Skip to main content
Advertisement
  • Loading metrics

Heterogeneity of Human Neutrophil CD177 Expression Results from CD177P1 Pseudogene Conversion

  • Zuopeng Wu,

    Affiliations Translational Research Unit, Canberra Hospital, Woden, Australian Capital Territory, Australia, Clinical Trials Unit, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯
  • Rong Liang,

    Affiliation Australian Phenomics Facility, Australian National University, Australian Capital Territory, Australia

    ⨯
  • Thomas Ohnesorg,

    Affiliation Murdoch Children’s Research Institute, Department of Paediatrics, The University of Melbourne, The Royal Children's Hospital, Melbourne, Victoria, Australia

    ⨯
  • Vicky Cho,

    Affiliation Department of Immunology, The John Curtin School of Medical Research, Australian National University, Acton, Australian Capital Territory, Australia

    ⨯
  • Wesley Lam,

    Affiliation Translational Research Unit, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯
  • Walter P. Abhayaratna,

    Affiliation Clinical Trials Unit, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯
  • Paul A. Gatenby,

    Affiliation Department of Immunology, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯
  • Chandima Perera,

    Affiliation Department of Rheumatology, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯
  • Yafei Zhang,

    Affiliation Australian Phenomics Facility, Australian National University, Australian Capital Territory, Australia

    ⨯
  • Belinda Whittle,

    Affiliation Australian Phenomics Facility, Australian National University, Australian Capital Territory, Australia

    ⨯
  • Andrew Sinclair,

    Affiliation Murdoch Children’s Research Institute, Department of Paediatrics, The University of Melbourne, The Royal Children's Hospital, Melbourne, Victoria, Australia

    ⨯
  • Christopher C. Goodnow,

    Affiliation Department of Immunology, The John Curtin School of Medical Research, Australian National University, Acton, Australian Capital Territory, Australia

    ⨯
  • Matthew Field,

    Affiliation Department of Immunology, The John Curtin School of Medical Research, Australian National University, Acton, Australian Capital Territory, Australia

    ⨯
  • T. Daniel Andrews,

    Affiliation Department of Immunology, The John Curtin School of Medical Research, Australian National University, Acton, Australian Capital Territory, Australia

    ⨯
  • Matthew C. Cook

    Matthew.Cook@anu.edu.au

    Affiliations Translational Research Unit, Canberra Hospital, Woden, Australian Capital Territory, Australia, Department of Immunology, The John Curtin School of Medical Research, Australian National University, Acton, Australian Capital Territory, Australia, Department of Immunology, Canberra Hospital, Woden, Australian Capital Territory, Australia

    ⨯

Abstract

Most humans harbor both CD177neg and CD177pos neutrophils but 1–10% of people are CD177null, placing them at risk for formation of anti-neutrophil antibodies that can cause transfusion-related acute lung injury and neonatal alloimmune neutropenia. By deep sequencing the CD177 locus, we catalogued CD177 single nucleotide variants and identified a novel stop codon in CD177null individuals arising from a single base substitution in exon 7. This is not a mutation in CD177 itself, rather the CD177null phenotype arises when exon 7 of CD177 is supplied entirely by the CD177 pseudogene (CD177P1), which appears to have resulted from allelic gene conversion. In CD177 expressing individuals the CD177 locus contains both CD177P1 and CD177 sequences. The proportion of CD177hi neutrophils in the blood is a heritable trait. Abundance of CD177hi neutrophils correlates with homozygosity for CD177 reference allele, while heterozygosity for ectopic CD177P1 gene conversion correlates with increased CD177neg neutrophils, in which both CD177P1 partially incorporated allele and paired intact CD177 allele are transcribed. Human neutrophil heterogeneity for CD177 expression arises by ectopic allelic conversion. Resolution of the genetic basis of CD177null phenotype identifies a method for screening for individuals at risk of CD177 isoimmunisation.

Author Summary

Expression of the neutrophil-specific antigen CD177 varies across the population. 1–10% of humans are CD177null. CD177pos neonates born to CD177null mothers are susceptible to alloimmune neutropenia. Interestingly, CD177pos and CD177neg populations of neutrophils often exist together within individuals. The reasons for heterogeneous CD177 expression are not well understood. We deep sequenced the CD177 locus in individuals with different levels of CD177 expression, catalogued CD177 single nucleotide variants, and identified a premature stop codon that causes lack of CD177 expression. Comparison of messenger RNA from neutrophils with genomic CD177 DNA identified significant sequence similarity with CD177P1 pseudogene, which probably explains existing misannotation in public databases, but also explains susceptibility to cross-over errors. Indeed, we report that the stop codon responsible for the CD177null phenotype arises when exon 7 of CD177 gene is supplied entirely by CD177P1 by gene conversion. We also show that the proportion of CD177hi neutrophil numbers within individuals is a heritable trait, determined by the proportion of intact CD177 and converted CD177 alleles. Furthermore, within individuals, CD177 gene is differentially transcribed in CD177neg and CD177hi neutrophils. Our work resolves the genetic basis of CD177 phenotype and identifies a method for screening individuals at risk of CD177 isoimmunisation.

Introduction

CD177 (also known as neutrophil specific antigen B1 [NB1], human neutrophil antigen 2a [HNA-2a], and polycythemia rubra vera 1 [PRV1]) is a 56–64 kDa protein belonging to the Ly-6 family [1, 2], and is expressed exclusively on neutrophils by glycosylphosphatidylinositol (GPI)-linkage [3, 4]. CD177 expression is heterogeneous within the human population. 1–10% of people are CD177null, while the remainder harbor neutrophils that are bi- or tri-modal for CD177 expression [4–6].

Heterogeneity for neutrophil surface antigen expression within the population results in susceptibility to alloantibody formation due to loss of acquired immunological tolerance. Transplacental passage or transfusion of neutrophil antibodies have been implicated in severe neonatal alloimmune neutropenia (NAN) [7] and transfusion related acute lung injury (TRALI) [8, 9]. Polymorphic human neutrophil antigens (HNA) include CD16 or FcγRIIIb (HNA-1a, -1b, -1c and -1d, encoded by FCGR3B) [10], CD177 (HNA-2a, encoded by CD177) [11, 12], choline transporter-like protein 2 (HNA-3a) [13–15], CD11b (HNA-4a) and CD11a (HNA-5a) [16–19]. In some cases, the genetic polymorphisms that account for alloantigenicity have been resolved. For example, three separate alleles of FCGR3B (designated HNA-1a, -1b, and -1c) appear to account for CD16 alloantigenicity, and the different epitopes of each defined isoform are specified by variations of five amino acid exchanges [10, 20–22]. Similarly, single amino acid substitutions account for HNA-3a antigenicity [13, 14, 23]. Absence of HNA-1a, -1b, -1c, -1d, HNA-3a, HNA-4a and HNA-5a has been associated with formation of maternal alloantibodies [24, 25]. CD177 deficiency has also been shown to result in development of maternal alloantibodies that cause neonatal alloimmune neutropenia [11]. In addition, CD177 is pertinent to systemic vasculitis, since one of the principal autoantigens, proteinase 3, is a constituent of primary granules, but is exposed on the neutrophil surface in association with CD177 [26, 27]. Complete elucidation of the genetic basis of neutrophil alloantigenic variation is an important goal, since testing for neutrophil antibodies is technically challenging and limited in current clinical practice [28]. By contrast, identification of the genetic basis of antigen expression, particularly for absence of antigen, permits screening individuals at risk of generating specific antibodies in these disease settings [29].

