Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Repeated truncation of a modular antimicrobial peptide gene for neural context

Abstract

Antimicrobial peptides (AMPs) are host-encoded antibiotics that combat invading pathogens. These genes commonly encode multiple products as post-translationally cleaved polypeptides. Recent studies have highlighted roles for AMPs in neurological contexts suggesting functions for these defence molecules beyond infection. During our immune study characterizing the antimicrobial peptide gene Baramicin, we recovered multiple Baramicin paralogs in Drosophila melanogaster and other species, united by their N-terminal IM24 domain. Not all paralogs were immune-induced. Here, through careful dissection of the Baramicin family’s evolutionary history, we find that paralogs lacking immune induction result from repeated events of duplication and subsequent truncation of the coding sequence from an immune-inducible ancestor. These truncations leave only the IM24 domain as the prominent gene product. Surprisingly, using mutation and targeted gene silencing we demonstrate that two such genes are adapted for function in neural contexts in D. melanogaster. We also show enrichment in the head for independent Baramicin genes in other species. The Baramicin evolutionary history reveals that the IM24 Baramicin domain is not strictly useful in an immune context. We thus provide a case study for how an AMP-encoding gene might play dual roles in both immune and non-immune processes via its multiple peptide products. As many AMP genes encode polypeptides, a full understanding of how immune effectors interact with the nervous system will require consideration of all their peptide products.

Author summary

Antimicrobial peptides are immune proteins that directly combat infection, found across all animals. Antimicrobial peptides have long been implicated in neurological roles, though the ways these genes accomplish either immune or neurological function is poorly understood. One aspect of antimicrobial peptide genes that has received less attention is the fact that many genes encode multiple gene products on a precursor protein (including fruit fly Defensin, Attacin, Diptericin, Drosocin, or Baramicin). Here we show how the fruit fly Baramicin gene family has evolved for either immune-specific or neurological roles.

One sub-peptide type (IM10-like) is repeatedly lost in genes lacking immune induction that are enriched in nerve tissue. In these nervous system-specific genes, a different sub-peptide is uniquely retained (IM24). This pattern has happened repeatedly across different species and gene lineages, suggesting the ancestral gene was equipped with specific sub-peptides adapted for either role. These findings suggest some antimicrobial peptide genes might accomplish alternative roles in immunity or neurology by different actions of their sub-peptides. It will be interesting to reflect on these findings in the light of inflammatory diseases, as many human neuropeptides and antimicrobial peptides have multiple mature products.

Citation: Hanson MA, Lemaitre B (2022) Repeated truncation of a modular antimicrobial peptide gene for neural context. PLoS Genet 18(6): e1010259. https://doi.org/10.1371/journal.pgen.1010259

Editor: Lynn M. Riddiford, Friday Harbor Laboratories: University of Washington, UNITED STATES

Received: April 1, 2022; Accepted: May 17, 2022; Published: June 17, 2022

Copyright: © 2022 Hanson, Lemaitre. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting information files.

Funding: This research was supported by the Swiss National Science Foundation Sinergia grant CRSII5_186397 awarded to BL. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Antimicrobial peptides (AMPs) are immune effectors best known for their role in defence against infection. These antimicrobials are commonly encoded as a polypeptide including both pro- and mature peptide domains [1,2]. AMP genes frequently experience events of duplication and loss [3–6] and undergo rapid evolution at the sequence level [7–12]. The selective pressures that drive these evolutionary outcomes are likely the consequence of host-pathogen interactions [13]. However AMPs and AMP-like genes in many species have recently been implicated in non-immune roles in flies, nematodes, and humans, suggesting non-immune functions might help explain AMP evolutionary patterns.

For instance, Diptericins are membrane-disrupting antimicrobial peptides of flies (Diptera) that are required for defence against infection by Providencia bacteria [13,14]. It was therefore surprising that the D. melanogaster gene Diptericin B (DptB) affects memory processes [15]. In this study, DptB derived from the fly fat body (analogous to the mammalian liver) regulated the ability of the fly to form long-term memory associations [15]. Another AMP-like gene, nemuri, regulates fly sleep and promotes survival upon infection [16]. Studies in nematodes have also shown that an immune-induced polypeptide (NLP-29) binds to a G-protein coupled receptor (NPR-12) triggering neurodegeneration through activation of the NPR-12-dependent autophagy pathway [17], and injury triggers epidermal AMPs including NLP-29 to promote sleep [18]. Drosophila AMPs have also recently been shown to regulate behaviours after seeing parasitoid wasps [19], during feeding with different bacteria [20], or following infection [21]. In humans, the Cathelicidin gene encodes the AMP LL-37, which is implicated in glia-mediated neuroinflammation and Alzheimer’s disease [22,23]. Indeed recent evidence suggests Alzheimer’s disease is an infectious syndrome [24], though the importance of this process is debated [25]. Notably, AMPs share a number of properties with classic neuropeptides [26], further muddying the distinction between peptides of the immune and nervous systems.

We recently described a novel antifungal peptide gene of Drosophila melanogaster that we named Baramicin A (BaraA) [21]. A unique aspect of BaraA is its precursor protein structure, which encodes a polypeptide cleaved into multiple mature products by interspersed furin cleavage sites. The use of furin cleavage sites to produce more than one mature peptide from a single polypeptide precursor is widespread in animal AMP genes [2,27], including multiple peptide repeats in bees and other flies [12,28]. However, BaraA represents an exceptional case as many tandem repeat peptides are cleaved by furin from a single precursor protein, effectively resembling a “protein-based operon”. The immature precursor protein of D. melanogaster BaraA encodes three types of domains: an IM24 domain, three tandem repeats of IM10-like domains, and an IM22 domain. BaraA mutants are susceptible to infection by fungi, and in vitro experiments suggest the BaraA IM10-like peptides have antifungal activity [21]. The other Baramicin domains encoding IM22 and IM24 remain uncharacterized. Curiously, BaraA deficient flies also display an erect wing behavioural phenotype upon immune stimulation even in the absence of infection, suggesting that BaraA products could have non-microbial targets [21].

In this study, we describe the evolution of the Drosophilid Baramicin gene family. Three unique Baramicin genes (BaraA, B, and C) are present in the genome of D. melanogaster. Surprisingly, only BaraA is immune-induced, while BaraB and BaraC are enriched in the nervous system. Both BaraB and BaraC have truncations compared to the ancestral Baramicin gene, and these two genes effectively encode just the Baramicin IM24 domain. We found similar truncations in other species, and confirmed loss of immune expression for IM24-specific Baramicins of other species. We also confirmed enrichment in the head or nervous system for IM24-specific genes in D. melanogaster and other species. We resolved the genomic ancestry of the Baramicins, which confirmed that these repeated truncations creating IM24-specific genes came from independent events (convergent evolution). The complex ‘protein operon’ polypeptide nature of Baramicin draws attention to how different sub-peptides can be adapted to context-specific roles, like in immunity or neurology. Attention to the multiple peptide products of AMP genes could explain how these immune effectors affect both immune and neurological processes.

Results

Baramicin is an ancestral immune effector

The Baramicin A gene was only recently described as encoding antifungal effectors by our group [21], and another recent study also confirmed Baramicin’s important contribution to Toll immune defence [29]. These initial characterizations were done only in D. melanogaster, and focused on one Baramicin gene (BaraA). We will therefore first provide a basic description of the immune Baramicins of other species and also the larger Baramicin gene family of D. melanogaster to establish that this is a classical immune gene family. This is relevant to paralogous genes to be discussed later.

In D. melanogaster, BaraA is regulated by the Toll immune signalling pathway [21,29]. Using BLAST, we recovered BaraA-like genes encoding each Baramicin peptide (IM24, IM10-like, and IM22) across the genus Drosophila and in the outgroup Scaptodrosophila lebanonensis. In many species, this was the only Baramicin gene present, suggesting Dmel\BaraA resembles the ancestral Baramicin structure. We performed infection experiments to confirm that BaraA-like genes were immune-inducible in the diverse species D. melanogaster, D. pseudoobscura, D. willistoni, D. virilis, and D. neotesteacea (last common ancestor ~47mya [30]) with Micrococcus luteus and Candida albicans, two microbes that stimulate the Toll pathway (Fig 1A). In all five species, BaraA-like genes were immune-induced (Fig 1B–1F). We therefore confirm the ancestral Baramicin was an immune-induced gene. Deviations from immune function are therefore derived.

thumbnail
Download:
Fig 1. The ancestral BaraA gene was immune-induced.

