Endoplasmic reticulum engagement of transcripts triggers VSG mRNA balancing in trypanosomes

Erick O. Aroko; Elisabeth Meyer-Natus; Christopher Batram; Kathrin Weißenberg; Jasmin Henning; Majeed Bakari-Soale; Nicola G. Jones; Markus Engstler

doi:10.1371/journal.ppat.1014518

Abstract

The cell surface of bloodstream-form African trypanosomes is covered by a dense coat of variant surface glycoproteins (VSGs). By periodically switching the expressed VSG antigen, parasites evade host immune responses. VSG mRNA constitutes ~10% of total cellular mRNA, and depletion of VSG transcripts is lethal. When two VSGs are expressed simultaneously, however, total VSG mRNA levels remain close to wild-type amounts, indicating the presence of a balancing mechanism that limits the overall abundance of these highly expressed transcripts. Using inducible and constitutive expression systems, we found that attenuation of endogenous VSG mRNA requires efficient engagement of ectopic transcripts with the endoplasmic reticulum (ER). This response occurs independently of efficient VSG protein production and does not require a VSG open reading frame. In contrast, abundant transcripts lacking functional ER-engagement signals fail to trigger balancing despite containing the VSG 3′ UTR 16-mer stability element. These results indicate that the signal for VSG mRNA regulation is the presence of abundant ER-engaged transcripts (i.e., transcripts undergoing co-translational targeting to the ER), rather than VSG-specific sequence features or productive protein synthesis. Based on our findings together with previous work, we propose an ER-engagement-coupled homeostatic attenuation mechanism in which increased ER-engaged transcript load elicits a regulatory response that reduces endogenous VSG mRNA abundance. This model links the cytoplasmic burden of ER-targeted transcripts to transcriptional control of the nuclear VSG expression site, providing a mechanism that could allow trypanosomes to couple secretory pathway capacity to surface antigen expression. Such a mechanism could enable trypanosomes to maintain secretory pathway homeostasis while supporting rapid surface-coat remodelling during antigenic variation.

Author summary

African trypanosomes evade the host immune system by regularly changing the variant surface glycoprotein (VSG) that coats their cell surface. At any given time, one VSG is expressed at very high levels, and the parasite tightly controls the total amount of VSG mRNA. Previous work showed that when an additional VSG is artificially expressed, the parasite compensates by reducing expression of the original VSG, a phenomenon termed “mRNA balancing.” However, the signal that triggers this response has remained elusive. Here, we show that mRNA balancing does not require production of a fully functional VSG protein. Instead, the response is triggered when large amounts of VSG mRNA, or other mRNAs encoding ER-targeted proteins, engage the endoplasmic reticulum (ER), the cellular compartment where secreted and surface proteins enter the secretory pathway. Our findings support a model in which VSG mRNA balancing is triggered by the abundance of ER-engaged mRNAs, rather than by successful assembly of a functional surface coat. This could provide a rapid way to adjust VSG expression and may help the parasite maintain surface homeostasis during immune evasion.

Citation: Aroko EO, Meyer-Natus E, Batram C, Weißenberg K, Henning J, Bakari-Soale M, et al. (2026) Endoplasmic reticulum engagement of transcripts triggers VSG mRNA balancing in trypanosomes. PLoS Pathog 22(8): e1014518. https://doi.org/10.1371/journal.ppat.1014518

Editor: Christine Clayton, Heidelberg University, GERMANY

Received: September 2, 2025; Accepted: August 4, 2026; Published: August 18, 2026

Copyright: © 2026 Aroko et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: M.E. acknowledges funding from the following sources: German Research Foundation grants (EN305, GRK 2157, SPP 1726, SPP 2332), German-Israeli Foundation for Scientific Research and Development grant (I-473-416.13/2018), European Union Innovative Training Network “Physics of Microbial Motility” grant (955910), German Federal Ministry of Education and Research, Network of University Medicine (NUM) “Organo-Strat”. E.O.A. was supported by the German Academic Exchange Service (Deutscher Akademischer Austauschdienst; DAAD) through a doctoral fellowship. The JEOL JSM-7500F electron microscope was funded by the German Research Foundation – 218894895 (INST93/761-1 FUGG). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

African trypanosomes parasitise humans and a wide range of mammals, causing sleeping sickness and Nagana, respectively. These parasites have a digenetic life cycle, shuttling between the mammalian hosts and their insect vector, the tsetse fly. The mammalian stage bloodstream form (BSF) parasites are extracellular, residing in the blood, lymph, and the interstitial fluid of various tissues. Therefore, African trypanosomes are under constant attack from the host’s immune system, and their cell surface has evolved as the first and most important line of defence. The cell surface of BSF Trypanosoma brucei is the best characterised compared to other African trypanosomes. This parasite is coated by a dense monolayer of an immunogenic glycosylphosphatidylinositol (GPI) anchored protein known as the variant surface glycoprotein (VSG). Other than providing an impenetrable protective shield to the parasites, the VSG coat is essential for antibody clearance and antigenic variation [1–3]. Together, these mechanisms ensure that the parasites stay ahead of the host’s immune responses.