Variation in CD177 expression has been the subject of previous investigations (S1 Table). Analysis of mRNA amplified from neutrophils of two CD177null donors showed two separate RNA insertions. In one case, there was an intronic fragment inserted into exon 6, and in the other an alternative 5’ end splicing donor of exon 4. Both were postulated to cause loss of CD177 expression by introducing an in-frame premature stop codon [30, 31] (S1 Fig). Further investigation revealed an association between certain CD177 single nucleotide variations (SNVs) and different CD177 phenotypes, although the mechanism to account for these effects was not elucidated, and the association was insufficient to permit diagnostic testing [32, 33]. More recently, a SNV of cDNA829A>T mutation that introduces a stop codon was identified in CD177 as a cause for loss of CD177 expression [34].

We set out to determine the genetic basis of inter- and intra-individual CD177 phenotypes, by deep sequencing neutrophil-derived genomic DNA across the CD177 locus. Taking this approach, we confirmed the stop codon identified by Li et al in CD177null individuals, but discovered that variation arises when exon 7 of CD177 gene is supplied entirely by allelic conversion with the CD177 pseudogene (CD177P1), which comprises sequences homolog of CD177 exons 4–9 on the minus strand. This variant is present within the germline rather than somatically acquired within neutrophils. Individuals who are homozygous for CD177 have higher CD177 expression, whereas individuals with ectopic CD177P1 exon 7 conversion have larger proportions of CD177neg neutrophils in the blood. We demonstrated that CD177 is a heritable trait determined by the ratio of CD177/CD177P1 alleles, and uncovered distinctive CD177 transcription in CD177neg and CD177hi neutrophils within the same individual. These findings resolve the basis of interindividual (CD177null versus CD177 expressing) and intra-individual (CD177neg versus CD177hi subsets) CD177 expression, and identify a method for screening for individuals at risk of CD177 isoimmunisation.

Results

CD177 heterogeneity

Our discovery cohort comprised 40 patients with systemic vasculitis (cohort 1), and emerged as part of investigation of expression of vasculitis-associated autoantigens (proteinase 3 (PR3), myeloperoxidase, and the associated alloantigen CD177). Our study population was made up of individuals of European, Asian and Australian self-reported ethnicity (S2A Fig). Consistent with previous reports [33, 35], we identified three neutrophil populations according to CD177 expression: negative (neg), intermediate (int) and high (hi). The majority of individuals were bi-modal for CD177 (CD177hi and CD177neg) (Fig 1A), while some individuals harbor a substantial proportion (>20%) of neutrophils expressing CD177 at intermediate levels (Fig 1B). In a larger cohort (n = 535) of healthy donors (cohort 2), 65.4% of the subjects’ neutrophils were predominantly CD177hi (Fig 1C), while in 24.7% of the cohort, the distribution of CD177hi and CD177neg were similar (CD177hi/neg). 2.6% (n = 14) were found to be CD177null. A similar prevalence of CD177 phenotypes were observed in both cohorts (S2B Fig). We found that CD177 phenotypes are stable within individuals over six months (S2C, S2D and S2E Fig). Flow cytometric analysis using two different CD177 monoclonal antibodies (MEM-166 and REA258) yielded similar results, indicating absence of CD177 expression rather than modification of a CD177 epitope in CD177null (Fig 1D).

thumbnail
Fig 1. CD177 expression in neutrophils.

A. Neutrophils of 5 subjects were gated on CD66b+ cells and analysed for surface expression of CD177. Three neutrophil subsets defined by CD177 expression were shown: negative (neg) in black, intermediate (int) in orange and high (hi) in pink, percentages of each subset were indicated as numbers in the same colour. B. Atypical CD177 expression with CD177int subset >20% of neutrophils. C. A dot plot showing percentages of CD177hi versus CD177neg of total neutrophils in healthy subjects, each dot represents one subject. Three major phenotypic groups were marked as CD177hi, CD177hi/neg, and CD177null. D. Contour plots showing neutrophils from a CD177null subject (left) and a tri-model CD177 expressing donor (right), co-stained with two CD177 specific monoclonal antibodies (MEM-166 and REA258).

https://doi.org/10.1371/journal.pgen.1006067.g001

Two exons with enriched SNV density and a novel stop codon variation in CD177 gene

We deep sequenced CD177 in cohort 1. To ensure that we did not miss somatic mutations we isolated genomic DNA using a custom capture array specifically from neutrophils purified from each subject. Loci containing all nine CD177 exons were isolated and deep sequenced (>9,000x) (Fig 2A). We identified 41 SNVs, including 17 in the coding regions (Fig 2A and 2B and Table 1). These included common non-synonymous SNVs in exon 5 (rs12981714, rs12980412 and rs12981771) in 39/40 subjects. We also identified three non-synonymous SNVs in exon 7 (rs200145410, rs200006364 and rs201266439) and three novel variants located within five nucleotides of each other in all 40 subjects. One of these novel variants (genomic location 19:43,361,169, c.787A>T, g.7497A>T in hg38) changes a lysine codon (AAA) to a stop codon (TAA). This variant was present in 100% of reads from two individuals with CD177null phenotype.

thumbnail
Fig 2. Two exons of enriched SNP density and a novel stop codon variation in CD177 gene.

A. Summary of deep sequencing of CD177 gene (located at 43.8Mb, band q13.2, of the forward strand of chromosome 19 in human genome 19, 43.3 Mb and q13.31 for hg38). Amplicons covering the entire coding sequence of 9 exons were sequenced. 100% coverage was obtained at indicated read depths. 24 low frequency SNPs were found in exon adjacent non-coding regions and 17 polymorphisms were identified in CD177 coding sequences. Representative allelic frequencies of nine SNPs in exon 5 and 7 are displayed according to CD177 phenotypes. Graphs were generated from Integrative Genomics Viewer from Broad Institute referenced on hg19. B. SNV frequency of 41 variants (called from hg19) in cohort 1. Each dashed line represents genotypes from a single individual. A schematic CD177 gene structure is shown of variants within CD177. C. Sanger sequencing of CD177 exon 7 in DNA isolated from neutrophils (upper panel) and saliva (lower panel) from three individuals same as shown in A. Reference (Ref) and variant (Var) read frequencies derived from deep sequencing and CD177 neutrophil phenotypes for each subject were indicated on the top of each panel.

https://doi.org/10.1371/journal.pgen.1006067.g002

thumbnail
Table 1. List of 17 protein-coding variations showed their incidence, genomic location, polymorphisms and alteration in amino acids (A.A.) in GRCh 37 (hg19) and updated version GRCh38 (hg38).

https://doi.org/10.1371/journal.pgen.1006067.t001

We designed a high throughput assay using two-tailed allele specific primers for universal energy-transfer amplification (Amplifluor PCR), which identifies reference g.7497A and variant T alleles [36]. This correctly identified all genotypes defined by deep sequencing, and confirmed that the variant allele occurs with frequencies of 100, 75 and 50% in our test cohort (S3D and S3E Fig). Next, we genotyped the 535 healthy subjects in cohort 2 (S3F Fig) and found a similar distribution of genotypes as in cohort 1 (S3G Fig). Analysis of population frequencies of CD177 g.7497 genotypes was similar in individuals from each ethnic group (S3H Fig).

Neutrophil CD177 variations are germline encoded

SNVs identified by deep sequencing were confirmed by Sanger sequencing (Fig 2C). In addition, we compared sequences obtained from genomic DNA isolated from saliva and neutrophils, to determine whether CD177 exon 7 variations were transmitted in the germline or arose spontaneously by somatic mutation in neutrophils, and whether variant alleles were represented at different frequencies in individuals with different neutrophil phenotypes. Results were perfectly concordant with those obtained by deep sequencing, and confirmed all CD177 sequence variants, including the novel stop codon CD177 g.7497T (K263X), in DNA from both neutrophils and saliva, and consistent with allelic ratios derived from deep sequencing in neutrophil-derived DNA (Fig 2A and 2C).