A) Cladogram of species used in B-F. B-F) Expression of the Toll-responsive gene BomBc3 (brown) or BaraA-like genes (orange) in diverse Drosophila species upon infection. In all cases, both BomBc3 and BaraA-like genes are induced upon infection by either C. albicans yeast or M. luteus bacteria.

https://doi.org/10.1371/journal.pgen.1010259.g001

The D. melanogaster genome encodes up to four Baramicins: BaraA1, BaraA2, BaraB and BaraC

In D. melanogaster, we recovered four Baramicin genes. First, we realized that a duplication of BaraA is actively segregating in wild flies (Fig 2A). The D. melanogaster R6 genome assembly encodes two 100% identical BaraA genes (CG33470 and CG18279, BaraA1 and BaraA2 respectively). We screened 132 DGRP lines for the BaraA duplication event, finding only ~14% (18/132) of strains were PCR-positive for two BaraA copies (S1 Data). Perhaps as a consequence of the identical sequences of these two genes, this genome region is poorly resolved in RNA sequencing studies and the Drosophila Genetic Reference Panel (DGRP, see S1 Fig) [31,32]. Because this region is poorly resolved, it is unclear if our PCR assay might be sensitive to cryptic sequence variation. However our PCR screen nevertheless confirms that this region is variable in the wild, and we additionally note that common fly strains seem to differ in their BaraA copy number, where extra gene copies correlates with increased expression after infection (see S10 Fig in [21]).

thumbnail
Download:
Fig 2. The D. melanogaster Baramicin genes.

A) Schematic of the BaraA duplication. Using a PCR assay spanning the duplication-specific locus (PCR amplicon), we confirmed BaraA copy number is variable in various lab strains [21] and wild-caught flies (S1 Data). B) D. melanogaster encodes two other Baramicin genes that we name BaraB and BaraC. These paralogs differ markedly in their precursor protein structure through truncation of the C-terminus relative to BaraA. The BaraB truncation is segregating in the DGRP (greyed out region, and see S2 Data).

https://doi.org/10.1371/journal.pgen.1010259.g002

We also recovered two paralogous Baramicin genes in D. melanogaster through reciprocal BLAST searches: CG13749 and CG30285, which we name BaraB and BaraC respectively (Fig 2B). The three Baramicin gene loci are scattered on the right arm of chromosome II at cytological positions 44F9 (BaraB), 50A5 (BaraA), and 57F8 (BaraC). These paralogous Baramicins are united by the presence of the IM24 domain. In the case of BaraB, we additionally recovered a frameshift mutation (2R_4821599_INS) causing a premature stop segregating in the DGRP leading to the loss of IM13 and IM22 relative to the BaraA gene structure (Fig 2B); this truncation is present in the Dmel_R6 genome assembly, but many DGRP strains encode a CDS with either a standard (e.g. DGRP38) or extended (e.g. DGRP101) IM22 domain (a DGRP BaraB alignment is provided in S2 Data). Moreover, in contrast to BaraA, the initial IM10-like peptide of BaraB no longer follows a furin cleavage site, and encodes a serine (RSXR) in its IM10-like motif instead of the universal proline (RPXR) of BaraA-like IM10 peptides across the genus. Each of these mutations prevents the secretion of classical IM10-like and IM22 peptides by BaraB. Finally, BaraC encodes only IM24 tailed by a transmembrane domain at the C terminus (TMHMM v2.0 [33]), and thus lacks both the IM10-like peptides and IM22 (Fig 2B).

BaraB and BaraC are not immune-inducible

BaraA is strongly induced following microbial challenge (Fig 1), being predominantly regulated by the Toll pathway with a minor input from the Immune Deficiency (Imd) pathway [21,29]. We therefore assayed the expression of BaraB and BaraC in wild-type flies, and also flies with defective Toll (spzrm7) or Imd (RelE20) signalling to see if their basal expression relied on these pathways. Surprisingly, neither gene was induced upon infection regardless of microbial challenge (Figs 3A and S2A and S2B). Of note: BaraC levels were consistently reduced in spzrm7 mutants regardless of treatment (cumulative data in S2C Fig, p = .005), suggesting BaraC basal expression is affected by Toll signalling. We next measured Baramicin expression over development from egg to adult. We found that expression of all genes increased over development and reached their highest level in young adults (Fig 3B). Of note, BaraB expression approached the lower limit of our assay’s detection sensitivity at early life stages. However BaraB was robustly detected beginning at the pupal stage, indicating it is expressed during metamorphosis. BaraC expression also increased markedly between the L3 larval stage and pupal stage.

thumbnail
Download:
Fig 3. D. melanogaster BaraB and BaraC have neural functions.

A) Only BaraA is immune-induced. BaraB and BaraC do not respond to infection, though basal BaraC expression relies on Toll signalling (S3C Fig). B) Time series of whole animal Baramicin expression over the course of development. Expression values are normalized within each gene, with expression in the adult set to 100% (left panel). For context, normalizing each gene to BaraA in adults shows that BaraC and especially BaraB expression is much lower at a whole fly level (right panel). C) ΔBaraB mutations generated in this study. ΔBaraBLC1 is an incidental hypomorph with reduced BaraB expression (S3A Fig), while ΔBaraBLC4 has the intended genetic replacement of BaraB with a DsRed cassette. Both mutations cause expression of DsRed in the eyes, ocelli, and abdomen. D) Partial lethality of ΔBaraBLC1 hypomorphs or complete lethality of ΔBaraBLC4 null flies in varied genetic backgrounds. E) The partial expansion wing phenotype is copied by BaraB gene silencing using the neural driver elav-Gal4. F) Specific wing mechanosensory neurons seem to express BaraB in adults. Meanwhile the BaraC gene almost perfectly matches the expression pattern of glia specific Repo-expressing cells in single cell RNA sequencing of the adult fly brain [38].

https://doi.org/10.1371/journal.pgen.1010259.g003

Collectively we reveal that BaraA is part of a larger gene family. While the BaraA gene was first described as an immune effector, the two Baramicin paralogs BaraB and BaraC are not induced by infection in D. melanogaster. Both BaraB and BaraC first see increased expression during pupation, and are ultimately expressed at their highest levels in adults.

Dmel\BaraB is required in the nervous system over the course of development

A simple interpretation of the truncated gene structure and low levels of BaraB expression is that this gene is undergoing pseudogenization. Indeed, AMP gene pseudogenization is common in insects including Drosophila [3,34,35]. To explore BaraB function, we used two mutations for BaraB (ΔBaraBLC1 and ΔBaraBLC4, generously gifted by S.A. Wasserman). These mutations were made using a CRISPR double gRNA approach to replace the BaraB locus with sequence from the pHD-DsRed vector. The ΔBaraBLC1 and ΔBaraBLC4 mutations differ in their ultimate effect, as ΔBaraBLC1 is an incidental insertion of the DsRed cassette in the promoter of the gene. This disruption reduces gene expression, resulting in a hypomorph state (S3A Fig). The ΔBaraBLC4 mutation however deletes the locus as intended, leading to BaraB null flies (Fig 3C).

We further introgressed both ΔBaraB mutations into the DrosDel isogenic background (referred to as iso) for seven generations according to Ferreira et al. [36]. At the same time, we combined the original ΔBaraB chromosomes with a CyO-GFP balancer chromosome in a mixed genetic background to distinguish homozygous/heterozygous larvae. In all cases, ΔBaraBLC4 homozygous individuals failed to develop to the adult stage, whereas homozygous ΔBaraBLC1 adults emerged (Fig 3D). We next assessed BaraB hypomorph viability by crossing ΔBaraBLC1 homozygous males to ΔBaraBLC1/CyO heterozygous females. The resulting offspring ratio departed from Mendelian inheritance, and was exacerbated by rearing at 29°C (S3B Fig). Using our CyO-GFP reporter to track hetero- vs. homozygous larvae revealed that the major lethal phase occurs primarily in the late larval and pupal stages (S3C–S3F Fig), consistent with a role for BaraB in the larva/pupa stage as suggested by an increase in expression at this stage (Fig 3B). Some ΔBaraBLC1 homozygous flies also exhibited locomotor defects, and/or a partial expansion wing phenotype (e.g. in Fig 3E) where the wings were stuck in a shrivelled state for the remainder of the fly’s lifespan. However, a proportion of ΔBaraBLC1 homozygotes successfully emerged, and unlike their siblings, had no immediate morphological or locomotory defects. The lifespan of morphologically normal iso ΔBaraBLC1 adults is nevertheless significantly shorter compared to wild-type flies and iso ΔBaraBLC1/CyO siblings (S4G Fig). We confirmed these developmental defects using ubiquitous gene silencing with Actin5C-Gal4 (Act-Gal4) to drive two BaraB RNAi/interfering RNA (IR) constructs (TRiP-IR and KK-IR). Both constructs resulted in significant lethality and occurrence of partial expansion wings (S1 Table). Genomic deficiency crosses also confirmed significantly reduced numbers of eclosing BaraB-deficient flies at 25°C (n = 114, χ2 p < .001) and 29°C (n = 63, χ2 p < .001) (S3H Fig). We therefore conclude that full gene deletion causes lethality at the larva-pupa transition stage, and BaraB hypomorphic flies suffer significant costs to fitness during development, and have reduced lifespan even following successful eclosion.

