Skip to main content
Advertisement
  • Loading metrics

HTL/KAI2 signaling substitutes for light to control plant germination

  • Jenna E. Hountalas ,

    Contributed equally to this work with: Jenna E. Hountalas, Michael Bunsick, Zhenhua Xu

    Roles Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review & editing

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • Michael Bunsick ,

    Contributed equally to this work with: Jenna E. Hountalas, Michael Bunsick, Zhenhua Xu

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Supervision, Validation, Writing – review & editing

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • Zhenhua Xu ,

    Contributed equally to this work with: Jenna E. Hountalas, Michael Bunsick, Zhenhua Xu

    Roles Formal analysis, Investigation, Methodology, Validation

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • Andrea A. Taylor,

    Roles Formal analysis, Investigation, Writing – review & editing

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • Gianni Pescetto,

    Roles Data curation, Investigation, Methodology

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • George Ly,

    Roles Data curation, Formal analysis, Investigation, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Department of Cell & Systems Biology, University of Toronto, Toronto, Canada

  • François-Didier Boyer,

    Roles Resources, Writing – review & editing

    Affiliation Université Paris-Saclay, CNRS, Institut de Chimie des Substances Naturelles, Gif-sur-Yvette, France

  • Christopher S. P. McErlean,

    Roles Resources, Writing – review & editing

    Affiliation School of Chemistry, The University of Sydney, S`ydney, Australia

  • Shelley Lumba

    Roles Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Visualization, Writing – original draft, Writing – review & editing

    shelley.lumba@utoronto.ca

    Affiliations Department of Cell & Systems Biology, University of Toronto, Toronto, Canada, Centre for the Analysis of Genome Evolution and Function, University of Toronto, Toronto, Canada

Abstract

Plants monitor multiple environmental cues, such as light and temperature, to ensure they germinate at the right time and place. Some specialist plants, like ephemeral fire-following weeds and root parasitic plants, germinate primarily in response to small molecules found in specific environments. Although these species come from distinct clades, they use the same HYPOSENSITIVE TO LIGHT/KARRIKIN INSENSITIVE 2 (HTL/KAI2) signaling pathway, to perceive different small molecules suggesting convergent evolution on this pathway. Here, we show that HTL/KAI2 signaling in Arabidopsis thaliana bypasses the light requirement for germination. The HTL/KAI2 downstream component, SUPPRESSOR OF MAX2 1 (SMAX1) accumulates in the dark and is necessary for PHYTOCHROME INTERACTING FACTOR 1/PHYTOCHROME INTERACTING FACTOR 3-LIKE 5 (PIF1/PIL5) to regulate hormone response pathways conducive to germination. The interaction of HTL/KAI2 and light signaling may help to explain how specialist plants like ephemeral and parasitic weeds evolved their germination behaviour in response to specific environments.

Author summary

Specialist plants have convergently evolved to use the same family of receptors to perceive different small molecules in lieu of necessary germination cues, like light. Although light is necessary for the germination of many generalist plants such as the model organism Arabidopsis thaliana, we show that activating the conserved receptor in Arabidopsis promotes germination in the absence of light. We show that the downstream component of the AtKAI2 signaling pathway is stable in the dark which explains its ability to negatively regulate germination. Additionally, we show that activating the receptor in the dark can modulate the gene expression profile by regulating key components of the light signaling pathway. Our study highlights how specialist plants may recycle components of conserved signaling pathways to thrive in new environments.

Introduction

Germination strategies are key to determining the environment that a plant will experience, thus, control of this developmental process is highly adaptive [1]. Generally, many plants monitor multiple environmental cues such as temperature changes, moisture content, and light quality to determine when to germinate. By contrast, a single cue dominates germination in some specialist species. For example, seeds of some pyroendemic species remain dormant and only germinate when exposed to a collection of structurally related small molecules called karrikins (KARs), which are released from charred plant matter after a fire [2,3]. Parasitic plants of the Striga genus are another example. These species only germinate when they detect the phytohormone strigolactone (SL) released by a nearby host plant [4,5]. Intriguingly, these pyroendemic and parasitic plants perceive these germination cues through a conserved receptor class designated, HYPOSENSITIVE TO LIGHT/KARRIKIN INSENSITIVE 2 (HTL/KAI2) [68]. However, since these species are not amenable to genetic analysis, it is difficult to dissect how activation of the HTL/KAI2 receptor elicits a germination response.

Fortunately, HTL/KAI2 signaling also occurs in model experimental plants like Arabidopsis thaliana (Arabidopsis). The HTL/KAI2 receptor in Arabidopsis (AtKAI2) interacts with an F-box protein, MORE AXILLARY MERISTEMS 2 (MAX2) to degrade two negative regulators: SUPPRESSOR OF MAX2 1 (SMAX1) and SUPPRESSOR OF MAX2 LIKE 2 (SMXL2) [4,5]. Presently, the ligand for AtKAI2 is not identified although this receptor is closely related to other α/β hydrolase receptors that bind the hormone strigolactone (SL) [79]. Chemically, canonical SL structures are tricyclic lactones (ABC rings) connected to a butenolide ring (D-ring) via an enol-ether bridge. The stereochemistry around the D-ring is important as only SLs with (+)-(2’R) stereochemistry are bioactive [10]. Surprisingly, unlike SL receptors, AtKAI2 is activated by SLs with (-)-(2’S) stereochemistry [10]. However, because 2’S isomers do not occur in nature, a compound, dubbed KL, for KAI2-ligand, has been hypothesized [9]. More perplexing, AtKAI2 is activated by KARs although Arabidopsis is not a fire-follower. Although loss-of-function mutations in AtKAI2 result in increased primary dormancy in some Arabidopsis accessions, AtKAI2 at first glance, appears to play only a minor role in germination of after-ripened seed [11,12].

The first loss-of-function mutant isolated in AtKAI2 was termed hyposensitive to light (htl), indicating the KAI2/HTL pathway is a positive regulator of light responses [13]. While germination of many plant species is not affected by light, germination of photoblastic seed is affected by light [14, see 15 for review]. In the case of Arabidopsis, which physiologically establishes seed dormancy, light positively promotes germination, an example of positive photoblasticism [see 15,16 for review]. There are, however, negative photoblastic plant species such as onion and lily for which light inhibits germination [14, see 15 for review]. Although the molecular mechanisms underlying this distinction in seeds are unclear, light could be alleviating or promoting the repression of the final set of genes involved in germination in positive and negative photoblastic species, respectively [1719]. Intriguingly, KARs can substitute for light in germinating the positive photoblastic lettuce species, Lactuca sativa cv. Grand Rapids [2022]. KAR appears to act through a KAI2 receptor in lettuce (LsKAI2b) based on heterologous expression of LsKAI2b in Arabidopsis [23]. The sufficiency of the KAI2 pathway in lettuce strongly suggests that the KAI2 pathway can replace the light requirement for germination in some positive photoblastic species. To elucidate the mechanisms by which the KAI2 pathway substitutes for light, we investigated this ability in a model positive photoblastic plant, Arabidopsis thaliana.

For Arabidopsis seed germination, the phytochrome photoreceptors play the biggest role with PHYTOCHROME B (PHYB) promoting germination of imbibed seed in red light (660 nM) and as seeds hydrate PHYTOCHROME A (PHYA) contributes to a positive far-red (700 nM) light signal [24,25]. Light-activated PHYB and PHYA, in turn, inactivate a key basic helix-loop-helix (bHLH) transcriptional regulator PHYTOCHROME-INTERACTING FACTOR 1 (PIF1; also known as PHYTOCHROME INTERACTING FACTOR 3-LIKE 5 (PIL5) and BHLH105) [2628]. A reduction in PIF1 action promotes germination through the accumulation of positive regulators of light responses [29].

In the seed, PIF1 modulates other functions including the levels of two key hormones, gibberellins (GA), which promote germination and abscisic acid (ABA), which inhibits it [26,27,30]. PIF1 achieves this by transcriptionally activating of SOMNUS (SOM), which encodes a CCCH type zinc finger protein [31]. Active SOM downregulates GA biosynthetic genes, GIBBERELLIN3-OXIDASE 1 (GA3ox1) and GIBBERELLIN3-OXIDASE 2 (GA3ox2) and upregulates the GA turnover gene, GIBBERELLIN2-OXIDASE 2 (GA2ox2) [3133]. Concurrently, SOM inhibits expression of a gene encoding an enzyme for ABA breakdown, CYTOCHROME707-A2 (CYP707A2) and upregulates ABA DEFICIENT 1 (ABA1), NINE-CIS-EPOXYCAROTENOID DIOXYGENASE6 (NCED6) and NINE-CIS-EPOXYCAROTENOID DIOXYGENASE 9 (NCED9), which are genes involved in ABA synthesis [3133]. PIF1 also induces the expression of several genes involved in cell wall loosening, allowing the embryonic root (radicle) to push through a weakened seed coat (testa) [29]. The overall importance of PIF1 in germination is reflected in the ability of pif1 loss-of-function mutant seed to germinate in the dark in contrast to wild-type seed [26].

The HTL/KAI2 signaling pathway adds complexity to the interactions among light, GA and ABA signaling in germination. Double mutants between pif1 and either Atkai2 or max2 show intermediate germination phenotypes, suggesting KAR signaling acts independently of PIF1 in Arabidopsis [34,35]. Transcriptome studies, however, reveal that many KAR-induced genes are also induced by red light [27]. Moreover, Atkai2 and max2 seed exhibit a reduced seed germination under red light while smax1 mutants show enhanced germination [3638]. Furthermore, Atkai2 mutant seed show altered expression of PIF1-regulated genes such as GA3ox1, GA2ox2, ABA1, and NCED9 suggesting KAR signaling is linked to the PHYB-PIF1 signaling module [35]. Related to this, SMAX1 binds the promoter of the GA3ox2 repressing its transcription and the SMAX1 protein interacts with GA dependent repressors, RGA-LIKE 1 (RGL1) and RGA-LIKE 1 (RGL3) [38,39]. By contrast, in the light, loss of SMAX1 and SMXL2 function allows Arabidopsis to germinate without GA action suggesting the AtKAI2/HTL pathway is independent of GA signaling under these conditions [40]. These conflicting observations most likely reflect the complex roles of light on many aspects of plant growth and development.

