trends.

https://doi.org/10.1371/journal.pgen.1012169.g003

Functional complementation of paRecN gain-of-function mutants

When the six single substitutions identified were mapped onto the AlphaFold2-predicted structure of paRecN, the mutations were distributed across distinct structural regions (Fig 3B). Some substitutions were located on the outer surfaces of the globular domains and were spatially separated from one another, whereas others mapped near the interface between the N- and C-terminal domains. These observations suggest that multiple, potentially distinct mechanisms may underlie the functional restoration of paRecN in E. coli. Notably, I73T and R453H were found to be located in close spatial proximity despite their distant location in the primary sequence (Fig 3B), raising the possibility that both residues contribute to a shared functional surface. Based on this observation, we focused subsequent analysis on these two mutants and performed detailed functional characterization to evaluate the extent and specificity of their activity in E. coli. To determine whether this enhanced functionality correlated with improved nucleoid integrity under DNA-damaging conditions, we observed nucleoid structures in ∆recN cells expressing paRecN^I73T or paRecN^R453H. Following 120 min of MMC treatment, the cells became filamentous while maintaining almost the same number of nucleoids per cell, a phenotype similar to that of wild-type E. coli (Fig 3C and 3D). These results confirmed that the I73T and R453H substitutions restored the ability of paRecN to maintain nucleoid integrity during MMC exposure, re-establishing functional activity in E. coli to the wild-type level.

Based on evidence regarding the species-specific compatibility between RecA and RecN, we next tested whether the improved function of paRecN^I73T and paRecN^R453H depended on the presence of ecRecA. Each mutant protein was co-expressed with ecRecA or paRecA in ∆recA ∆recN cells, which were then tested for MMC sensitivity. As expected, both mutants fully complemented the MMC sensitivity of the ∆recA ∆recN strain in the presence of ecRecA (Fig 3E). Remarkably, when coexpressed with paRecA, the ability of these paRecN mutants to confer MMC resistance was substantially reduced compared with that of wild-type paRecN (Fig 3E). This finding suggests that these mutations represent species-specific adaptive mutations that selectively enhance functional interaction with ecRecA at the expense of compatibility with paRecA.

Effect of the paRecN expression level on functional complementation

To examine the expression level of paRecN, we constructed C-terminally Flag-tagged versions of ecRecN, paRecN, paRecN^I73T, and paRecN^R453H, and confirmed that the addition of the flag tag did not alter MMC resistance phenotypes in E. coli (Fig 4A). Western blot analysis of MMC-treated cells revealed that wild-type paRecN was expressed at a substantially lower level than ecRecN, despite being driven by the same promoter (Fig 4B), suggesting that sequence-intrinsic factors, such as rare codons, might impair translation efficiency in E. coli. To evaluate this hypothesis, we synthesized a codon-optimized version of paRecN (paRecN⁺), replacing infrequently used codons with synonymous codons preferred in E. coli (S3 Fig). The codon-optimized paRecN⁺ was expressed at a level comparable to that of ecRecN and fully complemented MMC resistance (Fig 4A and 4B), confirming that reduced expression of paRecN leads to its decreased functionality in E. coli cells. Importantly, both paRecN^I73T and paRecN^R453H were expressed at low levels similar to that of wild-type paRecN (Fig 4C), indicating that their functional restoration is not attributable to increased protein expression, but rather to qualitative improvements in their function, likely in terms of protein–protein interactions and/or activity, conferred by the amino-acid substitutions.

Download:

Fig 4. Expression levels of paRecN and its mutants.

(A) MMC sensitivity of ∆recN cells expressing C-terminally Flag-tagged ecRecN, paRecN, or paRecN mutants. Ten-fold serial dilutions were spotted onto LB plates in the presence or absence of MMC (0.75 μg/mL). Three independent experiments were performed which showed similar trends. (B) ∆recN cells expressing ecRecN, paRecN, or codon-optimized paRecN (paRecN⁺) were treated with MMC (1.0 μg/mL) for the indicated times. Protein extracts were prepared and analyzed using western blot with an anti-flag antibody (upper panel). Coomassie stain was used as a loading control (lower panel). Three independent experiments were performed which showed similar trends. (C) MMC-dependent induction of paRecN mutant proteins. Detection was performed as in B.

https://doi.org/10.1371/journal.pgen.1012169.g004

Function of GFP-tagged paRecN

Previous studies showed that N-terminally GFP-tagged ecRecN (GFP-ecRecN) fusion protein retains full DNA repair activity and forms discrete foci on nucleoids after MMC treatment (Fig 5A and 5B) [23,32,33]. To assess whether a similar strategy would allow visualization of paRecN, we constructed an N-terminal GFP-paRecN fusion driven by the SOS-inducible recN promoter (S4A Fig). However, GFP-paRecN showed the same MMC sensitivity as ∆recN cells, indicating a loss of function (Fig 5A). Similar N-terminal tagging effects have been reported for Bacillus subtilis RecN [23,25,26], underscoring species-specific structural features of RecN. Therefore, we created alternative fusion configurations to minimize steric hindrance, including GFP-Lk-RecN, in which GFP was fused to the N-terminus via a flexible linker (Lk), and RecN-GFP or RecN-Lk-GFP, in which GFP was fused to the C-terminus either directly or via the flexible linker (S4A Fig). When expressed in ∆recN cells, both GFP-Lk-paRecN and paRecN-GFP failed to complement MMC sensitivity (Fig 5A). In contrast, paRecN-Lk-GFP conferred partial MMC resistance, albeit with reduced survival compared to paRecN (Fig 5A). Furthermore, co-expression of paRecA with paRecN-Lk-GFP, but not with GFP-paRecN, in ∆recA ∆recN cells restored MMC resistance (Fig 5A). These results indicate that C-terminal Lk fusion is the least disruptive configuration for paRecN functionality in E. coli.

Download:

Fig 5. Cellular localization and function of paRecN and its mutants.