These data indicate BaraB is unlikely to be pseudogenized. While whole-fly BaraB expression is low, BaraB appears to be important for development. The fact that there is a bimodal outcome in hypomorph-like ΔBaraBLC1 adults (either severe defects or generally healthy) suggests BaraB could be involved in passing some checkpoint during larval/pupal development. Flies deficient for BaraB may be more likely to fail at this developmental checkpoint, resulting in either lethality or developmental defects.

Baramicin B suppression in the nervous system mimics mutant phenotypes

We next sought to determine in which tissue(s) BaraB is required. A previous screen using neural elav-Gal4 driven RNA interference highlighted BaraB silencing for lethality effects (n = 15) [37]. Given BaraB mutant locomotory defects, we started by silencing BaraB in the nervous system using the pan-neural elav-Gal4 driver with both the TRiP-IR and KK-IR BaraB-IR lines (IR = interfering RNA). We also used a combination of UAS-Dicer2 (Dcr2) and/or 29°C for greater silencing efficiency. In all cases, BaraB-IR driven by elav-Gal4 caused a significant (p < .02) departure from Mendelian inheritance in lethality and partial expansion wing presentation (S1 Table). Moreover the frequency of both lethality and the partial expansion wing phenotype was increased with increasing strength of gene silencing, and elav-Gal4>BaraB-IR flies also displayed locomotion difficulties with increasing strength of gene silencing, often getting stuck in the food and moving haphazardly.

This analysis suggests that BaraB plays an important role in the nervous system, explaining both the lethality and partial expansion wing phenotypes. Interestingly, BaraB is expressed in a specific subset of mechanosensory neuron cells in the wing in FlyCellAtlas [38] (Fig 3F), despite very low levels of BaraB expression in other FlyCellAtlas tissue datasets. We additionally investigated the effect of BaraB silencing in non-neural tissues including the fat body (c564-Gal4), hemocytes (hml-Gal4), the gut (esg-Gal4, Myo1A-Gal4), the wing disc (nubbin-Gal4), and in myocytes (mef2-gal4), all of which did not present with increased lethality or partial expansion wings. We also screened neural drivers specific for glia (Repo-Gal4), motor neurons (D42-, VGMN-, and OK6-Gal4), and a BaraA-Gal4 driver [21] that could overlap BaraB-expressing cells. However all these Gal4>BaraB-IR flies were viable and never exhibited overt morphological defects.

Baramicin C is expressed in glia

Tissue-specific transcriptomic data indicate that BaraC is expressed in various neural tissues including the eye, brain, and the thoracic abdominal ganglion (S4A Fig), but also the hindgut and rectal pads pointing to a complex expression pattern [32,39]. We next searched FlyCellAtlas [38] to narrow down which neural subtypes BaraB and BaraC were expressed in. BaraB expressing cells were few, and mostly showed only low expression in this dataset. However BaraC was robustly expressed in all glial cell types, fully overlapping the glia marker Repo (Fig 3F). To confirm the observation that BaraC was expressed in glia, we compared the effects of BaraC RNA silencing (BaraC-IR) using Act-Gal4 (ubiquitous), elav-Gal4 (neural) and Repo-Gal4 (glia) drivers on BaraC expression. Act-Gal4, elav-Gal4, and Repo-Gal4 reduced BaraC expression to ~14%, ~63% and ~57% that of control flies (S4B Fig, overall controls vs. neural/glia-IR, p = .002). We also screened for overt lethality, and locomotor or developmental defects upon BaraC silencing using ubiquitous Act-Gal4 and neural elav-Gal4>Dcr2 or Repo-Gal4. However BaraC silencing never produced overt phenotypes in morphology or locomotor activity.

Collectively, our results support the notion that BaraC is expressed in the nervous system, and are consistent with BaraC expression being most localized to glial cells.

Repeated genomic turnover of the Baramicin gene family

Our results thus far show that BaraA-like genes are consistently immune-induced in all Drosophila species (Fig 1), however the two paralogs Dmel\BaraB and Dmel\BaraC are not immune-induced, and are truncated in a fashion that deletes some or all of the antifungal IM10-like peptides (Fig 2B). These two Baramicins are now enriched in the nervous system (Fig 3E and 3F). In the case of BaraB, a role in the nervous system is evidenced by severe defects recapitulated using pan-neural RNA silencing. In the case of BaraC, nervous system expression is evidenced by a clear overlap with Repo-expressing cells.

While BaraA-like genes are conserved throughout the genus Drosophila, BaraB is conserved only in Melanogaster group flies, and BaraC is found only in Melanogaster and Obscura group flies, indicating that both paralogs stem from duplication events of a BaraA-like ancestor (Fig 4). To determine the ancestry of each D. melanogaster Baramicin gene, we traced their evolutionary history by analyzing genomic synteny through hierarchical orthologous groups [40]. Ancestry tracing revealed that these three loci ultimately stem from a single-locus ancestor encoding only one Baramicin gene that resembled Dmel\BaraA (Fig 4A). This is evidenced by the presence of only a single BaraA-like gene in the outgroup S. lebanonensis, and also in multiple lineages of the subgenus Drosophila (Fig 4B). Indeed, the general BaraA gene structure encoding IM24, tandem repeats of IM10-like peptides, and IM22 is conserved in S. lebanonensis and all Drosophila species (Fig 4C). On the other hand, the Dmel\BaraC gene comes from an ancient duplication restricted to the subgenus Sophophora, and Dmel\BaraB resulted from a more recent duplication found only in the Melanogaster group (Fig 4B).

thumbnail
Download:
Fig 4. Baramicin evolutionary history.

A) Detailed map of genomic neighbourhoods in the drosophilids S. lebanonensis, D. willistoni, and D. melanogaster, detailing inferred duplication, inversion, and translocation events. Gene names are given as found in D. melanogaster. B) Cladogram and genomic loci further detailing the series of events leading to the extant Baramicin loci of Drosophila species. Loci in S. lebanonensis and flies in the subgenus Drosophila encode only one Baramicin gene, indicating the ancestral drosophilid likely encoded only one Baramicin. C) IM24-specific Baramicins arose from convergent evolution both in gene structure and expression profile. Genomic loci are described here as ATP8A or stum reflecting prominent genes neighbouring the Baramicins (see Fig 4A). Expression dynamics relating to immune-induction or enrichment in the head (yes/no) are shown in Figs 2 and S5. The Baramicin loci in D. willistoni are syntenic with D. melanogaster, but evolved in a vice versa fashion (purple arrow). The D. virilis Baramicins GJ21309 and GJ25897 are direct sister genes (100% identity at N-terminus).