The observation that the HTL/KAI2 signaling pathway appears to have a role in light signaling suggested to us that designing experiments under conditions that limit light exposure may have utility in understanding the role of this signaling pathway in germination. Here, we find that activating KAI2/HTL signaling in the dark affects numerous PIF1-regulated genes, including genes involved in ABA and GA synthesis as well as genes that modify cell wall composition. Moreover, like pif1 mutant seed, we find loss of SMAX1 and SMXL2 function also allow seeds to germinate in the dark. Genetic analysis suggests SMAX1 and SMXL2 act through PIF1 to inhibit germination and this relationship posits how KAR and SL could replace light as a germination cue in certain plant species. This model has implications on how specialist plants like some ephemeral weeds and parasitic plants may have evolved their germination behaviours in response to specific small molecule germination cues.

Results

SMAX1 and SMXL2 inhibits Arabidopsis germination in the dark

The conditions used to germinate Arabidopsis vary widely in the literature. Typically, after-ripened seeds are exposed to various sterilizing agents and then plated onto rich nutrient agar plates with or without a sugar source. Moreover, many dark-based experiments involve pre-exposing seeds to a complicated light regime involving red and far-red light exposure before germination to ensure the ratio of active (Pfr) to inactive phytochrome (Pr) is experimentally correct. To analyze the germination of various genotypes and perform large-scale mutant screens under light-limited conditions, we simplified dark germination conditions of treated seeds in the following way.

First, we removed the confounding effects of seed age on levels of dormancy by only using seeds that had ripened for at least six months; a timeframe based on observations that at least three months of seed ripening is required to maximally decay PHYB to its Pr form [41]. We tested this by giving seeds a five-minute pulse of far-red light and found similar germination responses to our dark conditions (S1 Fig). Second, seeds were plated on water and agar media devoid of nutrients and a carbon source, which removes the promotive effects of nitrogen and carbon on germination. Finally, we were concerned that seed sterilization may influence seed germinability in the dark and tested the effects of no sterilization, ethanol sterilization, and bleach sterilization on the germination of seeds in the dark (S2A Fig). We found unsterilized or ethanol-sterilized seeds of wild-type (Col-0) reproducibly did not germinate under our dark conditions (S2A Fig). Bleaching seed, however, markedly increased the germination of these genotypes in the dark, which most likely reflects a weakening of the seed coat due to the bleach (S2A Fig). Because experiments would now require unsterilized seeds, we added the fungicide benomyl to the media and found this has no obvious effect on germination or seedling viability (S2B Fig). Based on these results, our dark germination experiments of plating six-month-old dry unsterilized seeds directly onto water agar plates followed by immediate placement in the dark is a useful and simple method of testing dark germination response in Arabidopsis.

To further characterize wild-type seed germination under light-limiting conditions, we exposed imbibed seeds to a low light fluence (~0.3 μmol m-2 s-1) for increasing time periods to determine a threshold of light duration required for germination. Wild-type seeds showed a slow, steady rise in germination as low-light exposure progressed. In contrast, htl-3 (kai2) seed germinated poorly over the same timeframe, suggesting that the AtKAI2 pathway positively contributed to germination under limiting light conditions, which is consistent with the original identification of KAI2 as ‘hyposensitive to light’ at the level of inhibition of hypocotyl growth (S2C Fig) [13]. Two additional genetic experiments further supported this premise. First, two well-characterized htl-3 lines overexpressing AtKAI2 (AtKAI2OX-A, AtKAI2OX-B) germinated in the absence of light at effective KAR2 concentrations (EC50) in the low nanomolar range (Fig 1A and 1B) [8]. Second, genetic inactivation of the downstream negative regulator of AtKAI2 signaling, SUPPRESSOR OF MAX2 1 (SMAX1) resulted in partial germination in the dark (Fig 1C). When a loss-of-function mutation in SUPPRESSOR OF MAX2 LIKE 2 (SMXL2), a partially redundant ortholog of SMAX1, was introduced into this line (smax1-2; smxl2-1), almost all seeds germinated constitutively in the dark (Fig 1C). Consistent with our genetic results, the expression of genes known to be induced by AtKAI2 activation (DLK2, KUF1, BBX20) increased in dark-germinated AtKAI2OX-A seeds treated with KAR2 (Fig 1D) [42,43]. As predicted, these genes were constitutively expressed in smax1-2 single and smax1-2; smxl2-1 double mutants (Fig 1D). Our results indicate that SMAX1 and SMXL2 contribute to the repression of germination of Arabidopsis seeds in the dark.

thumbnail
Fig 1. Activation of AtKAI2 signaling promotes Arabidopsis germination in the dark.

(A) Representative images of Arabidopsis genotypes germinating on minimal mock media (DMSO) or media containing 0.5 μM KAR2 under continuous dark conditions. (B) Effective concentrations (EC50) of KAR2 required to germinate 50% of two AtKAI2 overexpression lines (AtKAI2OX-A, AtKAI2OX-B) [8], wild-type Col-0, and htl-3 seed. Each point represents the mean germination percentage of three biological replicates. Bar = SD. (C) Dark germination of Col-0, smax1-2, and smax1-2; smxl2-1 double homozygous mutant. Each open circle represents the germination percentage of a biological replicate. Bar = SD (D) Expression (RT–qPCR analysis) of KAR-induced genes (DLK2, KUF1, and BBX20) [42,43] in dark-germinated AtKAI2OX-A seeds on 0.5 μM KAR2. AtACTIN8 gene was used as an internal control. Lower case letters indicated a significant difference compared to untreated (DMSO) control seeds (P < 0.05, ANOVA with post-hoc one-sided Fisher’s least significant difference). P values, sample sizes and plot elements are provided in S1 Table.

https://doi.org/10.1371/journal.pgen.1011447.g001

Light reverses SMAX1 accumulation in the dark

In Arabidopsis, SMAX1 and SMXL2 are degraded by the F-box protein, MAX2, when AtKAI2 is activated by either the (-)-(2’S) isomer of rac-GR24 or by KARs [4446]. Evidence for this model, however, often requires special experimental conditions because of difficulties in detecting SMAX1 protein in Arabidopsis [44]. Our result that SMAX1 is a negative regulator and represses germination in the dark led us to hypothesize that the SMAX1 protein in Arabidopsis should accumulate in the dark. To test this, we fused eYFP (enhanced yellow fluorescent protein) to SMAX1 and placed it under the control of the ubiquitously expressed 35S promoter (35S::eYFP-SMAX1). We generated stable transgenic lines in a smax1-2 loss-of-function mutant background and found that the eYFP-SMAX1 transgene complemented smax1-2 phenotypes, such as hypocotyl length and germination in the presence of the GA biosynthesis inhibitor, paclobutrazol (PAC) (S3 Fig).

In contrast to seeds germinated in the light, dark-grown seedlings showed a strong nuclear-localized eYFP signal throughout the root (Fig 2A). Importantly, the dark-dependent SMAX1 accumulation disappeared within six hours of light exposure (Fig 2A). When we performed the reciprocal experiment, where light-grown seedlings were moved to the dark, we observed nuclear-localized eYFP signal within six hours (Fig 2B). This signal accumulated to higher levels after twelve hours in the dark (Fig 2B). To assess if the eYFP-SMAX1 line was responding correctly, we reperformed our light shift experiments in the presence of rac-GR24. Exposure to rac-GR24 activates AtKAI2 signaling through the (-)-(2’S) isomer and should result in SMAX1 degradation. Indeed, only weak YFP signal was detected in rac-GR24 treated roots under all conditions (Fig 2A and 2B). In summary, SMAX1 accumulates in the dark. Genetic analysis indicates that SMAX1 accumulation represses germination in the absence of light stimulus. Upon exposure to light, the SMAX1 signal disappears. The ability of rac-GR24 to prevent SMAX1 accumulation in the dark suggested that SMAX1 stability depends on activation of AtKAI2 signaling.

thumbnail
Fig 2. SMAX1 accumulates in the dark.