(A) Upper panel: MMC sensitivity of ∆recN cells expressing GFP fusions at the N- or C-terminus of RecN. Lower panel: MMC sensitivity of ∆recA ∆recN cells co-expressing paRecA and paRecN fused to GFP at the N- or C-terminus. Ten-fold serial dilutions were spotted onto LB plates in the presence or absence of MMC (0.5 μg/mL). Three independent experiments were performed which showed similar trends. (B) ∆recN cells expressing GFP-ecRecN, paRecN-Lk-GFP, paRecN mutant-Lk-GFP, or paRecN⁺-Lk-GFP were treated with MMC (0.75 μg/mL), fixed, stained with DAPI, and analyzed using fluorescence microscopy. Panels show merged GFP/DAPI/bright-field images. Nucleoids appear dark blue. Scale bar = 2.5 μm. (C) Quantitative analysis of nucleoid-associated GFP-RecN foci in B. At least 100 cells were analyzed for each time point. Data are shown as mean ± SD from three independent experiments. Significance difference was assessed by Student’s t-test. **P < 0.001.

https://doi.org/10.1371/journal.pgen.1012169.g005

Intracellular localization of RecN-Lk-GFP

To investigate whether functional differences correlated with the subcellular localization of RecN, we analyzed the formation of nucleoid-associated foci following MMC treatment in ∆recN cells expressing either GFP-ecRecN, paRecN-Lk-GFP, or codon-optimized paRecN (paRecN⁺)-Lk-GFP. As reported previously, distinct GFP-ecRecN foci formed on the nucleoid 30 min after MMC treatment, and the proportion of cells exhibiting nucleoid-associated foci increased to approximately 80% by 60 min (Fig 5B and 5C). In contrast, only ~20% of cells expressing paRecN-Lk-GFP exhibited nucleoid-associated foci at 30 min, and this proportion did not increase at 60 min (Fig 5B and 5C). The weak fluorescence intensity of paRecN-Lk-GFP likely reflects its reduced expression level, as confirmed by western blotting with anti-GFP antibodies (S4B Fig). Consistent with this, paRecN⁺-Lk-GFP exhibited stronger fluorescence, reflecting increased expression. In addition, paRecN⁺ showed a substantially higher proportion of nucleoid-associated foci than wild-type paRecN (Fig 5B and 5C). These results suggest that increased protein abundance can partially restore nucleoid localization.

Although paRecN-Lk-GFP cannot be directly compared to GFP-ecRecN due to differences in fusion constructs and expression patterns, these observations suggest that paRecN displays reduced nucleoid localization in response to DNA damage. We therefore evaluated the formation of nucleoid-associated foci by paRecN^I73T and paRecN^R453H. As expected, both paRecN^I73T-Lk-GFP or paRecN^R453H-Lk-GFP were expressed at lower levels, similar to that of wild-type paRecN-Lk-GFP, but conferred higher MMC resistance than paRecN-Lk-GFP (S4B and S4C Fig). Microscopy analysis revealed that, during MMC treatment, the proportion of cells containing nucleoid-associated foci was increased in both mutants relative to wild-type paRecN-Lk-GFP and reached levels comparable to those observed for the paRecN⁺ (Fig 5B and 5C). Taken together, these results suggest that both increased protein abundance (paRecN⁺) and amino acid substitutions (paRecN^I73T and paRecN^R453H) can enhance nucleoid localization, although potentially through distinct mechanisms. The gain-of-function mutants, in particular, may promote more efficient recruitment to, and/or altered interactions with, the nucleoid in response to DNA damage, which may contribute to their enhanced repair activity in E. coli.

RecA-RecN interaction

Previous studies have shown that ecRecN physically interacts with ecRecA [28,29]. To examine the interaction between ecRecA and paRecN or its mutants, we purified paRecN and its variants. During purification, we found that the N-terminally His-tagged construct (His-paRecN) failed to bind to a Ni² ⁺ affinity column. This observation suggests that N-terminal tagging interferes with paRecN function, consistent with our previous results using GFP fusion constructs. Therefore, paRecN was purified as a C-terminally His-tagged protein (S5 Fig).

Using purified ecRecA, ecRecN, and paRecN proteins, we performed pull-down assays to assess their binding interactions. Following incubation of ecRecA with RecN, RecA–RecN complexes were recovered using Co² ⁺ -conjugated magnetic beads and analyzed by SDS–PAGE. Under these conditions, His-ecRecN, paRecN-His, paRecN^I73T-His and paRecN^R453H-His were recovered at comparable levels on the beads (Fig 6A). In contrast, the amount of ecRecA co-recovered with paRecN was markedly reduced compared with that recovered with ecRecN (Fig 6A and 6B). Notably, the paRecN^I73T and paRecN^R453H mutants showed a modest increase in ecRecA recovery relative to wild-type paRecN (Fig 6A and 6B). These results indicate that paRecN exhibits a reduced physical interaction with ecRecA compared with ecRecN, and that the paRecN mutant partially restores this interaction.

Download:

Fig 6. The physical interaction of ecRecN/paRecN with ecRecA.

(A) The reaction mixtures were incubated in the presence of the indicated proteins (2 μM each protein). The proteins bound to Co²⁺-conjugated beads were collected, washed, eluted with SDS–sample buffer, and then analyzed by SDS–PAGE and CBB staining. (B) The RecA/RecN ratio in the pull-down samples was quantified using ImageJ software. The data shown in (A) represent the mean ± SD from three independent experiments. P values were determined using a Student’s t-test (*P < 0.05, **P < 0.01).

https://doi.org/10.1371/journal.pgen.1012169.g006

Discussion

In this study, we investigated the functional interplay between RecA and RecN during DSB repair in E. coli using functional complementation assays with P. aeruginosa RecA and RecN. We found that neither paRecA nor paRecN alone could fully rescue the MMC sensitivity of E. coli, whereas co-expression of both proteins did restore survival. These results suggest that the reduced DNA repair activity of the heterologous proteins in E. coli arises from a defect in the functional interaction between the two proteins originating from different species.

E. coli ∆recA cells expressing paRecA showed only partial resistance to MMC, yet retained the ability to activate the SOS response, as indicated by SOS gene induction and MMC-dependent filamentation. This suggests that paRecA is impaired in HR repair rather than in SOS response. In this regard, cells expressing paRecA exhibited abnormal nucleoid morphologies in response to DNA damage, including highly condensed nucleoids and an increased frequency of anucleate cells. This phenotype resembles that of ∆ruvC, but not ∆recA, which exhibit a filamentous phenotype with centrally located chromosome aggregates and subsequently produced anucleate cells [34]. Given that RuvC is essential for resolving Holliday junction intermediates formed by RecA [35,36] and that paRecA can promote the formation of nucleoid-associated ecRecN foci, these results suggest that while paRecA can recruit ecRecN to DSB sites and promote early steps of HR, such as sister chromatid interaction and D-loop formation, it may not fully support the functional interaction between paRecA and ecRecN that is required for the later stages of recombination, leading to the accumulation of unresolved recombination intermediates.

