Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Hypopituitarism in Sox3 null mutants correlates with altered NG2-glia in the median eminence and is influenced by aspirin and gut microbiota

Abstract

The median eminence (ME), located at the base of the hypothalamus, is an essential centre of information exchange between the brain and the pituitary. We and others previously showed that mutations and duplications affecting the transcription factor SOX3/Sox3 result in hypopituitarism, and this is likely of hypothalamic origin. We demonstrate here that the absence of Sox3 predominantly affects the ME with phenotypes that first occur in juvenile animals, despite the embryonic onset of SOX3 expression. In the pituitary, reduction in hormone levels correlates with a lack of endocrine cell maturation. In parallel, ME NG2-glia renewal and oligodendrocytic differentiation potential are affected. We further show that low-dose aspirin treatment, which is known to affect NG2-glia, or changes in gut microbiota, rescue both proliferative defects and hypopituitarism in Sox3 mutants. Our study highlights a central role of NG2-glia for ME function during a transitional period of post-natal development and indicates their sensitivity to extrinsic signals.

Author summary

The hypothalamus, a complex structure in the ventral-medial brain, has many critical functions, including controlling the secretion of hormones from the pituitary gland. In turn, these hormones regulate many important physiological functions, such as growth, stress responses and reproduction, and insufficient levels result in significant morbidity and even mortality if untreated. The hypothalamus is linked to the pituitary via the median eminence (ME), where information is exchanged. Previously, we, and others, have highlighted the importance of SOX3/Sox3 for the hypothalamo-pituitary axis, because mutations in this gene result in a reduction of all pituitary hormones, or hypopituitarism, in both humans and mice. Here we demonstrate that loss of Sox3 in mice affects specialised supporting cells of the ME called NG2-glia and that this only occurs only after weaning. The defects correlate with abnormal development of the hormone-secreting cells of the pituitary and the onset of hypopituitarism. We also show that external factors such as aspirin or changes in gut microbiota can rescue both the hypopituitarism in Sox3 mutants and renewal of the ME NG2-glia. In conclusion, our data suggest a critical role for NG2 glia in the ME for the maturation of hormone producing cells in the pituitary and that these NG2 glia are sensitive to the loss of Sox3 and to extrinsic factors. This argues that aspirin, altering gut microbiota, or perhaps just dietary modulation may be of benefit in treating certain cases of hypopituitarism.

Citation: Galichet C, Rizzoti K, Lovell-Badge R (2024) Hypopituitarism in Sox3 null mutants correlates with altered NG2-glia in the median eminence and is influenced by aspirin and gut microbiota. PLoS Genet 20(9): e1011395. https://doi.org/10.1371/journal.pgen.1011395

Editor: Bruce A. Hamilton, University of California San Diego, UNITED STATES OF AMERICA

Received: January 15, 2024; Accepted: August 13, 2024; Published: September 26, 2024

Copyright: © 2024 Galichet et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: Gut microbiota datasets are publicly available at the Sequence Read Archive (SRA) of the National Library of Medicine (PRJNA1113545). All other relevant data are within the manuscript and its Supporting information files.

Funding: This work was supported by the Medical Research Council, U.K. (U117512772 for CG, KR and RLB, U117562207 for CG, KR and RLB and U117570590 for CG, KR and RLB) and by the Francis Crick Institute which receives its core funding from Cancer Research UK (CC2116 for CG, KR and RLB), the UK Medical Research Council (CC2116 for CG, KR and RLB), and the Wellcome Trust (CC2116 for CG, KR and RLB). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The hypothalamus is a crucial regulator of homeostasis and energy balance in vertebrates. It centralizes information from other regions of the brain and from the periphery, while an important part of its function is to regulate the secretion of pituitary hormones. These control essential functions, including post-natal growth, puberty, pregnancy, fertility, lactation, stress and energy homeostasis. Consequently, pituitary hormone deficiencies (hypopituitarism) are associated with significant morbidity.

The murine pituitary gland, which is located under the hypothalamus, has three compartments: the anterior pituitary lobe (AL), containing five different endocrine cell types, the intermediate (IL) with one (melanotrophs), and the posterior pituitary, composed of glial cells and hypothalamic axonal termini. The hypothalamus connects to the pituitary via the pituitary stalk, which itself contains neuronal, glial, and vascular components.

AL endocrine cells are regulated by neurohormones secreted by different hypothalamic neurons into a bed of fenestrated capillaries located at the base of the third ventricle, in a structure called the median eminence (ME). These neurohormones are delivered to the anterior pituitary by the hypophyseal portal system. Conversely, for the posterior pituitary, neurohormones (oxytocin and vasopressin) are released directly from hypothalamic axons that reach the gland itself [1]. The ME, which is located outside the blood-brain barrier [2], and the pituitary stalk are crucial components of the hypothalamo-pituitary axis, as flow of information in and out of the hypothalamus is respectively collected and conveyed through these structures. In addition to the blood vessels, several cell types, including glial cells and microglia, are found in the ME (for review see [2,3]). NG2-glia, or oligodendrocyte precursor cells (OPCs), are present in ME [4–6]. They are the most proliferative cells within the central nervous system (CNS) and their canonical function is to generate oligodendrocytes, although rarely astrocytes and neurons in some contexts. However, they also fulfil other roles, such as interacting with and modulating the function of neighbouring neurons, astrocytes or microglia (for review see [7]). Within the ME, NG2-glia have been shown to generate oligodendrocytes [5,6], some of which are in close contact with the dendrites of leptin receptor expressing neurons. The relevance of these interactions is revealed by ablation of ME NG2-glia which results in the degeneration of these dendrites, leading to increased body weight [4]. Furthermore, refeeding after an overnight fast induces a rapid proliferation and differentiation of ME NG2-glia [6], demonstrating that nutrition influences, and is influenced by, ME NG2-glia. Another category of glial cells, the tanycytes, of which there are several types [8], are flanking the base of the third ventricle. Because the ME is located outside the blood-brain barrier, tanycytes are exposed to both the systemic circulation and the cerebro-spinal fluid [9]. They regulate neurohormone secretion from hypothalamic axon terminals [10–12] and modulate the release of blood-borne peripheral information to the hypothalamus ([13] and for review see [14]). Furthermore, they comprise a population of hypothalamic stem cells (SCs) (for review see [2,15]). Similarly to other CNS stem cell populations, tanycytes express the HMG-box transcription factor SOX2 [16–20], required for maintenance of several different adult stem cell populations (for review see [21]). In embryonic neural progenitors, SOX2 is often co-expressed with the two other SOXB1 members, SOX1 and SOX3 [22]. Upon cell differentiation, either in embryonic or adult contexts, expression of Soxb1 genes, tends to be downregulated [23]. There are exceptions, however. For example, SOX2 and SOX3 are maintained in spinal cord oligodendrocyte precursors, where they are required for their subsequent differentiation [24].

In both humans and mice, mutations in SOX3/Sox3, which is located on the X chromosome, are associated with hypopituitarism (for review see [25]). In mice, we showed that SOX3 is largely absent from the pituitary, but it is found in the developing and mature hypothalamus, being particularly highly expressed in the embryonic infundibulum and later maintained in the ME ([26] and this study). Here, we aimed to characterise the role of SOX3 in the hypothalamus and the etiology of the hypopituitarism. Using conditional gene deletion, we show that loss of Sox3 in the central nervous system (CNS) is sufficient to cause hypopituitarism and that this develops postnatally, at the time of weaning. Consequently, we observe in the pituitary a defective maturation of endocrine cells. SOX3 is expressed in hypothalamic stem cells and its deletion affects their proliferation in vivo and in hypothalamic neurosphere assays. SOX3 is also expressed in NG2-glia in the ME, and both their proliferation and differentiation are reduced in Sox3 mutants. Furthermore, we observe a striking deficiency in myelination of axons in the ME. Importantly, the appearance of all these defects correlates with development of hypopituitarism suggesting that SOX3 is required postnatally for the functional maturation of the ME. Building on previous work demonstrating the efficacy of aspirin in inducing proliferation and/or differentiation of NG2-glia [27,28], we treated Sox3 mutants with low dose aspirin. We observed a restoration of NG2-glia proliferation, and a rescue of pituitary hormonal deficiencies, but not a rescue of myelination. We also found that changes in the gut microbiome ameliorate the hypopituitarism. Our study highlights a novel role for NG2-glia in the post-weaning formation of a functional ME and its control of pituitary maturation, and that an otherwise robust phenotype due to loss of Sox3 in these cells can be modified by non-genetic factors.

Results

1. SOX3 is required in the hypothalamus for post-natal pituitary endocrine cell maturation

SOX3 is widely expressed in the developing CNS [22], but it is also retained within some brain regions postnatally, notably the hypothalamus [26], where its expression is found in tanycytic neural stem cells (NSCs) and several differentiated cell types [29]. In contrast, we only observed SOX3 in rare cells within the pituitary representing a very small subset of lactotrophs (S1A Fig). Therefore, the hypopituitarism displayed by Sox3 mutants is likely to be of hypothalamic origin.

To test this hypothesis, we used Nestin-Cre [30] and Pou1f1-Cre [31] to delete Sox3 in the CNS and the pituitary respectively. Pituitary hormonal contents were then measured by radio immunoassay (RIA) in two-month-old males (Fig 1A). While Nestin-Cre animals display a modest but significant reduction in growth hormone (GH) levels, as we previously reported [32], we observed a significant reduction of GH contents in Nestin-Cre; Sox3floxGFP/Y mice compared to both Nestin-Cre and Sox3floxGFP/Y controls. This 75% reduction in Nestin-Cre; Sox3floxGFP/Y mice is comparable to that measured in Sox3-/Y mutant males (Fig 1A, [26]). In contrast, in Pou1f1-Cre; Sox3floxGFP/Y mice, neither GH (Fig 1A) nor Prolactin (PRL) (S1B Fig) contents are affected. These data are therefore in agreement with a CNS origin of the hypopituitarism displayed by Sox3-/Y animals. To avoid undesirable effects originating from the Nestin-Cre transgene, we pursued our subsequent analyses on Sox3-/Y animals.

thumbnail
Download:
Fig 1. The hypopituitarism in Sox3-/Y has a hypothalamic origin and develops after weaning, concomitantly with defective pituitary endocrine cell maturation.