https://doi.org/10.1371/journal.pgen.1010259.g004

We originally found outgroup Baramicins by reciprocal BLAST searches, and screened BaraA-like genes encoding the full suite of Baramicin peptides for immune induction (i.e. encoding IM24, IM10-likes, and IM22: expression in Fig 1). However following genomic synteny analysis, we realized that the D. willistoni BaraA-like gene Dwil\GK10648 is syntenic with the Dmel\BaraC locus (Fig 4A), yet this gene is immune-induced (Fig 1D) and retains a BaraA-like gene structure (Fig 4C). On the other hand, Dwil\GK10645 is found at the locus syntenic with BaraA, but has undergone an independent truncation to encode just an IM24 peptide (similar to Dmel\BaraC). Thus these two D. willistoni genes have evolved similar to D. melanogaster BaraA/BaraC, but in a vice versa fashion. This suggests a pattern of convergent evolution with two key points: i) the duplication event producing Dmel\BaraA and Dmel\BaraC originally copied a full-length BaraA-like gene to the BaraC locus, and ii) the derivation of an IM24-specific gene structure has occurred more than once (Dmel\BaraC and Dwil\GK10645). Indeed, another independent IM24-specific Baramicin gene is present in D. virilis (Dvir\GJ25897), which is a direct sister of the BaraA-like gene Dvir\GJ21309 (the signal peptides of these genes is identical at the nucleotide level, and see Fig 4C). Thus Baramicins in both D. willistoni and D. virilis have convergently evolved towards an IM24-specific protein structure resembling Dmel\BaraC. We checked the expression of these truncated Baramicins in each species upon infection. As was the case for Dmel\BaraC, neither gene is immune-induced (S5A–S5C Fig). Given the glial expression of Dmel\BaraC, we reasoned that the heads of adult flies (rich in nerve tissue) should be enriched in BaraC compared to whole animals. Indeed we saw a significant enrichment of BaraC in the heads of D. melanogaster males compared to whole flies, which was not the case for BaraA (S5D Fig). When we checked the heads of D. willistoni and D. virilis, we indeed saw a consistent and significant enrichment in the head for the IM24-specific genes Dwil\GK10645 and Dvir\GJ25897, while BaraA-like genes were more variable in expression (S5E and S5F Fig).

Genomic synteny shows the gene structure and immune expression of BaraA are the ancestral state, and Dmel\BaraB and Dmel\BaraC are paralogs derived from independent duplication events. Strikingly, we observe a parallel evolution of expression pattern and gene structure in Baramicins of D. willistoni and D. virilis. Moreover these independent IM24-specific Baramicins across species are not immune induced, and are enriched in the head. Expression data across genes and species are shown in S5 Fig and summarized in Fig 4C.

Residue 29 in the IM24 domain evolves in lineage-specific fashions

Thus far we have shown that IM24-specific genes are expressed in the nervous system, yet IM24 is the only peptide domain conserved across all Baramicin genes. We therefore wanted to better understand the properties of IM24 to know if any evolutionary patterns might distinguish the IM24 domains of nervous system-expressed genes from IM24 domains of immune-induced genes. We were unable to model the protein satisfactorily with various protein prediction techniques, preventing a 3D comprehension of the IM24 peptide. Therefore we asked if we could highlight any residues in this traditionally immune peptide that might correlate with nervous system or immune-induced gene lineages to better understand what aspect of IM24 contributes to it being retained in neural contexts.

To do this, we screened for positive selection (elevated non-synonymous mutation rate) in the IM24 domain using the HyPhy package implemented in Datamonkey.org [41] using separate codon alignments of Baramicin IM24 domains beginning at their conserved Q1 starting residue. As is recommended with the HyPhy package [41], we employed multiple statistical approaches including Likelihood (FEL), Bayesian (FUBAR), and Count-based (SLAC) analyses to ensure patterns in selection analyses were robust to different methods of investigation. Specifically, we used locus-specific alignments (e.g. genes at the stum locus in Fig 4B were all analyzed together) to ensure IM24 evolution reflected locus-specific evolution. FEL, FUBAR, and SLAC site-specific analyses each suggest strong purifying selection in many residues of the IM24 domain (p-adj < .05, data in S3 Data), agreeing with the general protein structure of IM24 being broadly conserved (Fig 5A). However one residue (site 29) was consistently highlighted as evolving under positive selection using each type of statistical approach for genes located at the Sophophora ATP8A locus (BaraA genes and Dwil\GK10645: p-adj < .05; Fig 5A). This site is universally Proline in Baramicin genes located at the stum locus (BaraC-like), in both D. willistoni Baramicins, and in the outgroup S. lebanonensis, suggesting Proline is the ancestral state. However this residue diverges in both the BaraA (commonly Threonine) and BaraB (commonly Valine) lineages. We also note that two sites on either side of site 29 (site 27 and site 31) similarly diverge by lineage in an otherwise highly conserved region of the IM24 domain. FUBAR analysis (but not FEL or SLAC) similarly found evidence of positive selection at site 31 in the BaraA locus genes (p-adj = .026). Thus this neighbouring site could also be evolving in a non-random fashion. Similar analyses of the BaraB and stum loci Baramicins did not find evidence of site-specific positive selection.

thumbnail
Download:
Fig 5. BaraB and IM24 rapid evolution.

A) Evolution of the signal peptide and core IM24 domain. Residue highlighting indicates agreement with Dmel\BaraB. Arrows indicate site 29 and the D. melanogaster 40HHASSPAD48 domain. Insertion events in D. yakuba and D. sechellia BaraB are denoted as XX to save space. While longer than other Baramicin proteins, the D. sechellia signal peptide is predicted to remain functional (SignalP 5.0). The cladogram on the left shows genomic relatedness according to speciation and gene duplication patterns independent of sequence similarity. Background colouring is included to show birth of novel Baramicin loci/lineages. B) BaraB immune inducibility across the Melanogaster group phylogeny. The D. erecta BaraB gene is pseudogenized by multiple premature stop codons, and the D. yakuba gene is not immune-induced and encodes a 9-residue insertion in the IM24 peptide bordering the HHASSPAD domain (see XX site in A). However the BaraB genes of D. suzukii, and both D. mauritiana and D. sechellia remain inducible by infection, while the BaraB genes of D. simulans and D. melanogaster are not and are expressed at very low levels (S6 Fig). This pattern suggests that BaraB of D. melanogaster (and D. simulans) lost immune induction only recently, and is correlated with the loss of the BaraB signal peptide.

https://doi.org/10.1371/journal.pgen.1010259.g005

We highlight site 29 as a key residue in IM24 that diverged in Baramicin in lineage-specific fashions. This ancestrally Proline residue has settled on a Threonine in most BaraA-like genes of Obscura and Melanogaster group flies, and a Valine in most BaraB genes, which are unique to the Melanogaster group. The ancestral Proline residue is found in both D. willistoni Baramicins, alongside significant enrichment of both genes in the head, despite only one gene being immune-induced (Figs 4C and S5). Thus it is unclear how this site contributes to tissue-specific Baramicin functions, but Threonine and Valine residues evolved in the BaraA and BaraB lineages.

Another IM24 motif in Baramicin lineages varies through relaxed selection

Visual inspection of aligned IM24 proteins shows the overall IM24 domain is broadly conserved, except in sites 40–48 (Fig 5A). This motif aligns to residues 40HHASSPAD48 of Dmel\BaraB, and departs in lineage-specific fashions; the three C-terminal residues of this motif are diagnostic of each gene lineage (BaraA, BaraB, and BaraC have RGE, PXE, or (S/N)GQ respectively; Fig 5A). However even with additional branch-site selection analyses (aBSREL and BUSTED [42]), we found no evidence of positive selection at this motif, and in fact many residues also failed to show evidence of purifying selection. For instance, six of nine sites of this motif in the BaraA locus analysis failed to reach significance (p > .05) for purifying selection in SLAC analysis (S3 Data).

Given an absence of positive selection, and many residues failing to reach significance for purifying selection at the residue 40–48 motif, we suspect this motif is diversifying due to drift effects through relaxed selection. The high conservation of IM24 residues up- and downstream of this motif is nevertheless striking. One possible explanation may be that these residues act as a linker between the two functional parts of IM24 up- and downstream of residues 40–48. Perhaps supporting this interpretation, we found that D. yakuba BaraB independently lost immune induction alongside an insertion at site 40 (Fig 5). Such speculation awaits validation by robust protein modelling efforts.

Overt structural change best explains Baramicin loss of immune induction

We found that site 29 evolves rapidly in Baramicin lineages, but this site is common to both immune-induced and non-induced Baramicin genes (e.g. in D. willistoni). Thus IM24 sequence variation does not explain why IM24-specific Baramicins lose immune inducibility. However within the BaraA/BaraB lineage, we observed that BaraB genes commonly encode Valine at IM24 site 29, compared to Threonine in BaraA. As the BaraB locus is derived from an ancestral immune-induced (Fig 4A), it is unclear if other BaraB genes are immune-inducible, and thus what IM24 evolutionary patterns (like Valine at site 29) might predict BaraB functional divergence.