We found that paRecN was expressed at lower levels than ecRecN. Codon optimization for E. coli significantly improved paRecN expression and fully restored MMC resistance in ∆recN cells, indicating that increased protein abundance can compensate for inefficient interaction between ecRecA and paRecN. Beyond this expression effect, however, the gain-of-function mutants paRecN^I73T and paRecN^R453H conferred MMC resistance without any increase in protein levels. Notably, these mutants gained compatibility with ecRecA while losing that with paRecA, demonstrating that the substitutions re-established a species-specific interaction optimized for E. coli (Fig 7). We also found that MMC-induced nucleoid localization was increased in paRecN^I73T and paRecN^R453H compared with paRecN, suggesting that their enhanced repair activity may be attributable to improved recruitment to DNA damage sites. Taken together, these findings demonstrate that species-specific RecA–RecN compatibility likely contributes to efficient DSB repair in E. coli, and that enhanced recruitment of the mutant paRecN proteins to damage sites plays a central role in their functional restoration (Fig 7). Furthermore, the interaction between ecRecA and paRecN was markedly reduced compared with that of the ecRecA–ecRecN pair, whereas paRecN^I73T and paRecN^R453H showed a modest but reproducible recovery in their interaction with ecRecA relative to paRecN. This partial restoration may reflect an improved compatibility at the ecRecA–paRecN interface. However, because the binding of these mutants to ecRecA remains substantially weaker than that of ecRecN, it remains unclear to what extent functional recovery can be attributed solely to this effect. Other factors, such as interactions with additional factors or recovery of functional (rather than strictly physical) interactions with ecRecA, may also contribute to the observed phenotypes. Notably, although the two substituted residues are distant in the primary sequence, they are located in close proximity at the interface between the N- and C-terminal domains implicated in ATP binding. Previous study has shown that DNA-bound RecA can stimulate RecN ATP hydrolysis in a species-specific manner [28]. This raises the possibility that, in addition to enhanced nucleoid recruitment, altered RecN ATPase activity in paRecN^I73T and paRecN^R453H may also contribute to their functional recovery, leaving this as an intriguing but unverified possibility that warrants further investigation.

Download:

Fig 7. The species-specific coevolution of RecA–RecN interfaces in DSB repair.

In Escherichia coli, ecRecN is recruited to DSB sites in a RecA-dependent manner through a coevolved interaction interface with ecRecA. In contrast, paRecN preferentially interacts with paRecA via a species-specific coevolved interface and therefore shows limited functionality in the E. coli cellular context. Gain-of-function paRecN mutants (I73T or R453H) acquire an adaptive interaction interface that restores compatibility with ecRecA. However, this adaptive interaction is accompanied by a loss of compatibility with paRecA, highlighting a trade-off imposed by species-specific coevolution of protein–protein interaction interfaces.

https://doi.org/10.1371/journal.pgen.1012169.g007

Protein coevolution is a process in which pairs of proteins undergo coordinated changes, generally to preserve or optimize their functional association; therefore, protein–protein interaction interfaces are often under coevolutionary constraints [37]. In this study, we identified species-specific gain-of-function paRecN mutants that regained functional interaction with ecRecA while concomitantly losing compatibility with paRecA. Notably, none of the substitutions identified occurred at conserved residues. These findings indicate that the RecA–RecN interface required for functional interaction is not universally conserved across species but has likely been optimized through species-specific coevolution driven by the multifunctional nature of RecA and RecN. Indeed, the SMC-like RecN not only cooperates with RecA during HR but also contributes to high-order chromosome organization and dynamics. Given that the bacterial nucleoid comprising genomic DNA, RNA, and nucleoid-associated proteins is a highly dynamic and species-specific structure that adapts to environmental fluctuations [38–40], it is plausible that the RecN–RecA interface has coevolved in parallel with the species-specific evolution of nucleoid organization.

Our findings indicate that RecA–RecN interaction is essential for DSB repair while being subject to species-specific constraints. These results suggest that coevolution may optimize the RecA–RecN interface within each species to support efficient DSB repair. The gain-of-function paRecN mutants identified in this study were localized to the N- and C-terminal globular domains. Notably, some of these substitutions are spatially separated within the structure, suggesting that functional restoration may not be explained solely by improved RecA–RecN interface interactions. Instead, multiple mechanisms may contribute to the recovery of DNA repair activity in E. coli, including partial restoration of RecA interaction, functional modulation of RecN, or altered interactions with additional factors. These findings may reflect an adaptive mechanism that enables paRecN to function with a heterologous RecA. Future studies should focus on biochemical characterization of these mutants, as well as the additional mutants not examined here, to dissect the relative contributions of RecA interaction and ATP hydrolysis to HR promotion. A better understanding of these mechanisms may provide further insight into the structural and functional roles of RecN in HR-dependent DSB repair, which likely requires coordination between RecA and chromosome dynamics.

Materials and methods

Bacterial strains and plasmids

All strains used in this study were derivatives of BW25113, unless otherwise stated, and are listed in Table 1. H. influenzae and P. aeruginosa recN genes were PCR-amplified from genomic DNA from H. influenzae strain Rd and P. aeruginosa strain PAO1 (American Type Culture Collection), respectively. An E. coli recN fragment containing the native SOS promoter was cloned into pSTV28 and pSCH19, generating pST-RecN and pSC-RecN, respectively. The recN genes in pST-RecN and pSC-RecN were replaced with P. aeruginosa or H. influenzae recN to generate pST-paRecN, pST-hiRecN, and pSC-paRecN. An E. coli recA fragment containing the native promoter was cloned into pSTV28, generating pST-RecA. Plasmids expressing paRecA were constructed by replacing the E. coli recA open reading frame in pST-RecA and pRecA [23] with P. aeruginosa recA, yielding pST-PaRecA and pPaRecA. C-terminally flag-tagged RecN was constructed from pST-RecN/pST-paRecN by introducing a Flag epitope coding sequence into the 3′ end of recN in frame. RecN/paRecN proteins were tagged with an enhanced GFP cassette at either the N- or C-terminus in pST-RecN or pST-paRecN, generating pGFP-RecN/paRecN and pRecN/paRecN-GFP. For pGFP-Lk-RecN/paRecN, a linker sequence (GGATCCGCTGGCTCCGCTGCTGGTTCTGGCGAATTCCAT) was inserted between GFP and the recN N-terminus. For pRecN/paRecN-Lk-GFP, a linker sequence (GGCGGAGAATTCTTGGATTCAA-TAGAAAAGGTAAGCGAATTTGCCACC) was inserted between GFP and the RecN C-terminus. For the codon-optimized paRecN plasmid, we used a codon optimization tool provided by Gene Frontier that redesigned P. aeruginosa recN by substituting rare codons with synonymous codons preferred in E. coli. The optimized open reading frame gene of paRecN was synthesized and cloned downstream of the SOS promoter of recN in pSTV28, yielding pST-paRecN⁺. All recN mutants were generated by PCR-based mutagenesis and used to substitute wild-type recN on each plasmid. Recombinant plasmid structures were confirmed by DNA sequencing.

Download:

Table 1. E. coli strains used in this study.

https://doi.org/10.1371/journal.pgen.1012169.t001

Media and general methods

For E. coli genetic manipulation and DNA recombination, standard methods as described by Miller and Sambrook were used [42,43]. Ampicillin (50 μg/mL), tetracycline (10 μg/mL), chloramphenicol (100 μg/mL), and kanamycin (30 μg/mL) were added to Luria Bertani (LB) broth as required. MMC (0.5 mg/mL stock) was dissolved in 10 mM Tris-HCl (pH 8.5).

