Loss of function of lin-2 or frm-3 decreases locomotion speed

To assess LIN-2 and FRM-3’s impact on behavior, we measured locomotion speed in lin-2 and frm-3 mutants. The lin-2 gene encodes two isoforms, LIN-2A and LIN-2B, which share the PDZ, SH3, and GK domains while only LIN-2A contains the CaMK homology domain [34]. The lin-2(e1309) mutation deletes an N-terminal region of LIN-2A but has no effect on LIN-2B (Fig 1A). The frm-3 gene encodes three isoforms, two of which (FRM-3A and B) possess a FERM domain. The gk585 allele is a deletion disrupting both frm-3a and b (Fig 1C). Locomotion speed was significantly decreased in lin-2(e1309) mutants and frm-3(gk585) mutants (Fig 1E and 1F), suggesting that LIN-2A and FRM-3 are required for the function of the locomotion circuit. No additional decrease in locomotion speed was observed in lin-2(e1309); frm-3(gk585) double mutants, indicating that LIN-2 and FRM-3 act together to promote locomotion.

Because the lin-2(e1309) and frm-3(gk585) may not be null mutants, we used CRISPR to introduce early nonsense mutations in lin-2(syb1019) and frm-3(syb1036). The lin-2(syb1019) nonsense mutation is in an exon shared by LIN-2A and B (Fig 1A and 1B); consequently, both isoforms are inactivated by this allele. The lin-2(syb1019) mutants exhibited similar vulva development and egg-laying defects to those seen in lin-2(e1309) mutants. Similarly, the frm-3(syb1036) nonsense mutation is in an exon shared by the FRM-3A and B isoforms (Fig 1C and 1D). Hereafter, we refer to syb1019 and syb1036 as lin-2 and frm-3 null mutants respectively. The locomotion speed defects in lin-2 and frm-3 null mutants were similar to those in lin-2(e1309) and frm-3(gk585) mutants (Fig 1F). Together, these results reveal that LIN-2/CASK and FRM-3/FARP play important roles in locomotion behavior.

Cholinergic synaptic transmission is severely impaired in lin-2 and frm-3 mutants

We next asked if LIN-2/CASK and FRM-3/FARP are required for cholinergic synaptic transmission. C. elegans body wall muscles receive synaptic inputs from both cholinergic and GABAergic motor neurons [35]. Prior studies demonstrated that the synaptic abundance and mobility of UNC-49/GABA_A receptors (GABA_AR) at the NMJs are significantly disrupted in lin-2(e1309) and frm-3(gk585) mutants, leading to decreased amplitude of the miniature inhibitory postsynaptic currents (mIPSCs) [20,21]. By recording the miniature and stimulus-evoked excitatory postsynaptic currents (mEPSCs and evoked EPSCs) in lin-2(e1309) and frm-3(gk585) mutants, we found that the cholinergic excitatory synaptic transmission was also significantly impaired, with the mEPSC amplitude, and evoked EPSC amplitude and charge transfer being markedly decreased (Fig 2A, 2B, 2E and 2F). The mEPSC frequencies were also significantly decreased in lin-2(e1309) and frm-3(gk585) mutants (60% and 30% of WT; Fig 2B). The lin-2(e1309); frm-3 (gk585) double mutants exhibited similar synaptic transmission defects to those found in frm-3(gk585) single mutants, including mEPSCs and evoked EPSCs, indicating that LIN-2/CASK and FRM-3/FARP function together at the ACh NMJs.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 2. Cholinergic synaptic transmission is dramatically decreased in lin-2 and frm-3 mutants.

(A, B) Representative traces of mEPSCs and quantification of mEPSC frequency and amplitude from the indicated genotypes, including wild type, lin-2(e1091), frm-3(gk585), lin-2(e1091);frm-3(gk585), lin-2^null, and frm-3^null mutants. (C, D) Example traces of mIPSCs and summary of mIPSC frequency and amplitude from the same genotypes in A. (E, F) Evoked EPSC traces and quantification of EPSC amplitude and charge transfer. Data are mean ± SEM (*, p < 0.05, ***, p < 0.001 when compared to wild type; n.s., non-significant; one-way ANOVA). The number of worms analyzed for each genotype is indicated in the bar.

https://doi.org/10.1371/journal.pgen.1010211.g002

Compared to lin-2(e1309) mutants, lin-2 null mutants exhibited more severe defects in cholinergic synaptic transmission, including larger decreases in mEPSC frequency and amplitude, and evoked EPSC amplitude and charge transfer (Fig 2A, 2B, 2E and 2F). The mEPSC frequency in frm-3 null mutants was also significantly lower than in frm-3(gk585) mutants. Moreover, mIPSC frequencies, which were unaltered in lin-2(e1309) and frm-3(gk585) mutants, were significantly decreased in both lin-2 and frm-3 null mutants (Fig 2C and 2D). These results demonstrate that synaptic transmission was more severely impaired in the lin-2 and frm-3 null mutants, further establishing that these scaffolds play a pivotal role in the function of cholinergic synapses. It should be noted that LIN-2’s impact on cholinergic transmission does not require its other binding partners LIN-7/Velis and LIN-10/Mint [25,36], as the lin-7 and lin-10 mutants exhibited normal mEPSCs and evoked EPSCs (S1 Fig).

The decreased mEPSC amplitude suggests that postsynaptic ionotropic AChRs are disrupted in lin-2 and frm-3 mutants (e.g., decrease in synaptic abundance). It should be noted that smaller mEPSC amplitudes may cause some mEPSC events to become undetectable, thereby reducing mEPSC frequency. This is supported by the fact that mEPSC frequency is decreased by 55% in acr-16 mutants, which lack nicotine-sensitive receptors that are orthologous to mammalian CHRNA7 receptors (S2A and S2B Fig). Thus, the decreased mEPSC rates observed in lin-2 and frm-3 mutants could be caused by the decreased mEPSC amplitude. Moreover, the severe defects in mEPSCs but normal locomotion speed in the acr-16 mutants (S2C Fig) also explained the moderate decrease in locomotion in lin-2 and frm-3 mutants. Taken together, our results revealed that LIN-2/CASK and FRM-3/FARP play essential roles in cholinergic synaptic transmission, likely by promoting post-synaptic responses to ACh.