As GPI-anchored proteins, nascent VSGs contain an N-terminal endoplasmic reticulum (ER) import signal peptide that is cleaved following translocation to produce the mature protein [4,5]. Although no strict consensus sequence has been defined for these naturally occurring ER import signals, cleavable signal peptides of secretory and GPI-anchored proteins share several common features. These include a positively charged N-terminal region (n-region), a hydrophobic core (h-region), and a polar C-terminal region (c-region) [6,7]. The c-region contains the signal peptidase cleavage site and typically harbours small, uncharged aliphatic residues at the -1 and -3 positions relative to the scissile bond [8,9]. Variations in the signal peptide sequence affect different aspects of protein biogenesis, including targeting and translocation, cleavage, and ER exit [6,10], and the hydrophobicity of the h-region has been reported to be vital in determining whether a substrate is translocated by the signal receptor particle (SRP) dependent or independent pathway in yeast [11].

Further, both the length and overall hydrophobicity of the h-region appear to be critical for efficient translocation [15]. T. brucei VSG ER import signal peptides are approximately 15–30 residues long and share the characteristic features for signal peptides in yeast and mammals [5,16,17].

Transcription of virtually all eukaryotic genes is monocistronic. However, most T. brucei protein-coding genes are arranged in polycistronic arrays transcribed by RNA polymerase II [18,19]. The long polycistronic transcripts are processed into mature mRNAs by trans-splicing of a 39-nucleotide spliced leader to the 5′ end and polyadenylation at the 3′ end of individual genes [20–22]. Due to this polycistronic arrangement of genes and a lack of transcriptional initiation control of individual genes, regulation of RNA levels in T. brucei is predominantly post-transcriptional [23]. RNA-binding proteins (RBPs) and sequence elements within the 3′ UTRs of genes are crucial for this post-transcriptional modulation of T. brucei gene expression [24,25]. Transcription of the major surface proteins in T. brucei is unusual in that it is driven by RNA polymerase I. In the BSF, a single VSG gene located in one of ~15 telomeric polycistronic VSG expression units known as the expression site (ES), is monoallelically expressed to ensure that only a single VSG is produced at a time from the vast repertoire of 2000 genes and pseudogenes [26,27]. The active ES localises to the extranucleolar expression site body (ESB) in the nucleus [28,29].

The expression of VSG is tightly regulated to ensure an intact coat is maintained both in vivo and in vitro. Down-regulation of VSG expression via RNAi or by blocking translation using morpholino oligonucleotides causes a precise pre-cytokinesis cell cycle arrest and subsequent cell death [30,31]. A study by Muñoz-Jordán et al. [32] showed T. brucei could be engineered to constitutively express two VSGs in equal amounts by integrating a second VSG gene just upstream of the active ES-resident VSG, generating a so-called double expressor. Integration of a second VSG gene downstream of the active ES promoter, approximately 60 kb upstream of the native VSG, also supported stable expression of two VSGs with roughly equal amounts of both mRNA and protein, that did not exceed the wild-type levels. In addition, when transcripts of one of the VSGs were depleted using RNAi, there was a compensatory effect by which the transcripts of the other VSG were upregulated to wild-type levels [33]. A similar apparent upregulation of the ectopic VSG expression was observed when the native ES-resident VSG was deleted by replacement with a blasticidin resistance gene [34]. VSG mRNA regulation has been shown not to require expression site residence. Inducible overexpression of an ectopic VSG121 from the ribosomal spacer region resulted in a fast and efficient exchange of the VSG mRNA population and protein, with similar kinetics in both monomorphic and pleomorphic trypanosomes [35,36]. In the monomorphic cell line, the ectopic VSG mRNA is rapidly upregulated to 80% of the wild-type levels within 2 h of inducing expression and this level of expression is maintained for at least 24 h. Concomitantly, the endogenous VSG mRNA is downregulated and reaches ⁓25% of wild-type amounts within 6 h of induction of expression [35]. Taken together, these observations strongly suggest the existence of a regulatory mechanism that maintains VSG mRNA abundance within a narrow range. However, the molecular trigger for this balancing response remains unknown.