Sensitivity to MMC

The cultures were grown in LB broth to an A₆₀₀ of ~0.4. They were serially diluted and spotted onto LB containing ampicillin and/or chloramphenicol, where appropriate, and the indicated concentration of MMC. The plates were then incubated at 37 °C overnight.

Isolation of paRecN mutants

PCR-mediated random mutagenesis was carried out on pSC-RecN using forward and reverse oligonucleotides; paRecNF (GCCGCCCCATATGCTGGTTCACCTGTCCGTTCAC) and paRecNR (GGAAAGGATCCGCGAGCGCGGCTTCGAGCTGGTCG) containing NdeI and BamHI sites, respectively. A library of paRecN mutants was generated by replacing mutagenized NdeI-BamHI fragments with wild-type P. aeruginosa recN in pSC-paRecN. The AB1157 ∆recN strain was used for screening because it has a wider dynamic range for detecting improvement than the BW25113 ∆recN strain. The resultant paRecN mutant library was transformed into a ∆recN strain, and transformants were plated on LB agar supplemented with 0.5 μg/mL MMC and ampicillin. MMC-resistant colonies were selected after overnight incubation.

E. coli cell extract and western blotting

Cells were grown at 37 °C to an OD₆₀₀ of 0.5 and treated with 0.5 or 1.0 μg/mL MMC at 37°C. Aliquots were taken at the indicated times and centrifuged. Cells were rapidly frozen in liquid nitrogen, resuspended in SDS loading buffer (82 mM Tris-HCl at pH 6.8, 5.6 M urea, 1.6 M thiourea, 0.24 M NaCl, 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 2% 2-mercaptoethanol), and lysed by boiling. Samples were analyzed by 10% SDS-polyacrylamide gels, and proteins were transferred to polyvinylidene difluoride (PVDF) membranes. ecRecN, RecN-flag and RecN-GFP were detected with anti-ecRecN [33], anti-flag (Sigma), and anti-GFP (MBL) antibodies, respectively. The protein bands were visualized by enhanced chemiluminescence detection (Western blot ultrasensitive horseradish peroxidase [HRP] substrate; Takara). Coomassie brilliant blue stain was used as a loading control.

SOS response

SOS response induction was monitored by measuring RecN expression, as described previously. Overnight cultures of ∆recA cells containing pRecA or pPaRecA were diluted into LB containing ampicillin (50 μg/mL). Cells were grown at 37 °C to an OD₆₀₀ of 0.5 and treated with 1.0 μg/mL MMC. Aliquots were collected at indicated time points for immunoblotting with an anti-RecN antibody.

Structure prediction using AlphaFold2

The structure of paRecN was predicted using AlphaFold2 implemented via ColabFold. The amino acid sequence of paRecN was used as input, and multiple sequence alignments were generated using the MMseqs2 pipeline with default parameters. Five models were generated, and the top-ranked model (ranked_0) was used for analysis.

Fluorescence microscopy

Fluorescence microscopy analysis was carried out as described previously [24,44]. Exponentially growing cells were treated with the indicated concentrations of MMC at 37 °C, fixed with ethanol, stained with 1.0 μg/mL DAPI, and mounted on glass slides. Fluorescence microscopy was performed using a Zeiss Axioplan2 microscope. RecN foci located on or adjacent to nucleoids were classified as nucleoid-associated, whereas those at cell poles or distant from nucleoids were classified as cytoplasmic. For each strain, the localization of GFP-RecN foci was assessed in more than 100 individual cells. The results are the mean of at least five independent experiments.

Protein purification

N-terminally hexahistidine-tagged ecRecN was purified as described previously [29]. During purification of paRecN, the N-terminally His-tagged construct (His-paRecN) failed to bind to the HisTrap HP column (Cytiva). Therefore, paRecN was expressed and purified as a C-terminally His-tagged protein (paRecN-His). The purification procedure for paRecN-His was otherwise identical to that used for ecRecN. Protein concentrations were determined using a Bio-Rad protein assay kit.

E. coli RecA was purified as described previously [45].

RecA-RecN pull-down assay

RecN (2 µM) was incubated with RecA (2 µM) at 37 °C for 10 min in 10 µL of buffer A (20 mM Tris–HCl, pH 7.5, 0.01% NP-40, and 1 mM DTT) supplemented with 50 mM KCl, 2 mM MgCl₂, and 5% glycerol. The reaction mixture was then incubated with Co² ⁺ -conjugated magnetic beads (1 µL suspension), pre-equilibrated in buffer A containing 50 mM KCl, in the presence of 10 mM imidazole at 4 °C for 30 min with gentle rotation. The beads were collected and washed with buffer A containing 100 mM KCl, 2 mM MgCl₂, and 20 mM imidazole. Bound proteins were eluted with SDS sample buffer and analyzed by 10% SDS–PAGE followed by Coomassie Brilliant Blue staining.

Supporting information

S1 Table. E. coli strains used in this study.

https://doi.org/10.1371/journal.pgen.1012169.s001

(PDF)

S1 Data. Source data for all of the main figures.

https://doi.org/10.1371/journal.pgen.1012169.s002

(XLSX)

S1 Fig. MMC sensitivity of ∆recN and ∆recA ∆recN cells expressing RecA and/or RecN from the indicated species.

(A, B) All strains were derivatives of AB1157. (A) ∆recN cells carrying plasmids expressing RecN from the indicated species. (B) ∆recA ∆recN cells co-expressing RecA and RecN from the indicated species. Ten-fold serial dilutions were spotted onto LB_Cm (A) or LB_Cm + Ap (B) plates containing the indicated concentrations of MMC. Three independent experiments were performed which showed similar trends.

https://doi.org/10.1371/journal.pgen.1012169.s003

(TIFF)

S2 Fig. Isolation of paRecN gain-of-function mutants for MMC sensitivity.

(A) MMC sensitivity of ∆recN cells transformed with paRecN mutant plasmids identified in the initial screen. Ten-fold serial dilutions were spotted onto LB plates in the presence or absence of MMC (0.5 μg/mL). (B) Amino acid sequence alignment of paRecN and ecRecN. Red boxes indicate the positions of six single-amino-acid substitutions identified in this study.

https://doi.org/10.1371/journal.pgen.1012169.s004

(TIFF)

S3 Fig. Nucleotide sequence alignment of the coding regions of paRecN and codon-optimized paRecN (paRecN⁺).

https://doi.org/10.1371/journal.pgen.1012169.s005

(TIFF)

S4 Fig. Construction of GFP-fused RecN expression plasmid.