Muscle specific knockouts of lin-2 and frm-3 cause cholinergic transmission defects

LIN-2/CASK and FRM-3/FARP are expressed in both motor neurons and postsynaptic body wall muscles [20,21]. To determine which cells require LIN-2/CASK and FRM-3/FARP function, we generated lin-2(nu743 FLEX) and frm-3(nu751 FLEX) alleles that allow inactivation of these genes by the CRE recombinase. Using CRISPR, we introduced a stop cassette into lin-2 and frm-3 introns (in the opposite orientation). For both genes, the STOP cassette was inserted into an intron shared by both isoforms (Fig 3A). The STOP cassette is bounded by FLEX recombination signals mediating CRE-induced inversions. In this manner, CRE expression inverts the stop cassette thereby blocking expression of LIN-2(A and B) and FRM-3(A and B). Neuron-specific knockouts (KO) were made by expressing Psbt-1::Cre (termed Neuron^Cre) while body wall muscle KOs were made by expressing Pmyo-3::Cre (termed Muscle^Cre).

Download:

• PNG
  larger image
• TIFF
  original image

Fig 3. Conditional knockouts of lin-2 and frm-3 in muscle reduce cholinergic transmission.

(A) The STOP cassette is inserted into the common intron region in lin-2a and lin-2b, and in frm-3a and frm-3b. The presence of CRE inverts the STOP cassette to inactivate expression of lin-2 and frm-3 isoforms. (B) Example traces of mEPSCs from control (no expression of CRE), neuron KO (expressing CRE in all neurons driven by the sbt-1 promoter, Neuron^Cre), and muscle KO (expressing CRE in body wall muscles driven by the myo-3 promoter Muscle^Cre) of lin-2. (C) Quantification of mEPSC frequency, amplitude, decay, and charge in B. (D) Evoked EPSC traces from control, lin-2 neuron KO and muscle KO. (E) Quantitation of evoked EPSC amplitude, and charge transfer. (F, G) mEPSC traces and averaged mEPSC frequency, amplitude, decay and charge from control, frm-3 neuron KO, and frm-3 muscle KO. (H, I) Evoked EPSCs and summary of EPSC amplitude and charge transfer from control and frm-3 conditional KO mutants. Data are mean ± SEM (**, p < 0.01, ***, p < 0.001 when compared to control; one-way ANOVA). The number of worms analyzed for each genotype is indicated in the bar.

https://doi.org/10.1371/journal.pgen.1010211.g003

We next examined synaptic transmission following lin-2 and frm-3 muscle and neuron KO. Compared to control lin-2(nu743) and frm-3(nu751) mutants (lacking Cre expression), the frequency and amplitude of mEPSCs, and the amplitude and charge transfer of evoked EPSCs, were all severely reduced by Muscle^Cre, but were not changed by Neuron^Cre (Fig 3B–3I), demonstrating that LIN-2/CASK and FRM-3/FARP both promote cholinergic synaptic transmission by acting in body wall muscles. Similarly, Muscle^Cre also significantly decreased the mIPSC amplitude in lin-2(nu743) and frm-3(nu751) mutants (Fig 3B, 3C, 3F and 3G), indicating that LIN-2 and FRM-3 also act in muscle to regulate postsynaptic GABA_A receptors, consistent with prior studies [20,21]. However, unlike cholinergic synapses, Muscle^Cre decreased the mIPSC frequency by only 50% in lin-2(nu743) mutants (versus 90% in lin-2 null mutants), and did not change mIPSC frequency in frm-3(nu751) mutants. Collectively, these results indicate that LIN-2 and FRM-3 control synaptic transmission at both cholinergic and GABAergic synapses but that the detailed mechanisms likely differ at these two synapses.

We next analyzed the locomotion speed in lin-2 and frm-3 conditional knockout mutants. Our results showed that the speed is significantly decreased in lin-2 Muscle^Cre mutants (S3 Fig), consistent with that in lin-2 null mutants (Fig 1F). However, the speed is not altered in either the Muscle^Cre or Neuron^Cre mutants of frm-3. One possibility is that the efficiency of the Cre recombinase in frm-3(nu751) is not as strong as that in lin-2(nu743). This is likely because the mIPSC frequency is not decreased in frm-3 Muscle^Cre mutants, unlike frm-3 null mutants (Figs 1F and 2D).

Notably, the mEPSCs and evoked EPSCs in the Muscle^Cre mutants are comparable with those in the lin-2 and frm-3 null mutants (Fig 2), indicating that the cholinergic synaptic transmission defects result from the loss of LIN-2 and FRM-3 postsynaptic function.

The unchanged synaptic transmission in the Neuron^Cre mutants of lin-2 and frm-3 may arise from a failure of the Cre recombinase to inactivate lin-2 and frm-3 in ACh neurons. To address this concern, we asked if Cre recombinase expression could inactivate an essential pre-synaptic gene, unc-2. The unc-2 gene encodes the P/Q-type Ca²⁺ channel in C. elegans. Loss of unc-2 function leads to strong decrease in both locomotion rate and Ca²⁺-dependent neurotransmitter release [37,38]. The unc-2(nu657 FLEX) allele contains an inverted STOP cassette in intron 17. The presence of CRE is expected to inactivate unc-2, leading to behaviour and transmission defects. As shown in S4 Fig, Neuron^Cre in unc-2 (nu657) significantly decreased locomotion speed, mEPSC frequency, and evoked EPSC amplitude and charge transfer. These results are similar to those observed in unc-2 mutants, demonstrating that the Cre recombinase is highly efficient in cholinergic motor neurons.