(A) GH contents of 2-month Sox3floxGFP/Y, Nestin-Cre, Nestin-Cre; Sox3floxGFP/Y, Sox3-/Y and Pit1-Cre; Sox3floxGFP/Y pituitaries. Reduction in GH contents only appears when SOX3 is removed from the CNS. (B) GH contents of Sox3+/Y and Sox3-/Y at different post-natal weeks. Reduction in GH contents in Sox3-/Y animals appears post-weaning. (C) In situ hybridization for Ghrh (upper panels) and somatostatin (Sst, lower panels) on 2-month Sox3+/Y and Sox3-/Y hypothalami. Scale bar: 100μm. (D) Sox3+/Y and Sox3-/Y anterior pituitary sizes at different post-natal weeks. Insets show 2-month Sox3+/Y and Sox3-/Y H&E-stained sections where the anterior pituitary is outlined. Sox3-/Y anterior pituitaries are smaller post-weaning. Scale bar: 200μm. (E) Sox3+/Y and Sox3-/Y anterior pituitary cell densities. Insets represent 2-month Sox3+/Y and Sox3-/Y H&E-stained anterior pituitaries. Sox3-/Y anterior pituitary cell densities remain constant while these decrease in Sox3+/Y post-weaning. Scale bar: 15μm. (F) Sox3+/Y and Sox3-/Y TSH+ve cell volumes at 1 week (white columns) and 2 months (grey columns). Insets show 1-week and 9-month Sox3+/Y and Sox3-/Y pituitaries immunolabelled for TSH. TSH+ve cell volumes increase with age in Sox3+/Y but remain constant in Sox3-/Y mice. (G) Transmission electron microscopy images of 2-week and 6-month Sox3+/Y and Sox3-/Y anterior pituitaries. The bar chart shows the number of secretory granules in Sox3+/Y and Sox3-/Y pituitaries at 2 weeks (white columns) and 6 months (grey columns). Note that fewer secretory granules are present in 6-month Sox3-/Y anterior pituitaries. Scale bar: 2μm. *: p<0.05; **: p<0.01; ***: p<0.001.

https://doi.org/10.1371/journal.pgen.1011395.g001

We then measured GH contents at different time points after birth to determine when deficits appear in Sox3-/Y males (Fig 1B). After birth, GH levels rise normally in mutants compared to Sox3+/Y animals, but decline sharply shortly after weaning, down to 25% of the levels observed in Sox3+/Y animals at two months of age. Similar post-weaning deficiencies were measured for PRL, thyroid-stimulating hormone (TSH) and luteinizing hormone (LH) (S1C Fig; [26]) and similar results were obtained when analysing Gh and Prl gene expression (S1D Fig). Because the growth spurt observed in juveniles is known to be regulated by changes in growth hormone releasing hormone (GHRH) pulsatility [33], this result is again in accord with a hypothalamic origin of the phenotype in Sox3-/Y animals.

We did not observe any obvious morphological defect in the hypothalami in Sox3-/Y adult males [26]. We thus examined in more detail the arcuate and paraventricular nuclei, both involved in GH secretion control, by performing in situ hybridisation using Ghrh and somatostatin (Sst) mRNA probes (Fig 1C). Their expression patterns are similar in Sox3+/Y and Sox3-/Y animals, again indicating that cell specification and patterning within the hypothalamus are unaffected.

To understand which aspect of hypothalamic function is affected in mutants, we examined the consequences of Sox3 loss on the pituitary. In parallel with the appearance of the hormonal deficiencies, we observed that the growth of the anterior lobe slows down significantly in Sox3-/Y compared to Sox3+/Y mice after weaning (Fig 1D). Furthermore, while the cellular density in Sox3+/Y animals sharply decreases between 4 and 5 weeks of age, it remains constant in Sox3-/Y (Fig 1E). This suggests that endocrine cells, whose secretory capacities usually increase dramatically postnatally [34], remain small in Sox3 mutants. To confirm this hypothesis, we measured the volume of TSH secreting cells. We chose these because they represent a small population, about 5% of AL cells [35], and because they are individualized, which thus make them suitable for cell volume measurement. In Sox3+/Y animals, TSH positive cells double their volume from one-week old to adulthood. In contrast, in Sox3 mutants, their volume does not significantly increase during the same period (Fig 1F). This suggests that hormonal secretory capacity/maturation is affected in mutants. We directly examined this aspect by performing transmission electron microscopy (TEM) and observed a striking reduction in the number of secretory granules in cells of Sox3-/Y ALs (Fig 1G), implying impaired endocrine cell terminal differentiation. Altogether these data show that the hypopituitarism displayed by Sox3-/Y mice is of hypothalamic origin. The consequence, at the pituitary level, is an impairment of endocrine cell maturation, which becomes apparent after weaning and results in the production of insufficient levels of hormones.

2. Hypothalamic progenitor maintenance in vitro relies on SOX3

To determine the origin of the hypothalamic defect, we analysed SOX3 expression in more detail (Fig 2A). SOX3 is expressed in cells lining the third ventricle and in scattered cells in the surrounding parenchyma. In the latter, it is present in some neurons (NeuN, Figs 2B and S2A), as previously shown [29], and in a few astrocytes (GFAP, Figs 2C and S2A) and NG2-glia (PDGFRa, Figs 2E–2F and S2A). SOX3 is also present in Nestin+ve tanycytes (Fig 2D). Beside these 3 cell types, it is likely that SOX3 is alos expressed in neuroblasts and during oligodendrocyte differentiation, as shown in the spinal cord [24]. Within the ME, SOX3 is found in NG2-glia (PDGFRa, Fig 2E; NG2, S2B Fig), but not in MAG+ve oligodendrocytes (S2C Fig).

thumbnail
Download:
Fig 2. SOX3 is expressed in hypothalamic SCs and NG2-glia, and it is required for hypothalamic neurosphere maintenance.

(A- F) Fluorescent immunolabelling for SOX3 alone (A) or together with NeuN (Neurons—B), GFAP (astrocytes—C), Nestin (Tanycyctes—D) or PDGFRa (NG2-glia—E-F) in 2 month-old hypothalami. Arrows point to double positive cells. Scale bar: 100μm (A), 10μm (C, F), 20μm (B, D, E). (G) In situ hybridization for Rax and fluorescent immunolabelling for Nestin on 2-month Sox3+/Y and Sox3-/Y hypothalami. Scale bar: 100μm. (H) Sox3+/Y (i, iii, vi) and Sox3-/Y (ii, iv, vii) hypothalamic derived neurospheres at primary (i,ii) or quintenary (vi,vii) passage. Scale bar: 200μm (primary) and 400μm (quintenary). Insets show neurospheres immunolabelled for SOX3 (Sox3+/Y spheres—iii) or GFP (Sox3-/Y spheres—iv). Scale bar: 50μm. (I) Total number of cells after each passage of hypothalamic derived (red lines) or SEZ derived (blue lines) neural stem cells from Sox3+/Y (light colour) or Sox3-/Y (dark colour) mice. Sox3-/Y hypothalamic derived neurospheres cannot be maintained in culture. (J) Percentage of mitotic cells in progenitor monolayer culture. Insets represent mitotic cells immunolabelled with phospho-Histone 3. Scale bar: 50 μm. There is a proliferation defect in Sox3-/Y progenitors. (K) Percentage of Sox3+/ΔGFP neurospheres containing mostly SOX3+ve cells (white columns) or mostly GFP+ve cells (grey columns) derived from SEZ or hypothalami. Sox3+/ΔGFP hypothalamic neurospheres are not maintained in culture. *: p<0.05.

https://doi.org/10.1371/journal.pgen.1011395.g002

Because SOX3 is expressed in hypothalamic tancyte NSCs, and SOXB1 proteins are known to be required for NSC emergence and maintenance (for review see [21]), we first performed in situ hybridization for the tanycyte marker Rax [36]. Rax expression pattern between Sox3-/Yand Sox3+/Yanimals is similar, albeit possibly slightly reduced in Sox3-/Y hypothalmi, suggesting that deletion of Sox3 does not affect tanycyte emergence (Fig 2G). We then investigated neurosphere forming ability of hypothalamic progenitors from 6-week-old animals [37] (Fig 2H). We generated Sox3+/Y hypothalamic neurospheres which maintain expression of SOX3 (Fig 2Hiii), as previously shown for embryonic ones [38]. Neurospheres from Sox3-/Y hypothalamic progenitors were formed and these express GFP, the open reading frame of which replaces that of Sox3 (Fig 2Hiv) and not SOX3 (S3A–S3B Fig) [26]. There was initially no difference in the number of plated cells and of primary neurospheres formed between Sox3+/Y and Sox3-/Y animals. However, by the third passage, the total number of cells and size of Sox3-/Y spheres had declined sharply (Fig 2H–2I–red lines). In subsequent passages, most Sox3-/Y cells adhere and very few neurospheres are formed, with none arising by the 9th passage. We then analysed cell proliferation and apoptosis on adherent NSC cultures of dissociated neurospheres [39]. There were significantly fewer phospho-histone H3+ve mitotic cells in Sox3-/Y samples (Fig 2J) while no increase in cell apoptosis was observed by TUNEL assay (S4A Fig). In contrast, formation and maintenance of neurospheres from the sub-ependymal zone (SEZ) of the lateral ventricles, a well characterised adult neurogenic niche [40], which also express SOX3 [41], is normal in adult Sox3-/Y animals (Fig 2I–blue lines). Furthermore, hypothalamic neurospheres made from Sox3-/Y mice before the hypopituitarism appears can also be propagated and proliferate normally (S5A and S5B Fig). We analysed the differentiation potential of pre and post-weaning hypothalamic NSCs in vitro (S6A and S6B Fig). As previous shown [19,38], we observed differentiation into the three CNS lineages, βIII-tubulin+ve neurons, GFAP+ve astrocytes and CNPase+ve oligodendrocytes in Sox3+/Y and Sox3-/Y animals. Therefore, SOX3 is necessary for self-renewal, but not differentiation in vitro, in hypothalamic neurospheres and this requirement correlates in time with the onset of hypopituitarism in mutant animals.

We next performed neurosphere assays using Sox3+/ΔGFP females (Fig 2K). Due to the location of Sox3 on the X-chromosome and to random X chromosome inactivation, cells from these mice that normally transcribe Sox3 should express either SOX3 or GFP in roughly equal proportions. This was seen in neurospheres derived from the SEZ of the lateral ventricles of two-month- or ten-day old Sox3+/ΔGFP animals and in spheres derived from the hypothalamus of ten-day old Sox3+/ΔGFP pups cultured in non-clonal conditions (Figs 2K and S5C). In contrast, neurospheres from the hypothalamus of two-month-old Sox3+/ΔGFP animals, show a significant reduction in the contribution of GFP+ve, SOX3-ve cells, compared to SOX3+ve, GFP-ve cells (Fig 2K). This mosaic analysis confirms and expands our previous analyses, showing that SOX3 is required cell-autonomously for hypothalamic tanycyte NSC self-renewal in vitro, again, in an age-dependent manner.