(A) Schematic representation of GFP-fused RecN expression plasmids. Constructs included: GFP-RecN, in which GFP was fused directly to the N-terminus. GFP-Lk-RecN, in which GFP was fused to the N-terminus via the flexible linker. RecN-GFP, in which GFP was fused directly to the C-terminus. RecN-Lk-GFP, in which GFP was fused via the flexible linker to the C-terminus. (B) MMC-dependent induction of ecRecN-Lk-GFP, paRecN-Lk-GFP, or paRecN mutant Lk-GFP proteins. For comparison of expression levels, ecRecN was expressed as a C-terminal fusion construct containing the flexible linker. Protein extracts were prepared and analyzed by western blot using anti-GFP antibody. Two independent experiments were performed which showed similar trends. (C) MMC sensitivity of ∆recN cells expressing C-terminally GFP-tagged paRecN mutants (paRecN^I73T-Lk-GFP and paRecN^R453H-Lk-GFP). Ten-fold serial dilutions were spotted onto LB plates in the presence or absence of MMC. Three independent experiments were performed which showed similar trends.

https://doi.org/10.1371/journal.pgen.1012169.s006

(TIFF)

S5 Fig. Purification of paRecN protein.

His-ecRecN, paRecN-His, and paRecN-His mutants were purified as described under “Materials and Methods”. Purified RecN (2 µg) were analyzed on a 10% SDS gel and visualized by staining with Coomassie brilliant blue. Marker proteins (Precision plus protein prestained standard, Bio-rad) are shown on the left.

https://doi.org/10.1371/journal.pgen.1012169.s007

(TIFF)

Acknowledgments

We thank Yoshihiro Kishi, Shunsuke Noda, and Kenji Keyamura for assistance with developing analysis tools; and T.H. laboratory members for feedback and discussion.