One candidate signal that could be involved in VSG mRNA control is a conserved 16-mer sequence present in all T. brucei VSG 3′ UTRs that is essential for high expression and stability of VSG mRNA [37]. This sequence has been proposed to recruit a limiting RNA-binding factor that could potentially act as a counting mechanism [34]. Recently, it has been suggested that this limiting factor could be the 16-mer motif-dependent inclusion of N⁶-methyladenosine in the VSG poly(A) tails [38]. In another study the mRNA binding protein CFB2 was found to interact with the 16-mer motif, where it mediates VSG mRNA stability by recruitment of a stabilising complex. In addition, it was proposed that regulation of CFB2 levels might in turn limit VSG synthesis to avoid excess production [39]. However, by introducing premature termination codons (PTCs) in the ectopic VSG gene open reading frame (ORF), Maudlin et al. reported massively increased total VSG mRNA levels, thus questioning whether a direct counting mechanism for VSG mRNA exists [40].

Here, we show that the endogenous VSG mRNA regulation response is elicited only when ectopic transcripts are targeted to the ER. Consistent with this interpretation, high-level expression of ER-targeted GFP is sufficient to trigger attenuation of endogenous VSG mRNA. These findings indicate that the balancing response does not depend on the identity of the VSG open reading frame or efficient VSG protein production but instead correlates with the presence of abundant ER-engaged transcripts. We therefore propose that trypanosomes maintain secretory pathway homeostasis by attenuating endogenous VSG mRNA when the load of ER-engaged transcripts increases.

Thus, the counterbalancing of VSG mRNA levels appears to be a strategy for regulating the secretory pathway’s cargo and maintaining ER homeostasis. As the regulation is independent of the open reading frame, it could well facilitate the rapid exchange of surface coats during antigenic variation and developmental progression.

Results

Different T. vivax VSGs elicit distinct VSG mRNA balancing responses in T. brucei

The abundance of VSG mRNA in T. brucei is tightly regulated, and previous studies have suggested that sequence elements within the VSG transcript might contribute to this balancing mechanism. We therefore asked whether T. vivax VSG transcripts can trigger the VSG mRNA balancing response in T. brucei.

For this purpose, we selected two well documented T. vivax VSGs, ILDat1.2 (TriTrypDB: TvY486_0008160) and ILDat2.1 (GenBank: Z48228.1) [41–45], for inducible overexpression in T. brucei. This expression strategy was used because it enables monitoring of early events after induction of VSG expression, and it is not obscured by adaptive responses to constitutive ectopic VSG expression, which can occur during selection of transgenic parasites [35,46]. First, a construct for the expression of ILDat2.1 VSG was generated.

As the published ILDat2.1 sequence lacks a start codon [44], we added a start codon to the ILDat2.1 VSG open reading frame (S1 Table). Given that the conserved elements in the VSG 3′ UTRs are unique to T. brucei and essential for high levels of expression [34,37], a T. brucei VSG 3′ UTR sequence was fused to the ILDat2.1 VSG ORF, which was then integrated into the transcriptionally silent rDNA spacer region using the pLew82v4 vector (Addgene plasmid #24009). Expression of the ectopic VSG genes was driven by an ectopic tetracycline inducible T7 RNA polymerase promoter (Fig 1A) [35].

Download:

Fig 1. An endogenous VSG mRNA regulation response is not elicited upon induction of ILDat2.1 expression.

(A) Schematic of the ectopic VSG overexpression strategy. The ILDat2.1 construct was integrated into a transcriptionally silent rDNA spacer and expression of the VSG was driven by the T7 promoter in the presence of tetracycline. (B) Cumulative growth profiles of uninduced (-tet) and induced (+tet) 221^ES.ILDat2.1^tet cells. The data are averages from three independent clonal cell lines, with error bars representing ± standard deviation (SD). The parental 13-90 cells (P) served as a growth control. (C) Relative quantification of VSG mRNA levels in the presence (8 h) or absence (0 h) of tetracycline. Expression of VSG221 (left y-axis) is presented as a percentage relative to the VSG221 expression of the parental 13-90 cells while the ectopic ILDat2.1 value (right y-axis) is relative to the non-induced levels. The values are given as mean ± SD of three independent clones. The mRNA was normalised to tubulin. (D) Analysis of ILDat2.1 protein expression by SDS-PAGE after 24 h in the presence (+tet) or absence (-tet) of tetracycline. The parental 13-90 cells (P) served as the loading control and three independent clones (1 – 3) were analysed.