3. SOX3 is required in the ME for cell renewal

We then examined cell proliferation in vivo by performing BrdU incorporation experiments. In Sox3+/Y adult hypothalami, we observed BrdU+ve cells within the ME and the parenchyma (Fig 3B), as previously shown (for review see [14,42]). In both Sox3+/Y and Sox3-/Y adult hypothalami, BrdU+ve cells are mostly located within the body of the ME rather than in ventricle lining cells (Fig 3B). We observed fewer BrdU+ve cells in Sox3-/Y versus Sox3+/Y animals (Fig 3B–3C), predominantly affecting the ME where a 40% reduction in BrdU incorporation/ME surface area is observed in Sox3-/Y (Fig 3D). ME is also significantly smaller in mutants (Fig 3D). Because we did not observe any increase in the number of apoptotic cells in Sox3-/Y mutants compared to Sox3+/Y mice (S4B Fig), the smaller size of the ME is likely explained by its reduced proliferative capacity. In contrast, BrdU incorporation in the dentate gyrus, another well studied neurogenic niche [40], of 2-month-old Sox3-/Y is similar to that of Sox3+/Y (Fig 3C). There was also no difference in the number of BrdU+ve cells in 1-week-old hypothalami between Sox3+/Y and Sox3-/Y littermates, i.e. before the hypopituitarism appears in the latter (S5D Fig).

thumbnail
Download:
Fig 3. Cell renewal in ME is reduced in absence of SOX3.

(A) BrdU administration paradigm. Created with BioRender.com (B) Fluorescent immunolabelling for BrdU on 2-month Sox3+/Y and Sox3-/Y hypothalami. Insets show ME only. Fewer BrdU+ve cells are present in the Sox3-/Y median eminences. Scale bar: 50 μm. (C) Number of BrdU+ve cells in Sox3+/Y (white columns) and Sox3-/Y (grey columns) median eminences, hypothalamic parenchyma, tanycytes (α and β) and dentate gyri. Fewer BrdU+ve cells are seen in Sox3-/Y median eminences. (D) Median eminence area and BrdU density in Sox3+/Y (white columns) and Sox3-/Y (grey columns) hypothalami. ME are smaller in Sox3-/Y mice. (E) Percentage of BrdU+ve, PDGFRa+ve NG2-glia in Sox3+/Y (white columns) and Sox3-/Y (grey columns) median eminences. (F) Fluorescent immunolabelling for BrdU together with SOX2, SOX3, SOX E, OLIG2 or PDGFRa on 2-month Sox3+/Y hypothalami. Scale bar: 50 μm. Insets and arrows point to double-positive cells. Scale bar: 10 μm (G) Percentage of BrdU+ve cells expressing either SOX3, SOX2, SOX E, OLIG2, or PDGFRa, in 2-month Sox3+/Y (white columns) and Sox3-/Y (grey columns) hypothalami. No difference in the identity of BrdU+ve cells between Sox3+/Y and Sox3-/Y animals is observed. NS: not significant; *: p<0.05.

https://doi.org/10.1371/journal.pgen.1011395.g003

Immunochemistry was used to determine the identity of the proliferating cells in the ME. In Sox3+/Y animals, the vast majority of BrdU+ve cells express SOX3, SOX2 and one or more of the SOXE proteins SOX8, SOX9 and SOX10 (80, 75 and 82% of BrdU+ve cells respectively, Fig 3F–3G). These cells also express NG2-glia markers, such as PDGFRa and OLIG2 (65 and 80% of BrdU+ve cells respectively Fig 3F–3G), in agreement with studies showing that NG2-glia are the most proliferative cell type in the ME [4,43]. In Sox3-/Y mutants, the remaining BrdU+ve cells also represent NG2-glia (Fig 3G), although their proliferation is significantly affected in the ME (Fig 3E).

In summary, SOX3 is required for cell renewal within the ME. Within this structure, NG2-glia proliferation is particularly sensitive to Sox3 deletion. Moreover, in agreement with an impairment of neurosphere maintenance (Fig 2), proliferation of tanycytes is also affected in mutants (Fig 3C). The reduction in ME cell renewal correlates with the onset of hypopituitarism in Sox3-/Y mutants.

4. SOX3 supports ME oligodendrocyte differentiation

Because NG2-glia represent the ME cell population mostly affected by Sox3 deletion, we next characterised their differentiation potential in mutants by performing lineage tracing in Pdgfra-CreERT2; Rosa26ReYFP animals. In six-week-old Sox3+/Ymice, the majority of eYFP+ve cells detected four weeks after tamoxifen induction are PDGFRa and OLIG2 positive NG2-glia, both in the hypothalamic parenchyma and ME (Fig 4B–4C). In the latter, 20% of the eYFP+ve cells have become MAG+ve mature oligodendrocytes. In contrast, in Sox3-/Y, we observed a significant reduction in the percentage of MAG+ve oligodendrocytes in the progeny of PDGFRa+ve precursors compared to Sox3+/Y animals, while there is an increase in the proportion of eYFP; PDGFRa-double positive cells in ME (Fig 4B–4C). These results suggests that ME PDGFRa+ve progenitors are unable to differentiate into oligodendrocytes in the absence of SOX3. We thus examined these cells in the ME. We found both fewer PDGFRa+ve progenitors and mature MAG+ve oligodendrocytes in 2-month-old Sox3-/Y ME compared to Sox3+/Y ME (Fig 4D). The reduction in PDGFRa+ve cell numbers is in agreement with a reduction in proliferation (Fig 3C), while the decrease in MAG+ve oligodendrocytes fits with an impaired differentiation capacity. We also noticed an increase in cells expressing APC, which is not expressed by NG2-glia, but is a marker of both differentiating and differentiated oligodendrocytes [5]. This indicates that immature oligodendrocytes accumulate in the mutant ME, reflecting a role for SOX3 post weaning in both early and late stages of this lineage (Fig 4D). To confirm the latter, we analysed myelination by transmission electron microscopy (TEM) (Fig 4E). Myelinated axons are clearly visible in Sox3+/Y hypothalamic parenchyma and ME, and in the parenchyma of Sox3-/Y mutants, however we could not observe any in the mutant ME, in agreement with defective oligodendrocytic differentiation. Because most ME myelinated axons are those of oxytocin and vasopressin (AVP) neurons travelling to the posterior pituitary [44], we analysed potential consequences of defects affecting these. We did not observe any obvious difference in posterior pituitary volume or in the hypothalamic expression of Avp in Sox3-/Y males (S7A and S7B Fig). AVP deficiency can result in cranial diabetes insipidus, which is characterised by an increase in water consumption and urine volume, which is hypotonic [45]. We did not find any difference in urine osmalarity between Sox3+/Y and Sox3-/Y animals (S7C Fig) suggesting that the AVP axis is not affected in Sox3-/Y mice. Collectively, this data suggests that the reduced number of NG2-glia and/or the lack of myelination underlies the reduction in pituitary hormone levels in Sox3-/Y mice.

thumbnail
Download:
Fig 4. SOX3 loss results in impaired oligodendrocyte differentiation and myelination in ME.

(A) Injection paradigm and oligodendrogenesis markers used. Created with BioRender.com (B) Fluorescent Immunolabelling for eYFP and PDGFRa (top panels), MAG (bottom panels) on Pdgfra-CreERT2; Rosa26ReYFP/+; Sox3+/Y or Pdgfra-CreERT2; Rosa26ReYFP/+; Sox3-/Y hypothalami. Left panels show the ME and the right ones hypothalamic parenchyma. Arrows point to double-positive cells. Scale bar: 50 μm. (C) Percentage of recombinant cells expressing OLIG2, PDGFRa or MAG in ME and parenchyma in Pdgfra-CreERT2; Rosa26ReYFP/+; Sox3+/Y (white columns) and Pdgfra-CreERT2; Rosa26ReYFP/+;Sox3-/Y (grey columns) hypothalami. Fewer PDGFRa+ve progenitors differentiate into MAG positive cells in Sox3-/Y MEs. (D) Percentage of cells expressing PDGFRa, APC (left Y axis) or MAG (right Y axis) in Sox3+/Y (white columns) and Sox3-/Y (grey columns) MEs. There are fewer PDGFRa and MAG present in Sox3-/Y MEs. (E) Transmission electron microscopy images of 2-month Sox3+/Y or Sox3-/Y MEs (left panels) and hypothalamic parenchymas (right panels). Arrows point to myelinated axons in Sox3+/Y ME samples. These are absent in Sox3 mutant MEs. Scale bars: 2μm for ME and 1μm for Parenchyma. *: p<0.05; **: p<0.01; ***: p<0.001.

https://doi.org/10.1371/journal.pgen.1011395.g004

5. Aspirin treatment rescues hypothalamic and pituitary defects in Sox3 mutants

Two reports have suggested that aspirin can specifically affect NG2-glia [27,28]. In one, both proliferation and differentiation of NG2-glia were induced by low dose aspirin administration in vitro and in vivo following an ischemic injury in rats [28], while the second suggests that differentiation was exclusively enhanced in neonates following treatment [27]. We therefore decided to examine the effects of a low dose aspirin treatment (12mg/day/kg for 21 days) in 2-month old Sox3-/Y animals. We first examined BrdU incorporation within ME and observed a significant rescue of the proliferation defect, with the number of BrdU+ve cells/section being now similar between Sox3+/Y and aspirin treated Sox3-/Y animals (Fig 5A–5C). We then examined the composition of the ME with respect to the oligodendrocyte lineage. We observed a significant increase of PDGFRa+ve cells, and a decrease of APC+ve cells in aspirin treated compared to untreated Sox3-/Y mice (Fig 5B–5D). However, we did not observe any significant increase in MAG+ve cells or myelination of axons in the ME with aspirin treatment (Figs 5D and S8A). Finally, we examined pituitary GH (Fig 5E) and ACTH (S8B Fig) levels and observed a clear and significant rescue of the deficiencies in aspirin treated Sox3-/Y mice. These data show that aspirin is able to restore proliferation of NG2-glia and pituitary function, but that the latter does not depend on differentiation to mature oligodendrocytes or myelination of axons.

thumbnail
Download:
Fig 5. Sox3-/Y NG2 proliferation defect and GH deficiencies are rescued by low dose aspirin treatment.