(A) Representative z-stack projection images of an overexpression eYFP-SMAX1 line (smax1-2; 35S::eYFP-SMAX1). Seeds were exposed to light for six hours to initiate germination and then transferred to total darkness for 48 hours. After 48 hours in the dark, seedlings were exposed to light for 6 or 12 hours. The red outline is propidium iodide staining of the cell walls. The duration of light and dark treatments is drawn at the top of the figure. (B) Representative z-stack projection images of an overexpression eYFP-SMAX1 line (smax1-2; 35S::eYFP-SMAX1) after 48 hours of continuous light germination with or without 1μM rac-GR24. Seeds were exposed to light for 48 hours. After 48 hours in the light, seedlings were placed in the dark for 6 or 12 hours. The red outline is propidium iodide staining of the cell walls. The duration of light and dark treatments is drawn at the top of the figure. Scale bar = 25μm.

https://doi.org/10.1371/journal.pgen.1011447.g002

SMAX1 regulates PIF1 to mediate hormone action

Although SMAX1 and SMXL2 repress seed germination under dark conditions, it is not clear how these proteins regulate this process. Activation of AtKAI2 is thought to primarily target SMAX1 and SMXL2 proteins for degradation [4446]. Taking advantage of this specificity, we compared global gene expression changes between untreated and KAR2-treated AtKAI2OX seeds imbibed in the dark. Despite the absence of light stimulus, KAR2-treatment of AtKAI2OX seed upregulated the expression of many genes typically only induced by light (Fig 3A and S2 Table) [47]. Seedling greening after germination is a highly regulated process that balances the establishment of photosynthesis whilst minimizing photooxidative damage and many of the involved genes are controlled by phytochrome through inhibition of PIF1 [48]. Consistent with this, while cataloguing components involved in phytochrome signaling, we noticed that expression of several basic helix-loop-helix (bHLH) family members including PACLOBUTRAZOL RESISTANCES (PREs), PHYTOCHROME RAPIDLY REGULATED (PARs) and LONG HYPOCOTYL FAR RED1 (HFR1) that contribute to seedling greening, were upregulated in KAR2-treated AtKAI2OX seed (Fig 3B and S2 Table). These bHLHs are thought to fine-tune phytochrome responses by forming feedback loops where the transcription factor, PIF1, promotes HFR1, HECATES (HECs), and PAR expression [4951]. In turn, the HFR1, HECs, and PAR proteins sequester PIF1 to prevent transcription of downstream targets [4951]. Notably, 94 of the 166 known direct targets of PIF1 were activated two-fold by KAR2 (Fig 3C and S3 Table). [29]. This large overlap of gene expression together with the shared dark germination phenotype of pif1-1 and smax1-2 mutants, suggest that a genetic relationship exists between these pathways. Indeed, epistatic analysis between htl-3 and pif1-1, which germinates poorly and constitutively under light-limiting conditions, respectively, places PIF1 at or downstream of AtKAI2 in a genetically dependent pathway (Fig 3D).

thumbnail
Fig 3. Activated AtKAI2 signaling perturbs light signaling.

(A) Heatmap representation of the expression of genes annotated as components of the photosynthetic apparatus in dark germinated AtKAI2OX seed treated with KAR2. All heatmaps depict log2-transformed fold-change in gene expression between AtKAI2OX+KAR2/AtKAI2OX at 24h. See S2 Table for gene lists and values. (B) Heatmap representation of the expression of genes annotated as regulatory components of phytochrome signaling in dark-germinated AtKAI2OX seed treated with KAR2. (C) Heatmap representation of the expression of annotated PIF1-regulated genes [29] in dark-germinated AtKAI2OX seed with KAR2 at 24 hours. See S3 Table for gene lists and values. (D) Representative pictures of htl-3, pif1-1, and htl-3; pif1-1 seed placed under dark conditions for five days.

https://doi.org/10.1371/journal.pgen.1011447.g003

Since many of the genes downstream of PIF1 are annotated as responsive to hormones, PIF1 appears to contribute to establishing the correct combination of hormonal responses required for germination [29]. We observed that the expression of genes involved in hormone response affected by the loss of PIF1 were also regulated by KAR2 activation of AtKAI2 in dark germinated AtKAI2OX seed (Fig 4A and S4 Table). The ratio of the hormones, ABA to GA is crucial for tuning the seed for germination [52]. For example, PIF1 partially represses germination by increasing ABA and decreasing GA levels through SOM [31]. SOM increases ABA levels by activating ABA anabolic genes, ABA1, NCED6, and NCED9 as well as repressing the ABA catabolic gene, CYP707A2 [31]. SOM also decreases the expression of GA anabolic genes, GA3ox1 and GA3ox2 and increases the transcript levels of the GA catabolic gene, GA2ox2 [31]. We found that KAR2 activation of AtKAI2 in dark-germinated AtKAI2OX seed decreased transcript levels of the SOM targets ABA1, NCED6 and NCED9 (Fig 4B and S2 Table). AtKAI2 activation also increases the levels of GA3ox1 and GA3ox2 transcripts whilst decreasing GA20ox3 (Fig 4B). Unlike SOM, however, AtKAI2 activation induced expression of a different CYP707 homolog (CYP707A3 versus CYP707A2) and decreased expression of GA2ox2 (Fig 4B). Even considering this nuance, the transcript profile of KAR2 activation of AtKAI2, demonstrated an overall similarity to the transcript profile of pif1 loss-of-function seeds. Consistent with a decrease in ABA and increase in GA levels, the expression of genes annotated as ABA-regulated, decreased upon AtKAI2 activation while transcripts of GA-responsive genes increased (Fig 4A and 4B).

thumbnail
Fig 4. Activating AtKAI2 signaling perturbs hormone signaling.

(A) Heatmap representation of the expression of genes annotated as PIF1-regulated hormonal response genes [29] in dark-germinated AtKAI2OX seed with KAR2 relative to mock treated (AtKAI2OX+KAR2/AtKAI2OX). All heatmaps depict log2-transformed fold-change at 24h. See S4 Table for gene lists and values. (B) Heatmap representing select ABA-and GA-regulated genes in dark germinated AtKAI2OX seed with KAR2. Dark red pathways are ABA-regulated genes. Purple pathways are GA-regulated genes. Heat map values are the ratio of AtKAI2OX+KAR2/AtKAI2OX gene expression after 24 hrs. See S2 Table for gene lists and values. (C) Germination of smax1-2; smxl2-1 seed in the dark on 3 μM ABA. Each open circle represents the germination percentage of a biological replicate. Bar = SD. (D) Germination of smax1-2; smxl2-1 seed in the dark on 20 μM PAC. Each open circle represents the germination percentage of a biological replicate. Bar = SD. Asterisks indicated a significant difference compared to untreated (mock) smax1-2; smxl2-1 seeds (P < 0.05, one-way ANOVA with post-hoc Tukey honest significant difference test). P values, sample sizes and bar plot elements are provided in S1 Table.

https://doi.org/10.1371/journal.pgen.1011447.g004

To functionally test the contributions of ABA and GA to AtKAI2 signaling, we next manipulated the levels of these hormones in the smax1-2; smxl2-1 double mutant and monitored dark germination. Adding ABA to smax1-2; smxl2-1 seeds partially inhibited germination in the dark (Fig 4C) as measured by radicle emergence, but ABA did fully inhibit seedling emergence (S4 Fig). These phenotypes are consistent with the previous finding that ABA does not increase the DELLA repressors of GA signaling to levels needed to inhibit seed coat rupture [53]. The inability of smax1-2; smxl2-1 seed to overcome the capacity of ABA to stop seedling greening also suggests that ABA signaling is functional after testa rupture. In contrast to increasing ABA, we found that reducing GA levels by exposing smax1-2; smxl2-1 seed to paclobutrazol (PAC), a GA biosynthesis inhibitor, fully inhibited germination (Fig 4D).

Identification of dark germination mutants

The ability of the smax1-2 loss-of-function mutant to germinate in the dark encouraged us to further probe this process by performing an unbiased forward genetic screen to identify new mutations in AtKAI2 signaling. We screened 48,000 EMS mutagenized Col-0 seeds (48 M2 pools) for mutants capable of germinating under our dark conditions and identified 122 potential mutants (Fig 5 and S5 Table). To speed up the mutant classification, we used a chemical genetics approach where various compounds that are known to differentiate different hormone- and light-related mutants were tested against the mutant collection. We exposed mutant seed to ABA and PAC in the light as these two compounds are commonly used to probe the ABA and GA signaling pathways as they pertain to Arabidopsis wild type seed germination. We also included a condition of PAC plus rac-GR24 to see if any PAC sensitive mutants could be rescued by addition of this artificial SL/KL. This information was then used to classify groups using two-dimensional hierarchical clustering. The response of a reference set of known hormonal or light signaling mutants to our compounds were also queried through this system to further catalog our dark germination lines. This reference set included an ABA-auxotroph, aba deficient2 (aba2-2), two ABA-insensitive mutants, aba insensitive1 (abi1-1), aba insensitive4 (abi4-5), three constitutive light signaling mutants, phytochrome interacting factor1 (pif1-1), de-etiolated1 (det1-1), constitutive photomorphogenic1 (cop1-4) and the constitutive AtKAI2 signaling mutant, smax1-2.

thumbnail
Fig 5. A genetic screen for dark germination mutants.

Heatmap representation of mutant germination phenotypes on 20 μM PAC, 20 μM PAC, and 1 μM rac-GR24, 2 μM ABA, or in the absence of light. The germination responses were hierarchically clustered using the complete linkage method with Euclidean Distance. The mutants fall into three groups: det1-1 like (Group 1), abi1-1 like (Group 2), and smax1-2 like (Group 3). The photographs show the bleached seedling phenotype of various mutants grown on 2.5 μM CTL-VI. Bolded cells indicate mutants which showed wild-type sensitivity to CTL-VI. smax1-4 is a novel SMAX1 allele. See S5 Table for putative mutant list and values.

https://doi.org/10.1371/journal.pgen.1011447.g005

Using these criteria, we identified three major groupings. Group 1 mutants did not germinate well on either PAC or ABA, indicating they are not perturbed in GA or ABA signaling (Fig 5). Within this group, the light signaling mutants pif1-1 and det1-1, which also germinate in the dark, did not germinate well on PAC or ABA suggesting this group may be enriched for mutants defective in light signaling (Fig 5). Group 2 mutants showed moderate germination in the dark, high germination on ABA, and varying germination on PAC (Fig 5). As expected, this group included abi1-1 and abi4-5 and therefore most likely is enriched for ABA signaling mutants (Fig 5). Finally, Group 3 mutants, which included smax1-2 and aba2-2 seed, generally germinated well in the dark and on PAC in the presence or absence of rac-GR24 but did not germinate on ABA (Figs 5 and S4). Mutants perturbed in KL signaling can be identified using a compound called cotylimide-VI (CTL-VI) [54]. Addition of CTL-VI to germinating Arabidopsis seed bleaches their cotyledons and max2 mutants, which are insensitive to SL or KL signaling are insensitive to this bleaching effect [54]. We, therefore, thought mutants constitutive for KL signaling, like smax1-2, may show increased sensitivity to CTL-VI application versus ABA auxotrophs with respect to cotyledon bleaching. Indeed, CTL-VI preferentially bleaches smax1-2 cotyledons compared to aba2-2 and abi4-5 cotyledons (Figs 5 and S5). Interestingly, five mutants from Group 3 showed a similar bleaching phenotype on CTL-VI to that of smax1-2 and subsequent sequencing for the SMAX1 locus identified a new smax1 allele (smax1-4) carrying a nonsense mutation in codon 118 (CAA→TAA). The smax1-4 allele is predicted to produce the smallest truncated product among all the known SMAX1 alleles [37] and therefore could represent a good null mutant. Importantly, our isolation of a novel allele in SMAX1, smax1-4, indicated that our screening conditions for constitutive dark germinating mutants can identify constitutive AtKAI2 signaling mutants and directly connects the dark germinating phenotype to the AtKAI2 signaling pathway.