https://doi.org/10.1371/journal.ppat.1014518.g001

Inducing the expression of ILDat2.1 VSG in the 221^ES.ILDat2.1^tet cell line caused a minor reduction in proliferation (Fig 1B). We tested whether high levels of ILDat2.1 VSG mRNA were transcribed and if so, whether an endogenous VSG mRNA regulation response was triggered upon induction of expression. Quantitative dot blots carried out 8 h after induction showed an approximately 20-fold increase of the ILDat2.1 VSG mRNA. This increase was higher than the approximate 10-fold change recorded when wild-type T. brucei VSGs are expressed in this way. The endogenous VSG221 mRNA level was, however, not downregulated (Fig 1C). This contrasts with the regulation that occurs when T. brucei VSGs are overexpressed. No ILDat2.1 VSG protein was detectable by Coomassie staining, although low-level expression cannot be excluded (Fig 1D). As the endogenous VSG221 mRNA was not affected, and thus VSG221 protein levels remained high, the transgenic trypanosomes grew normally (Fig 1B-1D).

Despite strong accumulation of ILDat2.1 transcripts, endogenous VSG221 mRNA levels remained unchanged. Thus, high levels of a 16-mer–containing VSG transcript alone are insufficient to trigger VSG mRNA balancing.

Induction of expression of a second T. vivax VSG, ILDat1.2 VSG (S1 Table), in the 221^ES.ILDat1.2^tet cell line, led to a different phenotype, namely a significant slowing in growth within 24 h and complete stalling thereafter (Fig 2A). Quantitative dot blots carried out 8 h after inducing expression showed that a high amount of ILDat1.2 VSG mRNA was present, with a concomitant reduction of the endogenous VSG221 mRNA to 20% of the wild- type levels (Fig 2B). This phenotype contrasted with that observed for VSG ILDat2.1; however, the reason for this difference was difficult to interpret. Furthermore, the analysis of ILDat1.2 expression showed that the protein was produced in only low amounts in two of the three clones analysed (Fig 2C), differing from what happens when T. brucei VSGs are overexpressed. This means that downregulation of the endogenous VSG mRNA, in addition to the insufficient production of the ectopic ILDat1.2, resulted in a shortage of VSG protein and slowed parasite growth, which eventually led to cell death.

Download:

Fig 2. The endogenous regulation response is elicited upon induction of ILDat1.2 VSG expression.

(A) Cumulative growth of the 221^ES.ILDat1.2^tet cell line in the presence (+tet) or absence (-tet) of tetracycline. The data are averages of three independent clones and the error bars represent ± SD. The parental 13-90 cells (P) served as a growth control. (B) Relative quantification of mRNA levels of the ectopic ILDat1.2 expressed from an rDNA spacer and the endogenous VSG221 using dot blots. The cells were induced to express the ectopic VSG for 8 h. Expression of VSG221 (left y-axis) is given as a percentage relative to the VSG221 expression of the parental 13‑90 cells while the ectopic ILDat1.2 value (right y-axis) is relative to the non-induced levels. VSG transcript levels were normalised to tubulin and the results given as means of three independent clones. The error bars indicate the SD. (C, D) SDS-PAGE analyses of protein expression of wild-type ILDat1.2 (C) and ILDat1.2 with its GPI signal sequence replaced by that of the T. brucei VSG MITat1.11 (ILDat1.2*) (D) after 24 h in the presence (+tet) or absence (-tet) of tetracycline. The parental 13-90 cells (P) served as a reference. Three independent inducible clonal cell lines were analysed.

https://doi.org/10.1371/journal.ppat.1014518.g002

In search for the cause of the poor production of ILDat1.2 VSG protein, we examined whether the native ILDat1.2 GPI-anchoring signal functions efficiently in T. brucei. We replaced the C-terminal GPI-signal sequence with that of T. brucei VSG MITat1.11 (S1 Table). This ILDat1.2 VSG transgene was highly expressed on both mRNA and protein levels (Fig 2D), and cell growth was normal (S1 Fig).

These results demonstrate that, in principle, a T. vivax VSG transcript fused to a T. brucei VSG 3′ UTR can elicit VSG mRNA balancing in T. brucei. However, the balancing response was only observed in the ILDat1.2 overexpression cell line but not in the ILDat2.1 overexpression cell line. This discrepancy prompted us to investigate which feature of the ectopic transcript determines whether VSG mRNA balancing is triggered.