We also examined all variants by in silico prediction algorithms, as our recent analysis on de novo or low-frequency missense mutations revealed that deleterious effects might be over-estimated in animal models [37]. Although only the stop gain K263X variation segregates with altered CD177 expression, 5 out 17 (35%) coding variations in CD177 are predicted to be damaging with high scores of PolyPhen2, CADD and SIFT (S2 Table) [38, 39, 40]. A mutation significance cutoff (MSC) study demonstrated that with a 99% confidence interval (CI), CD177-specific cutoff for PolyPhen2 and CADD are 0.523 and 5.946 respectively, predicting high impact of five PolyPhen2 predicted and three CADD predicted damaging variations [41].

CD177 g.7497A allele frequency correlates with CD177 expression

We examined CD177 g.7497A allele frequency in individuals with different CD177 phenotypes in both cohorts. This analysis included a total of sixteen CD177null individuals. We observed a strong correlation between expression of CD177 and CD177 g.7497A allele frequency in cohort 2 (Fig 3A). In particular, all individuals homozygous for CD177 g.7497T were CD177null. Individuals with a g.7497A allele read frequency of 50% have larger proportions of CD177hi and fewer circulating CD177neg neutrophils than individuals with 25% A alleles (Fig 3B and 3C). These data are consistent with the proposition that presence of the reference g.7497A allele determines neutrophil CD177 expression, whilst the CD177 g.7497T allele specifies the abundance of CD177neg neutrophils. Exclusive presence of T at g.7497 accounts for the CD177null phenotype.

thumbnail
Fig 3. CD177 g.7497A allele frequencies correlate to neutrophil CD177 expression.

A—C. Association of reference allele frequency (g.7497A) with neutrophil CD177 expression measured by geometric mean fluorescence intensity (MFI) of CD177 on the cell surface of total neutrophils (A), percentages of CD177hi neutrophils (B), and CD177neg neutrophils (C) in the blood of cohort 2. D. Heat map of variant allele frequency (determined by deep sequencing) and neutrophil phenotypes (determined by flow cytometry) in cohort 1.

https://doi.org/10.1371/journal.pgen.1006067.g003

We expressed genotype-phenotype data according to all nucleotide variants identified by deep sequencing, and by reference to CD177 surface phenotypes in cohort 1 (Fig 3D). This makes obvious the concordance for read frequencies of each exon 7 variant. There is a correlation between each haplotype encompassing exon 7 and CD177 phenotype. We found 100% variant exon 7 reads in all CD177null individuals, 75% variant exon 7 reads in 7/9 of the individuals with the next lowest ratios of CD177hi to CD177neg cells, and 50% variant exon 7 reads in 26/28 individuals expressing the highest proportion of CD177hi cells.

CD177 novel variants reflect sequence divergence from CD177P1 pseudogene

According to Human Genome Assembly 106 (build 38), human chromosome 19 contains CD177 (CD_00019.10) separated by 10kb from the CD177P1 pseudogene, which comprises sequences homologous with CD177 exons 4–9 on the minus strand (NC_000019.10) (Fig 4A). Analysis of these reference sequences, and alternative sequences deposited in GenBank reveals uncertainty over the provenance of the variants we identified (Fig 4B). Comparison of human reference CD177 gene sequences with those from other mammalian species is informative for resolving this uncertainty (S4A, S4B and S4C Fig). The g.1991C>G variant identified in exon 4 (43,355,663, c.381C>G), which causes a proline to alanine (P128A) substitution, has not been reported in any of the reference sequences, and is not annotated in dbSNP. The exon 5 variants we identified as heterozygous in 39/40 subjects appear as discrepancies in reference sequences and probably reflect differences between CD177 gene and CD177P1. Most significantly, the exon 7 variant haplotype containing g.7497T appears to arise from CD177P1 (Fig 4B). We postulated that the CD177null phenotype arises when exon 7 reads are derived exclusively from CD177P1, while CD177 exon7 sequence is not detected in the genome of these individuals.

thumbnail
Fig 4. CD177 and CD177P1 variations.

A. CD177 locus on human chromosome 19 and a schematic comparison of CD177 and CD177P1 genes. B. Current annotation of three copy number variations of CD177 and CD177P1 gene polymorphisms. C. CD177 reference allele frequencies of two polymorphisms, g.1991C in exon 4 and g.7497A in exon 7, of cohort 1. Each dot represents one of 40 tested subjects. 15 out of 40 subjects displayed allele frequencies of g.1991C and g.7497A simultaneously at 50%. 14/40 subjects harboured similarly 50% g.7497A allele but 75% g.1991C. D. Proposed CD177/CD177P1 haplotypes in two loci of exon 4 (C/G) and exon 7 (A/T). CD177 gene in black line and CD177P1 in grey. The most frequent genotype is highlighted.

https://doi.org/10.1371/journal.pgen.1006067.g004

The sequence homolog between CD177 and CD177P1, along with detection of two bi-alleles of CD177 exon 4, 5 and 7 as described above, suggested that variations in these regions may reflect sequence divergence from CD177P1. To explore this proposition further, we examined the relation between variation g.1991C at 43,355,663 locus in exon 4 and g.7497A (43,361,169) in exon 7 across cohort 1 (Fig 4C and 4D). We recorded read frequencies of 25, 50 and 75% for g.1991C, but read frequencies of 0, 25 and 50% for g.7497A. Our observation of a maximum of 50% g.7497A reads is consistent with homozygosity for the T allele at the CD177P1 locus in the population. This was also most frequently observed in 29/40 subjects, in which 15/40 subjects were 50:50 heterozygous at both g.1991 in exon 4 and g.7497 in exon 7, suggesting homozygous reference alleles of C/C and A/A in the two loci of CD177 gene and ‘variant’ alleles G/G and T/T in CD177P1. Other possibilities included homozygosity at one locus but heterozygosity at the other, or heterozygosity at both loci. Possible haplotypes are shown in Fig 4D. Analysis of haplotypes between exon 4 and exon 5 showed similar results. Interestingly, linkage disequilibrium (LD) analysis with Genome1000 data are consistent with a haplotype block encompassing CD177P1 and only the 3’ region of CD177 (S5 Fig).

Phylogenetic analysis reveals CD177-like sequence in orang-utan and pygmy chimpanzee (S6 Fig). However, the exonic structure of CD177 varies considerably between mammalian species (S7 Fig), with evidence of gene duplication giving rise either to CD177-like genes (S8 Fig) or to CD177 itself. Thus, mouse Cd177 comprises 17 exons, and with significant nucleotide and protein sequence homology between the first and second halves of the molecule (S9 Fig). Both halves of mouse CD177 exhibit approximately 50% amino acid homology with human CD177 (S10 Fig).

CD177 expression is a heritable trait determined by the ratio of CD177/CD177P1 alleles

As another approach to evaluate the association between CD177 and CD177P1 genotypes and CD177 phenotypes, we examined CD177 expression according to the genotypes of parents and their offspring in families where parents exhibit different ratios of A and T at CD177.g7497 (Fig 5A–5D). In pedigree 1, both parents exhibit CD177hi phenotypes, and are sequenced for CD177.g7497A/T at 50:50 ratio according to electropherogram, from which we infer homozygous g.7497A in CD177, since CD177P1 is homozygous T. Consistent with this, their offspring shares the same genotype and phenotype (Fig 5A). In pedigree 2, the maternal phenotype is CD177hi and 50:50 CD177.g7497A/T, while the paternal phenotype is CD177hi/neg, with 25:75 CD177.g7497A/T, from which we infer A/T heterozygosity for CD177. The offspring is genotyped as 50:50 g.7497A/T (inheriting a reference CD177 allele from each parent), and exhibits a CD177hi phenotype (Fig 5B). By contrast, pedigree 3 illustrates similar parental genotypes and phenotypes to pedigree 2, but the offspring is 25:75 CD177.g7497A/T according to the electropherogram and exhibits a CD177hi/neg phenotype, suggesting a CD177 variant allele from the father (Fig 5C). Finally, in pedigree 4, both parents have 25:75 g.7497A/T genotype and CD177hi/neg phenotypes, and both offspring inherit similar phenotypes and genotypes (Fig 5D).

thumbnail
Fig 5. An inheritable phenotype of CD177 determined by ratio of CD177/CD177P1 alleles.