Discussion

SMAX1 and SMXL2 inhibits Arabidopsis germination in the dark

Generally, for plants like Arabidopsis, GA signaling is the major germination promotive pathway while the KL pathway appears to only have a minor role. By contrast, fire-following ephemeral weeds and some parasitic plant species have an absolute requirement for HTL/KAI2 for germination and are not responsive to GA [3,7,8,11]. We believe we have reconciled these species differences by showing that Arabidopsis germination like parasitic and ephemeral weeds can also become completely dependent on AtKAI2 signaling under appropriate environmental conditions. Consistent with this, smax1; smxl2 double mutants show efficient germination under dark conditions. Loss of SMAX1 and SMXL2 function by the activation of AtKAI2 produced a similar transcriptional signature as loss of the light-dependent repressor, PIF1. Epistatic analysis suggested that these genes act in a common signaling pathway. On this note, SMAX1 reduces the inhibitory effect of PHYB on PIF4, which indicates that phytochrome requires activated AtKAI2 signaling to repress PIF function in the seedling [55]. Since our genetic epistasis and transcriptome comparisons demonstrated a functional and mechanistic connection between SMAX1 and PIF1, we predict that SMAX1 and SMXL2 are also necessary for PIF1 function in the dark.

The ability of light to inhibit SMAX1 accumulation could explain some of the previous experimental difficulties involving SMAX1 cell biology. Fluorescence is not detected in transgenic Arabidopsis containing SMAX1-GFP fusions even when the F-box MAX2, which is thought to control SMAX1 degradation, is genetically removed [44]. By contrast, under our dark growth conditions, we detected accumulation of eYFP-SMAX1 in planta with the signal diminishing over a few hours in the presence of rac-GR24 or light. The ability of light to inhibit SMAX1 accumulation is similar to a previous study that did not detect SMAX1-GFP in light-grown seedlings unless the SMAX1 degron motif was deleted [44]. However, our results differed from SMAX1 accumulation studies in the hypocotyl, which conclude that light encourages SMAX1 accumulation [55]. Perhaps these results reflect differences in the light regime as well as the tissue and developmental stage used in the studies. In the hypocotyl study, older seedlings were exposed to a short-day light exposure of 8 hours light and 16 hours dark, in contrast to our experiments which were conducted on germinating seeds under constant light or dark. The difference in light exposures could affect the dynamics of SMAX1 accumulation. At different developmental stages, SMAX1 stability could differ in the dark compared to light. Unfortunately, the absence of a KL ligand candidate limits speculation on how light conditions may affect this ligand composition, concentration or sensitivity. However, light and the addition of KARs or rac-GR24 stimulate AtKAI2 transcription, which is consistent with our findings that SMAX1 is degraded in the light during early stages of germination [12,40]. Whatever the case, special consideration regarding the development stage of the plant and light regime should be given when studying SMAX1 stability.

Low nanomolar KAR2 concentrations were sufficient to stimulate high germination rates of AtKAI2OX seed in the dark, which was unexpected given that KAR2 addition to AtKAI2OX seed in the light only partially germinates seeds depleted of GA [40]. There are numerous reports of GA and SL interactions at the level of synthesis; for example, GA addition negatively regulates the levels of SL in rice [56]. As light is known to increase GA synthesis this would suggest SL levels are lower in the light perhaps sensitizing the AtKAI2 signaling pathway to exogenous KL [30]. Of course, because KL is not identified, we are not sure this compound is regulated in a similar manner to SL. More directly, SMAX1 interacts with DELLA domain proteins and this interaction appears to enhance SMAX1 transcription and inhibit expression of a gene involved in GA biosynthesis [38]. These relationships support that DELLA and SMAX1 positively enhance one another. Whatever the case, our genetic studies suggest that the SMAX1-DELLA module act together on Arabidopsis germination under low light conditions [38].

An alternative explanation for light-dependent SL sensitivities could revolve around the role of PIF proteins [57,58]. Although this interaction appears antagonistic in the hypocotyl, the PIF1-DELLA module appears to be positive in the seed. PIF1 activation reduces GA levels, which in principle would encourage DELLA protein stabilization (Fig 6). In this context, PIF1 function also requires SMAX1 and SMXL2, thus inactivation of these proteins through SL signaling increases GA resulting in DELLA protein degradation (Fig 6). Accordingly, seed germination in the dark will be PAC dependent. In the light, all PIF proteins are inactivated by phytochromes, consequently DELLA repressors are inactive (Fig 6). This light-dependent loss of DELLA function removes the requirement of GA for germination thereby making seed germination insensitive to PAC.

thumbnail
Fig 6. A working model on the contributions of SMAX1 and SMXL2 to germination under dark versus light conditions.

Far left panel, in the dark, PIF proteins actively repress light response genes. Under low KL conditions, SMAX1 and SMXL2 activate PIF1 to reduce the GA to ABA ratio discouraging germination. SMAX1 and SMXL2 also could act to directly dampen germination as SMAX1 interacts with the EAR motif repressors, TOPLESS1 (TPL1) and TOPLESS RELATED1, 2, 4 (TPR1, 2, 4) [5962]. Center left panel, increasing KL inhibits SMAX1 and SMXL2 function to both alleviate the repressive effects of these proteins and increase the GA/ABA ratio. Although this allows germination in the dark, inhibition of GA synthesis by addition of the GA synthesis inhibitor, PAC, will decrease the germination response due to the repressive effects of DELLA proteins. Right central panel, in the light, phytochromes inactivate PIF proteins resulting in DELLA protein inactivation. Although seeds no longer require GA to germinate, SMAX1 and SMXL2 proteins still maintain their function to attract TPL and TPR. Also, SMAX1 is thought to inhibit PHYB inactivation of PIF4 in the light. This may be true of other PIF proteins. These events would suggest a weaker germination response in low KL conditions. Far right panel, increased KL levels inhibit SMAX1 and SMXL2 function and this in combination with PIF inactivation of DELLA repressors will lead to a stronger germination response in the presence of PAC.

https://doi.org/10.1371/journal.pgen.1011447.g006

Like all working models there are complexities. For example, differences in light versus dark germination in response to karrikins may also reflect metabolic differences under these environmental conditions. Possibly, KARs are converted to more potent ligands in the dark or perhaps are degraded more effectively in the light. It is important to note that neither the addition of KAR2 nor the overexpression of AtKAI2 was solely sufficient to trigger germination under our dark conditions, which suggests that the expression of AtKAI2 and production of KL are tightly controlled. Whatever the case, our results demonstrated a major role for SMAX1 and SMXL2 signaling in regulating Arabidopsis germination. Moreover, we suggest darkness is an optimal environmental condition to study the roles of AtKAI2 signaling in Arabidopsis germination.

Conservation of the roles of HTL/KAI2 signaling in germination

Our analysis gives some insight into the evolution of germination signaling pathways in ephemeral weeds that are fire followers. Adapting a signaling pathway for a particular process broadly follows scenarios where either the pathway is established for its function by natural selection (historical genesis) or the pathway, which has other functions, is co-opted for new uses (current utility) [63]. Fire-following behaviour is a derived trait, thus our findings in Arabidopsis suggest the role of HTL/KAI2 signaling in these species is the product of historical genesis rather than current utility. Our results suggest in generalist plants like Arabidopsis, SMAX1 and SMXL2 inhibit germination in the absence of light like PIF1. Unlike PIF1, however, which is modulated by a ubiquitous environmental cue, light, SMAX1 and SMXL2 levels depend on light and specific small molecules generated by distinct environmental conditions. Because SMAX1 and SMXL2 function is necessary to repress dark germination, any selective pressures affecting their levels will dominate germination behaviours.

These findings also suggest that smoke-derived karrikins substitute for light in germinating the positive photoblastic lettuce cultivar, L. sativa cv. Grand Rapids, through activation of the KAI2 pathway leading to inactivation of SMAX1 [2022]. Finally, our results emphasized that defining signaling pathways by their ligands and receptors can be confounding when these signals converge on conserved downstream effectors which are also modulated by other signaling pathways. We suggest when looking at fundamental processes such as germination, it is more informative to reference pathways by their bottom effectors like SMAX1, rather than by specific receptors [64].

The genetic space of dark germination

The establishment of simple dark conditions creates an experimentally tractable environment to identify genes involved in the germination process. Furthermore, these conditions can be combined with small molecule compounds that perturb germination to quickly classify mutants into categories for subsequent genetic analysis. Traditionally, mutants are classified through genetic complementation, which is tedious in Arabidopsis. Using a chemical biology approach to classify mutant lines is based on the concept that each chemical represents a unique environmental condition [65]. With enough compounds and two-dimensional hierarchical clustering, in principle, different classes of mutations can be grouped without performing complementation testing. By focusing on compounds that perturb germination and early seedling growth, we showed the utility of using only four compounds to classify dark germination mutants into three categories, one of which included a new SMAX1 allele.