(A-B) Fluorescent immunolebelling for BrdU on 2-month hypothalami of Sox3-/Y mice receiving placebo pellets (top panel) or low dose aspirin pellets (bottom panel) (A) or for OLIG2, PDGFRa and MAG of Sox3+/Y, Sox3-/Y or Sox3-/Y receiving low dose aspirin (B). Scale bar: 50 μm for A and 20 μm for B. (C) Number of BrdU+ve cells in the median eminence or dentate gryus of Sox3+/Y (white columns), Sox3-/Y (dark grey columns), Sox3-/Y with low dose aspirin (light grey columns) or Sox3+/Y with low dose aspirin (black columns) mice. The number of BrdU+ve cells is rescued in Sox3-/Y mice treated with low dose aspirin. (D) Composition of the median eminence in regard to the oligodendrocyte lineage using OLIG2, PDGFRa, APC and MAG of Sox3+/Y (white columns), Sox3-/Y (grey columns), Sox3-/Y with low dose aspirin (black columns) mice. (E) GH contents in 2-month Sox3+/Y, Sox3+/Y with low dose aspirin, Sox3-/Y with low dose aspirin, Sox3-/Y with placebo and Sox3-/Y pituitaries. GH contents are rescued in Sox3-/Y mice receiving low dose aspirin. *: p<0.05, **: p<0.01, ***: p<0.001.

https://doi.org/10.1371/journal.pgen.1011395.g005

6. Pituitary function in Sox3 mutants is sensitive to composition of gut microbiota

Following our relocation and the rederivation by embryo transfer of our animals to the Francis Crick institute (Crick) from the National Institute for Medical Research (NIMR), the hypopituitarism was no longer seen in rederived Sox3-/Y mice (Fig 6D), while the cranio-facial defects [46] were still present. There were several differences between the new mouse facility and the previous one, ranging from water to cage system, but notably these included the adoption of a free-from animal protein and fish meal diet (Labdiet 5021 and Envigo 2018S at NIMR and Crick respectively—S9A Fig). Because an increasing number of studies have highlighted the relationship between diet and gut microbiome and, in turn, gut microbiome and hypothalamic functions (for review see [47–49]), we compared the gut microbiota of mice hosted in our previous and current institutions. We analysed 4 animals for each group and found substantial differences in gut microbiota composition (Figs 6A, 6B and S9B). We noticed that Bacteroidetes were more abundant at NIMR, while Firmicutes were prominent at the Crick (Fig 6A and 6C). At the species level and using Shannon index which evaluates both abundance and richness of species, we found that the alpha diversity was reduced at the Crick compared to NIMR (Fig 6D). To test whether changes in gut microbiota underlie rescue of hormonal deficiencies, we performed faecal transplant (FT) from NIMR animals into Crick animals, while maintaining the mice on Crick diet (Envigo 2018S). Transplants were successful, with FT mice displaying phylum abundance, log F/B ratio and Shannon index similar to that of NIMR mice (Fig 6A–6D). Notably this was accompanied by reappearance of the hypopituitarism, with Gh expression being reduced in Sox3-/Y FT animals compared to Sox3+/Y FT animals (Fig 6E). We then analysed the oligodendrocyte lineage, particularly in the ME, of NIMR, Crick and FT Sox3+/Y and Sox3-/Y animals. The reduction in the number of PDGFRa+ve NG2-glia, MAG+ve mature oligodendrocytes and concomitant increase of APC+ve cells observed in NIMR Sox3-/Y mice (Figs 5B–5D and 6F–6G) was confirmed in FT Sox3-/Y ME but absent in Crick Sox3-/Y ME (Fig 6E–6F). Altogether, these data indicate that changes of gut microbiota affect oligodendrocyte lineage composition in ME, and occurrence of hypopituitarism in Sox3-/Y mutants.

thumbnail
Download:
Fig 6. Sox3-/Y NG2-glia ME composition and GH deficiencies is affected by changes of gut microbiota.

(A) Graphical representation of the process the fecal transplant was performed. Created with BioRender.com (B) Abundance of different bacteria phylum in gut microbiota of mice housed at NIMR, Crick or faecal transplanted (FT). (C) PCA analysis of gut microbiota of samples from Crick (circle), NIMR (square) and FT (triangle). (D) Log Ratio of Firmicutes/Bacteroidetes (F/B) of mice housed at NIMR, Crick or FT. (E) Shannon index of species of mice housed at NIMR, Crick or FT. (F) Expression of Gh (ddCt) in 2-month NIMR, Crick and FT Sox3+/Y (white column) and Sox3-/Y (grey columns) pituitaries. (G) Composition of the median eminence in regard to the oligodendrocyte lineage using PDGFRa, APC and MAG of NIMR, Crick and FT Sox3+/Y (white columns) and Sox3-/Y (grey columns) mice. (H) Fluorescent immunolabelling for APC and PDGFRa on 2-month NIMR, Crick and FT Sox3+/Y and Sox3-/Y hypothalami. *: p<0.05; **: p<0.01; ***: p<0.001.

https://doi.org/10.1371/journal.pgen.1011395.g006

In conclusion, because NG2-glia in the ME are the cells mostly affected by Sox3 loss and their proliferation, but not differentiation to oligodendrocytes, is corrected by either low-dose Aspirin treatment or by a ‘Crick-typical’ profile of gut microbiota, we propose that sufficient numbers of NG2-glia are required in the ME to support pituitary cell maturation as the animal becomes independent at weaning.

Discussion

Congenital pituitary hormone deficiencies, found with a frequency of about 1/4000 [50], can significantly affect quality of life. However, relatively few genes have been identified as being causative, with most of these having critical roles in prenatal pituitary development [50–52]. Moreover, ways to treat patients are limited to replacement of missing hormones, but in way that does not mimic their normal physiological release by the pituitary. Mutations affecting SOX3 are associated with panhypopituitarism in mice and humans [25,26], however the etiology of this was unknown. Here, our results suggest that the phenotype has a hypothalamic origin, because conditional deletion of the gene using Nestin-Cre is sufficient to reproduce the hypopituitarism characterising the null phenotype. Nestin-cre is expressed in some locations outside the nervous system, such as by cells in the kidney and heart [53], but these have not been reported to be sites of Sox3 expression, and while both Nestin and Sox3 are expressed quite broadly in the nervous system, the crucial regulatory role of the hypothalamus on the pituitary makes it highly likely that it is defects in this region that underlie the hypopituitarism phenotype. Moreover, adding weight to this premise, we found that the onset of defects in the ME correlate with the failure of endocrine cell maturation in the pituitary after weaning, and this in turn explains why they can only make low levels of hormones.

The ME is a crucial structure conveying information from and to the brain, but how and when it becomes functional and controls pituitary output is not well characterized [54–58]. We find that SOX3 is required for self-renewal of both hypothalamic NSCs, which are part of the tanycyte population lining the third ventricle including the ME, and NG2-glia within the ME. SOX3 is also required for the differentiation of the latter to mature oligodendrocytes, however in two conditions where the panhypopituitarism is rescued, via the effects of aspirin or altered gut microbiota, although cell proliferation returns to normal, there is still a failure of oligodendrocyte differentiation suggesting that myelination of axons is not essential for ME function. Given that the hypothalamic NSCs generate very few neurons, if any, post-puberty (for review see [59]), it would seem most likely that the pituitary phenotype is due to insufficient numbers of glia. Indeed, our data point to the NG2-glia themselves as having a critical role in inducing or allowing pituitary endocrine cell maturation. It follows that there must be processes that occur around weaning in the ME, perhaps involving an increase in levels and/or alteration in patterns of hormone releasing factors secreted into the hypophyseal portal system, which are indispensable for maturation of the juvenile pituitary.

Weaning is a crucial transition period when the suckling pup becomes independent [60] and this is accompanied by both behavioural and physiological changes [61]. The sensitivity of this stage is highlighted by mutations in genes affecting appetite control, another crucial function of the hypothalamus [62], such as in Neurogenin3 [63] and U11 spliceosomal RNA (Rnu11) [64], or affecting the maturation of endocrine cells in the pancreas [65]. It would of interest to ask if altering the time of weaning of Sox3-/Y mice has any influence on the onset of pituitary hormone deficiencies.

SOX3 in hypothalamic neural stem cells

We show that tanycytes, a proportion of which are hypothalamic neural stem cells, divide less frequently in Sox3-/Y mice compared to Sox3+/Y animals. This is also reflected in neurosphere cultures derived from the hypothalamus, where those from Sox3-/Y mice post-weaning fail to be maintained for more than a few passages in contrast to cultures initiated at earlier stages or from other neurogenic niches at any stage. This is similar to the effects of the loss of Sox2 in the adult dentate gyrus [66]. We showed that lineage commitment is not affected in differentiated Sox3-/Y hypothalamic neurospheres, consistent with a previous report indicating that over-expression of SOX3 does not promote neurogenesis in embryonic telencephalic NSC culture [67]. This is in contrast with SOX1 and SOX2, the other members of the SOXB1 family, which have essential roles in neuronal differentiation [66,68].

SOX3 is present in all adult NSC niches ([41] and this study), however, its loss exclusively affects hypothalamic stem/progenitor cells post puberty. In the embryonic brain, SOX3 is expressed at its highest levels in the infundibulum which will give rise to the ME. Although the related factor SOX2, with which it is known to show functional redundancy, is expressed throughout the neuroepithelium, the absence of SOX3 does have consequences at this stage with respect to induction of the pituitary and its morphological development [26]. It seems likely that the hypothalamic stem cells, in which SOX2 is also expressed, are similarly more sensitive to the loss of SOX3.

Sox3 and ME NG2-glia

NG2-glia are the most clearly affected cell type in the Sox3-/Y ME, with both their proliferation and differentiation being disrupted, which suggests that deficits in this population are responsible for the hypopituitarism. We cannot exclude an additional role for tanycytes, whose maintenance is also affected in Sox3 mutants, however, hypothalamic stem cells do not normally give rise to NG2-glia in adult mice [69]; it is therefore unlikely that the reduction in the number of ME NG2-glia in Sox3 mutants is secondary to the proliferation defect of the stem cells. Tancytes are directly involved in regulating Gonadotropin hormone-releasing hormone and Thyrotropin-releasing hormone release into the blood stream at the ME level ([70,71] and for review: [8]) and it is possible that SOX3 plays a role in this, as well as in their self-renewal as we reveal by proliferation and neurosphere assays. However, unless other neurohormones are similarly affected this would not explain the pan-hypopituitarism we see in Sox3 mutants, moreover, the phenotype and its rescue correlate with alterations in NG2 glia. SOX3 function in ME NG2-glia could relate to its role in the spinal cord where it is required for their differentiation [24]. ME NG2-glia proliferate faster than their parenchymal counterparts [5], perhaps because they are exposed to systemic blood circulation. This higher cell-turnover suggests that modest defects affecting this population may be more pronounced in the ME explaining why the defects seen in Sox3-/Y mice are restricted to this domain.