A-D. Pedigrees of 4 unrelated families with different CD177 geno- and phenotypes, all exhibit Mendelian inheritance. ⊕: female, ⊠: male; filled: CD177 exon 7, blank: CD177P1 exon 7. Genotypes were also shown in schematic structures, CD177 in orange and CD177P1 in blue, with g.7497A/T polymorphisms labelled in both alleles at CD177 and CD177P1 loci. Chromatograms showed genomic sequence trace of CD177 g.7497 labelled with ratio of Ref:Var in each subject. Histograms showed CD177 phenotypes, numbers in corresponding colours indicating percentages of neutrophil subsets, CD177neg in black, CD177int in orange, CD177hi in pink.

https://doi.org/10.1371/journal.pgen.1006067.g005

CD177/CD177P1 divergence confirmed by comparison of gDNA and cDNA sequences

In order to resolve the uncertainty of CD177 reference sequence, we compared sequences of CD177 gDNA and mRNA isolated from individuals who exhibited different CD177 phenotypes and harboured putative CD177 polymorphisms. We sorted CD177hi and CD177neg subsets from a subject whose 88% of neutrophils in the blood were CD177hi, amplified full-length CD177 cDNA from both subsets, and compared them with genomic DNA sequences determined by deep sequencing (Fig 6A). In individuals whose neutrophils are predominantly CD177hi, CD177 transcripts are homozygous c.787A. Variant c.787T transcripts were not detected, consistent with prediction of nonsense mediated decay (NMD) of CD177P1 transcripts.

thumbnail
Fig 6. Analysis of CD177 variations and CD177P1 divergence from gDNA and cDNA sequence.

A. CD177neg and CD177hi cells were sorted from an individual who predominantly express CD177hi in neutrophils (left). Sequencing traces showed CD177 codon variations at indicated loci, comparing results from gDNA deep sequencing (top), CD177 mRNA isolated from purified CD177hi cells (middle) and CD177neg neutrophils (bottom). The reference nucleotide sequences were labelled in colour letters below. The two SNPs present in gDNA and cDNA of both cell subsets were labelled (*). B. A schematic summary of the variations in gDNA and mRNA in neutrophils of this subject. Sequence variations were indicated on the top of the gene/transcript and exons were indicated (E2, E4 etc) below. CD177P1 nucleotides in exon 4, 5 and 7 were outlined. CD177P1 transcripts were shown in grey signifying expected NMD with the stop codon variation g.7497T in red.

https://doi.org/10.1371/journal.pgen.1006067.g006

We identified 11 CD177 polymorphisms in exons 2, 4, 5, 7 and 8, all apparently heterozygous (approximately 50% of reads). Exon 2 is absent from CD177P1, therefore, we inferred that g.242G>A is a SNP in CD177, which was confirmed by analysis of cDNA sequences (Fig 6B). Similarly, g.7968G>A in exon 8 appears to be a CD177 SNP, whereas other putative polymorphisms in exons 4, 5 and 7 were not found in CD177 transcripts (Fig 6A), suggesting that they represent divergence between CD177 and CD177P1 rather than CD177 SNPs (Fig 6B). In summary, g.1991C (exon 4), g.2368G, g.2427A and g.2431G (exon 5), and g.7492G, g.7496A, g.7497A, g.7500G, and g.7509A (exon 7) are CD177 gene reference sequences, and variants at these loci are actually derived from CD177P1.

Incorporation of CD177P1 exon 7 into CD177 locus causes distinctive CD177 transcription in CD177neg neutrophils

Next, we investigated the CD177 sequences in individuals with 25:75 ratio of g.7497A/T genotype, which confers CD177hi/neg neutrophil phenotypes. Once again, we compared genomic and transcript sequences but this time from a subject with approximately equal distributions of CD177hi and CD177neg neutrophils in peripheral blood. gDNA sequences revealed similar abundance of variations and references bases for seven SNPs in exons 2, 4, 5 and 6. By contrast, we observed a 25:75 ratio (reference to variant allele) for five SNPs in exon 7 (Fig 7A), consistent with presence of one copy of CD177 exon 7 and three copies of CD177P1 pseudogene derived sequence. A possible explanation is that one CD177 allele was partially replaced with CD177P1 homolog via ectopic gene conversion, yielding a chimeric CD177 allele containing a pre-mature stop codon (g.7497T) in exon 7 (Fig 7A and 7B).

thumbnail
Fig 7. Ectopic and allelic CD177P1 exon 7 conversion.

A. CD177hi and CD177neg neutrophils were sorted from a single donor with bimodal CD177 expression (left). Genomic variant allele frequencies were determined by deep sequencing (top), and compared with sequence variations in cDNA from CD177hi (middle) and CD177neg neutrophils (bottom). Two CD177 transcripts were found in CD177neg neutrophils. SNPs present in gDNA and cDNA of CD177neg subsets but absent from CD177hi cells are labelled (*). B. Schematic summaries of CD177 vs CD177P1 gDNA variations and CD177 mRNA in two neutrophil subsets. CD177P1 derived nucleotides in exon 4, 5 and 7 are outlined, suggesting one CD177 allele partially supplied by CD177P1 exon 7. C&E. Genomic sequence traces in indicated loci within exon 4, 5 and 7 of two CD177null individuals. Only CD177P1 exon 7 sequences are detected in CD177null subjects, who harbour both CD177 and CD177P1 upstream elements, i.e., exon 4 (C) and exon 5 (E). D&F. Schematic genomic CD177/CD177P1 structures of CD177null individuals as shown in C&E. G. Confirmation of ectopic and allelic CD177P1 exon 7 conversion in three subjects by MLPA. The plots show the peak ratio of probes for indicated loci of CD177 and CD177P1 genes. Exon 2 is used as a reference read out of the CD177 gene only; probes for exon 4, 5, 7 and 9 bind to both CD177 and CD177P1, whereas probes labelled as (P1) are specific to CD177P1 exon 5 and 7. The graph shows one copy duplication of CD177P1 exon 7 in blue in the same subject as shown in A & B; and two copies duplication (allelic conversion) in the two CD177null subjects (red & orange) as shown in C-F. The subject in red also shows duplication of CD177P1 exon 5 in concordant to C & D.

https://doi.org/10.1371/journal.pgen.1006067.g007

This hypothesis was lent additional support by the presence of distinctive CD177 transcripts in CD177neg and CD177hi cells within the same individual (Fig 7A). Monomorphic CD177 mRNA transcripts from the reference CD177 allele were recovered from CD177hi neutrophils. By contrast, two different transcripts were recovered from CD177neg neutrophils. Besides a same copy of CD177 reference transcript, a variant transcript was also recovered containing eight SNPs: c.92A/T, c.114G/A, c.751C/A, c.782G/C, c.786A/C, c.787A/T, c.790G/A and c.798A/G in CD177neg neutrophils. These SNPs corresponded exactly to genomic heterozygosity of g.220A/T and g.242G/A (exons 2), g.6724C/A (exon 6) and g.7492G/C, g.7496A/C, g.7497A/T, g.7500G/A and g.7509A/G (exon 7). Again, SNPs identified in exon 2 (g.220A>T and g.242G>A) and exon 6 (g.6724C>A) represented common variations in CD177 gene, whereas SNPs in exon 7 arose from CD177P1. CD177P1 derived exon 7 sequences were recovered in the cDNA. This demonstrated the expression of chimeric CD177 transcripts and supported the proposition of CD177P1 exon 7 incorporation in CD177 locus (Fig 7A and 7B). This finding proved that both intact and converted CD177 alleles are transcribed in CD177neg neutrophils, whereas CD177hi neutrophils express only reference allele. A mechanism of ectopic gene conversion also explains 25:75 (ref/var) ratio of polymorphisms in exon 7 of the gene.