In this study, we limited ourselves to chemical mutagenesis which will mostly enrich for loss-of-function mutations in regulators that impede germination under dark conditions but similar experiments with mis-expression collections would identify positive components [66,67]. In our screen, we identified three classes of mutations. DET1, for example, is known to directly interact with and promote the protein stability of PIF1 and our screen placed loss-of-function mutations in DET1 and PIF1 into one class (Group 1) [68]. Mutations in another key light component, COP1 resulted in low germination rates in the dark but this weak phenotype most likely reflects the leakiness of the cop1-4 allele we used as a reference [69]. Hence, our dark germination screens should enrich for mutants that influence light signaling.

Our screen should also identify new mutations in ABA synthesis and signaling. This may be useful as the identification of mutants in the ABA pathway action often requires screening in the presence of exogenous hormones. Because our dark screen does not require any chemical additions, new alleles may be more relevant to seed physiology. Finally, we expected to identify new negative regulators in AtKAI2 signaling and to this end, we identified a new SMAX1 nonsense allele. Presently, all the current SMAX1 alleles either contain nonsense mutations or T-DNA insertions [37].

Our study presents new evidence that activation of the AtKAI2 signaling pathway can modulate hormone action to germinate in the absence of light. Loss-of-function of the downstream negative regulator, SMAX1, can constitutively germinate in the dark and through cell biology experiments, we show that SMAX1 is stable in the dark. Interestingly, the gene expression profile of activated AtKAI2 signaling reflects that of a light signaling mutant, pif1, and we genetically place PIF1 at or downstream of the AtKAI2 signaling pathway. Lastly, we utilize the dark germinating phenotype of constitutive AtKAI2 signaling mutants to screen for mutants in this pathway and display the advantages of screening during light-limiting conditions. Therefore, we present novel insights into the AtKAI2 signaling pathway with respect to the light signaling pathway.

Materials and methods

Plant material and plant growth

Arabidopsis thaliana Col-0 was the default wild-type (WT) for this study, except for abi1-1 (Ler) [70]. htl-3 (kai2) [71], smax1-2 (SALK_128579) [37], smax1-2/smxl2-1 [37], pif1-1 [26], abi4-5 [72], cop1-4 [72], aba2-2 [73], abi1-1 [70], det1-1 [74], and Arabidopsis kai2 mutant overexpressing Arabidopsis AtKAI2 (35S::AtKAI2) or Striga ShHTL7 (35S::ShHTL7) [8] were described previously. Arabidopsis thaliana plants were grown in a continuous 24-hour light chamber at 22°C. Seeds were harvested and stored in constant conditions (24°C in the dark) for after ripening. All genotypes used in this study are listed below and in S7 Table.

Plasmid construction and plant transformation

The 35S::eYFP cassette was amplified from pGWB542 and cloned into pGREENII-0179 vector using Fast Digest KpnI and ApaI restriction enzymes (ThermoScientific, cat no. FD0524, cat no. FD1414) and primers 35S-YFP_F_KpnI:5’ CGGGGTACCTGAGACTTTTCAACAAAGGGT 3‘ and 35S-YFP_R_ApaI:5’ GCGGGCCCCTTGTACAGCTCGTCCATG 3’. Arabidopsis SMAX1 was amplified from Col-0 cDNA using primers AtSMAX1_F_ApaI: 5’ GCGGGCCCATGAGAGCTGGTTTAAGTACGA 3’ and AtSMAX1_R_HindIII: 5’ CGGAAGCTTTCATACTGCCAAAGTAATAGTTGT 3’ and cloned into pGREENII-0179-eYFP using Fast Digest ApaI and HindIII (Thermofisher, cat no. FD1414, cat no. FD0504), resulting in the pGREENII0179-eYFP-AtSMAX1 construct. All primers used in this study are listed in S6 Table. The construct was transformed into the smax1-2 mutant by Agrobacterium tumefaciens GV3101- mediated floral dip transformation [75].

Double mutant construction

Putative htl-3; pif1 double mutants were identified from F2 offspring of htl-3; ShHTL7OX x pif1 cross by first screening for the pif1 dark germination phenotype. Plants were then screened for the htl-3 round rosette leaves and long hypocotyl phenotype. These lines were also screened on glufosinate ammonium (BASTA) to look for lines that were 100% sensitive on BASTA to ensure that the ShHTL7OX transgene was absent. Potential htl-3; pif1 homozygous lines were confirmed by genotyping of individual plants by PCR for the htl-3 and pif1 allele. Primers used for genotyping are listed in S6 Table. See S6 Fig for workflow and PCR gels confirming htl-3; pif1 double mutants.

Dark germination assays

Seeds for dark germination assays were left to dry for at least six months in a glass tube and closed cardboard storage box at room temperature (24°C) in the laboratory before use in germination assays. Approximately 25 to 35 of unsterilized dry seeds per replicate were sprinkled directly onto 10 mm petri plates in the dark containing water agar (0.8%) and the fungicide benomyl (10 μg/ml) (Toronto Research Chemicals, B161380). Seeds were exposed to low light (~0.1 μmol m-2 s-1) for less than 30 seconds while plating and then plates were wrapped with three layers of aluminum foil. Plates were placed at 4°C for four days and then incubated at 22°C for five days in the dark. Germination was quantified using radicle emergence. Seedling emergence was quantified by counting fully elongated hypocotyls.

For all chemical treatments, rac-GR24 was used which is a racemic mixture of (+)-GR24 and (-)-GR24. A stock solution of rac-GR24, PAC (Cayman Chemical Company, 18864), and ABA (Sigma-Aldrich, A1049-100MG) was diluted in DMSO, 100% ethanol, and 100% methanol, respectively. For dark germination assays on compounds, the fungicide benomyl (10 μg/ml) and the appropriate compound at specific concentrations (3 μM ABA, 20 μM PAC) or the solvent were added to the water agar media (0.8%) at 1/1000 concentration.

Light germination assays

Germination assays on paclobutrazol, cotylimide, and ABA in the light were performed as previously described [40, 54]. Seeds were surfaced sterilized with 70% (v/v) ethanol and gently mixed for five minutes. After the 70% ethanol was removed, 100% ethanol was added, gently mixed for 30 seconds, and then removed. Once dry, approximately 25 to 35 seeds were sprinkled directly onto 10mm petri plates of ½ MS (Murashige-Skoog) agar (0.8%) containing the appropriate compound at specific concentrations or the solvent at 1/1000 concentration. Plates were placed at 4°C for four days and then incubated at 24°C for five days in the light. Germination was quantified using radicle emergence. Seedling emergence was quantified by counting fully elongated hypocotyls.

Far-red germination assays

Approximately 25 to 35 of unsterilized seeds per technical replicate were sprinkled directly onto 10 mm petri plates in the dark containing water agar (0.8%) and the fungicide benomyl (10 μg/ml) (Toronto Research Chemicals, B161380). Plates were wrapped with three layers of aluminum foil and placed at 4°C for four days. Plates were treated with far-red light at ~5 μmol m-2 s-1 for 5 minutes and then wrapped in three layers of aluminum foil and incubated at 22°C for five days in the dark. Germination was quantified using radicle emergence.

Transcript profiling and data analysis

Total RNA from three biological replicates of KAI2OX seeds that germinate in the dark for 24 hours in the presence of 0 μM or 0.5 μM KAR2 was isolated using the mini hot phenol method [76], following the clean-up using RNase-free DNase I and Monarch RNA Cleanup Kit (New England Biolabs) and was used for single-end 1X75bp RNA-Seq on a NextSeq500 sequencing platform (Illumina). After examining the data quality using FastQC (v0.11.5) [77], the fastq data containing the raw reads for each sample was trimmed and filtered using htStream (v1.3.0) (UC, Davis) [78] to generate clean reads. For each read, trimming and filtering processes include removing the last base, removing the low-quality fragments, removing ‘N’s and returning the longest fragments, and discarding reads that are less than 25 bp. Clean reads from each sample were subjected to HISAT2 [79] (v2.1.0) for genome mapping using Arabidopsis thaliana TAIR10 genome as a reference. Samtools (v1.10) [80] was used to remove the unmapped and multi-loci mapped reads and convert the uniquely mapped reads into a BAM file. Transcript assembles for each sample were performed using StringTie (v2.1.3) [81] against Arabidopsis thaliana Araport11 [82] annotation and transcriptome assembles from each sample were merged using the merge function in StringTie to generate a combined transcriptome across all sequencing samples to serve as a new reference transcriptome. A customized Python script, stringtieGeneIdReplace2.py was written to replace the StringTie default ’MSTRG’-tagged gene_id with the TAIR10 gene locus name in order to facilitate the comparisons of genes and transcripts between different samples. A StringTie provided Python script, prepDE.py, was used to extract the read counts matrix from each transcriptome assemble and this counts matrix served as the input data for DESeq2 (v1.18.1) [83], an R [84] package for identifying the differentially expressed genes between various comparisons. The transcriptome data is stored under GEO accession number GSE161704. Python script, stringtieGeneIdReplace2.py can be accessed from https://github.com/maplexuci/stringtie_gene_id_replacement.

Gene expression analysis by quantitative RT-PCR

Seed total RNA from three biological replicates of each treatment was isolated using mini hot phenol method [75], following the clean-up using RNase-free DNase I and Monarch RNA Cleanup Kit (New England Biolabs). One μg of DNA-free total RNA was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs) according to the manual. cDNA product was diluted by 10 times and 1 μL was used in the quantitative RT-PCR reaction. The primers used are listed in S6 Table. Real-time PCR was performed using Luna Universal qPCR Master Mix (New England Biolabs) on a Bio-rad CFX96 Real-time Detection System (Bio-rad). The PCR reaction was performed in triplicate for each biological replication. Expression levels were normalized against the expression of the endogenous control gene, AtACTIN8, and were calculated using 2-ΔΔCt method [85]. All the expression data was presented as fold change value and was transformed into log2 value for statistical analysis.