We therefore performed infection experiments in diverse species across the Melanogaster group to see if their BaraB genes had similarly lost immune induction (see S6 Fig for qPCR data). Surprisingly, we found that the lack of immune inducibility of Dmel\BaraB is extremely recent, as Melanogaster sister species like D. sechellia and D. mauritiana encode immune inducible BaraB loci (summary in Fig 5B). However, we found that D. simulans BaraB lacked immune induction, despite D. simulans being most closely related to D. sechellia [43]. Thus IM24 sequence evolution does not predict immune induction.

This drew our attention to the overall protein structure of the various extant BaraB genes. A striking feature of the Dmel\BaraB protein is the absence of a functional signal peptide (Fig 2B). This signal peptide sequence is conserved in all Baramicin lineages, except in Dmel/BaraB and also Dsim/BaraB. Indeed despite D. simulans being more closely related to D. sechellia and D. mauritiana, both Dmel\BaraB and Dsim\BaraB encode a homologous N-terminus of parallel length (Fig 5A). Loss of the BaraB signal peptide is therefore more specifically associated with loss of immune expression in the Melanogaster species complex (D. simulans, D. sechellia, D. mauritiana, and D. melanogaster). The last common ancestor of D. simulans, D. sechellia, and D. mauritiana is estimated to be just ~250,000 years ago, and these species diverged from D. melanogaster ~3 million years ago [43]. The fact that D. simulans uniquely encodes this Dmel\BaraB-like sequence suggests it was either introgressed from one species to the other prior to the complete development of hybrid inviability, or reflects incomplete lineage sorting of this locus in the Melanogaster species complex.

Overall, we find no evidence to suggest IM24 domain sequence has evolved drastically to allow for function in the nervous system. Rather than small sequence changes, overt structural changes like truncation to focus on the IM24 domain and loss of a signal peptide in Dmel\BaraB are associated with Baramicins expressed in the nervous system. After duplication, Baramicin daughter lineages have repeatedly derived neural-specific expression through subfunctionalization of the IM24 domain from the overall precursor protein. Importantly, this finding suggests that the ancestral Baramicin encoded peptides with distinct roles in either the immune response or the nervous system.

Discussion

Recent studies have suggested AMP genes regulate behavioural responses, and may be involved in disease progression through interactions with the nervous system. Many of these genes encode polypeptides with multiple mature products. To date, little attention has been paid to AMP genes in these neural contexts at the level of the sub-peptides they encode. Here we demonstrate that the Baramicin antimicrobial peptide gene of Drosophila ancestrally encodes distinct peptides that may interact with either the nervous system (IM24) or invading pathogens (IM10-like, IM22). These peptides are maturated from a longer precursor protein, accomplished via furin cleavage. Importantly, this suggests that AMP genes can mediate these distinct neural and immune roles via specialized sub-peptides, and not necessarily due to dual action of a single peptide. Moreover the ‘protein operon’ structure of immune-induced Baramicins can act as a mechanism to allow peptides with distinct roles to be produced simultaneously from a single mRNA transcript.

There is building evidence that immune-induced AMPs and AMP-like genes affect the nervous system. Loss of Metchnikowin protects flies from neurodegeneration after traumatic brain injury [44], Induced by infection (IBIN) regulates behavioural changes in flies after seeing parasitoid wasps [19], epidermal nematode AMPs trigger motor neuron autophagy [17] and sleep [18] after infection, and loss of Diptericin B produced by the fat body leads to memory deficits in Drosophila [15]. This last example is intriguing, as Diptericin B also encodes a polypeptide maturated by furin cleavage, and its effect on memory was derived from peptide secreted into the hemolymph by the fat body and not from neural expression. Similarly, we recently found that BaraA deletion causes infected flies to display an erect wing behavioural phenotype, which was independent of active infection, and could be rescued by priming the hemolymph with BaraA expressed by the fat body [21]. Thus some component of BaraA likely interacts with some host target(s) to prevent this behaviour during the immune response. The present study suggests this could be due to the action of BaraA IM24, given IM24 is retained in genes more specifically expressed in the nervous system. We also found no natural selection patterns in IM24 that were unique to immune or non-immune genes across the phylogeny, suggesting the core IM24 peptide does not need to drastically change its structure to suit expression in the nervous system. However AMPs and neuropeptides have many similar features, including cationic charge and amphipathicity [26]. Thus while our results suggest that IM24 of different Baramicin genes might underlie Baramicin interactions with the nervous system, we cannot exclude the possibility that IM24 is also antimicrobial, or even that antimicrobial activity is IM24’s ancestral purpose. Future studies could use tagged IM24 transgenes or synthetic peptides to determine the host binding partner(s) of secreted IM24 from the immune-induced Dmel\BaraA, and/or to see if IM24 binds to microbial membranes.

One human AMP recently implicated in chronic neuroinflammatory disease is the Cathelicidin LL-37 [22,23,45]. Like Baramicin, the Cathelicidin gene family is unified by its N-terminal domain: the “Cathelin” domain. However to date no one has described antimicrobial activity of the Cathelin domain in vitro [1]. Instead, Cathelicidin research has focused almost exclusively on the mature peptide LL-37 at the C-terminus of mammalian Cathelicidin genes. Reflecting on Baramicin evolution and the implication of Cathelicidin in neurodegenerative diseases, what does the Cathelin domain do? While this study was conducted in fruit flies, we hope we have emphasized the importance of considering each peptide of AMP genes for in vivo function. This is relevant to neural processes even if the gene is typically thought of for its role in innate immunity. Indeed, recent studies of Drosophila AMPs have emphasized that in vitro activity does not always predict the interactions that arise from endogenous loss of function study [14,46]. Care should be taken not to conflate in vitro activity with realized in vivo function. Most studies focus on AMPs specifically in an immune role, but this is akin to ‘looking for your keys under the streetlight.’ To understand AMP functions in vivo, genetic approaches will be necessary that allow a more global view of gene function.

In summary, we reflect on the structural characteristics of AMP genes through the lens of the Baramicins. We found that one sub-peptide of the immune-induced Baramicin ancestor is readily adapted for functions relating to the nervous system. Meanwhile, other sub-peptides known to suppress fungi are repeatedly lost in daughter genes that lack immune inducibility, suggesting they are irrelevant to neural functions. As AMP genes commonly encode polypeptides maturated by furin cleavage (including Baramicin), it will be interesting to consider the functions of AMP genes in neural processes not simply at the level of the gene, but at the level of the mature peptides produced by that gene. This consideration may explain how some polypeptide immune effectors play dual roles in disparate contexts.

Materials and methods

DGRP population screening and bioinformatics analyses

Genomic sequence data were downloaded from GenBank default reference assemblies and Kim et al. [47], and DGRP sequence data from http://dgrp2.gnets.ncsu.edu/ [31]. Sequence comparisons and alignment figures were prepared using Geneious R10 [48], Prism 7, and Inkscape. Alignments were performed using MUSCLE or MAFFT followed by manual curation, and phylogenetic analyses were performed to validate sequence patterns using the Neighbour Joining, PhyML, RaxML, and MrBayes plugins in Geneious. BaraA copy number screening was performed using primers specific to the duplication and CG30059 control primers for DNA extraction (S1 Data). We found a significant correlation between BaraA PCR status and variant sites starting at 2R_9293471_SNP and extending to 2R_9293576_SNP (Pearson’s correlation matrix: 0.0001 < p-value < 0.005 at all nine sites), however the status of genetic variants at this site is poorly resolved and so we cannot be confident that our ~14% estimate for the BaraA duplication in the DGRP would hold true if long-read sequencing was employed. DGRP annotation of the BaraA locus in S1 Fig was generated using the UCSC D. melanogaster DGRP2 genome browser. Selection analyses were performed using the HyPhy package implemented in datamonkey.org [41]. Codon alignments of the IM24 domain used in Fig 5A are included as a .fasta file in S3 Data alongside outputs from FEL, FUBAR, SLAC, and aBSREL selection analyses.