LIN-2/CASK and FRM-3/FARP regulate the synaptic abundance of postsynaptic AChRs

The dramatic decrease in mEPSC amplitude in lin-2 and frm-3 null mutants suggests that the ionotropic AChRs are impaired in postsynaptic body wall muscles. There are two classes of ionotropic AChRs expressed on body wall muscles in C. elegans, nicotine-sensitive homo-pentameric receptors (nAChRs) consisting of five ACR-16/CHRNA7 subunits, and levamisole-sensitive hetero-pentameric receptors (L-AChRs) containing alternative α subunits (UNC-38, UNC-63, and LEV-8) and non-α subunits (UNC-29 and LEV-1) [39,40]. These two types of AChRs can be distinguished by their differential desensitization in response to long-time exposure to acetylcholine [41]. Moreover, because of the difference in channel conductance, activation of nAChRs elicits large and rapidly decaying responses, and L-AChRs produce small synaptic responses with slow decay when activated [42–44].

To estimate the synaptic abundance of nAChRs, we imaged ACR-16::RFP (expressed by the myo-3 promoter in a single copy transgene). ACR-16::RFP exhibits a punctate distribution in the nerve cords, consistent with previous observation [42]. Compared to wild-type animals, the lin-2 and frm-3 null mutants exhibited significantly reduced ACR-16::RFP puncta fluorescence in the dorsal nerve cord (Fig 4A and 4B), consistent with results reported in a recent study [24]. These observations are consistent with the decreased mEPSC and evoked EPSC amplitude (Fig 2). We next asked if loss of LIN-2 and FRM-3 alters the synaptic abundance of endogenously expressed L-AChRs, by analyzing the puncta intensity produced by the unc-29(kr208) allele, which contains an RFP tag [22]. Our data showed that the UNC-29::RFP puncta fluorescence was also remarkably decreased in both lin-2 and frm-3 null mutants (Fig 4C and 4D). There were no additional decreases in ACR-16::RFP and UNC-29::RFP in the lin-2;frm-3 double mutants (Fig 4B and 4D), suggesting that LIN-2 and FRM-3 function together to regulate both ACR-16/CHRNA7 and L-AChR synaptic abundance.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 4. LIN-2 and FRM-3 regulate the synaptic abundance but not surface expression level of AChRs.

(A-D) ACR-16::RFP and UNC-29::RFP synaptic abundance were decreased in lin-2^null and frm-3^null mutants. Representative images (A, C, scale bar 10 μm) and mean puncta intensity (B, D) are shown. The wild type is normalized to 1. (E-H) ACh- and Levamisole-activated currents were unaltered in lin-2^null and frm-3^null mutants. Representative traces (E, G) and mean current amplitude (F, H) are shown. (I, J) GABA-activated currents were decreased by 50% in lin-2^null mutants but were unchanged in frm-3^null mutants. Data are mean ± SEM (***, p < 0.001 when compared to control; one-way ANOVA). The number of worms analyzed for each genotype is indicated in the bar.

https://doi.org/10.1371/journal.pgen.1010211.g004

LIN-2 and FRM-3 regulation of post-synaptic AChRs is also supported by the altered kinetics of mEPSCs. In lin-2 and frm-3 null mutants, as well as their Muscle^Cre mutants, mEPSCs exhibited significantly slower decay kinetics (S5 Fig), which likely results from a greater contribution of L-AChRs to the synaptic current. These observations further suggest a defect in postsynaptic AChRs in lin-2 and frm-3 mutants. Together, our results demonstrate that LIN-2 and FRM-3 act in the same genetic pathway regulating the synaptic abundance of two classes of ionotropic AChRs in body wall muscles.

To examine the function of endogenous nAChRs and L-AChRs on the muscle surface, we measured acetylcholine- and levamisole-activated synaptic responses. A pulse application of ACh (0.5mM, 100ms) onto body wall muscle elicited a large and robust current in wild-type animals. In lin-2 and frm-3 null mutants, ACh-activated currents were indistinguishable from that in wild type (Fig 4E and 4F). Puffing levamisole (100μM, 100ms) produced a small but long-lasting current in wild-type animals, and the levamisole-evoked currents were also unaltered in lin-2 and frm-3 null mutants (Fig 4G and 4H). These results indicate that inactivating LIN-2 and FRM-3 did not alter the total expression level or surface delivery of nAChRs and L-AChRs in muscles. Instead, inactivating LIN-2 and FRM-3 prevent nAChRs and L-AChRs clustering or destabilize receptor clusters at synapses, resulting in decreased ACR-16::RFP and UNC-29::RFP puncta fluorescence and decreased mEPSC and evoked EPSC amplitudes.

The impact of LIN-2 and FRM-3 on post-synaptic AChR clustering is similar to their role at GABAergic synapses [20,21]. In lin-2(e1309) and frm-3(gk585) mutants, UNC-49::GFP/GABA_A puncta intensity and mIPSC amplitude were significantly decreased while currents evoked by exogenous GABA puffs were unchanged [20]. Because the null mutants of lin-2 and frm-3 displayed stronger transmission defects, we re-examined the effects of lin-2 and frm-3 knockouts on GABA_AR. We found that GABA-activated currents were significantly reduced (by 50%) in lin-2 null mutants but were unchanged in frm-3 null mutants (Fig 4I and 4J). These results suggest that LIN-2 also controls total surface GABA_AR levels in muscles.

To further confirm the regulation of LIN-2 and FRM-3 on the surface levels of AChRs and GABA_ARs, we also measured ACh-, levamisole-, and GABA-activated currents in the muscle cKO mutants of lin-2 and frm-3. Overall, the results were similar to those observed in the null mutants (S6 Fig). We only found a significant decrease in GABA-activated current in lin-2 Muscle^Cre mutants, providing further support for a previously unknown role of LIN-2 in the trafficking of GABA_ARs to the cell surface.

Synaptic morphology is normal in lin-2 and frm-3 mutants

Thus far, our results suggest that LIN-2 and FRM-3 are required for post-synaptic function; however, it remains possible that these scaffolds also have important pre-synaptic functions. To address this possibility, we examined the synaptic ultrastructure of cholinergic motor neurons. Morphometric analyses showed that the terminal size and total number of SVs in lin-2 and frm-3 mutants were indistinguishable from that in wild-type control (Fig 5A and 5B). These results indicate that lin-2 and frm-3 mutations do not have dramatic effects on the morphology of presynaptic terminals.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 5. Ultrastructural analysis of lin-2 and frm-3 mutants.