Alternatively, rather than just being precursors of oligodendrocytes, NG2-glia have other roles that involve crosstalk with neurons, astrocytes and microglia (for review, see [7]), all of which are found within the ME [6]. Indeed, a direct role for NG2-glia in the ME for neuronal function has already been indicated, whereby their ablation is associated with obesity attributed to degeneration of the dendritic processes of arcuate nucleus leptin receptor neurons [4]. While we do not yet know if NG2-glia are required for pituitary hypophysiotropic neuron integrity, it is worth noting that hypopituitarism occurs in both humans and rats after cranial irradiation [72,73] where NG2-glia may be the most sensitive cell type given their high rate of proliferation compared to other cell types in the brain.

Aspirin restores pituitary function in Sox3 mutants

A further indication that the hypopituitarism seen in the Sox3 mutants is likely due to a deficiency of NG2-glia comes from the restoration of both pituitary function and proliferation of NG2-glia with low dose aspirin, while differentiation into mature oligodendrocytes is still impaired. The canonical mode of action of low dose aspirin involves the suppression of cyclooxygenase (COX) 1 activities [74]. COX1 is expressed in microglia [75] and tanycytes [76] and its inhibition in these could affect NG2-glia. However, it was shown recently that targeted ablation of microglia led to a decrease in NG2-glia, differentiating and mature oligodendrocytes in the ME [5] and indicated a relationship between microglia and myelin turnover. Detailed analyses would be needed to determine whether inhibition of COX1 activities in microglia by aspirin is responsible for the restoration of NG2-glia proliferation in Sox3 mutants or if COX-independent mechanisms are also relevant [77]. In contrast, low dose aspirin increases differentiation rather than proliferation of cultured NG2-glia by inhibiting Wnt signalling [27], but the situation may be different in vivo, where the effects of aspirin might also be mediated by other cells within or outside the ME. COX signalling is active in tanycytes. Furthermore, inhibition of the pathway at the ME has been proposed to impair the ovarian cycle through its effect on tanycytes [76]. Therefore, we cannot exclude a tanycytic component of the beneficial effect that low-dose aspirin has on Sox3-/Y hypopituitarism. However, dissecting the relative contribution of tanycytes, NG2-glia and microglia to the phenotype will require new methods that avoid the use of tamoxifen, or of other agents that can themselves affect pituitary function.

Gut microbiota and hypopituitarism in Sox3 mutant mice

We found that changes in microbiome composition can alter both the NG2-glia phenotype and development of hypopituitarism in Sox3 mutants. Communication between the gut microbiota and the brain could be via chemical compounds released into the blood stream, neuronal signalling, or by cells of the immune system [78]. For example, changes on the gut microbiome affect circulating levels of the promyelinating factor IGF1, which in turn affects cortical myelin basic protein but not NG2 expression [79,80]. Moreover, it is now thought that an intact gut microbiota is necessary for a proper response from the hypothalamo-pituitary-adrenal axis. Indeed, germ-free mice, which have a minimal gut microbiota, display an exacerbated response to early life stress [81]. It may be noteworthy that gut microbiome composition changes drastically during early postnatal life, and only stabilises after weaning, which is when the absence of SOX3 becomes relevant [82]. Understanding how a post-weaning stabilised microbiota of a particular composition could rescue both NG2-glia in the ME and pituitary deficiencies will be important especially if this can be shown to be relevant in humans.

In this respect, a ‘weaning reaction’ to microbiota has been described, and while this was associated with development of the immune system and protection against immunopathologies [83], gut bacterial cell wall components, muropeptides, can also be sensed directly via Nod1 and Nod2 receptors on cells in the brain, including the hypothalamus [84]. It is worth noting that the predominant phylum of gut microbiota at NIMR were Gram negative Bacteroidetes, which possess a unique diaminopimelate-containing GlcNAc-MurNAc tripeptide muropeptide (GM-TriDAP) sensed by NOD1, while the most abundant phyla at the Crick are Gram-positive Firmicutes carrying the GlcNAc-MurNAc dipeptide (GM-Di), which can be sensed by both NOD1 and NOD2 [85–87]. It will be important to determine which cells in the ME are expressing NOD1 and NOD2, especially post-weaning, and how these may respond to the different muropeptides. This might provide an explanation for the sensitivity of the Sox3 pituitary phenotype to gut microbiota. To confirm the contribution of the microbiome to the Sox3 null phenotype, experiments would have to be performed in more rigorous settings in which mice under germ-free conditions would be faecal transplanted with either NIMR or Crick materials. While we have not formally tested the effect of the different diets on the microbiome, GH-deficient FT mice and their progeny have been kept on the Crick diet suggesting that the phenotypic effect is primarily due to microbiome differences. Furthermore, certain bacteria within the gut microbiota could trigger inflammation throughout the body (for review [88]). Further experiments need to be undertaken to determine the level of inflammation in the different settings and whether the beneficial effect of aspirin is due to its anti-inflammatory action.

Conclusions

The data presented here strongly suggest that NG2-glia in the ME, and the presence of SOX3 in these, are crucial to forming a functional hypothalamo-pituitary axis post-weaning. Moreover, while hypopituitarism seen in both mice and humans lacking SOX3 can be a robust phenotype, we find that it can be modified by external influences, namely by low dose aspirin or gut microbiota. Consequently, because of the potential link between reduced NG2-glia after irradiation and hypopituitarism, it is of interest to explore whether low dose aspirin treatment and/or changes in microbiota composition could have rescuing effects in this context too.

Materials and methods

Ethics statement

All experiments carried out on mice were reviewed by the NIMR and Crick Animal Welfare and Ethical Review Committees and approved under the UK Animal (scientific procedures) Act (approved Project licence 80/2405, 70/8560 and PP8826065).

Mice

Mice carrying the Sox3-conditional allele (Sox3floxGFP/Y–MGI:5550577) and Sox3 null allele, where the Sox3 open reading frame is replaced by that of gfp, (Sox3ΔGFP/Y referred as Sox3-/Y–MGI: 3036671) [26], and alleles for Pou1f1-Cre [31], Nestin-Cre (MGI: 2176222) [30], Pdgfra-CreERT2 (MGI: 3832569) [89], Rosa26ReYFP (MGI: 2449038) [90] are maintained on MF1 background (random bred, NIMR:MF1 or HsdOla:MF1 for Crick and FT Sox3-/Y) and genotyped as described or by Transnetyx. Mice had access to food and water ad libitum with diet 5021 (Labdiet) at NIMR and diet 2018S (Envigo) at the Crick.

Radioimmunoassay

Pituitaries were homogenized in phosphate-buffered saline and anterior pituitary hormonal contents measured by radioimmunoassay (RIA) [91] using National Hormone and Pituitary Program reagents kindly provided by A.L. Parlow.

Neurosphere forming assay and monolayer culture

Hypothalamus and sub-ependymal zone (SEZ) of the lateral ventricles were dissected and cultivated in proliferation medium as described previously [37,92]. Neurospheres were passaged using TrypLE express (Invitrogen). For monolayer culture, coverslips were coated with reduced growth factor matrigel (BD biosciences) and cells were plated at 2.104cells/ml.

Substance administration, sample processing and histology

BrdU (Sigma) and Tamoxifen (Sigma) were administered intraperitoneally at 100μg/g and 0.2mg/g body weight respectively twice daily for BrdU, and daily for Tamoxifen for 5 consecutive days. Aspirin pellets (12mg/day/kg for 21 days, 7.5mg per pellet—Innovative Research of America) were administered subcutaneously. Adult animals were perfused intracardially with chilled 4% paraformaldehyde, brains were embedded in 2.5% agarose and free-floating sections obtained using a vibratome (Leica). Neurospheres or cell monolayers were fixed with chilled 4% paraformaldehyde for 20 minutes on ice. For histology, samples were fixed in Bouin’s solution, processed for wax embedding, sectioned, and stained with haematoxylin and eosin. For osmolality measurement, urine was collected in ependorf tubes and osmolality was measured with a vapour pressure osmometer.

Immunofluorescence, in situ hybridisation, TUNEL assay and qPCR experiments

Immunofluorescence was performed on 50μm free-floating sections, neurospheres or cell monolayers plated on coverslips. Samples were incubated in blocking solution (PBS, 10% donkey serum, 0.1% Triton X-100) and primary antibodies were incubated overnight at 4°C (Table 1). Detection was performed using a 1:500 dilution of anti-rabbit, anti-mouse or anti-goat secondary antibodies conjugated to Alexa-488, Alexa-555, Alexa-594 or Alexa-647 (Molecular probes). DNA was labelled using DAPI and sections were mounted in Aquapolymount (polysciences). RNA in situ hybridization on free-floating sections was performed as previously described [93] using Rax [94], Ghrh, somatostatin and arginine vasopression (AVP) probes (gift from JP. Martinez-Barbera, ICH, UCL, UK). TUNEL experiments were carried out following the supplier manual (ApopTag Kit, Millipore). For gene expression, RNA extraction was carried out following the supplier manual (miRNeasy kit, Qiagen). Complementary DNA was synthetised using 1x qScript cDNA SuperMix (Quantabio). Quantitative PCR (qPCR) were performed using PowerUp SYBR green (ThermoFisher Scientific) with primers for Gh 5’TGGGCAGATCCTCAAGCAAACCTA3’ and 5’GAAGGCACAGCTGCTTTCCACAAA3’. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression was used as house-keeping gene (5’TTCACCACCATGGAGAAGGC3’ and 5’CCCTTTTGGCTCCACCCT3’). Each biological sample was run in technical triplicates and, at least, three biological samples were analysed. Relative expression of gene of interest was calculated according to the ddCt method [95] and represented as fold change to the corresponding control.

thumbnail
Download:
Table 1. List of primary antibodies used.

https://doi.org/10.1371/journal.pgen.1011395.t001

Faecal transplant and gut microbiota sequencing

Crick mice were rederived via embryo transfer into germ-free recipient females and maintained in isolators under germ-free conditions at Taconic Biosciences facility (Taconic Biosciences). Frozen NIMR faecal materials were homogenised in 100ul PBS at room temperature for 1 minute. Freshly prepared supernatant (around 75 – 80ul) was then administered by oral gavage once per day for 2 days (TruBIOME, Taconic). Fecal transplanted (FT) mice were sent to the Crick facility for further breeding and maintenance. The FT mice were kept on Crick diet. For sequencing, freshly collected or snap-frozen faecal materials collected between 10am and 12-noon (3 to 5h in the light cycle) from 4 different animals in each group were incubated in stabilisation buffer and subjected to shotgun whole genome sequencing with read depth of 2 millions paired-end reads (Transnetyx). Data was analysed with OneCodex online software. Gut microbiota datasets are publicly available at the Sequence Read Archive (SRA) of the National Library of Medicine (PRJNA1113545).