References

1. Cromie GA, Connelly JC, Leach DR. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Mol Cell. 2001;8(6):1163–74. pmid:11779493
- View Article
- PubMed/NCBI
- Google Scholar
2. Kuzminov A. Recombinational repair of DNA damage in Escherichia coli and bacteriophage lambda. Microbiol Mol Biol Rev. 1999;63(4):751–813, table of contents. pmid:10585965
- View Article
- PubMed/NCBI
- Google Scholar
3. Wyman C, Ristic D, Kanaar R. Homologous recombination-mediated double-strand break repair. DNA Repair (Amst). 2004;3(8–9):827–33. pmid:15279767
- View Article
- PubMed/NCBI
- Google Scholar
4. Kowalczykowski SC. An overview of the molecular mechanisms of recombinational DNA repair. Cold Spring Harb Perspect Biol. 2015;7(11):a016410. pmid:26525148
- View Article
- PubMed/NCBI
- Google Scholar
5. Singleton MR, Dillingham MS, Gaudier M, Kowalczykowski SC, Wigley DB. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature. 2004;432(7014):187–93. pmid:15538360
- View Article
- PubMed/NCBI
- Google Scholar
6. Dillingham MS, Kowalczykowski SC. RecBCD enzyme and the repair of double-stranded DNA breaks. Microbiol Mol Biol Rev. 2008;72(4):642–71, Table of Contents. pmid:19052323
- View Article
- PubMed/NCBI
- Google Scholar
7. Smith GR. How RecBCD enzyme and Chi promote DNA break repair and recombination: a molecular biologist’s view. Microbiol Mol Biol Rev. 2012;76(2):217–28. pmid:22688812
- View Article
- PubMed/NCBI
- Google Scholar
8. Lusetti SL, Cox MM. The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu Rev Biochem. 2002;71:71–100. pmid:12045091
- View Article
- PubMed/NCBI
- Google Scholar
9. Courcelle J, Hanawalt PC. RecA-dependent recovery of arrested DNA replication forks. Annu Rev Genet. 2003;37:611–46. pmid:14616075
- View Article
- PubMed/NCBI
- Google Scholar
10. Cox MM. Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol. 2007;42(1):41–63. pmid:17364684
- View Article
- PubMed/NCBI
- Google Scholar
11. Lesterlin C, Ball G, Schermelleh L, Sherratt DJ. RecA bundles mediate homology pairing between distant sisters during DNA break repair. Nature. 2014;506(7487):249–53. pmid:24362571
- View Article
- PubMed/NCBI
- Google Scholar
12. Bell JC, Kowalczykowski SC. RecA: Regulation and Mechanism of a Molecular Search Engine. Trends Biochem Sci. 2016;41(6):491–507. pmid:27156117
- View Article
- PubMed/NCBI
- Google Scholar
13. Wiktor J, Gynnå AH, Leroy P, Larsson J, Coceano G, Testa I, et al. RecA finds homologous DNA by reduced dimensionality search. Nature. 2021;597(7876):426–9. pmid:34471288
- View Article
- PubMed/NCBI
- Google Scholar
14. Yang H, Zhou C, Dhar A, Pavletich NP. Mechanism of strand exchange from RecA-DNA synaptic and D-loop structures. Nature. 2020;586(7831):801–6. pmid:33057191
- View Article
- PubMed/NCBI
- Google Scholar
15. Courcelle J, Khodursky A, Peter B, Brown PO, Hanawalt PC. Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics. 2001;158(1):41–64. pmid:11333217
- View Article
- PubMed/NCBI
- Google Scholar
16. Hirano T. At the heart of the chromosome: SMC proteins in action. Nat Rev Mol Cell Biol. 2006;7(5):311–22. pmid:16633335
- View Article
- PubMed/NCBI
- Google Scholar
17. Graumann PL, Knust T. Dynamics of the bacterial SMC complex and SMC-like proteins involved in DNA repair. Chromosome Res. 2009;17(2):265–75. pmid:19308706
- View Article
- PubMed/NCBI
- Google Scholar
18. Nolivos S, Sherratt D. The bacterial chromosome: architecture and action of bacterial SMC and SMC-like complexes. FEMS Microbiol Rev. 2014;38(3):380–92. pmid:24118085
- View Article
- PubMed/NCBI
- Google Scholar
19. Rostas K, Morton SJ, Picksley SM, Lloyd RG. Nucleotide sequence and LexA regulation of the Escherichia coli recN gene. Nucleic Acids Res. 1987;15(13):5041–9. pmid:3037486
- View Article
- PubMed/NCBI
- Google Scholar
20. Sargentini NJ, Smith KC. Characterization of an Escherichia coli mutant (radB101) sensitive to gamma and uv radiation, and methyl methanesulfonate. Radiat Res. 1983;93(3):461–78. pmid:6344125
- View Article
- PubMed/NCBI
- Google Scholar
21. Picksley SM, Attfield PV, Lloyd RG. Repair of DNA double-strand breaks in Escherichia coli K12 requires a functional recN product. Mol Gen Genet. 1984;195(1–2):267–74. pmid:6092851
- View Article
- PubMed/NCBI
- Google Scholar
22. Meddows TR, Savory AP, Grove JI, Moore T, Lloyd RG. RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand breaks. Mol Microbiol. 2005;57(1):97–110. pmid:15948952
- View Article
- PubMed/NCBI
- Google Scholar
23. Keyamura K, Sakaguchi C, Kubota Y, Niki H, Hishida T. RecA protein recruits structural maintenance of chromosomes (SMC)-like RecN protein to DNA double-strand breaks. J Biol Chem. 2013;288:29229–37.
- View Article
- Google Scholar
24. Noda S, Akanuma G, Keyamura K, Hishida T. RecN spatially and temporally controls RecA-mediated repair of DNA double-strand breaks. J Biol Chem. 2023;299(12):105466. pmid:37979912
- View Article
- PubMed/NCBI
- Google Scholar
25. Vickridge E, Planchenault C, Cockram C, Junceda IG, Espéli O. Management of E. coli sister chromatid cohesion in response to genotoxic stress. Nat Commun. 2017;8:14618. pmid:28262707
- View Article
- PubMed/NCBI
- Google Scholar
26. McLean EK, Lenhart JS, Simmons LA. RecA is required for the assembly of RecN into DNA repair complexes on the nucleoid. J Bacteriol. 2021;203(20):e0024021. pmid:34339298
- View Article
- PubMed/NCBI
- Google Scholar
27. Chimthanawala A, Parmar JJ, Kumar S, Iyer KS, Rao M, Badrinarayanan A. SMC protein RecN drives RecA filament translocation for in vivo homology search. Proc Natl Acad Sci U S A. 2022;119:e2209304119.
- View Article
- Google Scholar
28. Uranga LA, Reyes ED, Patidar PL, Redman LN, Lusetti SL. The cohesin-like RecN protein stimulates RecA-mediated recombinational repair of DNA double-strand breaks. Nat Commun. 2017;8:15282. pmid:28513583
- View Article
- PubMed/NCBI
- Google Scholar
29. Keyamura K, Hishida T. Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli. Commun Biol. 2019;2:413. pmid:31754643
- View Article
- PubMed/NCBI
- Google Scholar
30. Reyes ED, Patidar PL, Uranga LA, Bortoletto AS, Lusetti SL. RecN is a cohesin-like protein that stimulates intermolecular DNA interactions in vitro. J Biol Chem. 2010;285(22):16521–9. pmid:20360008
- View Article
- PubMed/NCBI
- Google Scholar
31. Grove JI, Wood SR, Briggs GS, Oldham NJ, Lloyd RG. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli. DNA Repair (Amst). 2009;8(12):1434–43. pmid:19846353
- View Article
- PubMed/NCBI
- Google Scholar
32. Vikedal K, Ræder SB, Riisnæs IMM, Bjørås M, Booth JA, Skarstad K, et al. RecN and RecA orchestrate an ordered DNA supercompaction response following ciprofloxacin-induced DNA damage in Escherichia coli. Nucleic Acids Res. 2025;53(10):gkaf437. pmid:40433982
- View Article
- PubMed/NCBI
- Google Scholar
33. Nagashima K, Kubota Y, Shibata T, Sakaguchi C, Shinagawa H, Hishida T. Degradation of Escherichia coli RecN aggregates by ClpXP protease and its implications for DNA damage tolerance. J Biol Chem. 2006;281:30941–6.
- View Article
- Google Scholar
34. Ishioka K, Fukuoh A, Iwasaki H, Nakata A, Shinagawa H. Abortive recombination in Escherichia coli ruv mutants blocks chromosome partitioning. Genes Cells. 1998;3(4):209–20. pmid:9663656
- View Article
- PubMed/NCBI
- Google Scholar
35. Dunderdale HJ, Benson FE, Parsons CA, Sharples GJ, Lloyd RG, West SC. Formation and resolution of recombination intermediates by E. coli RecA and RuvC proteins. Nature. 1991;354(6354):506–10. pmid:1758493
- View Article
- PubMed/NCBI
- Google Scholar
36. Iwasaki H, Takahagi M, Shiba T, Nakata A, Shinagawa H. Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991;10(13):4381–9. pmid:1661673
- View Article
- PubMed/NCBI
- Google Scholar
37. Pazos F, Valencia A. Protein co-evolution, co-adaptation and interactions. EMBO J. 2008;27(20):2648–55. pmid:18818697
- View Article
- PubMed/NCBI
- Google Scholar
38. Dillon SC, Dorman CJ. Bacterial nucleoid-associated proteins, nucleoid structure and gene expression. Nat Rev Microbiol. 2010;8(3):185–95. pmid:20140026
- View Article
- PubMed/NCBI
- Google Scholar
39. Norris V, Kayser C, Muskhelishvili G, Konto-Ghiorghi Y. The roles of nucleoid-associated proteins and topoisomerases in chromosome structure, strand segregation, and the generation of phenotypic heterogeneity in bacteria. FEMS Microbiol Rev. 2023;47(6):fuac049. pmid:36549664
- View Article
- PubMed/NCBI
- Google Scholar
40. Badrinarayanan A, Le TBK, Laub MT. Bacterial chromosome organization and segregation. Annu Rev Cell Dev Biol. 2015;31:171–99. pmid:26566111
- View Article
- PubMed/NCBI
- Google Scholar
41. Bachmann BJ. Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol Rev. 1972;36(4):525–57. pmid:4568763
- View Article
- PubMed/NCBI
- Google Scholar
42. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989.
43. Miller JH. A short course in bacterial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria. New York: Cold Spring Harbor; 1992.
44. Hishida T, Han YW, Shibata T, Kubota Y, Ishino Y, Iwasaki H, et al. Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004;18:1886–97.
- View Article
- Google Scholar
45. Hishida T, Iwasaki H, Han Y-W, Ohnishi T, Shinagawa H. Uncoupling of the ATPase activity from the branch migration activity of RuvAB protein complexes containing both wild-type and ATPase-defective RuvB proteins. Genes Cells. 2003;8(9):721–30. pmid:12940820
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Cromie GA, Connelly JC, Leach DR. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Mol Cell. 2001;8(6):1163–74. pmid:11779493
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Kuzminov A. Recombinational repair of DNA damage in Escherichia coli and bacteriophage lambda. Microbiol Mol Biol Rev. 1999;63(4):751–813, table of contents. pmid:10585965
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Wyman C, Ristic D, Kanaar R. Homologous recombination-mediated double-strand break repair. DNA Repair (Amst). 2004;3(8–9):827–33. pmid:15279767
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Kowalczykowski SC. An overview of the molecular mechanisms of recombinational DNA repair. Cold Spring Harb Perspect Biol. 2015;7(11):a016410. pmid:26525148
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Singleton MR, Dillingham MS, Gaudier M, Kowalczykowski SC, Wigley DB. Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature. 2004;432(7014):187–93. pmid:15538360
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Dillingham MS, Kowalczykowski SC. RecBCD enzyme and the repair of double-stranded DNA breaks. Microbiol Mol Biol Rev. 2008;72(4):642–71, Table of Contents. pmid:19052323
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Smith GR. How RecBCD enzyme and Chi promote DNA break repair and recombination: a molecular biologist’s view. Microbiol Mol Biol Rev. 2012;76(2):217–28. pmid:22688812
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Lusetti SL, Cox MM. The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu Rev Biochem. 2002;71:71–100. pmid:12045091
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Courcelle J, Hanawalt PC. RecA-dependent recovery of arrested DNA replication forks. Annu Rev Genet. 2003;37:611–46. pmid:14616075
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Cox MM. Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol. 2007;42(1):41–63. pmid:17364684
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Lesterlin C, Ball G, Schermelleh L, Sherratt DJ. RecA bundles mediate homology pairing between distant sisters during DNA break repair. Nature. 2014;506(7487):249–53. pmid:24362571
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Bell JC, Kowalczykowski SC. RecA: Regulation and Mechanism of a Molecular Search Engine. Trends Biochem Sci. 2016;41(6):491–507. pmid:27156117
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Wiktor J, Gynnå AH, Leroy P, Larsson J, Coceano G, Testa I, et al. RecA finds homologous DNA by reduced dimensionality search. Nature. 2021;597(7876):426–9. pmid:34471288
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Yang H, Zhou C, Dhar A, Pavletich NP. Mechanism of strand exchange from RecA-DNA synaptic and D-loop structures. Nature. 2020;586(7831):801–6. pmid:33057191
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Courcelle J, Khodursky A, Peter B, Brown PO, Hanawalt PC. Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics. 2001;158(1):41–64. pmid:11333217
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Hirano T. At the heart of the chromosome: SMC proteins in action. Nat Rev Mol Cell Biol. 2006;7(5):311–22. pmid:16633335
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Graumann PL, Knust T. Dynamics of the bacterial SMC complex and SMC-like proteins involved in DNA repair. Chromosome Res. 2009;17(2):265–75. pmid:19308706
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Nolivos S, Sherratt D. The bacterial chromosome: architecture and action of bacterial SMC and SMC-like complexes. FEMS Microbiol Rev. 2014;38(3):380–92. pmid:24118085
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Rostas K, Morton SJ, Picksley SM, Lloyd RG. Nucleotide sequence and LexA regulation of the Escherichia coli recN gene. Nucleic Acids Res. 1987;15(13):5041–9. pmid:3037486
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Sargentini NJ, Smith KC. Characterization of an Escherichia coli mutant (radB101) sensitive to gamma and uv radiation, and methyl methanesulfonate. Radiat Res. 1983;93(3):461–78. pmid:6344125
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Picksley SM, Attfield PV, Lloyd RG. Repair of DNA double-strand breaks in Escherichia coli K12 requires a functional recN product. Mol Gen Genet. 1984;195(1–2):267–74. pmid:6092851
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Meddows TR, Savory AP, Grove JI, Moore T, Lloyd RG. RecN protein and transcription factor DksA combine to promote faithful recombinational repair of DNA double-strand breaks. Mol Microbiol. 2005;57(1):97–110. pmid:15948952
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Keyamura K, Sakaguchi C, Kubota Y, Niki H, Hishida T. RecA protein recruits structural maintenance of chromosomes (SMC)-like RecN protein to DNA double-strand breaks. J Biol Chem. 2013;288:29229–37.
View Article
Google Scholar