(A) Representative micrographs of wild-type control, lin-2^null mutant, and frm-3 ^null mutant synaptic profiles. Arrows indicate the dense projection. The terminal area is labelled by the dashed red line. Scale bar = 200 nm. (B) Quantification of synaptic terminal area (measured in μm²) and total number of SVs. Data are mean ± SEM.

https://doi.org/10.1371/journal.pgen.1010211.g005

SV abundance is not impaired in lin-2 and frm-3 mutants

To further examine the potential effects of LIN-2 and FRM-3 on presynaptic terminals, we examined SV abundance in lin-2 and frm-3 mutants. SV abundance was analyzed by imaging synaptic vesicle markers UNC-57::mCherry (expressed by the unc-129 promoter in a single copy transgene). UNC-57::mCherry fluorescence displays punctate distribution in dorsal nerve cord in wild-type animals (Fig 6A). Our data showed that UNC-57::mCherry in lin-2 and frm-3 mutants have comparable puncta fluorescence and density compared to wild-type controls (Fig 6B), indicating that presynaptic SV abundance is normal in these two mutants. These results are consistent with the observation in EM in which the total number of SVs is unaltered in lin-2 and frm-3 mutants (Fig 5B). Together, our results indicate that SV abundance is unchanged in lin-2 and frm-3 mutants, and consequently that the cholinergic transmission defects observed in these mutants are likely a consequence of post-synaptic defects.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 6. Presynaptic SV abundance is normal in lin-2 and frm-3 mutants.

Expression levels of UNC-57::mCherry was unchanged in lin-2^null and frm-3^null mutants. Representative images (A, scale bar 10 μm) and mean peak puncta intensity and puncta density (B) are shown. The wild type is normalized to 1. Data are mean ± SEM. The number of worms analyzed for each genotype is indicated in the bar.

https://doi.org/10.1371/journal.pgen.1010211.g006

The SH3 domain in LIN-2/CASK binds to both ACR-16 and UNC-29

The decreased nAChRs and L-AChRs in lin-2 and frm-3 mutants indicates that LIN-2/CASK and FRM-3/FARP may physically bind to these receptors and regulate their synaptic abundance. To test this, we performed yeast two-hybrid (Y2H) assays. Our data showed that LIN-2A could bind to the second cytoplasmic loop of both ACR-16 and UNC-29 (Fig 7A–7C), with stronger interaction with the ACR-16 loop than the UNC-29 loop. These results are consistent with the findings that lin-2 or frm-3 knockout led to a decrease in puncta fluorescence of AChRs (Fig 4). However, no direct interactions were detected between FRM-3 and the cytoplasmic loop of ACR-16 or UNC-29. By contrast, a recent study reported that ACR-16 binds both LIN-2 and FRM-3 [24]. This discrepancy could result from the use of different binding assays (i.e. Y2H versus GST pull-down). Nevertheless, since FRM-3 physically binds to LIN-2, FRM-3’s impact on AChRs is likely mediated by LIN-2/FRM-3/ACR-16 and LIN-2/FRM-3/UNC-29 ternary complexes.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 7. LIN-2/CASK binds to both ACR-16 and UNC-29 through SH3 domain.

(A) Summary of interactions by Yeast two-hybrid. Strong interaction (++); weak interaction (+), and no interactions (-) were indicated. (B) LIN-2A’s SH3 domain binds the ACR-16’s second intracellular loop (LoopII) in a Yeast two-hybrid assay. Y2HGold cells carrying indicated plasmids (Left) growing on selective media (-Trp/-Leu/-His/-Ade) is shown (Right). (C) LIN-2A’s SH3 domain binds the UNC-29’s second intracellular loop (LoopII) in the Yeast two-hybrid assay. (D-E) FRM-3 do not bind the ACR-16’s second intracellular loop (LoopII) (D) and UNC-29’s second intracellular loop (LoopII) (E) in the Yeast two-hybrid assay. (F-G) LIN-2A binds FRM-3 (F) and its FERM domain (G) requiring its PDZ domain, but not SH3 domain.

https://doi.org/10.1371/journal.pgen.1010211.g007

LIN-2 contains PDZ and SH3 domains that mediate protein-protein interactions. To examine which domain(s) in LIN-2 mediates the interaction with ACR-16 and UNC-29, we performed a Y2H assay to test the interaction of LIN-2’s PDZ and SH3 domains with ACR-16. Our results showed that the SH3 but not the PDZ domain directly binds to a cytoplasmic loop of ACR-16 (Fig 7A and 7B). Interestingly, the SH3 domain also mediates the interaction between LIN-2 and UNC-29 (Fig 7A and 7D). To test the role of other LIN-2 domains (e.g., CaM kinase, L27, and GK; Fig 1), we expressed a truncated LIN-2 protein lacking the SH3 domain (LIN-2ΔSH3), and found that LIN-2ΔSH3 did not detectably interact with ACR-16 and UNC-29 (Fig 7A and 7B). In contrast, LIN-2 lacking the PDZ domain (LIN-2ΔPDZ) still exhibited binding activity to both receptors (Fig 7A and 7B), demonstrating that the SH3 is the only domain mediating interaction with ACR-16 and UNC-29. Together, our results reveal that the LIN-2/FRM-3 complexes regulate the synaptic abundance of ionotropic AChRs, likely through binding and immobilizing clusters of AChRs on the postsynaptic cell surface.