Quantification and statistical analysis

Images were captured by confocal microscopy (Leica SP5 or SPE) or by light microscope (Leica DMRA2) and analysed using Leica LAS AF, ImageJ, OpenLab or Volocity softwares. For anterior pituitary images, cell density was measured by counting the number of haematoxylin positive nuclei per 35mm2 and pituitary volume was measured using ImageJ. TSH+ve cell volume was measured using Volocity. Immunostained Sox3+/ΔGFP neurospheres are imaged and quantified according to the number of SOX3 and GFP positive cells they contain. The spheres are categorized into mainly SOX3+ve spheres or mainly GFP+ve spheres. Experiments are carried out at least in triplicate and at least three different fields were quantified for each experiment. For BrdU quantification, only BrdU+ve cells 100μm either side of the 3rd ventricle and within the median eminence were counted. α and β tanycytes were determined by their relative location within the hypothalamus. For statistical calculation, angular transformation was performed on percentage values. Unpaired t-test with Welch’s correction and two-way ANOVA were used for the analysis of statistical significance and error bars represent the standard deviation.

Supporting information

S1 Fig. Pituitary expression of SOX3 and RIA.

(A) Fluorescent immunolabelling for SOX3, POU1F1 and Prolactin (PRL) on 2-month old Sox3+/Y anterior pituitaries. Scale bars represent 10μm. (B) PRL contents in 2-month Sox3floxGFP/Y and Pou1f1-Cre; Sox3floxGFP/Y. (C) PRL, TSH and LH contents in 4 weeks and 5 weeks Sox3+/Y and Sox3-/Y pituitaries. Concentrations on the Y axis: LH, 10-6g per pituitary; PRL, 10-6g per pituitary; TSH, 10-7g per pituitary. *: p<0.05.

https://doi.org/10.1371/journal.pgen.1011395.s001

(TIF)

S2 Fig. Median eminence expression of SOX3.

(A) Percentage of SOX3+ve cells in Sox3+/Y hypothalami expressing NeuN, PDGFRa or GFAP. (B-C) Fluorescent immunolabelling for SOX3, NG2 (B) and MAG (C) on 2-month Sox3+/Y MEs. SOX3 is expressed in NG2+ve NG2-glia but not in MAG+ve mature oligodendrocytes. Scale bars represent 10μm.

https://doi.org/10.1371/journal.pgen.1011395.s002

(TIF)

S3 Fig. SOX3 expression in Sox3-/Y hypothalamus and neurospheres.

(A) Fluorescent immunolabelling for SOX3 on 2-month old Sox3-/Y hypothalamic. (B) Fluorescent immunolabelling for SOX3 and Nestin on Sox3+/Y and Sox3-/Y neurospheres. Note the absence of SOX3 in Sox3-/Y spheres.

https://doi.org/10.1371/journal.pgen.1011395.s003

(TIF)

S4 Fig. Post-weaning apoptosis analysis in vitro and in vivo.

(A) Percentage of TUNEL+ve cells in Sox3+/Y (white columns) and Sox3-/Y (grey columns) of monolayer cultures derived from adult animals at secondary, tertiary, and quaternary passages. No significant difference is observed. (B) TUNEL staining on Sox3+/Yand Sox3-/Y 2-month hypothalami. Arrows point to TUNEL+ve cells. Very few positive cells are present in both samples. Scale bar represents 100μm.

https://doi.org/10.1371/journal.pgen.1011395.s004

(TIF)

S5 Fig. Pre-weaning hypothalamic neural/progenitor cells analyses in vitro and in vivo.

(A) Total number of cells counted after each passage from hypothalamic derived (red/pink) or SEZ derived (dark and light blue) NSCs from ten-day old Sox3+/Y (dark blue/red) and Sox3-/Y mice (light blue/pink). Sox3-/Y NSCs from pups self-renew normally. (B) Percentage of phospho-histone H3+ve cells in secondary progenitor monolayer cultures originated from ten-day old Sox3+/Y and Sox3-/Y hypothalami. Sox3-/Y progenitors proliferate normally. (C) Percentage of neurospheres containing mostly SOX3+ve cells (white columns) or mostly GFP+ve cells (grey columns) derived from ten-day old Sox3+/ΔGFP SEZ or hypothalami. SOX3-ve, GFP+ve progenitors are maintained in these cultures from young females. (D) Number of BrdU+ve cells in one-week Sox3+/Y (white columns) and Sox3-/Y (grey columns) hypothalamic parenchymas and MEs. The number of BrdU+ve cells is similar in Sox3-/Y compared to Sox3+/Y samples.

https://doi.org/10.1371/journal.pgen.1011395.s005

(TIF)

S6 Fig. Hypothalamic neurosphere differentiation potential.

(A-C) Fluorescent immunolabelling for GFAP (astrocytes), βIII-tubulin (neurons), CNPase (oligodendrocytes) on 6-weeks (A) and 1-week (C) Sox3+/Y hypothalamic differentiated progenitor monolayers. (B) Percentage of cells differentiated into βIII-tubulin+ve neurons and CNPase+ve oligodendrocytes derived from 6-weeks Sox3+/Y (white columns) or Sox3-/Y (grey columns) hypothalami. Scale bars represent 30μm.

https://doi.org/10.1371/journal.pgen.1011395.s006

(TIF)

S7 Fig. AVP axis is not affected in Sox3 mutants.

(A) In situ hybridization for AVP on 2-month Sox3+/Y and Sox3-/Y hypothalami. (B) Sox3+/Y and Sox3-/Y posterior pituitary sizes at different post-natal weeks. Sox3-/Y posterior pituitaries are not smaller to that of Sox3+/Y animals. (C) Urine osmolality measurement at different post-natal weeks.

https://doi.org/10.1371/journal.pgen.1011395.s007

(TIF)

S8 Fig. Low dose aspirin treated Sox3-/Y myelin analyses and RIA.

(A) Transmission electron microscopy images of 2-month Sox3+/Y, Sox3-/Y with placebo and aspirin-treated Sox3-/Y MEs. Myelinated axons are missing in aspirin-treated Sox3-/Y MEs. (B) ACTH contents in 2-month Sox3+/Y, Sox3+/Ywith low dose aspirin, Sox3-/Y with low dose aspirin and Sox3-/Y with placebo pituitaries. Note the rescue in ACTH contents in Sox3-/Y mice receiving low dose aspirin. **: p<0.01.

https://doi.org/10.1371/journal.pgen.1011395.s008

(TIF)

S9 Fig. Diet composition and gut microbiota phyla composition.

(A) Composition of rodent chow at NIMR and Crick. (B) Abundance of different bacteria phylum in gut microbiota of mice housed at NIMR, Crick or faecal transplanted (FT) focussing only on lowly expression phyla.

https://doi.org/10.1371/journal.pgen.1011395.s009

(TIF)

Acknowledgments

We are grateful for the help and support of all recent past and present members of the Lovell-Badge lab. We are indebted to Dr. AF Parlow and the NHPP for reagents for the RIA and immunofluorescence experiments. We thank Simon Rhodes (Indiana University School of Medicine) for the generous gift of POU1F1 antibodies, J.P. Martinez-Barbera (University College London, UK) for Ghrh and Sst probes and S. Blackshaw for Rax probe. We thank Patrice Mollard (IGF, Montpellier, France) foir helpful discussions. We also thank Biological Services, the light microscopy, the experimental histopathology and the electron microscopy platforms at the MRC National Institute for Medical Research and the Francis Crick Institute, for their excellent assistance and technical support and BioRender for graphical representation.

