Sample collection and RNA extraction

Collection and processing of samples were as previously described [2]. Twenty-four-hour composite samples were collected at the MO45 wastewater treatment facility and maintained at 4°C until they were delivered to the analysis lab, generally within 24 h of collection. Samples were then centrifuged at 3000× g for 10 min and followed by filtration through a 0.22 μM polyethersolfone membrane (Millipore, Burlington, MA, USA). Approximately 37.5 mL of wastewater was mixed with 12.5 mL solution containing 50% (w/vol) polyethylene glycol 8000 and 1.2 M NaCl, mixed, and incubated at 4°C for at least 1 h. Samples were then centrifuged at 12,000× g for 2 h at 4°C. Supernatant was decanted and RNA was extracted from the remaining pellet (usually not visible) with the QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA) using the manufacturer’s instructions. RNA was extracted in a final volume of 60 μL.

MiSeq

Similar to our previous protocol [2], the primary RBD RT-PCR was performed using the Superscript IV One-Step RT-PCR System (Thermo Fisher Scientific,12594100). Primary RT-PCR amplification was performed as follows: 25°C (2:00) + 50°C (20:00) + 95°C (2:00) + [95°C (0:15) + 55°C (0:30) + 72°C (1:00)] × 25 cycles using the MiSeq primary PCR primers CTGCTTTACTAATGTCTATGCAGATTC and NCCTGATAAAGAACAGCAACCT. Secondary PCR (25 μL) was performed on RBD amplifications using 5 μL of the primary PCR as template with MiSeq nested gene specific primers containing 5′ adapter sequences (0.5 μM each) acactctttccctacacgacgctcttccgatctGTRATGAAGTCAGMCAAATYGC and gtgactggagttcagacgtgtgctcttccgatctATGTCAAGAATCTCAAGTGTCTG, dNTPs (100 μM each) (New England Biolabs, N0447L) and Q5 DNA polymerase (New England Biolabs, M0541S). Secondary PCR amplification was performed as follows: 95°C (2:00) + [95°C (0:15) + 55°C (0:30) + 72°C (1:00)] × 20 cycles.

For Omicron exclusion amplification, the primary RBD RT-PCR was performed using the MiSeq primary PCR primers ATTCTGTCCTATATAATTCCGCAT and CCCTGATAAAGAACAGCAACCT (the first primer was changed to TATATAATTCCGCATCATTTTCCAC starting in May, 2022 to adapt to changing Omicron lineages) and secondary PCR used MiSeq nested gene specific primers containing 5′ adapter sequences (0.5 μM each) acactctttccctacacgacgctcttccgatctGTGATGAAGTCAGACAAATCGC and gtgactggagttcagacgtgtgctcttccgatctATGTCAAGAATCTCAAGTGTCTG.

A tertiary PCR (50 μL) was performed to add adapter sequences required for Illumina cluster generation with forward and reverse primers (0.2 μM each), dNTPs (200 μM each) (New England Biolabs, N0447L) and Phusion High-Fidelity or (KAPA HiFi for CA samples) DNA Polymerase (1U) (New England Biolabs, M0530L). PCR amplification was performed as follows: 98°C (3:00) + [98°C (0:15) + 50°C (0:30) + 72°C (0:30)] × 7 cycles +72°C (7:00). Amplified product (10 μl) from each PCR reaction is combined and thoroughly mixed to make a single pool. Pooled amplicons were purified by addition of Axygen AxyPrep MagPCR Clean-up beads (Axygen, MAG-PCR-CL-50) or in a 1.0 ratio to purify final amplicons. The final amplicon library pool was evaluated using the Agilent Fragment Analyzer automated electrophoresis system, quantified using the Qubit HS dsDNA assay (Invitrogen), and diluted according to Illumina’s standard protocol. The Illumina MiSeq instrument was used to generate paired-end 300 base pair reads. Adapter sequences were trimmed from output sequences using Cutadapt. Raw sequences are available in NCBI’s Sequence Read Archive under the bioproject PRJNA748354.

Computational analysis

Sequencing reads were processed similar to previously described [2]. Briefly, BBTools (Bushnell B. – http://sourceforge.net/projects/bbmap/) were used to merge paired reads, which were dereplicated with a custom script (https://github.com/degregory/Programs/blob/main/derep.py). Dereplicated sequences from RBD amplicons were mapped to the reference sequence of SARS-CoV-2 (NC_045512.2) Spike ORF using Minimap2 [9]. Mapped amplicon sequences were then processed with SAM Refiner using the same spike sequence as a reference and the command line parameters “--Alpha 1.6 --foldab 0.6”.