[90] View Article

[91] Google Scholar

[ref24] 24. Noda S, Akanuma G, Keyamura K, Hishida T. RecN spatially and temporally controls RecA-mediated repair of DNA double-strand breaks. J Biol Chem. 2023;299(12):105466. pmid:37979912
View Article
PubMed/NCBI
Google Scholar

[93] View Article

[94] PubMed/NCBI

[95] Google Scholar

[ref25] 25. Vickridge E, Planchenault C, Cockram C, Junceda IG, Espéli O. Management of E. coli sister chromatid cohesion in response to genotoxic stress. Nat Commun. 2017;8:14618. pmid:28262707
View Article
PubMed/NCBI
Google Scholar

[97] View Article

[98] PubMed/NCBI

[99] Google Scholar

[ref26] 26. McLean EK, Lenhart JS, Simmons LA. RecA is required for the assembly of RecN into DNA repair complexes on the nucleoid. J Bacteriol. 2021;203(20):e0024021. pmid:34339298
View Article
PubMed/NCBI
Google Scholar

[101] View Article

[102] PubMed/NCBI

[103] Google Scholar

[ref27] 27. Chimthanawala A, Parmar JJ, Kumar S, Iyer KS, Rao M, Badrinarayanan A. SMC protein RecN drives RecA filament translocation for in vivo homology search. Proc Natl Acad Sci U S A. 2022;119:e2209304119.
View Article
Google Scholar

[105] View Article

[106] Google Scholar

[ref28] 28. Uranga LA, Reyes ED, Patidar PL, Redman LN, Lusetti SL. The cohesin-like RecN protein stimulates RecA-mediated recombinational repair of DNA double-strand breaks. Nat Commun. 2017;8:15282. pmid:28513583
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref29] 29. Keyamura K, Hishida T. Topological DNA-binding of structural maintenance of chromosomes-like RecN promotes DNA double-strand break repair in Escherichia coli. Commun Biol. 2019;2:413. pmid:31754643
View Article
PubMed/NCBI
Google Scholar

[112] View Article

[113] PubMed/NCBI

[114] Google Scholar

[ref30] 30. Reyes ED, Patidar PL, Uranga LA, Bortoletto AS, Lusetti SL. RecN is a cohesin-like protein that stimulates intermolecular DNA interactions in vitro. J Biol Chem. 2010;285(22):16521–9. pmid:20360008
View Article
PubMed/NCBI
Google Scholar

[116] View Article

[117] PubMed/NCBI

[118] Google Scholar

[ref31] 31. Grove JI, Wood SR, Briggs GS, Oldham NJ, Lloyd RG. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli. DNA Repair (Amst). 2009;8(12):1434–43. pmid:19846353
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref32] 32. Vikedal K, Ræder SB, Riisnæs IMM, Bjørås M, Booth JA, Skarstad K, et al. RecN and RecA orchestrate an ordered DNA supercompaction response following ciprofloxacin-induced DNA damage in Escherichia coli. Nucleic Acids Res. 2025;53(10):gkaf437. pmid:40433982
View Article
PubMed/NCBI
Google Scholar