Confocal microscopy

The floral spray technique was used to construct the smax1-2; 35S::eYFP-SMAX1 line [75]. T1 transgenic lines were selected for resistance on hygromycin and propagated to the T2 generation. Line 1 in the T2 generation was phenotyped for PAC and hygromycin resistance and used for confocal imaging. For imaging of smax1-2; 35S::eYFP-SMAX1, seeds were surfaced sterilized with 70% (v/v) ethanol and gently mixed for five minutes. After the 70% ethanol was removed, 100% ethanol was added, gently mixed for 30 seconds, and then removed. Once dry, seeds were sprinkled directly onto 10mm petri plates of ½ MS (Murashige-Skoog) agar (0.8%) in the dark and then wrapped three times in aluminum foil. Plates were placed at 4°C for four days and then exposed to white light (~40 μmol m-2 s-1) for six hours. Plates were wrapped in three layers of aluminum foil and placed in a room-temperature dark cabinet for 48 hours depending on the light switch experiment and imaged.

Seedlings with specific light treatments were transferred to glass slides with staining solution containing 10μg/ml propidium iodide (PI) and visualized for nuclear localized eYFP fluorescence. The Leica TCS SP5 confocal laser microscope was used, and all images are z-stack projections with 3 μm per step overlayed in ImageJ. All images are imaged with the 40x oil immersion objective lens.

Genetic screen for new smax1 alleles

To generate an M1 EMS population, approximately 20,000 seeds were mutagenized in 0.2% for 16 hours and then washed in distilled water 10 times before sowing onto soil. For the primary screen, approximately 48,000 M2 seeds from 48 pools of EMS mutagenized Col-0 were plated onto water-agar plates. The plates were immediately wrapped in three layers of aluminum foil and stratified for four days at 4°C. After stratification, the plates were incubated in the dark at room temperature for five days. Any dark germinating seedlings were then grown to produce M3 seeds. For the phenotypic screening, M3 seeds were plated onto plates containing minimal ½ MS-agar or ½ MS-agar supplemented with either 20 μM PAC, 20 μM PAC + 1 μM GR24, 2 μM ABA, or 2.5 μM CTL-VI. The plates were stratified for four days at 4°C and then incubated under constant white light (~40 μmol m-2 s-1) at room temperature for seven days. After seven days, seed germination counted by radicle emergence and ABA resistance counted by cotyledon greening was quantified. A heatmap was generated from this data and hierarchically clustered using the Euclidean distance metric in RStudio.

Statistical analysis

One-way ANOVA analysis was performed using SPSS software (IBM) and Tukey HSD method was used for multiple comparison. Descriptive statistics was perfomed using an online tool CalculatorSoup (https://www.calculatorsoup.com/calculators/statistics/descriptivestatistics.php)

Python libraries scipy, pandas and numpy were used in calculating Pearson’s correlation coefficience R2, P-value and 99% confidence interval.

Supporting information

S1 Fig. Activation of the AtKAI2 signaling pathway can germinate seeds in PhyB-off conditions.

(A) Representative images of seeds treated with or without 0.5 μM KAR2 after five minutes of far-red light exposure and placed in a room-temperature dark cabinet. (B) Germination percentages of seeds after a far-red light regime as shown in (A). Germination was counted as radicle emergence. Bar plot represents three biological replicates. Black circles represent the mean of each biological replicate. Bars represent SD.

https://doi.org/10.1371/journal.pgen.1011447.s001

(TIF)

S2 Fig. AtKAI2 is a positive regulator of light germination.

(A) Germination of Arabidopsis seed under different sterilization conditions in the dark. (B) Germination percentages in the dark with or without the fungicide, benomyl. Germination was counted as radicle emergence. Bar plot represents three technical replicates. Closed circles represent the mean of each biological replicate. Bars represent SD. (C) Germination under different lengths of exposure to low light (0.3 μmol m-2 s-1). Sample sizes and box plot elements are provided in S1 Table.

https://doi.org/10.1371/journal.pgen.1011447.s002

(TIF)

S3 Fig. eYFP-SMAX1 overexpression line functionally complements smax1-2.

(A) 35S::eYFP-SMAX1 functionally complements smax1-2 on 20 μM Paclobutrazol (PAC). Germination on 20 μM PAC of wild type, smax1-2 and smax1-2; 35S::eYFP-SMAX1 transgenic line. Average germination was counted for radicle emergence of three technical replicates. Bar = SD. Asterisks indicate a significant difference to wild type (p<0.05, ANOVA one-way with post-hoc Tukey HSD test). (B) Overexpression of eYFP-SMAX1 is resistant on 20 μM hygromycin. Germination on hygromycin of wild type, smax1-2 and smax1-2; 35S::eYFP-SMAX1 transgenic line. Resistance was counted as unwilted cotyledons of three technical replicates. Bars represent SD. Asterisks indicate a significant difference to wild type (p<0.05, ANOVA one-way with post-hoc Tukey HSD test. (C) Overexpression of eYFP-SMAX1 functionally complements smax1-2 hypocotyl length. Hypocotyl length of wild-type, smax1-2, and smax1-2; 35S::eYFP-SMAX1 transgenic line. Seedlings were stratified for four days and then grown under white light for seven days. Hypocotyl length was measured with ImageJ. N = 10–11. Representative seedlings displayed above boxplot in order of x-axis. Bar = 1mm. Asterisks indicate a significant difference to wild type (p<0.05, ANOVA one-way with post-hoc Tukey HSD test). P values, sample sizes and box plot elements are provided in S1 Table.

https://doi.org/10.1371/journal.pgen.1011447.s003

(TIF)

S4 Fig. Abscisic acid (ABA) and paclobutrazol (PAC) treatment inhibits seedling emergence of smax1-2; smxl2-1 seed.

Seedling emergence was quantified as fully elongated hypocotyls. Black circles represent the mean of each biological replicate. Bar = SD. Asterisks indicate a significant difference compared to untreated (mock) smax1-2; smxl2-1 seeds (P < 0.05, one-way ANOVA with post-hoc Tukey honest significant difference test). P values, sample sizes and box plot elements are provided in S1 Table.

https://doi.org/10.1371/journal.pgen.1011447.s004

(TIF)

S5 Fig. Response of dark germination mutants to cotylimide-VI (CTL-VI).

Representative images of dark germination mutants germination with or without 2.5 μM CTL-VI.

https://doi.org/10.1371/journal.pgen.1011447.s005

(TIF)

S6 Fig. Workflow confirming homozygous htl-3; pif1 double mutants.

(A) Schematic illustration of WT and htl-3 allele of AtKAI2 gene, as well as the primers for htl-3 genotyping. (B) Schematic illustration of WT and pif1 T-DNA insertion allele of AtPIF1 gene, as well as the primers for pif1 allele genotyping. (C) Confirmation of htl-3 allele in individual pif1 htl-3 double mutants. (D) Confirmation of pif1 allele in individual pif1; htl-3 double mutants.

https://doi.org/10.1371/journal.pgen.1011447.s006

(TIF)

S1 Table. Supporting Table of statistical values.

https://doi.org/10.1371/journal.pgen.1011447.s007

(XLSX)

S2 Table. Supporting Table of Gene Expression Data in Figs 3A, 3B, and 4B.

https://doi.org/10.1371/journal.pgen.1011447.s008

(XLSX)

S3 Table. Supporting Tables of pif1 and KAI20X + KAR2 Gene Expression Data in Fig 3C.

https://doi.org/10.1371/journal.pgen.1011447.s009

(XLSX)

S4 Table. Supporting Table of pif1 and KAI20X + KAR2 Gene Expression Data in Fig 4A.

https://doi.org/10.1371/journal.pgen.1011447.s010

(XLSX)

S5 Table. Supporting Table of germination percentages of Col-0 mutant screen.

https://doi.org/10.1371/journal.pgen.1011447.s011

(XLSX)

S6 Table. Supporting Table primers used in this study.

https://doi.org/10.1371/journal.pgen.1011447.s012

(XLSX)

S7 Table. Supporting Table of genotypes used in this study.

https://doi.org/10.1371/journal.pgen.1011447.s013

(XLSX)

Acknowledgments

We thank Dr. David Nelson for the gift of smax1-2 and smax1-2; smxl2-1. We acknowledge the contribution of Dr. Peter McCourt for discussion and feedback on our manuscript. We acknowledge resource centers like the Arabidopsis Biological Resource Center (ABRC) for providing Arabidopsis accessions and mutant lines.