The PDZ domain in LIN-2/CASK and the FERM domain in FRM-3/FARP are required for LIN-2/FRM-3 interaction

To understand how the LIN-2/FRM-3 complex is formed, we examined what domains in LIN-2 and FRM-3 mediate their interaction. In LIN-2, we focused on the central PDZ and SH3 domains. Consistent with our previous findings, strong interaction was observed between full-length LIN-2 and FRM-3 (Fig 7A and 7F) [20]. No interaction was detected between the SH3 domain and FRM-3, indicating that SH3 does not mediate the LIN-2/FRM-3 interaction (Fig 7A and 7F). This was confirmed by the LIN-2ΔSH3, which still exhibited strong binding to FRM-3 (Fig 7A and 7F). Like the SH3 domain, the isolated PDZ domain also did not exhibit binding to FRM-3. However, the LIN-2ΔPDZ failed to bind to FRM-3 (Fig 7A and 7F). This indicates that the PDZ domain is required for LIN-2/FRM-3 interaction, although it alone is not sufficient to mediate this interaction. In FRM-3, the FERM domain exhibited strong binding to both the full-length LIN-2 and the LIN-2ΔSH3, but not the SH3, PDZ, and LIN-2ΔPDZ (Fig 7A and 7G), similar to the binding pattern seen with full-length FRM-3. Taken together, our results demonstrate that LIN-2 binds to the FERM domain in FRM-3, and this interaction requires the PDZ domain in LIN-2.

Cholinergic transmission is decreased by deleting the SH3 or the PDZ domain in LIN-2/CASK

The interaction between LIN-2 SH3 and AChRs prompted us to investigate the functional importance of this domain. We deleted SH3 by CRISPR and analyzed synaptic transmission (Fig 8A; syb1921, ΔSH3). Our data showed that cholinergic transmission was dramatically decreased in ΔSH3 mutants, including mEPSC frequency and amplitude, evoked EPSC amplitude and charge transfer, and mEPSC charge (Fig 8B–8F). These results indicate that the SH3 domain is indispensable for LIN-2’s function, and the cholinergic synaptic transmission is determined by its interaction with AChRs. As the PDZ domain is required for LIN-2/FRM-3 interaction, we also tested whether it participates in the regulation of cholinergic synaptic transmission. Interestingly, deleting the PDZ domain (syb1937, ΔPDZ; Fig 8A) caused similarly stronger decrease in cholinergic transmission, demonstrating that the PDZ domain also plays essential roles in LIN-2’s synaptic function. Thus, our data suggest that the function of LIN-2/CASK in cholinergic synaptic transmission requires the PDZ domain, which recruits FRM-3/FARP, allowing LIN-2/FRM-3 complexes to bind AChRs via LIN-2’s SH3 domain.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 8. The SH3 and PDZ domains are indispensable for LIN-2 function.

(A) The SH3 domain and the PDZ domain are deleted in the endogenous lin-2 gene by crispr. (B-G) Cholinergic and GABAergic synaptic transmission were severely reduced in lin-2 ΔSH3 and ΔPDZ mutants. Representative traces of mEPSCs (B), evoked EPSCs (D), mIPSCs (F), quantitation of mEPSC frequency and amplitude (C), the amplitude and charge transfer of evoked EPSCs (E), and mIPSC frequency and amplitude (G) are shown. Data are mean ± SEM (***, p < 0.001 when compared to wild type; one-way ANOVA). The number of worms analyzed for each genotype is indicated in the bar.

https://doi.org/10.1371/journal.pgen.1010211.g008

The functional importance of the SH3 and PDZ domains was also evaluated in GABAergic synapses. The mIPSC amplitude in ΔSH3 and ΔPDZ mutants was decreased to a similar extent to that in lin-2 null mutants (Fig 8F and 8G). However, the mIPSC frequency was not changed in the ΔSH3 and ΔPDZ mutants, unlike the lin-2 null mutants (Fig 2). These results suggest that the mutant LIN-2 proteins are expressed and retain some function.

Collectively, our findings provide novel and interesting models regarding the functions of scaffolding proteins LIN-2/CASK and FRM-3/FARP in C. elegans NMJ (Fig 9). We demonstrate that LIN-2 and FRM-3 regulate the clustering and/or stabilization of nAChRs and L-AChRs in body wall muscles, without affecting their overall expression or delivery to the cell surface. These functions require the participation of the SH3 and PDZ domains of LIN-2, which mediate interaction with AChRs and FRM-3. At the GABAergic synapses, postsynaptic LIN-2 and FRM-3 are also involved in the regulation of GABA_ARs. Moreover, the delivery of GABA_ARs to the cell surface requires LIN-2 but not FRM-3.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 9. Model for LIN-2/CASK and FRM-3/FARP complex in cholinergic and GABAergic synapses.

See discussion for details.

https://doi.org/10.1371/journal.pgen.1010211.g009

CASK and FARP regulate cholinergic synaptic transmission

Since its discovery as a neurexin-binding protein [29], CASK has been found to be broadly involved in the regulation of cell-cell junction organization. The high homology of the C-terminal domains in CASK (e.g., PDZ, SH3, and GK) with other MAGUK proteins such as PSD95 has suggested that CASK may function similarly by acting as a scaffolding protein, while the presence of the unique N-terminal CaM kinase domain endows CASK additional functions in various cellular pathways [45]. In addition to neurexin, CASK also binds to many other membrane proteins, such as Mint-1, Velis, Syndecan, FARP, glycophorins, and SynCaM through its central PDZ domain [46–49]. The CASK homolog in C. elegans LIN-2 is required for vulva development and proper localization of the EGF receptor LET-23 [34,50].

Despite its functions in membrane organization, the physiological importance of CASK in synapses has been controversial. Knockout of CASK in mice causes lethal phenotype but does not affect the development of neurons. Cortical neurons lacking CASK display normal ultrastructural morphology and evoked EPSCs, whereas spontaneous glutamate release is increased but spontaneous GABA release is decreased [33]. In Drosophila, loss of CAKI, the CASK ortholog, leads to increased frequency of MEPPs without changes in MEPP amplitude [51]. However, a later study in Drosophila found reduced spontaneous and evoked neurotransmitter release, as well as decreased postsynaptic glutamate receptors in CASK knockout mutants [18].