[124] View Article

[125] PubMed/NCBI

[126] Google Scholar

[ref33] 33. Nagashima K, Kubota Y, Shibata T, Sakaguchi C, Shinagawa H, Hishida T. Degradation of Escherichia coli RecN aggregates by ClpXP protease and its implications for DNA damage tolerance. J Biol Chem. 2006;281:30941–6.
View Article
Google Scholar

[128] View Article

[129] Google Scholar

[ref34] 34. Ishioka K, Fukuoh A, Iwasaki H, Nakata A, Shinagawa H. Abortive recombination in Escherichia coli ruv mutants blocks chromosome partitioning. Genes Cells. 1998;3(4):209–20. pmid:9663656
View Article
PubMed/NCBI
Google Scholar

[131] View Article

[132] PubMed/NCBI

[133] Google Scholar

[ref35] 35. Dunderdale HJ, Benson FE, Parsons CA, Sharples GJ, Lloyd RG, West SC. Formation and resolution of recombination intermediates by E. coli RecA and RuvC proteins. Nature. 1991;354(6354):506–10. pmid:1758493
View Article
PubMed/NCBI
Google Scholar

[135] View Article

[136] PubMed/NCBI

[137] Google Scholar

[ref36] 36. Iwasaki H, Takahagi M, Shiba T, Nakata A, Shinagawa H. Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991;10(13):4381–9. pmid:1661673
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref37] 37. Pazos F, Valencia A. Protein co-evolution, co-adaptation and interactions. EMBO J. 2008;27(20):2648–55. pmid:18818697
View Article
PubMed/NCBI
Google Scholar

[143] View Article

[144] PubMed/NCBI

[145] Google Scholar

[ref38] 38. Dillon SC, Dorman CJ. Bacterial nucleoid-associated proteins, nucleoid structure and gene expression. Nat Rev Microbiol. 2010;8(3):185–95. pmid:20140026
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref39] 39. Norris V, Kayser C, Muskhelishvili G, Konto-Ghiorghi Y. The roles of nucleoid-associated proteins and topoisomerases in chromosome structure, strand segregation, and the generation of phenotypic heterogeneity in bacteria. FEMS Microbiol Rev. 2023;47(6):fuac049. pmid:36549664
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref40] 40. Badrinarayanan A, Le TBK, Laub MT. Bacterial chromosome organization and segregation. Annu Rev Cell Dev Biol. 2015;31:171–99. pmid:26566111
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref41] 41. Bachmann BJ. Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol Rev. 1972;36(4):525–57. pmid:4568763
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref42] 42. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989.

[ref43] 43. Miller JH. A short course in bacterial genetics. A laboratory manual and handbook for Escherichia coli and related bacteria. New York: Cold Spring Harbor; 1992.

[ref44] 44. Hishida T, Han YW, Shibata T, Kubota Y, Ishino Y, Iwasaki H, et al. Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004;18:1886–97.
View Article
Google Scholar

[165] View Article

[166] Google Scholar

[ref45] 45. Hishida T, Iwasaki H, Han Y-W, Ohnishi T, Shinagawa H. Uncoupling of the ATPase activity from the branch migration activity of RuvAB protein complexes containing both wild-type and ATPase-defective RuvB proteins. Genes Cells. 2003;8(9):721–30. pmid:12940820
View Article
PubMed/NCBI
Google Scholar

[168] View Article

[169] PubMed/NCBI

[170] Google Scholar

Species-specific coevolution of RecA–RecN interfaces governs DNA double-strand break repair in Escherichia coli

Species-specific coevolution of RecA–RecN interfaces governs DNA double-strand break repair in Escherichia coli

This is an uncorrected proof.

Figures

Abstract

Author summary

Introduction

Results

Functional complementation of the ecRecN defect by RecN derived from other bacteria

Nucleoid morphology in paRecN-expressing ∆recN cells

DNA repair activity in paRecA and paRecN co-expressing cells

Nucleoid structure in paRecA and paRecN co-expressing cells

Screening and isolation of gain-of-function paRecN mutants

Functional complementation of paRecN gain-of-function mutants

Effect of the paRecN expression level on functional complementation

Function of GFP-tagged paRecN

Intracellular localization of RecN-Lk-GFP

RecA-RecN interaction

Discussion

Materials and methods

Bacterial strains and plasmids

Media and general methods

Sensitivity to MMC

Isolation of paRecN mutants

E. coli cell extract and western blotting

SOS response

Structure prediction using AlphaFold2

Fluorescence microscopy

Protein purification

RecA-RecN pull-down assay

Supporting information

S1 Table. E. coli strains used in this study.

S1 Data. Source data for all of the main figures.

S1 Fig. MMC sensitivity of ∆recN and ∆recA ∆recN cells expressing RecA and/or RecN from the indicated species.

S2 Fig. Isolation of paRecN gain-of-function mutants for MMC sensitivity.

S3 Fig. Nucleotide sequence alignment of the coding regions of paRecN and codon-optimized paRecN (paRecN⁺).

S4 Fig. Construction of GFP-fused RecN expression plasmid.

S5 Fig. Purification of paRecN protein.

Acknowledgments

References

This is an uncorrected proof.

Figures

Abstract

Author summary

Introduction

Results

Functional complementation of the ecRecN defect by RecN derived from other bacteria

Nucleoid morphology in paRecN-expressing ∆recN cells

DNA repair activity in paRecA and paRecN co-expressing cells

Nucleoid structure in paRecA and paRecN co-expressing cells

Screening and isolation of gain-of-function paRecN mutants

Functional complementation of paRecN gain-of-function mutants

Effect of the paRecN expression level on functional complementation

Function of GFP-tagged paRecN

Intracellular localization of RecN-Lk-GFP

RecA-RecN interaction

Discussion

Materials and methods

Bacterial strains and plasmids

Media and general methods

Sensitivity to MMC

Isolation of paRecN mutants

E. coli cell extract and western blotting

SOS response

Structure prediction using AlphaFold2

Fluorescence microscopy

Protein purification

RecA-RecN pull-down assay

Supporting information

S1 Table. E. coli strains used in this study.

S1 Data. Source data for all of the main figures.

S1 Fig. MMC sensitivity of ∆recN and ∆recA ∆recN cells expressing RecA and/or RecN from the indicated species.

S2 Fig. Isolation of paRecN gain-of-function mutants for MMC sensitivity.

S3 Fig. Nucleotide sequence alignment of the coding regions of paRecN and codon-optimized paRecN (paRecN+).

S4 Fig. Construction of GFP-fused RecN expression plasmid.

S5 Fig. Purification of paRecN protein.

Acknowledgments

References

S3 Fig. Nucleotide sequence alignment of the coding regions of paRecN and codon-optimized paRecN (paRecN⁺).