References

  1. 1. Donohue K, Rubio De Casas R, Burghardt L, Kovach K, Willis CG. Germination, Postgermination Adaptation, and Species Ecological Ranges. Annu Rev Ecol Evol Syst. 2010;41: 293–319.
  2. 2. Long RL, Stevens JC, Griffiths EM, Adamek M, Gorecki MJ, Powles SB, et al. Seeds of Brassicaceae weeds have an inherent or inducible response to the germination stimulant karrikinolide. Annals of Botany. 2011;108: 933–944. pmid:21821831
  3. 3. Chiwocha SDS, Dixon KW, Flematti GR, Ghisalberti EL, Merritt DJ, Nelson DC, et al. Karrikins: A new family of plant growth regulators in smoke. Plant Science. 2009;177: 252–256.
  4. 4. Lumba S, Holbrook-Smith D, McCourt P. The perception of strigolactones in vascular plants. Nat Chem Biol. 2017;13: 599–606. pmid:28514432
  5. 5. Waters MT, Gutjahr C, Bennett T, Nelson DC. Strigolactone Signaling and Evolution. Annu Rev Plant Biol. 2017;68: 291–322. pmid:28125281
  6. 6. Sun YK, Yao J, Scaffidi A, Melville KT, Davies SF, Bond CS, et al. Divergent receptor proteins confer responses to different karrikins in two ephemeral weeds. Nat Commun. 2020;11: 1264. pmid:32152287
  7. 7. Conn CE, Bythell-Douglas R, Neumann D, Yoshida S, Whittington B, Westwood JH, et al. Convergent evolution of strigolactone perception enabled host detection in parasitic plants. Science. 2015;349: 540–543. pmid:26228149
  8. 8. Toh S, Holbrook-Smith D, Stogios PJ, Onopriyenko O, Lumba S, Tsuchiya Y, et al. Structure-function analysis identifies highly sensitive strigolactone receptors in Striga. Science. 2015;350: 203–207. pmid:26450211
  9. 9. Conn CE, Nelson DC. Evidence that KARRIKIN-INSENSITIVE2 (KAI2) Receptors may Perceive an Unknown Signal that is not Karrikin or Strigolactone. Front Plant Sci. 2016;6. pmid:26779242
  10. 10. Flematti GR, Scaffidi A, Waters MT, Smith SM. Stereospecificity in strigolactone biosynthesis and perception. Planta. 2016;243: 1361–1373. pmid:27105887
  11. 11. Nelson DC, Riseborough J-A, Flematti GR, Stevens J, Ghisalberti EL, Dixon KW, et al. Karrikins Discovered in Smoke Trigger Arabidopsis Seed Germination by a Mechanism Requiring Gibberellic Acid Synthesis and Light. Plant Physiology. 2009;149: 863–873. pmid:19074625
  12. 12. Waters MT, Nelson DC, Scaffidi A, Flematti GR, Sun YK, Dixon KW, et al. Specialisation within the DWARF14 protein family confers distinct responses to karrikins and strigolactones in Arabidopsis. Development. 2012;139: 1285–1295. pmid:22357928
  13. 13. Sun X-D, Ni M. HYPOSENSITIVE TO LIGHT, an Alpha/Beta Fold Protein, Acts Downstream of ELONGATED HYPOCOTYL 5 to Regulate Seedling De-Etiolation. Molecular Plant. 2011;4: 116–126. pmid:20864454
  14. 14. Baskin CC, Baskin JM. Seeds: Ecology, Biogeography, And, Evolution of Dormancy and Germination. Elsevier; 2001.
  15. 15. Soltani E, Baskin CC, Gonzalez-Andujar JL. An Overview of Environmental Cues That Affect Germination of Nondormant Seeds. Seeds. 2022;1: 146–151.
  16. 16. Huq E, Lin C, Quail PH. Light signaling in plants—a selective history. Plant Physiology. 2024;195: 213–231. pmid:38431282
  17. 17. Evenari M, Evenari M. The germination of lettuce seeds. I. Light, temperature and coumarin as germination favtors. Palest J Bot (J),. 1952; 138–60. blbl. 24.
  18. 18. Footitt S, Douterelo-Soler I, Clay H, Finch-Savage WE. Dormancy cycling in Arabidopsis seeds is controlled by seasonally distinct hormone-signaling pathways. Proceedings of the National Academy of Sciences. 2011;108: 20236–20241. pmid:22128331
  19. 19. Finch-Savage WE, Footitt S. To germinate or not to germinate: a question of dormancy relief not germination stimulation. Seed Science Research. 2012;22: 243–248.
  20. 20. Drewes FE, Smith MT, van Staden J. The effect of a plant-derived smoke extract on the germination of light-sensitive lettuce seed. Plant Growth Regul. 1995;16: 205–209.
  21. 21. Jäger AK, Light ME, Van Staden J. Effects of source of plant material and temperature on the production of smoke extracts that promote germination of light-sensitive lettuce seeds. Environmental and Experimental Botany. 1996;36: 421–429.
  22. 22. Bączek-Kwinta R. An Interplay of Light and Smoke Compounds in Photoblastic Seeds. Plants. 2022;11: 1773. pmid:35807725
  23. 23. Martinez SE, Conn CE, Guercio AM, Sepulveda C, Fiscus CJ, Koenig D, et al. A KARRIKIN INSENSITIVE2 paralog in lettuce mediates highly sensitive germination responses to karrikinolide. Plant Physiol. 2022;190: 1440–1456. pmid:35809069
  24. 24. Reed JW, Nagatani A, Elich TD, Fagan M, Chory J. Phytochrome A and Phytochrome B Have Overlapping but Distinct Functions in Arabidopsis Development. Plant Physiol. 1994;104: 1139–1149. pmid:12232154
  25. 25. Shinomura T, Nagatani A, Chory J, Furuya M. The Induction of Seed Germination in Arabidopsis thaliana Is Regulated Principally by Phytochrome B and Secondarily by Phytochrome A. Plant Physiol. 1994;104: 363–371. pmid:12232088
  26. 26. Oh E, Kim J, Park E, Kim J-I, Kang C, Choi G. PIL5, a Phytochrome-Interacting Basic Helix-Loop-Helix Protein, Is a Key Negative Regulator of Seed Germination in Arabidopsis thaliana [W]. The Plant Cell. 2004;16: 3045–3058. pmid:15486102
  27. 27. Oh E, Yamaguchi S, Kamiya Y, Bae G, Chung W-I, Choi G. Light activates the degradation of PIL5 protein to promote seed germination through gibberellin in Arabidopsis. Plant J. 2006;47: 124–139. pmid:16740147
  28. 28. Leivar P, Quail PH. PIFs: pivotal components in a cellular signaling hub. Trends Plant Sci. 2011;16: 19–28. pmid:20833098
  29. 29. Oh E, Kang H, Yamaguchi S, Park J, Lee D, Kamiya Y, et al. Genome-Wide Analysis of Genes Targeted by PHYTOCHROME INTERACTING FACTOR 3-LIKE5 during Seed Germination in Arabidopsis. The Plant Cell. 2009;21: 403–419. pmid:19244139
  30. 30. De Wit M, Galvão VC, Fankhauser C. Light-Mediated Hormonal Regulation of Plant Growth and Development. Annu Rev Plant Biol. 2016;67: 513–537. pmid:26905653
  31. 31. Kim DH, Yamaguchi S, Lim S, Oh E, Park J, Hanada A, et al. SOMNUS, a CCCH-Type Zinc Finger Protein in Arabidopsis, Negatively Regulates Light-Dependent Seed Germination Downstream of PIL5. The Plant Cell. 2008;20: 1260–1277. pmid:18487351
  32. 32. Gabriele S, Rizza A, Martone J, Circelli P, Costantino P, Vittorioso P. The Dof protein DAG1 mediates PIL5 activity on seed germination by negatively regulating GA biosynthetic gene AtGA3ox1. Plant J. 2010;61: 312–323. pmid:19874540
  33. 33. Née G, Xiang Y, Soppe WJ. The release of dormancy, a wake-up call for seeds to germinate. Current Opinion in Plant Biology. 2017;35: 8–14. pmid:27710774
  34. 34. Shen H, Zhu L, Bu Q-Y, Huq E. MAX2 affects multiple hormones to promote photomorphogenesis. Mol Plant. 2012;5: 750–762. pmid:22466576
  35. 35. Lee I, Kim K, Lee S, Lee S, Hwang E, Shin K, et al. A missense allele of KARRIKIN-INSENSITIVE2 impairs ligand-binding and downstream signaling in Arabidopsis thaliana. J Exp Bot. 2018;69: 3609–3623. pmid:29722815
  36. 36. Nelson DC, Flematti GR, Riseborough J-A, Ghisalberti EL, Dixon KW, Smith SM. Karrikins enhance light responses during germination and seedling development in Arabidopsis thaliana. Proc Natl Acad Sci USA. 2010;107: 7095–7100. pmid:20351290
  37. 37. Stanga JP, Smith SM, Briggs WR, Nelson DC. SUPPRESSOR OF MORE AXILLARY GROWTH2 1 Controls Seed Germination and Seedling Development in Arabidopsis. Plant Physiol. 2013;163: 318–330. pmid:23893171
  38. 38. Xu P, Hu J, Chen H, Cai W. SMAX1 interacts with DELLA protein to inhibit seed germination under weak light conditions via gibberellin biosynthesis in Arabidopsis. Cell Reports. 2023;42: 112740. pmid:37405917
  39. 39. Kim JY, Park Y-J, Lee J-H, Park C-M. SMAX1 Integrates Karrikin and Light Signals into GA-Mediated Hypocotyl Growth during Seedling Establishment. Plant And Cell Physiology. 2022;63: 932–943. pmid:35477800
  40. 40. Bunsick M, Toh S, Wong C, Xu Z, Ly G, McErlean CSP, et al. SMAX1-dependent seed germination bypasses GA signalling in Arabidopsis and Striga. Nat Plants. 2020;6: 646–652. pmid:32451447
  41. 41. Hayes RG, Klein WH. Spectral quality influence of light during development of Arabidopsis thaliana plants in regulating seed germination. Plant and Cell Physiology. 1974;15: 643–653.
  42. 42. Stanga JP, Morffy N, Nelson DC. Functional redundancy in the control of seedling growth by the karrikin signaling pathway. Planta. 2016;243: 1397–1406. pmid:26754282