FARP was first recognized as a synaptic component that is required for dendrite growth in spinal motor neurons [52]. Later studies revealed that FARP forms a synaptic complex with SynCAM1 through its FERM domain and functions as a synaptic organizer in cultured dissociated hippocampal neurons [53]. It is enriched at postsynaptic sites and increases synapse number and modulates spine morphology. At C. elegans NMJs, FRM-3/FARP and its binding protein LIN-2/CASK promote post-synaptic localization of GABA_AR, most likely by immobilizing receptors at post-synaptic specializations [20,21]. Here we describe LIN-2/CASK and FRM-3/FARP function at cholinergic synapses, finding that they regulate postsynaptic abundance of ionotropic AChRs.

Several lines of evidence suggest that LIN-2/CASK and FRM-3/FARP form a scaffold complex regulating synaptic transmission at the C. elegans NMJ. First, these two scaffolds physically bind each other [20,21]. Second, synaptic transmission defects in lin-2 and frm-3 mutants are comparable, and no additional decrease in the lin-2; frm-3 double mutants (Fig 1), demonstrating that they act in the same genetic pathway. Third, both scaffolds function in postsynaptic body wall muscle regulating the synaptic abundance of two classes of AChRs (Fig 4) [24]. Although post-synaptic currents are dramatically reduced, locomotion rates were only modestly reduced in lin-2 and frm-3 null mutants. This persistent locomotion behavior likely reflects the residual function of post-synaptic L-AChRs in these mutants. Prior studies of the Drosophila NMJ have proposed that neurexin may also be involved in the CASK and protein 4.1 complex (CASK/neurexin/4.1), which regulates glutamate receptor clustering [18]. However, it seems that the LIN-2/FRM-3 complex does not require neurexin for clustering and stabilizing ionotropic AChRs at the worm NMJ, as the worm mutants lacking nrx-1/neurexin exhibit normal mEPSCs and evoked EPSCs [20,54]. A recent study showed that the loss of γ-neurexin causes a moderate decrease in evoked EPSCs at the NMJ; however, the mEPSCs, including frequency and amplitude, are unchanged, indicating that the ionotropic AChRs are functionally normal [55].

Despite their expression in motor neurons, our data show that LIN-2 and FRM-3 are not required for SV fusion at the presynaptic terminals, evidenced by the normal mEPSCs and evoked EPSCs in lin-2 and frm-3 neuron cKO mutants (Fig 3). It remains possible that LIN-2 and FRM-3 may play important roles in other neuronal functions, e.g. promoting the localization of presynaptic inotropic receptors.

Functional roles of LIN-2A and LIN-2B isoforms in synaptic transmission

The C. elegans lin-2 locus expresses two isoforms: a long isoform (LIN-2A) that includes the N-terminal CaM kinase domain and a short isoform (LIN-2B) lacking this domain (Fig 1) [34]. It is believed that the lin-2 e1309 mutants express only the LIN-2B isoform, as the deletion removes the whole promoter region for LIN-2A and part of the CaM kinase domain (Fig 1A). Our data show that LIN-2A plays a more dominant role in cholinergic transmission, accounting for 70% of the evoked neurotransmitter release. The more severe decrease in cholinergic synaptic transmission including both mEPSCs and evoked EPSCs in the lin-2 null mutants demonstrates that the LIN-2B isoform also plays important roles in synaptic function. In GABAergic synapses, it seems the LIN-2B isoform plays similarly important role as LIN-2A, as the mIPSC amplitude was decreased by 20% in the e1309 mutants and was decreased by a further 20% in the null mutants, different from the observations in mEPSC amplitude (30% decrease in e1309 and 40% decrease in null). Moreover, the mIPSC frequency was severely decreased in the null mutants but was not changed in the e1309 mutants. These results suggest that LIN-2A and LIN-2B may function redundantly in GABAergic synapses (Fig 2D). A lin-2b specific knockout mutant may help to confirm this notion in future studies.

Our data suggest that both LIN-2A and LIN-2B are involved in the regulation of AChRs clustering and stabilization in cholinergic synapses, consistent with results reported in a recent study [24]. Knockout of either LIN-2A (e1309 mutant) or both LIN-2A and LIN-2B causes decreased mEPSC amplitude without altering puffing ACh- or Levamisole-activated currents (Figs 1 and 4), indicating normal AChRs trafficking and surface delivery. However, LIN-2A and LIN-2B appear to function differently in regulating GABA_ARs. The decreased mIPSC amplitude but normal puffing GABA-activated currents in the e1309 mutants [20], demonstrate that LIN-2A functions only for GABA_ARs clustering and stabilization. In contrast, the lin-2 null mutants exhibited a 50% reduction of puffing GABA-activated currents (S2 Fig), indicating that the LIN-2B isoform is more likely involved in the delivery or retention of GABA_ARs on the muscle surface. These results suggest that the two LIN-2 isoforms have different functions at cholinergic and GABAergic synapses. Our data do not distinguish the two FRM-3 isoforms, as both are disrupted in gk585 and null mutants. The impact of LIN-2 and FRM-3 on post-synaptic receptor clustering could be mediated (at least in part) by syndecan. This is supported by the recent findings that sdn-1/syndecan regulates the synaptic clustering of AChRs by recruiting LIN-2/CASK and FRM-3/FARP at the C. elegans cholinergic NMJs [24]. Future studies will investigate these possibilities, as well as other potential LIN-2/FRM-3 binding partners in organizing post-synaptic receptor clustering.

Several results suggest that the deficits in synaptic transmission observed in lin-2 and frm-3 mutants arise primarily from failure to cluster post-synaptic ACh and GABA receptors. Muscle specific lin-2 and frm-3 knockouts recapitulate the ACh and GABA NMJ electrophysiological and post-synaptic receptor clustering defects observed in the corresponding null mutants, whereas neuron specific knockouts had no effects. The ultrastructure of ACh and GABA pre-synaptic terminals and the localization of several pre-synaptic markers was unaffected in lin-2 and frm-3 null mutants. Collectively, these results suggest that pre-synaptic structure and function are largely unaffected by inactivating LIN-2 and FRM-3. Our results do not exclude the possibility that further analysis will reveal pre-synaptic functions for these scaffolding proteins, as has been described for mammalian synapses [33].