To confirm this structural change, we performed MLPA using probes specific to different regions of CD177 and CD177P1 genes in relation to individuals with normal copy numbers of both genes. This analysis confirmed the presence of an additional copy of CD177P1 exon 7 (Fig 7G, sample 1 in blue), in concordance with deep sequencing data (Fig 7A). These results indicate ectopic gene conversion of CD177P1 exon 7 into the CD177 locus, resulting in 25:75 ratio of CD177 g.7497 A/T alleles.

Allelic gene conversion of CD177P1 results in CD177null phenotype

All CD177null subjects were homozygous for CD177P1 derived exon 7 sequence, suggesting an allelic gene conversion in the region (Figs 2A–2C, 7C–7F, S2D and S2F). Analysis of upstream variations implied different homologous recombination events among CD177null individuals. One subject harboured g.1991C>G polymorphism at 50:50 ratio (Fig 7C), indicating co-existence of two alleles of CD177 exon 4 (homozygous g.1991C) and two alleles of CD177P1 (homozygous G). By contrast, only CD177P1 derived sequence was found from exon 5 to exon 7 in the same individual, suggesting replacement of CD177 exon 5 to 7 by CD177P1 homolog in both alleles, and chromosomal crossover occurred between exon 4 and 5 (Fig 7C and 7D). Similarly, presence of both CD177 and CD177P1 sequences in exon 5 but exclusive CD177P1 sequence in exon 7 in another CD177null subject indicated homologous recombination between exon 5 and 7 (Fig 7E and 7F). MLPA confirmed the presence of 4 copies of CD177P1 exon 7 in both CD177null subjects, demonstrating allelic CD177 gene conversion (Fig 7G). Furthermore, duplication of CD177P1 exon 5 in one subject (red) but not in another (orange) confirmed various homologous recombination occurred in CD177null subjects (Fig 7G).

Our data from both deep sequencing and MLPA support an allelic gene conversion by CD177P1 exon 7 in CD177null subjects. CD177 exon 7 had been mistakenly annotated as a polymorphic pseudogene in GRCh37. It should be noted that current understanding for exon 5 sequence was incorrect too. Our data suggested that “reference” g.2368T, g.2427G and g.2431T according database were actually linked with other CD177P1 elements and “variant” genotypes of g.2368G, g.2427A and g.2431G should be annotated as CD177 sequence (Figs 6 and 7). Complete CD177 sequence in alignment with CD177P1 is shown in S11 Fig Taken together, these findings indicate that the stop codon responsible for the CD177null phenotype is derived from CD177P1. This chimeric CD177 gene has arisen by gene conversion. This would be consistent with both the allelic frequencies observed for exon 7 haplotypes, with the transcriptional analysis, and with gene structural analysis by MLPA. The allelic frequencies are in Hardy-Weinberg equilibrium (= 0.9998) based on the genotype frequencies in our large cohort 2 (Fig 8A and 8B).

thumbnail
Fig 8. Models for CD177 allelic arrangement and genotype-phenotype relation.

A. A proposed allelic arrangement model to account for CD177 variant read frequencies. CD177P1-derived segments are shown in blue boxes and g.7497T in red lines. CD177 genes are in yellow and g.7497A in green. Prevalence of each arrangement in cohort 2 is shown, together with calculated Hardy-Weinberg ratio. B. Model to account for observed CD177 genotype-phenotype relation.

https://doi.org/10.1371/journal.pgen.1006067.g008

Discussion

We report evidence for the genetic specification of heterogeneous CD177 phenotypes by ectopic and allelic conversion. We identified a novel polymorphism in exon 7 (g.7497A>T), encoding a stop codon in place of a lysine codon. Based on analysis of more than 9000 nucleotide reads from each individual and a large cohort over 500 subjects, we determined with a high level of confidence that this codon is present in all individuals. Most individuals have both lysine and stop codons detected, whereas in CD177null individuals, only the stop codon is detected which is derived from CD177P1 exon 7 conversion.

Previous studies have identified variations in the transcript of CD177 deficient individuals with no satisfactory explanation for the origin of the splicing error [30, 31]. Other investigators have identified SNVs within CD177 gene in association with expression [32, 33], and although this resulted in some progress, were ultimately inconclusive either because of the absence of full length genomic sequence of CD177, or the absence of CD177null subjects (S1 Table). As a result, the mechanisms that account or the CD177null phenotype have not been resolved. Recently, Li and colleagues independently identified the same putative nonsense mutation in CD177 gene reported here, and demonstrated that this variation account for lack of CD177 expression in transfected cells [34]. Our finding that the null allele arises by conversion from a pseudogene with close sequence homology helps to explain why previous results have been inconclusive. Indeed, we show that the CD177 reference sequences lodged in GenBank contain inconsistencies, and have resulted from assembly of sequences from the gene and pseudogene.

CD177P1 comprises orthologs of exons 4–9 of CD177 gene. Previous studies have unsuccessfully attempted to resolve the contributions of the CD177P1 [42, 43]. Resolution of this uncertainty has been achieved here with deep sequencing of captured CD177 alleles. We have identified portions of the CD177 gene that harbour variants with strict Mendelian inheritance, whereas exon 7 exhibits variant frequencies that could not be accounted for by the presence of just two alleles.

Our findings demonstrated that CD177 is sometimes a chimeric gene resulting from incorporation of a gene segment derived from CD177P1 (including exon 7). We provide evidence in this study that this chimeric gene has arisen by gene conversion. Gene conversion is a process of homologous recombination involving unidirectional transfer of genetic material to duplicated gene from its ancestor such as pseudogene [44]. A similar mechanism of gene conversion from pseudogenes resulting in insertion of a nonsense codon has been reported in chronic granulomatous disease, polycystic kidney disease, and B cell immune deficiency [45–47]. The presence of the homologous sequences in CD177 and CD177P1 has resulted in misannotation of CD177, and thwarted efforts to identify the genetic basis for the CD177null phenotype.

The explanation we propose for CD177null alleles within the population also appears to account for phenotypic heterogeneity. We observed a marked concordance between levels of CD177 expression and the number of CD177 exon 7 alleles. Thus, one allele (g.7497A read frequency of 25%, by ectopic CD177P1 conversion) is associated with lower levels of CD177 expression than two alleles (g.7497 read frequency 50%). Allelic frequency is supported by analysis of transcripts within neutrophils of subjects having various CD177 phenotypes.

CD177 expression not only varies across the population, but also within individuals. CD177neg cells appear to be distinguished from CD177hi neutrophils. In individuals heterozygous for CD177 exon 7, CD177neg cells harbor two CD177 transcripts containing CD177P1-derived exon 7 sequences, whereas CD177hi cells express only CD177-exon 7 containing transcripts. We have identified allelic and ectopic gene conversion as driving forces for CD177null and CD177neg expression respectively. Additional investigations are merited to explore mechanism of atypical CD177 expression (i.e., CD177int subset) within individuals, which might include epigenetic changes and posttranscriptional regulation.