For Fig 1, SAM Refiner covariant deconvolution outputs were matched to defined variants to determine the relative abundance for each sample using a custom script (modified from https://github.com/istaves/covid-variant-counter). For Fig 2, the same outputs of SAM Refiner for MiSeq sequences were collected and were processed to determine core haplotypes of the cryptic lineage. First sequences that contained fewer than 4 polymorphisms relative to the reference Wuhan I sequence or matched officially named variants were discarded. Remaining sequences were then processed to remove polymorphisms that never appeared in a sample at an abundance greater than .5%. In-frame deletions bypassed this removal. Condensed sequences that appear in at least two samples or had a summed abundance of at least 2% across all samples were passed on to further steps. All sequences were rendered into the figures using plotnine.

Plasmids

The Δ19 spike clone with the D614G mutation, as previously described [10], was used as a starting template to generate the 22-10-04 spike and was digested using the restriction enzymes SacII and XhoI (New England Biolabs). The 12 missense mutations found in 22-10-04 were designed using A Plasmid Editor (ApE [11]), ordered as a gBlock (Integrated DNA Technologies), and inserted into the D614G Δ19 spike vector at the SacII and XhoI sites using the 5x In-Fusion Snap Assembly Master Mix (Takara Bio). The 22-10-04 clone was confirmed via Sanger Sequencing (Genomics Technology Core - University of Missouri). The vector for HIV-1-Gluc particles was previously described [12]. The GFP-N1 plasmid was originally provided by Clontech. All mAb plasmids were initially obtained as 4 μg maxipreps from Genscript, transformed into DH5α cells, and then isolated using the PureLink HiPure Plasmid Maxiprep Kit (Invitrogen). The plasmids for bamlanivimab included LY_CoV555_HC_pcDNA3.4 and LY_CoV555_LC_pcDNA3.4. The plasmids for etesevimab included CB6_HC_pcDNA3.4 and CB6_LC_pcDNA3.4. The plasmids for casirivimab included REGN10933_HC_pcDNA3.4 and REGN10933_LC_pcDNA3.4. The plasmids for imdevimab included REGN10987_HC_pcDNA3.4 and REGN10987_LC_pcDNA3.4.

Cell culture

The 293FT/ACE2/TMPRSS2 cells, as previously described [10], and the 293FT cells (ATCC) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM; Sigma-Aldrich) supplemented with 7.5% fetal bovine serum (FBS; Gibco), 1% minimum essential medium (MEM) vitamins, 1% non-essential amino acids (NEAA), 4 mM L-Glutamine, and 1 mM sodium pyruvate (Sigma-Aldrich).

Virus and antibody production

All transfections were done in 10 cm dishes with 293FT cells using polyethylenimine (PEI). For both HIV-1-Gluc pseudotyped particles, 9000 ng of provirus was co-transfected with 1000 ng of either the D614G Δ19 or the 22-10-04 spike expression vectors. For all mAb transfections (bamlanivimab, etesevimab, casirivimab, and imdevimab), 5000 ng of each light chain vector was co-transfected with 5000 ng of each respective heavy chain vector. Additionally, 300 ng of a GFP-N1 plasmid was co-transfected during both pseudoparticle and mAb productions to check for transfection efficiency, which was assessed using an Olympus IX70 Fluorescence Microscope to look for GFP production. At 3 days post-transfection, viral or mAb supernatant was collected and centrifuged at 3000 × g for 5 minutes, and then the supernatant was separated from the pellet and collected and frozen at -80°C for a minimum of 4 hours before use in the neutralization assays.

Neutralization and Gluc assays

During the viral neutralization assays, 96-well plates were prepared for mAb assessment. 50 μL of supplemented DMEM was added to wells 2-12. The first well of each plate received 100 μL of only antibody supernatant, and then the subsequent wells were serially diluted by transferring supernatant from the previous well. At the tenth well of each row, 50 μL of the dilution was discarded, ensuring a consistent volume of 50 μL in all wells.

Next, 50 μL of viral supernatant was added to wells 1-11 so that wells 11 in all rows serve as positive controls containing only virus, media, and cells (added after incubation). In contrast, wells 12 were negative controls with only cells (added after incubation) and media. The plates were incubated at 37°C with 5% CO2 for at least 1 hour. Following incubation, ~28,000 of the 293FT/ACE2/TMPRSS2 cells were added to each well of the 96-well plates and then incubated for 2 days. All neutralizations were performed in triplicate on each plate.

Two days post-infection, 20 μL of supernatant from all wells was collected and placed into a black 96-well plate. Then, 50 μl of 25 mM coelenterazine (CTZ; Nanolight Technology) suspended in phosphate-buffered saline (PBS; Cytiva) was added to all wells and placed into a PerkinElmer EnSpire 2300 Multilabel Reader to measure Gaussia luciferase activity. Infectivity was measured as relative light units (RLU).