Strains

Animals were cultivated at room temperature on nematode growth medium (NGM) agar plates seeded with OP50 bacteria. On the day before experiments L4 larval stage animals were transferred to fresh plates seeded with OP50 bacteria for all the electrophysiological, imaging, and behavioural experiments. The following strains were used:

1. Wild type, N2 bristol
2. CB1309 lin-2(e1309)
3. PHX1019 lin-2(syb1019)
4. KP7338 frm-3(gk585)
5. PHX1036 frm-3(syb1036)
6. ZTH1032 lin-2(e1309);frm-3(gk585)
7. MT106 lin-7(n106)
8. KP7637 lin-10(n1508)
9. KP10507 lin-2(nu743, flex ON)
10. KP10609 lin-2(nu743, flex ON); nuSi502[Psbt-1::NLS-CRE::SL2::NLS-BFP]
11. KP10621 lin-2(nu743, flex ON); nuSi491[Pmyo-3::CRE]
12. KP10590 frm-3(nu751 FLEX ON)
13. KP10676 frm-3(nu751 FLEX ON); nuSi502[Psbt-1::NLS-CRE::SL2::NLS-BFP]
14. KP10677 frm-3(nu751 FLEX ON); nuSi491[Pmyo-3::CRE]
15. KP9579 unc-2(nu657, flex ON)
16. KP10796 unc-2(nu657); nuSi502[Psbt-1::NLS-CRE::SL2::NLS-BFP]
17. TXJ0502 nuSi0002[Pmyo-3::ACR-16::RFP]
18. TXJ0825 lin-2(syb1019); nuSi0002[Pmyo-3::ACR-16::RFP]
19. TXJ0822 frm-3(gk585); nuSi0002[Pmyo-3::ACR-16::RFP]
20. EN208 kr208 [Punc-29::UNC-29::tagRFP]
21. TXJ0569 lin-2(syb1019); kr208[Punc-29::UNC-29::tagRFP]
22. TXJ0816 frm-3(gk585); kr208[Punc-29::UNC-29::tagRFP]
23. KP9809 nu586[UNC-2::GFP11x7]; nuSi250[Punc-129::splitGFP1-10::SL2::UNC-57-mCherry::SL2::mTagBFP2]
24. TXJ0818 lin-2(syb1019); nu586[UNC-2::GFP11x7]; nuSi250[Punc-129::splitGFP1-10::SL2::UNC-57-mCherry::SL2::mTagBFP2]
25. TXJ1283 frm-3(syb1036); nu586[UNC-2::GFP11x7]; nuSi250[Punc-129::splitGFP1-10::SL2::UNC-57-mCherry::SL2::mTagBFP2]
26. PHX1921 lin-2 ΔSH3 (syb1921)
27. PHX1937 lin-2 ΔPDZ (syb1937)

Generation of lin-2 and frm-3 mutants

lin-2(syb1019) contains an opal stop codon at the first common region of LIN-2A (E420) or LIN-2B (E79). Forward genotype primer: tagtatccagcccgacgagt, reverse primer: gatgtgtggctaacgggtga. frm-3(syb1036) contains an amber stop codon at the first common region of FRM-3A (V36) or FRM-3B (V48). Forward genotype rimer: ccaaccaggtgcggatcata, reverse primer: cgagaagttgctcacctggt. lin-2 ΔSH3 (syb1921) contains a deletion from F637 to A718 for LIN-2A, or F296 to A377 for LIN-2B. lin-2 ΔPDZ (syb1937) contains a deletion from R545 to T620 for LIN-2A, or R204 to T279 for LIN-2B.

Transgenes and germline transformation

Transgenic strains were isolated by microinjection of various plasmids using either Pmyo-2::NLS-GFP (KP#1106) or Pmyo-2::NLS-mCherry (KP#1480) as the co-injection marker. The single copy insertion lines were generated using miniMos transposon [56].

CRISPR alleles

CRISPR alleles were isolated as described [57]. Briefly, unc-58 was used as a co-CRISPR selection to identify edited animals. Animals were injected with two guide RNAs (gRNAs) and two repair templates, one introducing an unc-58 gain of function mutation and a second modifying a gene of interest. Progeny exhibiting the unc-58(gf) uncoordinated phenotype were screened for successful editing of the second locus by PCR. Split GFP and split sfCherry constructs are described in [58].

MiniMOS inserts in which Pmyo-3 drives expression of either GFP 1–10 (nuTi144) or sfCherry 1–10 SL2 GFP 1–10 (nuTi458) were created using the protocol as described by [56].

Tissue specific frm-3 and lin-2 knockout was performed by introducing a stop cassette into introns in the ON configuration (i.e. in the opposite orientation of the target gene) using CRISPR, creating the frm-3(nu751, flex ON) and lin-2(nu743, flex ON) alleles. In frm-3(nu751, flex ON), the stop cassette was inserted into an intron shared by frm-3a and b (intron 3 of frm-3a). Similarly, the stop cassette in lin-2(nu743, flex ON) was inserted into an intron shared by both lin-2 isoforms (intron 3 of lin-2b). The stop cassette consists of a synthetic exon (containing a consensus splice acceptor sequence and stop codons in all reading frames) followed by a 3’ UTR and transcriptional terminator taken from the flp-28 gene (the 564bp sequence just 3’ to the flp-28 stop codon). The stop cassette is flanked by FLEX sites (which are modified loxP sites that mediate CRE induced inversions) [59]. In this manner, orientation of the stop cassette within the intron is controlled by CRE expression. Expression of the targeted gene is reduced when the stop cassette is in the OFF configuration (i.e. the same orientation as the targeted gene) but is unaffected in the ON configuration (opposite orientation). The endogenous flp-28 gene is located in an intron of W07E11.1 (in the opposite orientation). Consequently, we reasoned that the flp-28 transcriptional terminator would interfere with frm-3 and lin-2 expression in an orientation selective manner. A similar strategy was previously described for conditional gene knockouts in Drosophila [60].