Absence of self-antigen predispose to a breakdown in immunological tolerance upon exposure to self-antigen. Failure to acquire self-tolerance to neutrophil antigens places an individual at risk of developing antibodies to these antigens, either as natural antibodies, or after immunisation. For neutrophil antigens, this is likely to occur after exposure to fetal antigens, or less likely, after blood transfusion or allotransplantation. The consequences of passive transfer of neutrophil antibodies include TRALI, and neonatal immune neutropenia. Indeed, the first description of neonatal alloimmune neutropenia arose in the offspring of CD177nul mothers [11]. Despite the pathogenic role for anti-CD177 antibodies in TRALI and NAN, the lack of a method to genotype CD177 has prevented CD177 deficiency from being investigated in TRALI causing donors, TRALI patients [48], and pregnant women. For the first time, our study established a method to genotype CD177nul individuals with risk of anti-CD177 antibody development after pregnancies and infusions. Prospective studies will be necessary to characterise in more detail the requirements for alloimmunisation and antibody production in CD177null individuals.

In summary, we have identified the genetic variant that accounts for the CD177null phenotype and heterogeneous CD177 expression. The mechanism appears to result from insertion of a pseudogene derived sequence into the CD177 locus. Nevertheless, this event can be identified as apparent homozygosity for g.7497 of CD177 gene. This discovery makes it possible to screen individuals at risk of CD177 isoimmunisation.

Methods

Study subjects

Study subjects consisted of 40 patients with anti-neutrophil cytoplasmic autoantibodies (ANCA) associated vasculitis (AAV) (cohort 1) and 535 healthy subjects (cohort 2) were examined for CD177 genotypes and phenotypes, in an effort to elucidate neutrophil mediated autoimmunity. All research described was approved by the ACT Health Human Research Ethics Committee, under protocols ETH.11.11.269 and ETH.1.15.15. Participating subjects provided written informed consent.

Neutrophil isolation, flow cytometry and cell sorting

Anticoagulant citrate dextrose solution-treated fresh blood was layered on Ficoll-Paque Plus separation medium (GE Healthcare Life Science) at room temperature for 45 minutes to allow erythrocytes to sediment. Leukocytes with minimal residue erythrocytes after sedimentation were carefully layered on the top of 10 ml Ficoll-Paque Plus separation medium and centrifuged at 400g for 40 minutes without brake at room temperature. Neutrophils and peripheral blood mononuclear cells (PBMC) were then recovered to separate tubes [49].

Leukocytes (approximately 1x106) were stained with fluorescent conjugated antibodies for CD16 (3G8), CD66b (G10F5) from Biolegend, CD177 (MEM-166) from Abcam and CD177 (REA258) from Miltenyl Biotec in Ca++Mg++ free HBSS. Data were acquired on a FACSCanto II flow cytometer (BD Bioscience) and analysed using FlowJo software (TriStar). 1–2 million of CD177neg and CD177hi subsets were sorted on a BD FACS Aria II from CD66b+ neutrophils for sequencing and RNA analysis.

Sanger sequencing, amplifluor PCR, RT-PCR and MLPA

Genomic DNA was extracted from neutrophils and saliva using DNeasy Blood kit (Qiagen) and Oragen-DNA OG-500 kits (DNAgenoTec) respectively. CD177 exon 5 and 7 sequence was amplified with primers (CD177E5F: CAGCATCACTGACTCTCCC TC; CD177E5R: ATGCCCCATGTGTCATCGTG; CD177E7F: AGCTTTCCCTCTCACCCTC AG; CD177E7R: TCTGGGCCTCATTTCTCCACG), and examined in the Bioscience Research Facility.

Two allele specific forward primers and a single common reverse primer were designed to amplify across the polymorphisms at 19:43,361,164 (GRCh38) (CD177. g7492G/C). GAAGGTGACCAAGTTCATGCTGACTCACATCAACCCTGGTGGG (CD177F-1) and CD177F-2 (GAAGGTCGGAGTCAACGGATTGACTCACATCAACCCTGGTGGC) both had a 5’ tail corresponding to fluorophores FAM and HEX respectively. The common reverse primer was 86bp downstream within exon 7(CD177-R: CGAGGAGCAGAAGTGGGTAT). Amplification cocktails were prepared with KASP Master Mix (LGC Group). Fluorescences were measured after amplification. Allelic frequencies were discriminated using FLUOstar OPTIMA (BMG Labtech).

Neutrophil RNAs were extracted with TRIzol reagent (Invitrogen) and reverse transcribed into cDNA using Qiagen Reverse Transcription kit. Full length of CD177 transcript was amplified and sequenced with a pair of primers (CD177F: CTGGGGTTCATCCTCCCACT; CD177R: TTAGCAGGAAGGGCAAACCA).

Multiplex ligation-dependent probe amplification (MLPA) were performed using the MRC-Holland Salsa MLPA EK1 FAM reagent kit [50]. Probes were designed based on either homology or discrepancy between CD177 and CD177P1 genes following previously described criteria [51]. Oligonucleotides from Sigma-Aldrich are listed in Table 2. Probe mixes were prepared in water with each oligonucleotide at a final concentration of 4 fmol/ul and MLPAs were performed using 100ng gDNA. The products were separated by an ABI 3730 DNA Analyzer (Applied Biosystems). Trace data were analyzed using GeneMarker (Softgenetics). Peak heights were normalized to the average peak height of the control probes followed by normalization to the average peak height of the control samples in cohort 1 whose sequences indicated to have one copy of CD177 and CD177P1 gene respectively per chromosome. Threshold values for deletion were set at 0.75 and 1.25 for duplication.

Custom exon capture, deep sequencing, and data analysis

TruSeq Custom Amplicon libraries were prepared according to the manufacturer’s instruction (Illumina). 76 pairs of primers were designed for amplicons, covering the entire coding regions of three neutrophil antigen genes including CD177. High through-put paired-end sequencing was performed on the Illuminia MiSeq platform for 500 cycles in the Bioscience Research Facility. Primary processed FATSO files were analysed with MiSeq reporter and a homemade pipeline developed by the Immunogenomics Bioinformatics team. BAM files were viewed with integrative genomics viewer (the Broad Institute), comparing to reference human genome hg19 and converted to GRCh38 (hg38).

Supporting Information

S1 Table. Summary of studies on CD177 variations and expression.

https://doi.org/10.1371/journal.pgen.1006067.s001

(PDF)

S2 Table. In silico analysis of CD177 single nucleotide variants.

https://doi.org/10.1371/journal.pgen.1006067.s002

(PDF)

S1 Fig. A schematic structure of CD177 transcripts with premature stop codons identified.

https://doi.org/10.1371/journal.pgen.1006067.s003

(PDF)

S2 Fig.

A. Ethnicity of the study subjects in the two cohorts. B. Prevalence of CD177 phenotypes in both cohorts. C-E. Analysis of neutrophils for stability of CD177 phenotype over time.

https://doi.org/10.1371/journal.pgen.1006067.s004

(PDF)

S3 Fig.

A-C. Sequencing read depth for exons 4, 5 and 7 (A-C). D-F. Genotyping results for CD177 determined by Amplifluor assays. G. Prevalence of genotypes in both cohorts. H. Prevalence of genotypes by ethnicity.

https://doi.org/10.1371/journal.pgen.1006067.s005

(PDF)

S4 Fig. Nucleotide sequence alignment of CD177 exon 4 (A), 5 (B) and 7 (C) in human and mammal subsets.

https://doi.org/10.1371/journal.pgen.1006067.s006

(PDF)

S5 Fig. Linkage disequilibrium plots (expressed as r2 or D’) of CD177-CD177P1 locus using East Asian (CHS) and Central European (CEU) population data from Genome1000 project.

Figures were generated from Ensembl. 165 and 190 SNPs were examined in the two studies respectively. SNPs near exon 7 used in both studies were listed along the LD plots.

https://doi.org/10.1371/journal.pgen.1006067.s007

(PDF)

S6 Fig. Phylogenetic summary of CD177 and CD177 related sequences from selected primates.

https://doi.org/10.1371/journal.pgen.1006067.s008

(PDF)

S7 Fig. Exonic structure of CD177 in humans, chimpanzee, macaque, wolf, mouse and rat.

https://doi.org/10.1371/journal.pgen.1006067.s009

(PDF)

S8 Fig. Amino acid sequence alignment to human CD177 with mouse CD177 and human orthologs.