Fly genetics

The BaraBLC1 and BaraBLC4 mutations were generated using CRISPR with two gRNAs and an HDR vector by cloning 5’ and 3’ region-homologous arms into the pHD-DsRed vector, and consequently ΔBaraB flies express DsRed in their eyes, ocelli, and abdomen. The following PAM sites were used for CRISPR bordering the BaraB region. Slashes indicate the cut site: 5’: GCGGGCAACAGATGTGTTCA/GGG 3’: GTCCATTGCTTATTCAAAAA/TGG. These mutants were generated in the laboratory of Steve Wasserman by Lianne Cohen, who graciously allowed their use in this study. All fly stocks including Gal4 and RNAi lines are listed in S4 Data. Experiments were performed at 25°C unless otherwise indicated. When possible, genetic crosses of 6–8 males and 6–8 females were performed in both directions to test for an effect of the X or Y chromosomes on BaraB-mediated lethality; crosses in both directions yielded similar results in all cases and reported data are pooled results. Fly diet consisted of a nutrient-rich lab standard food: 3.72g agar, 35.28g cornmeal, 35.28g yeast, 36mL grape juice, 2.9mL propionic acid, 15.9mL moldex, and H2O to 600mL.

Infection experiments

Bacteria and yeast were grown to mid-log phase shaking at 200rpm in their respective growth media (LB, BHI, or YPG) and temperature conditions, and then pelleted by centrifugation to concentrate microbes. Resulting cultures were diluted to OD = 200 at 600nm before infections to measure gene expression. The following microbes were grown at 37°C: Escherichia coli strain 1106 (LB) and Candida albicans (YPG). Micrococcus luteus was grown at 29°C in LB. For Figs 1 and S2, pooled fly samples were collected either 6 hours post-infection (E. coli) or 24 hours post-infection (C. albicans, M. luteus) prior to RNA extraction on pools of 5 adult males. These timepoints correspond to the maximal expression inputs of the Imd (6hpi) or Toll (24hpi) NF-κB signalling pathways, which are most specifically induced by Gram-negative bacteria (Imd) or Gram-positive bacteria or fungi (Toll) [49]. Flies were pricked in the thorax as described in [14].

RNA extractions were performed using TRIzol, Ambion DNAse treatment, and PrimeScript RT according to manufacturer’s protocols. RT-qPCR was performed using PowerUP SYBR Green master mix with primers listed in S5 Data. Gene expression differences were analyzed using the PFAFFL method [50]. For gene expression experiments requiring dissection of heads, pools of 20 males were used for either whole flies or heads dissected in ice-cold PBS and transferred immediately to a tube kept on dry ice.

Selection analysis using the HyPhy package

Codon aligned nexus tree files were generated using either the Neighbour-joining (1000 bootstraps) or PhyML (100 bootstraps) methods including proteins beyond those shown in Fig 5. These tree files were analyzed using the HyPhy package with only 174nt pertaining to just the IM24 domain codons included. The cladogram in Fig 5A is manually drawn from known species divergences [47]. Use of either tree building method was chosen for convenience to best reflect known lineage sorting, as use of just 174nt was too information-poor to resolve exact phylogenetic relatedness reliably. Tree files were qualitatively screened to ensure topologies broadly matched known species sortings, and thus ensure only relevant comparisons were made given the genomic synteny analysis in Fig 4 is principally informative of true gene lineages. HyPhy analyses were run separately for each Baramicin lineage within their clade, defined by genomic synteny; i.e. based on locus (e.g. ATP8A locus), and not considering convergent gene structures. We used three site-specific analyses (FEL, FUBAR, and SLAC) that use three independent statistical approaches (Likelihood, Bayesian, and Count-based methods respectively). We also employed both BUSTED and aBSREL branch-site analyses, which are likelihood methods that differ in their approach of testing whole-phylogeny selection or branch-specific comparisons respectively; an anology might be performing analysis of variance (ANOVA) at the level of the entire ANOVA, or comparing multiple groups against each other and subsequently using multiple test correction. Each tree was rooted using the Scaptodrosophila lebanonensis Baramicin as an outgroup with ancestral characteristics; we did not include Baramicins of the subgenus Drosophila as including these resulted in long-branch attraction of the Willistoni group Baramicins to subgenus Drosophila lineages, which would confound relevant phylogenetic comparisons. When applicable, all internal branches were assessed for potential selection. For Baramicins of the ATP8A locus, one site (site 29) was highlighted as experiencing positive selection using FEL, FUBAR, and SLAC analyses (p-adj = .011, .013, and .039 respectively). Additionally, site 31 was also highlighted by FUBAR (p-adj = .026), but not FEL or SLAC analyses (p-adj > .05). BUSTED analysis also supported diversifying selection in the BaraA lineage (ATP8A locus, LRT p-adj = .008), indicating at least one site on at least one test branch has experienced diversifying selection within the ATP8A lineage. The aBSREL branch-site analysis specifically highlights the branch distinguishing the Willistoni group Baramicins from the other Sophophora species (p-adj = .0045), suggesting variation between these branches drives the signals of diversifying selection in the BUSTED analysis. This result is intuitive, as we find a parallel but opposite evolution of Baramicin protein structure in Baramicins of the ATP8A locus in D. willistoni compared with Baramicins of other Sophophora species. Furthermore, in whole-gene phylogenies, both D. willistoni Baramicins cluster together, supporting the notion that these two daughter genes have evolved independent from the selection that shaped the orthologues of Dmel\BaraA and Dmel\BaraC, also seen in qPCR data that showed both genes were significantly enriched in the head (S6 Fig). This phylogenetic clustering of the two D. willistoni Baramicins holds true when additional Baramicins from recently sequenced genomes of the Willistoni group are included (from [47] in S3 Data), indicating this is characteristic of the Willistoni group lineage and not specific to D. willistoni.

Supporting information

S1 Fig. The BaraA locus is poorly resolved in DGRP genome assemblies.

The BaraA1 and BaraA2 gene regions are totally devoid of mapped variants (dashed boxes). We speculate this is due to an artefact during genomic assembly, where reads mapping equally to the two identical BaraA genes were discarded as non-specific. This would explain why BaraA is typically discarded in RNAseq datasets using such measures in their pipeline, but not in microarray data from De Gregorio et al. [51] where it is called “IM10”.

https://doi.org/10.1371/journal.pgen.1010259.s001

(EPS)

S2 Fig. Additional assays of Baramicin expression upon infection.

A) Neither BaraB nor BaraC are regulated by the Imd pathway, which is specifically stimulated by E. coli infection. B) Neither BaraB nor BaraC are induced after infection by M. luteus. C) BaraC levels were consistently depressed in spzrm7 flies in the unchallenged condition (UC) or upon infection with C. albicans (Fig 3B) or M. luteus (S4B Fig). Data here are pooled for iso wild type or iso spzrm7 flies without regard for infection treatment (student’s t, p = .005).

https://doi.org/10.1371/journal.pgen.1010259.s002

(EPS)

S3 Fig. BaraB mutation is highly deleterious, even in ΔBaraBLC1 hypomorphs.

A) Diagram of BaraB mutant loci and qPCR showing that ΔBaraBLC1 is a hypomorph mutation. Under our normal qPCR assay conditions, BaraB expression is not detected in ΔBaraBLC1 homozygotes. However using highly concentrated cDNA beyond our assay’s valid range (100ng/10μL reaction), we could detect BaraB transcript in ΔBaraBLC1 flies. Quantification shown here is intended only to show that BaraB transcript can be recovered from ΔBaraBLC1 homozygotes, and to give a sense of relative whole-fly expression levels. B) Emergent frequencies of ΔBaraBLC1 flies at different temperatures. C) Aborted pupae (yellow arrows) are a common occurrence in ΔBaraB vials, and sometimes contain fully-developed adults that simply never eclosed. In D-F: ns = not significant, * = p < .05, *** p = < .001. D) The ratio of ΔBaraBLC1/CyO-GFP to ΔBaraBLC1 homozygous larvae drops between the S2 and S3 larval stages (χ2, p = .515 and p = .012 respectively). E) Frequency of successfully eclosing adults using ΔBaraBLC4/CyO-GFP flies. F) Frequency of successfully eclosing adults using ΔBaraBLC1/CyO-GFP flies. G) BaraB mutation negatively affects lifespan. iso ΔBaraBLC1 homozygotes suffer reduced lifespan even relative to their iso ΔBaraBLC1/CyO siblings. By comparison, iso ΔBaraA flies that used the same vector for mutant generation live as wild-type. ATM8 flies suffer precocious neurodegeneration and are included as short-lived controls [52]. H) ΔBaraBLC1 crossed to the genomic deficiency line (Df(9063)) supports a partial-lethal effect of BaraB mutation.

https://doi.org/10.1371/journal.pgen.1010259.s003

(EPS)

S4 Fig. BaraC is expressed in the nervous system, but also the hindgut and rectal pads.