Locomotion and behavioral assays

Young adult animals were washed with a drop of PBS and then transferred to fresh NGM plates with no bacterial lawn (30 worms per plate). Worm movement recordings (under room temperature 22°C) were started 10 min after the worms were transferred. A 2 min digital video of each plate was captured at 3.75 Hz frame rate by WormLab System (MBF Bioscience). Average speed and tracks were generated for each animal using WormLab software.

Fluorescence imaging

Worms were immobilized by 30 g/l 2,3-Butanedione monoxime (Sigma) and mounted on 2% agar on glass slides. Fluorescence images were captured by 100x (NA = 1.4) objective on an Olympus microscope (BX53). The mean fluorescence intensities of reference FluoSphere microspheres (Thermo Fisher Scientific) were measured during each experiment, and were used to control for illumination intensities changes. Multidimensional data were reconstructed as maximum intensity projections using Metamorph software (Molecular Devices). Line scans were analyzed in Igor Pro (WaveMetrics) using a custom script. The intensity of peak fluorescence of each marker was analyzed.

Electrophysiology

Electrophysiology was conducted on dissected C. elegans as previously described [54]. Worms were superfused in an extracellular solution containing 127 mM NaCl, 5 mM KCl, 26 mM NaHCO₃, 1.25 mM NaH₂PO₄, 20 mM glucose, 1 mM CaCl₂, and 4 mM MgCl₂, bubbled with 5% CO₂, 95% O₂ at 22°C. Whole-cell recordings were carried out at -60 mV for all EPSCs, including mEPSCs and evoked EPSCs. The holding potential was switched to 0mV to record mIPSCs. The internal solution contained 105 mM CH₃O₃SCs, 10 mM CsCl, 15 mM CsF, 4mM MgCl₂, 5mM EGTA, 0.25mM CaCl₂, 10mM HEPES, and 4mM Na₂ATP, adjusted to pH 7.2 using CsOH. Stimulus-evoked EPSCs were obtained by placing a borosilicate pipette (5–10 μm) near the ventral nerve cord (one muscle distance from the recording pipette) and applying a 0.4 ms, 85μA square pulse. Sucrose-evoked release was triggered by a 2s application of 0.5M sucrose dissolved in normal bath solution. For drug-activated current recordings, ACh, Levamisole, or GABA was pressure injected onto body wall muscle. All recordings were performed at room temperature (22°C).

Electron microscopy

Samples were prepared using high-pressure freeze fixation [61]. ~30 young adult hermaphrodites were placed in each specimen chamber containing E. coli and were frozen at -180°C under high pressure (Leica SPF HPM 100). Frozen specimens then underwent freeze substitution (Leica Reichert AFS) during which the samples were held at −90°C for 107 h in 0.1% tannic acid and 2% OsO₄ in anhydrous acetone. The temperature was then increased from 5°C/h to −20°C, kept at −20°C for 14 h, and increased by 10°C/h to 20°C. After fixation, samples were infiltrated with 50% Epon/acetone for 4 h, 90% Epon/acetone for 18 h, and 100% Epon for 5 hr. Finally, samples were embedded in Epon and incubated for 48 h at 65°C. Ultra-thin serial sections (50 nm) were cut and glued to a wafer, and counterstained in 0.08 mol/L citrate for 10 minutes. Images were acquired using a GeminiSEM460 scanning electron microscope operating at 5 kV. Images were collected from the ventral and dorsal nerve cord region anterior to the vulva for all genotypes. Cholinergic synapses were identified on the basis of their typical morphology and anatomical features [35]. A synapse was defined as a series of sections (profiles) containing a dense projection as well as two flanking sections on both sides without dense projections. Image acquisition and analysis using NIH ImageJ/Fiji software were performed blinded for genotype.

Yeast two-hybrid

The yeast two-hybrid assay was performed with the Matchmaker Gold Yeast Two-Hybrid System. Briefly, LIN-2A, LIN-2A-SH3, LIN-2A-PDZ, LIN-2A-ΔSH3, LIN-2A-ΔPDZ, FRM-3 and FERM were cloned into pGBKT7 as a bait vector. In addition, ACR-16-TM3-4(aa315-472) and UNC-29-TM3-4(aa318-445) were cloned into pGADT7 as a prey vector. The plasmid pairs were simultaneously transformed into the Y2HGold yeast cells. Transformants selected from the SD-Leu-Trp plates were restreaked onto SD-Leu-Trp-His-Ade plates to test interactions. Meanwhile, the pGBKT7-53 and pGADT7-T plasmids pair were used as positive controls, and pGBKT7-Lam and pGADT7-T plasmids pair were used as negative controls. False-positive from autoactivation was ruled out by co-transformation of pGBKT7-LIN-2A construct with pGADT7 empty vector alone.

Plasmids

Download:

• PNG
  larger image
• TIFF
  original image

https://doi.org/10.1371/journal.pgen.1010211.t001

Data acquisition and statistical analysis

All electrophysiological data were obtained using a HEKA EPC10 double amplifier (HEKA Elektronik) filtered at 2 kHz, and analyzed with open-source scripts developed by Eugene Mosharov (http://sulzerlab.org/Quanta_Analysis_8_20.ipf) in Igor Pro 7 (Wavemetrics). All imaging data were analyzed in ImageJ software. Each set of data represents the mean ± SEM of an indicated number (n) of animals. To analyze mEPSCs and mIPSCs, a 3.5pA peak threshold was preset, above which release events are clearly distinguished from background noise. The analyzed results were re-checked by eye to ensure that the release events were accurately selected.

Statistical analysis

All data were statistically analyzed in Prism 8 software. Normality distribution of the data was determined by the D’Agostino-Pearson normality test. When the data followed a normal distribution, an unpaired student’s t-test (two-tailed) or one-way ANOVA was used to evaluate the statistical significance. In other cases, a Mann-Whitney test or one-way ANOVA following Kruskal-Wallis test was used.