The PSI-Blast multiple sequence alignment was generated by hiden Markov model (HMM-HMM) matching with Phyre2 tools (www.sbg.bio.ic.au.uk/phyre2), colored by the properties of residues: Aromatic (dark green), Aliphatic (light green), charge (dark blue), hydroxylic (light blue), acidic (purple), basic (red) and sulfur containing (yellow) [52]. Genomic location of CD177 and orthologs are indicated in the schematic structure of chromosome 19q13.2 –q13.31.

https://doi.org/10.1371/journal.pgen.1006067.s010

(PDF)

S9 Fig. Amino acid sequence alignments of CD177 in humans, chimpanzee, macaque, wolf, mouse and rat.

Dashes indicate absence of corresponding amino acid. Human exons are shown in alternating blue and black text. Lysine subject to substitution from gene conversion is shown in red.

https://doi.org/10.1371/journal.pgen.1006067.s011

(PDF)

S10 Fig. Alignment of amino acids from first half (A) and second half (B) of mouse CD177 with human CD177.

Identity and E values determined by BLAST.

https://doi.org/10.1371/journal.pgen.1006067.s012

(PDF)

S11 Fig. Alignment of human CD177 nucleotide sequence with CD177P1.

Data was generated by Blastn CD177 gDNA sequence from Ensembl with some small gaps manually aligned. The alignment suggests that CD177P1 locus (43,372,742–43,379,123) should be expanded to 43,371,891–43,380,385, containing CD177 homologs from intron 3 / 4 to the end of exon 9 including 3’UTR. Dark blue and black letters indicates alternative exons, light blue letters represent intron retention. Polymorphic nucleotides in exon 4, 5, and 7 identified from this work have been highlighted and revised.

https://doi.org/10.1371/journal.pgen.1006067.s013

(PDF)

Acknowledgments

The authors thank the Departments of Immunology, Nephrology, Rheumatology, Clinical Trials Unit and Translational Research Unit in Canberra Hospital for their support, especially Mrs. Anastasia Wilson for helps with participant organization and data collection. We thank staffs at the Biomolecular Research Facility and Flow Cytometry Facility of the John Curtin School of Medical Research for technical assistance. We acknowledge and are grateful to all study participants for their generosity.

Author Contributions

Conceived and designed the experiments: ZW. Performed the experiments: ZW. Analyzed the data: ZW MCC TO AS WL. Wrote the paper: MCC. Contributed to project design: CP PAG WPA. Devised and supervised the study: MCC. Performed next-generation, Sanger Sequencing and genotyping: RL YZ BW. Performed MLPA: TO AS. RT-PCR: WL. Responsible for bioinformatics analysis: VC MF TDA CCG. Drafted the manuscript: ZW.