References

  1. 1. Burbridge S, Stewart I, Placzek M. Development of the Neuroendocrine Hypothalamus. Compr Physiol. 2016;6(2):623–43. pmid:27065164
  2. 2. Rizzoti K, Lovell-Badge R. Pivotal role of median eminence tanycytes for hypothalamic function and neurogenesis. Mol Cell Endocrinol. 2017;445:7–13. pmid:27530416
  3. 3. Clayton RW, Lovell-Badge R, Galichet C. The Properties and Functions of Glial Cell Types of the Hypothalamic Median Eminence. Front Endocrinol (Lausanne). 2022;13:953995. pmid:35966104
  4. 4. Djogo T, Robins SC, Schneider S, Kryzskaya D, Liu X, Mingay A, et al. Adult NG2-Glia Are Required for Median Eminence-Mediated Leptin Sensing and Body Weight Control. Cell Metab. 2016;23(5):797–810. pmid:27166944
  5. 5. Buller S, Kohnke S, Hansford R, Shimizu T, Richardson WD, Blouet C. Median eminence myelin continuously turns over in adult mice. Mol Metab. 2023;69:101690. pmid:36739968
  6. 6. Kohnke S, Buller S, Nuzzaci D, Ridley K, Lam B, Pivonkova H, et al. Nutritional regulation of oligodendrocyte differentiation regulates perineuronal net remodeling in the median eminence. Cell Rep. 2021;36(2):109362. pmid:34260928
  7. 7. Galichet C, Clayton RW, Lovell-Badge R. Novel Tools and Investigative Approaches for the Study of Oligodendrocyte Precursor Cells (NG2-Glia) in CNS Development and Disease. Front Cell Neurosci. 2021;15:673132. pmid:33994951
  8. 8. Prevot V, Dehouck B, Sharif A, Ciofi P, Giacobini P, Clasadonte J. The Versatile Tanycyte: A Hypothalamic Integrator of Reproduction and Energy Metabolism. Endocr Rev. 2018;39(3):333–68. pmid:29351662
  9. 9. Mullier A, Bouret SG, Prevot V, Dehouck B. Differential distribution of tight junction proteins suggests a role for tanycytes in blood-hypothalamus barrier regulation in the adult mouse brain. J Comp Neurol. 2010;518(7):943–62. pmid:20127760
  10. 10. Rosso L, Mienville JM. Pituicyte modulation of neurohormone output. Glia. 2009;57(3):235–43. pmid:18803308
  11. 11. Prevot V, Bellefontaine N, Baroncini M, Sharif A, Hanchate NK, Parkash J, et al. Gonadotrophin-releasing hormone nerve terminals, tanycytes and neurohaemal junction remodelling in the adult median eminence: functional consequences for reproduction and dynamic role of vascular endothelial cells. J Neuroendocrinol. 2010;22(7):639–49. pmid:20492366
  12. 12. Joseph-Bravo P, Jaimes-Hoy L, Uribe RM, Charli JL. 60 YEARS OF NEUROENDOCRINOLOGY: TRH, the first hypophysiotropic releasing hormone isolated: control of the pituitary-thyroid axis. J Endocrinol. 2015;226(2):T85–T100. pmid:26101376
  13. 13. Balland E, Dam J, Langlet F, Caron E, Steculorum S, Messina A, et al. Hypothalamic tanycytes are an ERK-gated conduit for leptin into the brain. Cell Metab. 2014;19(2):293–301. pmid:24506870
  14. 14. Bolborea M, Dale N. Hypothalamic tanycytes: potential roles in the control of feeding and energy balance. Trends Neurosci. 2013;36(2):91–100. pmid:23332797
  15. 15. Sharif A, Fitzsimons CP, Lucassen PJ. Neurogenesis in the adult hypothalamus: A distinct form of structural plasticity involved in metabolic and circadian regulation, with potential relevance for human pathophysiology. Handb Clin Neurol. 2021;179:125–40. pmid:34225958
  16. 16. Lee DA, Bedont JL, Pak T, Wang H, Song J, Miranda-Angulo A, et al. Tanycytes of the hypothalamic median eminence form a diet-responsive neurogenic niche. Nat Neurosci. 2012;15(5):700–2. pmid:22446882
  17. 17. Li J, Tang Y, Cai D. IKKbeta/NF-kappaB disrupts adult hypothalamic neural stem cells to mediate a neurodegenerative mechanism of dietary obesity and pre-diabetes. Nat Cell Biol. 2012;14(10):999–1012.
  18. 18. Haan N, Goodman T, Najdi-Samiei A, Stratford CM, Rice R, El Agha E, et al. Fgf10-expressing tanycytes add new neurons to the appetite/energy-balance regulating centers of the postnatal and adult hypothalamus. J Neurosci. 2013;33(14):6170–80. pmid:23554498
  19. 19. Robins SC, Stewart I, McNay DE, Taylor V, Giachino C, Goetz M, et al. alpha-Tanycytes of the adult hypothalamic third ventricle include distinct populations of FGF-responsive neural progenitors. Nat Commun. 2013;4:2049.
  20. 20. Furube E, Ishii H, Nambu Y, Kurganov E, Nagaoka S, Morita M, et al. Neural stem cell phenotype of tanycyte-like ependymal cells in the circumventricular organs and central canal of adult mouse brain. Sci Rep. 2020;10(1):2826. pmid:32071335
  21. 21. Sarkar A, Hochedlinger K. The sox family of transcription factors: versatile regulators of stem and progenitor cell fate. Cell Stem Cell. 2013;12(1):15–30. pmid:23290134
  22. 22. Wood HB, Episkopou V. Comparative expression of the mouse Sox1, Sox2 and Sox3 genes from pre-gastrulation to early somite stages. Mech Dev. 1999;86(1–2):197–201. pmid:10446282
  23. 23. Bylund M, Andersson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1-3 activity. Nat Neurosci. 2003;6(11):1162–8. pmid:14517545
  24. 24. Hoffmann SA, Hos D, Kuspert M, Lang RA, Lovell-Badge R, Wegner M, et al. Stem cell factor Sox2 and its close relative Sox3 have differentiation functions in oligodendrocytes. Development. 2014;141(1):39–50. pmid:24257626
  25. 25. Kelberman D, Rizzoti K, Lovell-Badge R, Robinson IC, Dattani MT. Genetic regulation of pituitary gland development in human and mouse. Endocr Rev. 2009;30(7):790–829. pmid:19837867
  26. 26. Rizzoti K, Brunelli S, Carmignac D, Thomas PQ, Robinson IC, Lovell-Badge R. SOX3 is required during the formation of the hypothalamo-pituitary axis. Nat Genet. 2004;36(3):247–55. pmid:14981518
  27. 27. Huang N, Chen D, Wu X, Chen X, Zhang X, Niu J, et al. Aspirin Promotes Oligodendroglial Differentiation Through Inhibition of Wnt Signaling Pathway. Mol Neurobiol. 2016;53(5):3258–66. pmid:26059811
  28. 28. Chen J, Zuo S, Wang J, Huang J, Zhang X, Liu Y, et al. Aspirin promotes oligodendrocyte precursor cell proliferation and differentiation after white matter lesion. Front Aging Neurosci. 2014;6:7. pmid:24478700
  29. 29. Rogers N, Cheah PS, Szarek E, Banerjee K, Schwartz J, Thomas P. Expression of the murine transcription factor SOX3 during embryonic and adult neurogenesis. Gene Expr Patterns. 2013;13(7):240–8. pmid:23665444
  30. 30. Isaka F, Ishibashi M, Taki W, Hashimoto N, Nakanishi S, Kageyama R. Ectopic expression of the bHLH gene Math1 disturbs neural development. Eur J Neurosci. 1999;11(7):2582–8. pmid:10383648
  31. 31. Cheung L, Le Tissier P, Goldsmith SG, Treier M, Lovell-Badge R, Rizzoti K. NOTCH activity differentially affects alternative cell fate acquisition and maintenance. Elife. 2018;7. pmid:29578405
  32. 32. Galichet C, Lovell-Badge R, Rizzoti K. Nestin-Cre mice are affected by hypopituitarism, which is not due to significant activity of the transgene in the pituitary gland. PLoS One. 2010;5(7):e11443. pmid:20625432
  33. 33. Hu Z, Friberg RD, Barkan AL. Ontogeny of GH mRNA and GH secretion in male and female rats: regulation by GH-releasing hormone. Am J Physiol. 1993;265(2 Pt 1):E236–42. pmid:8368293
  34. 34. Khetchoumian K, Balsalobre A, Mayran A, Christian H, Chenard V, St-Pierre J, et al. Pituitary cell translation and secretory capacities are enhanced cell autonomously by the transcription factor Creb3l2. Nat Commun. 2019;10(1):3960. pmid:31481663
  35. 35. Melmed S. Pathogenesis of pituitary tumors. Nat Rev Endocrinol. 2011;7(5):257–66. pmid:21423242
  36. 36. Salvatierra J, Lee DA, Zibetti C, Duran-Moreno M, Yoo S, Newman EA, et al. The LIM homeodomain factor Lhx2 is required for hypothalamic tanycyte specification and differentiation. J Neurosci. 2014;34(50):16809–20. pmid:25505333
  37. 37. McNay DE, Briancon N, Kokoeva MV, Maratos-Flier E, Flier JS. Remodeling of the arcuate nucleus energy-balance circuit is inhibited in obese mice. J Clin Invest. 2012;122(1):142–52. pmid:22201680
  38. 38. Nesan D, Thornton HF, Sewell LC, Kurrasch DM. An Efficient Method for Generating Murine Hypothalamic Neurospheres for the Study of Regional Neural Progenitor Biology. Endocrinology. 2020;161(4).
  39. 39. Conti L, Cattaneo E. Neural stem cell systems: physiological players or in vitro entities? Nat Rev Neurosci. 2010;11(3):176–87. pmid:20107441
  40. 40. Llorente V, Velarde P, Desco M, Gomez-Gaviro MV. Current Understanding of the Neural Stem Cell Niches. Cells. 2022;11(19).
  41. 41. Wang TW, Stromberg GP, Whitney JT, Brower NW, Klymkowsky MW, Parent JM. Sox3 expression identifies neural progenitors in persistent neonatal and adult mouse forebrain germinative zones. J Comp Neurol. 2006;497(1):88–100. pmid:16680766
  42. 42. Rojczyk-Golebiewska E, Palasz A, Wiaderkiewicz R. Hypothalamic subependymal niche: a novel site of the adult neurogenesis. Cell Mol Neurobiol. 2014;34(5):631–42. pmid:24744125
  43. 43. Robins SC, Kokoeva MV. NG2-Glia, a New Player in Energy Balance. Neuroendocrinology. 2018;107(3):305–12. pmid:29506015
  44. 44. Yin W, Gore AC. The hypothalamic median eminence and its role in reproductive aging. Ann N Y Acad Sci. 2010;1204:113–22. pmid:20738281
  45. 45. Arima H, Bichet DG, Cheetham T, Christ-Crain M, Drummond J, Gurnell M, et al. Changing the name of diabetes insipidus. Pituitary. 2022;25(6):777–9. pmid:36334185
  46. 46. Rizzoti K, Lovell-Badge R. SOX3 activity during pharyngeal segmentation is required for craniofacial morphogenesis. Development. 2007;134(19):3437–48. pmid:17728342
  47. 47. Asadi A, Shadab Mehr N, Mohamadi MH, Shokri F, Heidary M, Sadeghifard N, et al. Obesity and gut-microbiota-brain axis: A narrative review. J Clin Lab Anal. 2022;36(5):e24420. pmid:35421277