A) FlyAtlas2 expression data for BaraC. B) RT-qPCR of BaraC in whole flies using different Gal4 drivers to express BaraC RNAi. BaraC is knocked down by both the elav-Gal4 and Repo-Gal4 nervous system drivers. Cumulatively, nervous system drivers significantly depress BaraC expression compared to BaraC-IR controls (student’s t, p < .01). Ubiquitous knockdown using Act>BaraC-IR provides a comparative knockdown to better understand the strength of nervous system-specific knockdowns at the whole fly level.

https://doi.org/10.1371/journal.pgen.1010259.s004

(EPS)

S5 Fig. RT-qPCR of Baramicin genes in diverse species.

A-C) Independent IM24-specific genes in D. melanogaster (A), D. willistoni (B), and D. virilis (C) are not induced by infection. BomBc3 is included as an immune-induced control. D-F) The independent IM24-specific genes (blue) of D. melanogaster (D), D. willistoni (E), and D. virilis (F) are each enriched in the head relative to whole flies. BaraA-like genes (orange) were expressed more stochastically in the head, but also generally showed an enrichment pattern relative to whole flies (not always significant). Each data point represents an independent pooled sample from 20 male flies. Data were analyzed using one-way ANOVA with Holm’s-Sidak multiple test correction.

https://doi.org/10.1371/journal.pgen.1010259.s005

(EPS)

S6 Fig. The D. melanogaster BaraB gene acquired its non-immune role only recently.

A) Cladogram of the Melanogaster species group. The presence of a functional signal peptide (Fig 5A), and the disruption of the D. yakuba IM24 peptide by an in-frame insertion is noted. A summary of whether BaraB is an immune-induced orthologue (B-G) is annotated. B-G) Baramicin expression data from Melanogaster group flies either unchallenged or infected with M. luteus. BaraB is immune-induced in D. suzukii, D. sechellia, and D. mauritiana, but not in D. simulans and D. melanogaster, which both lack signal peptide structures. Drosophila yakuba BaraB is not immune-induced (C), has an insertion event in its IM24 peptide (Fig 5A), and its sister species D. erecta has pseudogenized its BaraB orthologue (Fig 5B), suggesting pseudogenization may explain the lack of immune induction in D. yakuba BaraB.

https://doi.org/10.1371/journal.pgen.1010259.s006

(EPS)

S1 Table. BaraB RNAi summary statistics.

Crosses used either the TRiP or KK BaraB-IR lines, driven by either Actin5C-Gal4 or elav-Gal4, sometimes including UAS-Dcr2. Rearing at 29°C and inclusion of UAS-Dcr2 increases the strength of RNA silencing. In the event there was no lethality, it was expected that emerging elav>TRiP-IR flies would follow simple mendelian inheritance. However both elav>TRiP-IR and elav>Dcr2, TRiP-IR resulted in partial lethality and occasional partial expansion wings (χ2 p < .02). Crosses using KK-IR used homozygous flies, and so we did not assess lethality using mendelian inheritance. However using this construct, no adults emerged when elav>Dcr2, KK-IR flies were reared at 29°C. Rare emergents (N = 11 after three experiments) occurred at 25°C, all of which bore partial expansion wings. Using elav-Gal4 at 29°C without Dcr2, we observed greater numbers of emerging adults, but 100% of flies had partial expansion wings. Finally, elav>KK-IR flies at 25°C suffered both partial lethality and partial expansion wings, but normal-winged flies began emerging (χ2 p < .001).

https://doi.org/10.1371/journal.pgen.1010259.s007

(PDF)

S1 Data. BaraA duplication status within the DGRP, with the caveat that our PCR assay may be sensitive to cryptic variation in the unresolved DGRP loci.

https://doi.org/10.1371/journal.pgen.1010259.s008

(XLSX)

S2 Data. Alignment of BaraB gene sequences from the DGRP showing the two variants either truncating or extending the BaraB coding sequence.

https://doi.org/10.1371/journal.pgen.1010259.s009

(RTF)

S3 Data. Ouputs from HyPhy analyses, with nexus tree files used in analyses and text file summaries of cumulative analyses per locus.

https://doi.org/10.1371/journal.pgen.1010259.s010

(ZIP)

S4 Data. Fly stocks used in this study.

https://doi.org/10.1371/journal.pgen.1010259.s011

(XLSX)

S5 Data. PCR primers used in this study.

https://doi.org/10.1371/journal.pgen.1010259.s012

(XLSX)

Acknowledgments

We would like to thank Maria Litovchenko for advice, Ana Marija Jakšić for generously providing DGRP flies, Huang et al. [29] for cooperation and discussion, Brian McCabe for consultation, and Florent Masson, Hannah Westlake, and others for commentary on our initial manuscript. The BaraBLC1 and BaraBLC4 mutations were graciously provided by Steven Wasserman and generated by Lianne Cohen, who we also thank for their critical involvement in characterizing Baramicin A.