References

  1. 1. Stroncek DF. Neutrophil-specific antigen HNA-2a, NB1 glycoprotein, and CD177. Curr. Opin. Hematol. 2007;14(6):688–693. pmid:17898576
  2. 2. Caruccio L, Bettinotti M, Director-Myska AE, Arthur DC, Stroncek D. The gene overexpressed in polycythemia rubra vera, PRV-1, and the gene encoding a neutrophil alloantigen, NB1, are alleles of a single gene, CD177, in chromosome band 19q13.31. Transfusion. 2006;46(3):441–447. pmid:16533288
  3. 3. Skubitz KM, Stroncek DF, Sun B. Neutrophil-specific antigen NB1 is anchored via a glycosyl-phosphatidylinositol linkage. Journal of Leukocyte Biology. 1991;49(2):163–171. pmid:1825110
  4. 4. Goldschmeding R, van Dalen CM, Gaber N, Calafat J, Huizinga TW, van der Schoot CE, et al. Further characterization of the NB 1 antigen as a variably expressed 56–62 kD GPI-linked glycoprotein of plasma membranes and specific granules of neutrophils. Br. J. Haematol. 1992;81(3):336–345. pmid:1382544
  5. 5. Stroncek DF, Plachta LB, Herr GP, Dalmasso AP. Analysis of the expression of neutrophil-specific antigen NB1: characterization of neutrophils that react with but are not agglutinated by anti-NB1. Transfusion. 1993;33(8):656–660. pmid:8342232
  6. 6. Matsuo K, Lin A, Procter JL, Clement L, Stroncek D. Variations in the expression of granulocyte antigen NB1. Transfusion. 2000;40(6):654–662. pmid:10864984
  7. 7. Bux J. Molecular nature of antigens implicated in immune neutropenia. Int J Hematol. 2002;76:399–403. pmid:12430890
  8. 8. Muschter S, Berthold T, Greinacher A. Developments in the definition and clinical impact of human neutrophil antigens. Curr. Opin. Hematol. 2011;18(6):452–460. pmid:21912255
  9. 9. Bux J. Antibody-mediated (immune) transfusion-related acute lung injury. Vox Sang. 2011;100(1):122–128. pmid:21175662
  10. 10. Huizinga TW, Kleijer M, Tetteroo PA, Roos D, Borne von dem AE. Biallelic neutrophil Na-antigen system is associated with a polymorphism on the phospho-inositol-linked Fc gamma receptor III (CD16). Blood. 1990;75(1):213–217. pmid:2136803
  11. 11. Lalezari P, Murphy GB, Allen FH. NB1, a new neutrophil-specific antigen involved in the pathogenesis of neonatal neutropenia. Journal of Clinical Investigation. 1971;50(5):1108–1115. pmid:5552408
  12. 12. Stroncek DF, Shapiro RS, Filipovich AH, Plachta LB, Clay ME. Prolonged neutropenia resulting from antibodies to neutrophil-specific antigen NB1 following marrow transplantation. Transfusion. 1993;33(2):158–163. pmid:8430456
  13. 13. Greinacher A, Wesche J, Hammer E, Fürll B, Völker U, Reil A, et al. Characterization of the human neutrophil alloantigen-3a. Nat. Med. 2010;16(1):45–48. pmid:20037594
  14. 14. Curtis BR, Cox NJ, Sullivan MJ, Konkashbaev A, Bowens K, Hansen K, et al. The neutrophil alloantigen HNA-3a (5b) is located on choline transporter-like protein 2 and appears to be encoded by an R>Q154 amino acid substitution. Blood. 2010;115(10):2073–2076. pmid:20040764
  15. 15. Kommareddi PK, Nair TS, Thang LV, Galano MM, Babu E, Ganapathy V, et al. Isoforms, expression, glycosylation, and tissue distribution of CTL2/SLC44A2. Protein J. 2010;29(6):417–426. pmid:20665236
  16. 16. Hartman KR, Wright DG. Identification of autoantibodies specific for the neutrophil adhesion glycoproteins CD11b/CD18 in patients with autoimmune neutropenia. Blood. 1991;78(4):1096–1104. pmid:1678288
  17. 17. Simsek S, van der Schoot CE, Daams M, Huiskes E, Clay M, CcCullough J, et al. Molecular characterization of antigenic polymorphisms (Ond(a) and Mart(a)) of the beta 2 family recognized by human leukocyte alloantisera. Blood. 1996;88(4):1350–1358. pmid:8695853
  18. 18. Moritz E, Norcia AM, Gardone JD, Kuvano ST, Chiba AK, Yamamoto M, et al. Human neutrophil alloantigens systems. An. Acad. Bras. Cienc. 2009;81(3):559–569. pmid:19722024
  19. 19. Bux J. Human neutrophil alloantigens. Vox Sang. 2008;94(4):277–285. pmid:18208407
  20. 20. Ory PA, Goldstein IM, Kwoh EE, Clarkson SB. Characterization of polymorphic forms of Fc receptor III on human neutrophils. Journal of Clinical Investigation. 1989;83(5):1676–1681. pmid:2523415
  21. 21. Ory PA, Clark MR, Kwoh EE, Clarkson SB, Goldstein IM. Sequences of complementary DNAs that encode the NA1 and NA2 forms of Fc receptor III on human neutrophils. Journal of Clinical Investigation. 1989;84(5):1688–1691. pmid:2478590
  22. 22. Bux J, Stein EL, Bierling P, Fromont P, Clay M, Stroncek D, et al. Characterization of a new alloantigen (SH) on the human neutrophil Fc gamma receptor IIIb. Blood. 1997;89(3):1027–1034. pmid:9028335
  23. 23. Flesch BK, Reil A, Bux J. Genetic variation of the HNA-3a encoding gene. Transfusion. 2011;51(11):2391–2397. pmid:21564101
  24. 24. Stroncek DF, Alloimmune neonatal neutropenia due to an antibody to the neutrophil Fc-gamma receptor III with maternal deficiency of CD16 antigen. Blood. 1991;77(7):1572–1580. pmid:1826224
  25. 25. Porcelijn L, Abbink F, Terraneo L, Onderwater-vd Hoogen L, Huiskes E, et al. Neonatal alloimmune neutropenia due to immunoglobulin G antibodies against human neutrophil antigen-5a. Transfusion. 2011;51(3):574–577. pmid:20735765
  26. 26. Bauer S, Abdgawad M, Gunnarsson L, Segelmark M, Tapper H, Hellmark T. Proteinase 3 and CD177 are expressed on the plasma membrane of the same subset of neutrophils. J Leukoc Biol. 2007;81(2):458–64. pmid:17077162
  27. 27. von Vietinghoff S, Tunnemann G, Eulenberg C, Wellner M, Cristina Cardoso M, Luft Fc, et al. NB1 mediates surface expression of the ANCA antigen proteinase 3 on human neutrophils. Blood. 2007. 109(10):4487–93. pmid:17244676
  28. 28. Lucas G, Porcelijn L, Fung YL, Green F, Reil A, Hopkins M, et al. External quality assessment of human neutrophil antigen (HNA)-specific antibody detection and HNA genotyping from 2000 to 2012. Vox Sang. 2013;105(3):259–269. pmid:23663230
  29. 29. Sachs UJH, Reil A, Bauer C, Bux J, Bein G, Santoso S. Genotyping of human neutrophil antigen-5a (Ond). Transfus Med. 2005;15(2):115–117. pmid:15859977
  30. 30. Kissel K, Scheffler S, Kerowgan M, Bux J. Molecular basis of NB1 (HNA-2a, CD177) deficiency. Blood. 2002;99(11):4231–4233. pmid:12010833
  31. 31. Wolff J, Brendel C, Fink L, Bohle RM, Kissel K, Bux J. Lack of NB1 GP (CD177/HNA-2a) gene transcription in NB1 GP- neutrophils from NB1 GP-expressing individuals and association of low expression with NB1 gene polymorphisms. Blood. 2003;102(2):731–733. pmid:12623849
  32. 32. Caruccio L, Walkovich K, Bettinotti M, Schuller R, Stroncek D. CD177 polymorphisms: correlation between high-frequency single nucleotide polymorphisms and neutrophil surface protein expression. Transfusion. 2004;44(1):77–82. pmid:14692971
  33. 33. Moritz E, Chiba AK, Kimura EY, Albuguergue D, Guirão FP, Yamamoto M, et al. Molecular studies reveal that A134T, G156A and G1333A SNPs in the CD177 gene are associated with atypical expression of human neutrophil antigen-2. Vox Sang. 2010;98(2):160–166. pmid:19695014
  34. 34. Li Y, Mair DC, Schuller RM, Li L, Wu J. Genetic mechanism of human neutrophil antigen 2 deficiency and expression variations. PLoS Genet. 2015;11(5):e1005255. pmid:26024230
  35. 35. Meyerson HJ, Osei E, Schweitzer K, Blidaru G, Edinger A, Balog A. CD177 expression on neutrophils: in search of a clonal assay for myeloid neoplasia by flow cytometry. Am J Clin Path. 2013;140(5):658–669. pmid:24124144
  36. 36. Myakishev MV, Khripin Y, Hu S, Hamer DH. High-throughput SNP genotyping by allele-specific PCR with universal energy-transfer-labeled primers. Genome Res. 2001;11(1):163–169. pmid:11156625
  37. 37. Moisge LA, Field MA, Sontani Y, Cho V, Johnson S, Palkova A, et al., Comparison of predicted and actual consequence of missense mutations. Proc Natl Acad Sci USA. 2015;112(37):E5189–98. pmid:26269570
  38. 38. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et al. A method and server for predicting damaging missense mutations. Nat Methods. 2010; 7: 248–249. pmid:20354512
  39. 39. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 2009; 4: 1073–81. pmid:19561590
  40. 40. Kircher M, Witten DM, Jain P, O'Roak BJ, Cooper GM, Shendure J. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet. 2004; 46: 310–5.
  41. 41. Itan Y, Shang L, Boisson B, Ciancanelli MJ, Markle JG, Martinez-Barricarte R, et al. The mutation significance cutoff: gene-level thresholds for variant predications. Nat Methods. 2016; 13:109–110. pmid:26820543
  42. 42. Bettinotti MP, Olsen A, Stroncek D. The use of bioinformatics to identify the genomic structure of the gene that encodes neutrophil antigen NB1, CD177. Clin. Immunol. 2002;102(2):138–144.36. pmid:11846455
  43. 43. Dittmar K, Lim JB, Caruccio L, Bettinotti M, Stroncek D. Assessment of the relative number of copies of the gene encoding human neutrophil antigen-2a(HNA-2a), CD177, and a homologous pseudogene by quantitative real-time PCR. Immunohematology. 2003;19(4):122–126. pmid:15373677
  44. 44. Chen JM, Cooper DN, Chuzhanova N, Férec C, Patrinos GP. Gene conversion: mechanisms, evolution and human disease. Nat Rev Genet. 2007;10:762.
  45. 45. Watnick TJ, Gandolph MA, Weber H, Neumann HP, Germino GG. Gene conversion is a likely cause of mutation in PKD1. Human Molecular Genetics. 1998;7(8):1239–1243. pmid:9668165
  46. 46. Minegishi Y, Coustan-Smith E, Wang YH, Cooper MD, Campana D, Conley ME. Mutations in the human lambda5/14.1 gene result in B cell deficiency and agammaglobulinemia. J. Exp. Med. 1998;187(1):71–77. pmid:9419212
  47. 47. Görlach A, Lee PL, Roesler J, Hopkins PJ, Christensen B, Green ED, et al. A p47-phox pseudogene carries the most common mutation causing p47-phox- deficient chronic granulomatous disease. Journal of Clinical Investigation. 1997;100(8):1907–1918. pmid:9329953
  48. 48. Bux J, Becker F, Seeger W, Kilpatrick D, Chapman J, Waters A. Transfusion-related acute lung injury to HLA-A2-specific antibodies in recipient and NB1-specific antibodies in donor blood. Br J Haematol. 1996;93(3):707–13. pmid:8652399
  49. 49. Nauseef WM. Isolation of human neutrophils from venous blood. In: Quinn MT, DeLeo FR, ed. Neutrophil Methods and Protocols. Springer, pp13–18.
  50. 50. Ohnesorg T, Turbitt E, White SJ. The many faces of MLPA. Methods Mol. Biol. 2011;687:193–205. pmid:20967609
  51. 51. Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative qunatification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acid Res. 2002; 30:e57. pmid:12060695
  52. 52. Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc. 2015;10(6):845–58. pmid:25950237