  48. 48. Qi M, Tan B, Wang J, Liao S, Deng Y, Ji P, et al. The microbiota-gut-brain axis: A novel nutritional therapeutic target for growth retardation. Crit Rev Food Sci Nutr. 2022;62(18):4867–92. pmid:33523720
  49. 49. Yu KB, Hsiao EY. Roles for the gut microbiota in regulating neuronal feeding circuits. J Clin Invest. 2021;131(10). pmid:33998595
  50. 50. Bando H, Urai S, Kanie K, Sasaki Y, Yamamoto M, Fukuoka H, et al. Novel genes and variants associated with congenital pituitary hormone deficiency in the era of next-generation sequencing. Front Endocrinol (Lausanne). 2022;13:1008306. pmid:36237189
  51. 51. Parkin K, Kapoor R, Bhat R, Greenough A. Genetic causes of hypopituitarism. Arch Med Sci. 2020;16(1):27–33. pmid:32051702
  52. 52. Fang Q, George AS, Brinkmeier ML, Mortensen AH, Gergics P, Cheung LY, et al. Genetics of Combined Pituitary Hormone Deficiency: Roadmap into the Genome Era. Endocr Rev. 2016;37(6):636–75. pmid:27828722
  53. 53. Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, et al. Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet. 1999;23(1):99–103. pmid:10471508
  54. 54. Lamperti A, Mastovich J. Morphological changes in the hypothalamic arcuate nucleus and median eminence in the golden hamster during the neonatal period. Am J Anat. 1983;166(2):173–85. pmid:6837485
  55. 55. Pastor FE, Blazquez JL, Toranzo D, Pelaez B, Sanchez A, Alvarez-Morujo AJ, et al. Myelinated Herring bodies in the median eminence of the cat. Histol Histopathol. 1991;6(2):161–5. pmid:1666315
  56. 56. Rutzel H, Schiebler TH. Prenatal and early postnatal development of the glial cells in the median eminence of the rat. Cell Tissue Res. 1980;211(1):117–37. pmid:7407881
  57. 57. Silverman AJ, Desnoyers P. Post-natal development of the median eminence of the guinea pig. Anat Rec. 1975;183(3):459–75. pmid:1200333
  58. 58. Mirzadeh Z, Alonge KM, Cabrales E, Herranz-Perez V, Scarlett JM, Brown JM, et al. Perineuronal Net Formation during the Critical Period for Neuronal Maturation in the Hypothalamic Arcuate Nucleus. Nat Metab. 2019;1(2):212–21. pmid:31245789
  59. 59. Bartkowska K, Turlejski K, Koguc-Sobolewska P, Djavadian R. Adult Neurogenesis in the Mammalian Hypothalamus: Impact of Newly Generated Neurons on Hypothalamic Function. Neuroscience. 2023;515:83–92. pmid:36805005
  60. 60. Ost’adalova I, Babicky A. Periodization of the early postnatal development in the rat with particular attention to the weaning period. Physiol Res. 2012;61(Suppl 1):S1–7. pmid:22827866
  61. 61. Richter SH, Kastner N, Loddenkemper DH, Kaiser S, Sachser N. A Time to Wean? Impact of Weaning Age on Anxiety-Like Behaviour and Stability of Behavioural Traits in Full Adulthood. PLoS One. 2016;11(12):e0167652. pmid:27930688
  62. 62. Schwartz MW, Woods SC, Porte D Jr., Seeley RJ, Baskin DG. Central nervous system control of food intake. Nature. 2000;404(6778):661–71.
  63. 63. Anthwal N, Pelling M, Claxton S, Mellitzer G, Collin C, Kessaris N, et al. Conditional deletion of neurogenin-3 using Nkx2.1iCre results in a mouse model for the central control of feeding, activity and obesity. Dis Model Mech. 2013;6(5):1133–45. pmid:23649822
  64. 64. White AK, Drake KD, Porczak AE, Tirado-Mansilla G, Lee MF, Hyatt KC, et al. Integrity of the minor spliceosome in the developing mouse hypothalamus determines neuronal subtype composition regulating energy balance. bioRxiv. 2022:2022.10.04.510883.
  65. 65. Stolovich-Rain M, Enk J, Vikesa J, Nielsen FC, Saada A, Glaser B, et al. Weaning triggers a maturation step of pancreatic beta cells. Dev Cell. 2015;32(5):535–45.
  66. 66. Favaro R, Valotta M, Ferri AL, Latorre E, Mariani J, Giachino C, et al. Hippocampal development and neural stem cell maintenance require Sox2-dependent regulation of Shh. Nat Neurosci. 2009;12(10):1248–56. pmid:19734891
  67. 67. Kan L, Israsena N, Zhang Z, Hu M, Zhao LR, Jalali A, et al. Sox1 acts through multiple independent pathways to promote neurogenesis. Dev Biol. 2004;269(2):580–94. pmid:15110721
  68. 68. Kan L, Jalali A, Zhao LR, Zhou X, McGuire T, Kazanis I, et al. Dual function of Sox1 in telencephalic progenitor cells. Dev Biol. 2007;310(1):85–98. pmid:17719572
  69. 69. Radecki DZ, Samanta J. Endogenous Neural Stem Cell Mediated Oligodendrogenesis in the Adult Mammalian Brain. Cells. 2022;11(13). pmid:35805185
  70. 70. Parkash J, Messina A, Langlet F, Cimino I, Loyens A, Mazur D, et al. Semaphorin7A regulates neuroglial plasticity in the adult hypothalamic median eminence. Nat Commun. 2015;6:6385. pmid:25721933
  71. 71. Muller-Fielitz H, Stahr M, Bernau M, Richter M, Abele S, Krajka V, et al. Tanycytes control the hormonal output of the hypothalamic-pituitary-thyroid axis. Nat Commun. 2017;8(1):484. pmid:28883467
  72. 72. Appelman-Dijkstra NM, Kokshoorn NE, Dekkers OM, Neelis KJ, Biermasz NR, Romijn JA, et al. Pituitary dysfunction in adult patients after cranial radiotherapy: systematic review and meta-analysis. J Clin Endocrinol Metab. 2011;96(8):2330–40. pmid:21613351
  73. 73. Forbes ME, Paitsel M, Bourland JD, Riddle DR. Systemic effects of fractionated, whole-brain irradiation in young adult and aging rats. Radiat Res. 2013;180(3):326–33. pmid:23952575
  74. 74. Ornelas A, Zacharias-Millward N, Menter DG, Davis JS, Lichtenberger L, Hawke D, et al. Beyond COX-1: the effects of aspirin on platelet biology and potential mechanisms of chemoprevention. Cancer Metastasis Rev. 2017;36(2):289–303. pmid:28762014
  75. 75. Hoozemans JJ, Rozemuller AJ, Janssen I, De Groot CJ, Veerhuis R, Eikelenboom P. Cyclooxygenase expression in microglia and neurons in Alzheimer’s disease and control brain. Acta Neuropathol. 2001;101(1):2–8. pmid:11194936
  76. 76. de Seranno S, d’Anglemont de Tassigny X, Estrella C, Loyens A, Kasparov S, Leroy D, et al. Role of estradiol in the dynamic control of tanycyte plasticity mediated by vascular endothelial cells in the median eminence. Endocrinology. 2010;151(4):1760–72. pmid:20133455
  77. 77. Dovizio M, Tacconelli S, Sostres C, Ricciotti E, Patrignani P. Mechanistic and pharmacological issues of aspirin as an anticancer agent. Pharmaceuticals (Basel). 2012;5(12):1346–71. pmid:24281340
  78. 78. Morais LH, Schreiber HLt, Mazmanian SK. The gut microbiota-brain axis in behaviour and brain disorders. Nat Rev Microbiol. 2021;19(4):241–55. pmid:33093662
  79. 79. Lu J, Lu L, Yu Y, Cluette-Brown J, Martin CR, Claud EC. Effects of Intestinal Microbiota on Brain Development in Humanized Gnotobiotic Mice. Sci Rep. 2018;8(1):5443. pmid:29615691
  80. 80. Lu J, Synowiec S, Lu L, Yu Y, Bretherick T, Takada S, et al. Microbiota influence the development of the brain and behaviors in C57BL/6J mice. PLoS One. 2018;13(8):e0201829. pmid:30075011
  81. 81. Sudo N, Chida Y, Aiba Y, Sonoda J, Oyama N, Yu XN, et al. Postnatal microbial colonization programs the hypothalamic-pituitary-adrenal system for stress response in mice. J Physiol. 2004;558(Pt 1):263–75. pmid:15133062
  82. 82. Schloss PD, Schubert AM, Zackular JP, Iverson KD, Young VB, Petrosino JF. Stabilization of the murine gut microbiome following weaning. Gut Microbes. 2012;3(4):383–93. pmid:22688727
  83. 83. Al Nabhani Z, Dulauroy S, Marques R, Cousu C, Al Bounny S, Dejardin F, et al. A Weaning Reaction to Microbiota Is Required for Resistance to Immunopathologies in the Adult. Immunity. 2019;50(5):1276–88 e5. pmid:30902637
  84. 84. Gabanyi I, Lepousez G, Wheeler R, Vieites-Prado A, Nissant A, Chevalier G, et al. Bacterial sensing via neuronal Nod2 regulates appetite and body temperature. Science. 2022;376(6590):eabj3986. pmid:35420957
  85. 85. Girardin SE, Travassos LH, Herve M, Blanot D, Boneca IG, Philpott DJ, et al. Peptidoglycan molecular requirements allowing detection by Nod1 and Nod2. J Biol Chem. 2003;278(43):41702–8. pmid:12871942
  86. 86. Vesth T, Ozen A, Andersen SC, Kaas RS, Lukjancenko O, Bohlin J, et al. Veillonella, Firmicutes: Microbes disguised as Gram negatives. Stand Genomic Sci. 2013;9(2):431–48. pmid:24976898
  87. 87. Wexler HM. Bacteroides: the good, the bad, and the nitty-gritty. Clin Microbiol Rev. 2007;20(4):593–621. pmid:17934076
  88. 88. Al Bander Z, Nitert MD, Mousa A, Naderpoor N. The Gut Microbiota and Inflammation: An Overview. Int J Environ Res Public Health. 2020;17(20). pmid:33086688
  89. 89. Rivers LE, Young KM, Rizzi M, Jamen F, Psachoulia K, Wade A, et al. PDGFRA/NG2 glia generate myelinating oligodendrocytes and piriform projection neurons in adult mice. Nat Neurosci. 2008;11(12):1392–401. pmid:18849983
  90. 90. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, et al. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol. 2001;1:4. pmid:11299042
  91. 91. McGuinness L, Magoulas C, Sesay AK, Mathers K, Carmignac D, Manneville JB, et al. Autosomal dominant growth hormone deficiency disrupts secretory vesicles in vitro and in vivo in transgenic mice. Endocrinology. 2003;144(2):720–31. pmid:12538635
  92. 92. Scott CE, Wynn SL, Sesay A, Cruz C, Cheung M, Gomez Gaviro MV, et al. SOX9 induces and maintains neural stem cells. Nat Neurosci. 2010;13(10):1181–9. pmid:20871603
  93. 93. Ozen I, Galichet C, Watts C, Parras C, Guillemot F, Raineteau O. Proliferating neuronal progenitors in the postnatal hippocampus transiently express the proneural gene Ngn2. Eur J Neurosci. 2007;25(9):2591–603. pmid:17466019
  94. 94. Furukawa T, Kozak CA, Cepko CL. rax, a novel paired-type homeobox gene, shows expression in the anterior neural fold and developing retina. Proc Natl Acad Sci U S A. 1997;94(7):3088–93. pmid:9096350
  95. 95. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. pmid:11846609