  43. 43. Wei C-Q, Chien C-W, Ai L-F, Zhao J, Zhang Z, Li KH, et al. The Arabidopsis B-box protein BZS1/BBX20 interacts with HY5 and mediates strigolactone regulation of photomorphogenesis. Journal of Genetics and Genomics. 2016;43: 555–563. pmid:27523280
  44. 44. Khosla A, Morffy N, Li Q, Faure L, Chang SH, Yao J, et al. Structure–Function Analysis of SMAX1 Reveals Domains That Mediate Its Karrikin-Induced Proteolysis and Interaction with the Receptor KAI2. Plant Cell. 2020;32: 2639–2659. pmid:32434855
  45. 45. Wang L, Xu Q, Yu H, Ma H, Li X, Yang J, et al. Strigolactone and Karrikin Signaling Pathways Elicit Ubiquitination and Proteolysis of SMXL2 to Regulate Hypocotyl Elongation in Arabidopsis. Plant Cell. 2020;32: 2251–2270. pmid:32358074
  46. 46. Zheng J, Hong K, Zeng L, Wang L, Kang S, Qu M, et al. Karrikin Signaling Acts Parallel to and Additively with Strigolactone Signaling to Regulate Rice Mesocotyl Elongation in Darkness. Plant Cell. 2020;32: 2780–2805. pmid:32665307
  47. 47. Ma L, Li J, Qu L, Hager J, Chen Z, Zhao H, et al. Light Control of Arabidopsis Development Entails Coordinated Regulation of Genome Expression and Cellular Pathways. Plant Cell. 2001;13: 2589–2607. pmid:11752374
  48. 48. Huq E, Al-Sady B, Hudson M, Kim C, Apel K, Quail PH. PHYTOCHROME-INTERACTING FACTOR 1 Is a Critical bHLH Regulator of Chlorophyll Biosynthesis. Science. 2004;305: 1937–1941. pmid:15448264
  49. 49. Hornitschek P, Lorrain S, Zoete V, Michielin O, Fankhauser C. Inhibition of the shade avoidance response by formation of non-DNA binding bHLH heterodimers. EMBO J. 2009;28: 3893–3902. pmid:19851283
  50. 50. Shi H, Zhong S, Mo X, Liu N, Nezames CD, Deng XW. HFR1 Sequesters PIF1 to Govern the Transcriptional Network Underlying Light-Initiated Seed Germination in Arabidopsis. The Plant Cell. 2013;25: 3770–3784. pmid:24179122
  51. 51. Zhu L, Xin R, Bu Q, Shen H, Dang J, Huq E. A Negative Feedback Loop between PHYTOCHROME INTERACTING FACTORs and HECATE Proteins Fine-Tunes Photomorphogenesis in Arabidopsis. Plant Cell. 2016;28: 855–874. pmid:27073231
  52. 52. Liu X, Hou X. Antagonistic Regulation of ABA and GA in Metabolism and Signaling Pathways. Front Plant Sci. 2018;9: 251. pmid:29535756
  53. 53. Piskurewicz U, Jikumaru Y, Kinoshita N, Nambara E, Kamiya Y, Lopez-Molina L. The Gibberellic Acid Signaling Repressor RGL2 Inhibits Arabidopsis Seed Germination by Stimulating Abscisic Acid Synthesis and ABI5 Activity. The Plant Cell. 2008;20: 2729–2745. pmid:18941053
  54. 54. Tsuchiya Y, Vidaurre D, Toh S, Hanada A, Nambara E, Kamiya Y, et al. A small-molecule screen identifies new functions for the plant hormone strigolactone. Nat Chem Biol. 2010;6: 741–749. pmid:20818397
  55. 55. Park Y-J, Kim JY, Park C-M. SMAX1 potentiates phytochrome B-mediated hypocotyl thermomorphogenesis. The Plant Cell. 2022;34: 2671–2687. pmid:35478037
  56. 56. Ito S, Yamagami D, Umehara M, Hanada A, Yoshida S, Sasaki Y, et al. Regulation of Strigolactone Biosynthesis by Gibberellin Signaling. Plant Physiol. 2017;174: 1250–1259. pmid:28404726
  57. 57. De Lucas M, Davière J-M, Rodríguez-Falcón M, Pontin M, Iglesias-Pedraz JM, Lorrain S, et al. A molecular framework for light and gibberellin control of cell elongation. Nature. 2008;451: 480–484. pmid:18216857
  58. 58. Feng S, Martinez C, Gusmaroli G, Wang Y, Zhou J, Wang F, et al. Coordinated regulation of Arabidopsis thaliana development by light and gibberellins. Nature. 2008;451: 475–479. pmid:18216856
  59. 59. Jiang L, Liu X, Xiong G, Liu H, Chen F, Wang L, et al. DWARF 53 acts as a repressor of strigolactone signalling in rice. Nature. 2013;504: 401–405. pmid:24336200
  60. 60. Soundappan I, Bennett T, Morffy N, Liang Y, Stanga JP, Abbas A, et al. SMAX1-LIKE/D53 Family Members Enable Distinct MAX2-Dependent Responses to Strigolactones and Karrikins in Arabidopsis. The Plant Cell. 2015;27: 3143. pmid:26546447
  61. 61. Wang L, Wang B, Jiang L, Liu X, Li X, Lu Z, et al. Strigolactone Signaling in Arabidopsis Regulates Shoot Development by Targeting D53-Like SMXL Repressor Proteins for Ubiquitination and Degradation. The Plant Cell. 2015;27: 3128–3142. pmid:26546446
  62. 62. Ma H, Duan J, Ke J, He Y, Gu X, Xu T-H, et al. A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex. Sci Adv. 2017;3: e1601217. pmid:28630893
  63. 63. Gould SJ, Vrba ES. Exaptation—a Missing Term in the Science of Form. Paleobiology. 1982;8: 4–15.
  64. 64. Bunsick M, McCullough R, McCourt P, Lumba S. Plant hormone signaling: Is upside down right side up? Current Opinion in Plant Biology. 2021;63: 102070. pmid:34166978
  65. 65. Cutler S, McCourt P. Dude, Where’s My Phenotype? Dealing with Redundancy in Signaling Networks. Plant Physiology. 2005;138: 558–559. pmid:15955914
  66. 66. Weigel D, Ahn JH, Blázquez MA, Borevitz JO, Christensen SK, Fankhauser C, et al. Activation Tagging in Arabidopsis. Plant Physiology. 2000;122: 1003–1014. pmid:10759496
  67. 67. Ichikawa T, Nakazawa M, Kawashima M, Iizumi H, Kuroda H, Kondou Y, et al. The FOX hunting system: an alternative gain-of-function gene hunting technique. The Plant Journal. 2006;48: 974–985. pmid:17227551
  68. 68. Shi H, Wang X, Mo X, Tang C, Zhong S, Deng XW. Arabidopsis DET1 degrades HFR1 but stabilizes PIF1 to precisely regulate seed germination. Proc Natl Acad Sci USA. 2015;112: 3817–3822. pmid:25775589
  69. 69. McNellis TW, Von Arnim AG, Araki T, Komeda Y, Misera S, Deng X-W. Genetic and Molecular Analysis of an Allelic Series of cop1 Mutants Suggests Functional Roles for the Multiple Protein Domains. The Plant Cell. 1994;6: 487. pmid:8205001
  70. 70. Koornneef M, Hanhart CJ, Hilhorst HWM, Karssen CM. In Vivo Inhibition of Seed Development and Reserve Protein Accumulation in Recombinants of Abscisic Acid Biosynthesis and Responsiveness Mutants in Arabidopsis thaliana. Plant Physiol. 1989;90: 463–469. pmid:16666794
  71. 71. Toh S, Holbrook-Smith D, Stokes ME, Tsuchiya Y, McCourt P. Detection of Parasitic Plant Suicide Germination Compounds Using a High-Throughput Arabidopsis HTL/KAI2 Strigolactone Perception System. Chemistry & Biology. 2014;21: 1253. pmid:25126711
  72. 72. Nambara E, Suzuki M, Abrams S, McCarty DR, Kamiya Y, McCourt P. A Screen for Genes That Function in Abscisic Acid Signaling in Arabidopsis thaliana. Genetics. 2002;161: 1247–1255. pmid:12136027
  73. 73. Nambara E, Kawaide H, Kamiya Y, Naito S. Characterization of an Arabidopsis thaliana mutant that has a defect in ABA accumulation: ABA-dependent and ABA-independent accumulation of free amino acids during dehydration. Plant Cell Physiol. 1998;39: 853–858. pmid:9787459
  74. 74. Chory J, Peto C, Feinbaum R, Pratt L, Ausubel F. Arabidopsis thaliana mutant that develops as a light-grown plant in the absence of light. Cell. 1989;58: 991–999. pmid:2776216
  75. 75. Harrison SJ, Mott EK, Parsley K, Aspinall S, Gray JC, Cottage A. A rapid and robust method of identifying transformed Arabidopsis thaliana seedlings following floral dip transformation. Plant Methods. 2006;2: 19. pmid:17087829
  76. 76. Suzuki Y, Kawazu T, Koyama H. RNA Isolation from Siliques, Dry Seeds, and other Tissues of Arabidopsis Thaliana. BioTechniques. 2004;37: 542–544. pmid:15517963
  77. 77. Babraham Bioinformatics—FastQC A Quality Control tool for High Throughput Sequence Data. [cited 22 Jun 2024]. Available: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
  78. 78. s4hts/HTStream. Software (for) High Throughput Sequencing; 2024. Available: https://github.com/s4hts/HTStream
  79. 79. Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37: 907–915. pmid:31375807
  80. 80. Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, et al. Twelve years of SAMtools and BCFtools. GigaScience. 2021;10: giab008. pmid:33590861
  81. 81. Pertea M, Pertea GM, Antonescu CM, Chang T-C, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33: 290–295. pmid:25690850
  82. 82. Cheng C-Y, Krishnakumar V, Chan A, Schobel S, Town CD. Araport11: a complete reannotation of the Arabidopsis thaliana reference genome. 2016.
  83. 83. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biology. 2014;15: 550. pmid:25516281
  84. 84. R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2023. Available: https://www.R-project.org/
  85. 85. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25: 402–408. pmid:11846609