References

  1. 1. Zanetti M. The role of cathelicidins in the innate host defenses of mammals. Curr Issues Mol Biol. 2005;7: 179–196. pmid:16053249
  2. 2. Hanson MA, Lemaitre B. New insights on Drosophila antimicrobial peptide function in host defense and beyond. Curr Opin Immunol. 2020;62: 22–30. pmid:31835066
  3. 3. Hanson MA, Lemaitre B, Unckless RL. Dynamic Evolution of Antimicrobial Peptides Underscores Trade-Offs Between Immunity and Ecological Fitness. Frontiers in Immunology. 2019;10: 2620. pmid:31781114
  4. 4. Sackton TB, Lazzaro BP, Clark AG, Wittkopp P. Rapid expansion of immune-related gene families in the house fly, musca domestica. Molecular Biology and Evolution. 2017. pmid:28087775
  5. 5. Vilcinskas A, Mukherjee K, Vogel H. Expansion of the antimicrobial peptide repertoire in the invasive ladybird Harmonia axyridis. Proceedings of the Royal Society B: Biological Sciences. 2013. pmid:23173204
  6. 6. Wang Y, Zhu S. The defensin gene family expansion in the tick Ixodes scapularis. Developmental and Comparative Immunology. 2011. pmid:21540051
  7. 7. Halldórsdóttir K, Árnason E. Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species. PeerJ. 2015;3: e976. pmid:26038731
  8. 8. Hellgren O, Sheldon BC, Buckling A. In vitro tests of natural allelic variation of innate immune genes (avian beta-defensins) reveal functional differences in microbial inhibition. Journal of Evolutionary Biology. 2010;23: 2726–2730. pmid:21121085
  9. 9. Chapman JR, Hill T, Unckless RL. Balancing selection drives maintenance of genetic variation in Drosophila antimicrobial peptides. Genome Biology and Evolution. 2019;11: 2691–2701. pmid:31504505
  10. 10. Jiggins FM, Kim KW. A screen for immunity genes evolving under positive selection in Drosophila. Journal of Evolutionary Biology. 2007;20: 965–970. pmid:17465907
  11. 11. Tennessen JA. Molecular evolution of animal antimicrobial peptides: Widespread moderate positive selection. 2005. https://doi.org/10.1111/j.1420-9101.2005.00925.x pmid:16313451
    • 12. Hanson MA, Hamilton PT, Perlman SJ. Immune genes and divergent antimicrobial peptides in flies of the subgenus Drosophila. BMC evolutionary biology. 2016;16: 228. pmid:27776480
    • 13. Unckless RL, Howick VM, Lazzaro BP. Convergent Balancing Selection on an Antimicrobial Peptide in Drosophila. Current Biology. 2016;26: 257–262. pmid:26776733
    • 14. Hanson MA, Dostálová A, Ceroni C, Poidevin M, Kondo S, Lemaitre B. Synergy and remarkable specificity of antimicrobial peptides in vivo using a systematic knockout approach. eLife. 2019;8. pmid:30803481
    • 15. Barajas-azpeleta R, Wu J, Gill J, Welte R. Antimicrobial peptides modulate long-term memory. PLoS Genetics. 2018; 1–26. pmid:30312294
    • 16. Toda H, Williams JA, Gulledge M. A sleep-inducing gene, nemuri, links sleep and immune function in Drosophila. Science. 2019;515: 509–515. pmid:30705188
    • 17. Lezi E, Zhou T, Koh S, Chuang M, Sharma R, Pujol N, et al. An Antimicrobial Peptide and Its Neuronal Receptor Regulate Dendrite Degeneration in Aging and Infection. Neuron. 2018;97: 125–138.e5. pmid:29301098
    • 18. Singanayagam A, Glanville N, Cuthbertson L, Bartlett NW, Finney LJ, Turek E, et al. Inhaled corticosteroid suppression of cathelicidin drives dysbiosis and bacterial infection in chronic obstructive pulmonary disease. Science Translational Medicine. 2019. pmid:31462509
    • 19. Ebrahim SAM, Talross GJS, Carlson JR. Sight of parasitoid wasps accelerates sexual behavior and upregulates a micropeptide gene in Drosophila. Nat Commun. 2021;12: 2453. pmid:33907186
    • 20. Kobler JM, Rodriguez Jimenez FJ, Petcu I, Grunwald Kadow IC. Immune Receptor Signaling and the Mushroom Body Mediate Post-ingestion Pathogen Avoidance. Curr Biol. 2020;30: 4693–4709.e3. pmid:33007248
    • 21. Hanson MA, Cohen LB, Marra A, Iatsenko I, Wasserman SA, Lemaitre B. The Drosophila Baramicin polypeptide gene protects against fungal infection. PLoS Pathog. 2021;17: e1009846. pmid:34432851
    • 22. De Lorenzi E, Chiari M, Colombo R, Cretich M, Sola L, Vanna R, et al. Evidence that the human innate immune peptide LL-37 may be a binding partner of amyloid-β and inhibitor of fibril assembly. Journal of Alzheimer’s Disease. 2017;59: 1213–1226. pmid:28731438
    • 23. Lee M, Shi X, Barron AE, McGeer E, McGeer PL. Human antimicrobial peptide LL-37 induces glial-mediated neuroinflammation. Biochemical Pharmacology. 2015;94: 130–141. pmid:25686659
    • 24. Dominy SS, Lynch C, Ermini F, Benedyk M, Marczyk A, Konradi A, et al. Porphyromonas gingivalis in Alzheimer’s disease brains: Evidence for disease causation and treatment with small-molecule inhibitors. Science Advances. 2019;5. pmid:30746447
    • 25. Abbott A. Are infections seeding some cases of Alzheimer’s disease? Nature. 2020;587: 22–25. pmid:33149296
    • 26. Brogden KA, Guthmiller JM, Salzet M, Zasloff M. The nervous system and innate immunity: The neuropeptide connection. Nat Immunol. 2005;6. pmid:15908937
    • 27. Gerdol M, Schmitt P, Venier P, Rocha G, Rosa RD, Destoumieux-Garzón D. Functional Insights From the Evolutionary Diversification of Big Defensins. Front Immunol. 2020;11: 758. pmid:32425943
    • 28. Casteels-Josson K, Capaci T, Casteels P, Tempst P. Apidaecin multipeptide precursor structure: a putative mechanism for amplification of the insect antibacterial response. The EMBO journal. 1993;12: 1569–78. pmid:8467807
    • 29. Huang J, Lou Y, Liu J, Bulet P, Jiao R, Hoffmann JA, et al. The BaramicinA gene is required at several steps of the host defense against Enterococcus faecalis and Metarhizium robertsii in a septic wound infection model in Drosophila melanogaster. bioRxiv; 2020 Nov.
    • 30. Suvorov A, Kim BY, Wang J, Armstrong EE, Peede D, D’Agostino ERR, et al. Widespread introgression across a phylogeny of 155 Drosophila genomes. Current Biology. 2021; S0960982221014962. pmid:34788634
    • 31. Mackay TFC, Richards S, Stone EA, Barbadilla A, Ayroles JF, Zhu D, et al. The Drosophila melanogaster Genetic Reference Panel. Nature. 2012;482: 173–8. pmid:22318601
    • 32. Leader DP, Krause SA, Pandit A, Davies SA, Dow JAT. FlyAtlas 2: A new version of the Drosophila melanogaster expression atlas with RNA-Seq, miRNA-Seq and sex-specific data. Nucleic Acids Research. 2018;46: D809–D815. pmid:29069479
    • 33. Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305: 567–580. pmid:11152613
    • 34. Quesada H, Ramos-Onsins SE, Aguade M. Birth-and-death evolution of the Cecropin multigene family in Drosophila. Journal of Molecular Evolution. 2005;60: 1–11. pmid:15696364
    • 35. Rolff J, Schmid-Hempel P. Perspectives on the evolutionary ecology of arthropod antimicrobial peptides. Philosophical Transactions of the Royal Society B: Biological Sciences. 2016;371. pmid:27160599
    • 36. Ferreira ÁG, Naylor H, Esteves SS, Pais IS, Martins NE, Teixeira L. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLoS Pathog. 2014;10: e1004507. pmid:25473839
    • 37. Neely GG, Hess A, Costigan M, Keene AC, Goulas S, Langeslag M, et al. A Genome-wide Drosophila screen for heat nociception identifies α2δ3 as an evolutionarily conserved pain gene. Cell. 2010;143: 628–638. pmid:21074052
    • 38. Li H, Janssens J, De Waegeneer M, Kolluru SS, Davie K, Gardeux V, et al. Fly Cell Atlas: a single-cell transcriptomic atlas of the adult fruit fly. Genomics; 2021 Jul.
    • 39. Hammonds AS, Bristow CA, Fisher WW, Weiszmann R, Wu S, Hartenstein V, et al. Spatial expression of transcription factors in Drosophila embryonic organ development. Genome Biol. 2013;14: R140. pmid:24359758
    • 40. Train C-M, Pignatelli M, Altenhoff A, Dessimoz C. iHam and pyHam: visualizing and processing hierarchical orthologous groups. Bioinformatics (Oxford, England). 2019;35: 2504–2506. pmid:30508066
    • 41. Delport W, Poon AFY, Frost SDW, Kosakovsky Pond SL. Datamonkey 2010: A suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics. 2010;26: 2455–2457. pmid:20671151
    • 42. Murrell B, Weaver S, Smith MD, Wertheim JO, Murrell S, Aylward A, et al. Gene-wide identification of episodic selection. Mol Biol Evol. 2015;32: 1365–1371. pmid:25701167
    • 43. Chakraborty M, Chang C-H, Khost DE, Vedanayagam J, Adrion JR, Liao Y, et al. Evolution of genome structure in the Drosophila simulans species complex. Genome Res. 2021;31: 380–396. pmid:33563718
    • 44. Swanson LC, Rimkus SA, Ganetzky B, Wassarman DA. Loss of the Antimicrobial Peptide Metchnikowin Protects Against Traumatic Brain Injury Outcomes in Drosophila melanogaster. G3 (Bethesda). 2020;10: 3109–3119. pmid:32631949
    • 45. Moir RD, Lathe R, Tanzi RE. The antimicrobial protection hypothesis of Alzheimer’s disease. Alzheimer’s & Dementia. 2018;14: 1602–1614. pmid:30314800
    • 46. Clemmons AW, Lindsay SA, Wasserman SA. An Effector Peptide Family Required for Drosophila Toll-Mediated Immunity. PLoS Pathogens. 2015;11. pmid:25915418
    • 47. Kim BY, Wang J, Miller DE, Barmina O, Delaney EK, Thompson A, et al. Highly contiguous assemblies of 101 drosophilid genomes. eLife. 2021;10: e66405. pmid:34279216
    • 48. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012. pmid:22543367
    • 49. Lemaitre B, Reichhart JM, Hoffmann JA. Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proceedings of the National Academy of Sciences of the United States of America. 1997;94: 14614–9. pmid:9405661
    • 50. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29: e45. pmid:11328886
    • 51. De Gregorio E, Spellman PT, Tzou P, Rubin GM, Lemaitre B. The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO Journal. 2002;21: 2568–2579. pmid:12032070
    • 52. Petersen AJ, Katzenberger RJ, Wassarman DA. The innate immune response transcription factor relish is necessary for neurodegeneration in a Drosophila model of ataxia-telangiectasia. Genetics. 2013;194: 133–142. pmid:23502677