Functional ER import signals determine whether ectopic VSG transcripts trigger mRNA balancing

We then also replaced the native ILDat2.1 GPI anchor signal with that of T. brucei VSG MITat1.11. This, however, led neither to regulation of the endogenous VSG mRNA nor to high-level ectopic VSG protein expression, despite the production of high levels of ILDat2.1 mRNA.

As VSG proteins are synthesised in the secretory pathway, we next considered the possibility that differences in ER targeting might determine whether ectopic transcripts trigger balancing.

We performed two experiments to test this possibility: (i) we tried to express T. brucei VSG121 with the potentially defective ILDat2.1 ER import signal (Fig 3A, upper panel), and (ii) we tried to rescue expression of ILDat2.1 by replacing the ILDat2.1 ER import signal with that of T. brucei VSG121 (Fig 3A, lower panel).

Download:

Fig 3. The endogenous VSG mRNA is regulated only when the ectopic VSG has a functional ER-import signal.

(A) Schematic of the constructs used to generate the ILDat2.1^SP:121^tet (upper panel) and 121^SP:ILDat2.1^tet (lower panel) cell lines. (B) Cumulative growth curves of the 121^SP:ILDat2.1^tet and ILDat2.1^SP:121^tet cell lines. Three independent clones were analysed for 5 days in the presence (+tet) or absence (-tet) of tetracycline and the values are presented as means ± SD. (C) Relative quantification of VSG mRNA levels before (0 h) and after (8 h) inducing expression of the ectopic VSG in the ILDat2.1^SP:121^tet cells. VSG221 expression (left y-axis) is shown as a percentage relative to the VSG221 expression in the parental 13-90 cells, while the VSG121 expression (right y-axis) is given relative to the non-induced levels. The mRNA was normalised to tubulin. Two independent clones were analysed, and the values are presented as means ± SD. (D) Western blot analysis of VSG121 protein expression in ILDat2.1^SP:121^tet cells before (-tet) and 24 h after (+tet) induction of expression, detected using anti-VSG121 antibodies. Wild-type (WT) T. brucei cells expressing VSG121 served as the positive control (green) and PFR protein (red) served as the loading control. (E) Analysis of VSG mRNA expression in three clones of the 121^SP:ILDat2.1^tet cells. The endogenous VSG221 and ectopic ILDat2.1 are quantified and presented as in (C). (F) SDS-PAGE analysis of ILDat2.1 protein expression in the 121^SP:ILDat2.1^tet cells before (-tet) and 24 h after (+tet) addition of tetracycline. Three independent clones of the 121^SP:ILDat2.1^tet cells were analysed, with the 13-90 parental cells (P) serving as a reference. Both the endogenous VSG221 and overexpressed ILDat2.1 bands are labelled. Assignment of the ILDat2.1 band is putative and based on its appearance only following induction of expression and its expected size range between 35 and 40 kDa. (G) Cell cycle analysis of 121^SP:ILDat2.1^tet (clone 1) at 0 h, 8 h and 24 h of induction with tetracycline. Parental 13-90 cells served as a reference. Approximately 300 cells were analysed per sample (see figure legend for the number of cells analysed for each sample). Cells were classified according to the number of kinetoplasts (K) and nuclei (N) present as 1K1N, 1K^d1N (dividing kinetoplast), 2K1N or 2K2N. Cells with aberrant K/N configurations were grouped as “others”.

https://doi.org/10.1371/journal.ppat.1014518.g003

Induction of the ILDat2.1^SP:121^tet reporter produced VSG121 mRNA but did not affect parasite growth and no VSG mRNA balancing was observed, as endogenous VSG221 mRNA levels in the ILDat2.1^SP:121^tet cell line remained at pre-induction expression levels (Fig 3B, 3C). Western blotting failed to detect the VSG reporter, indicating that protein expression was absent or below the detection limit of the assay (Fig 3D). Since endogenous VSG mRNA and protein were expressed abundantly, the cells grew well.

This result is consistent with defective ER targeting of the transcript, explaining why ILDat2.1 expression does not trigger VSG mRNA balancing, which was further supported by a further experiment. Induction of expression of ILDat2.1 VSG fused to the VSG121 ER import signal led to markedly impaired cell growth within 24 h, followed by cell death. Analysis of VSG transcripts in the 121^SP:ILDat2.1^tet cell line showed that expression of the VSG chimera caused a reduction of the endogenous VSG221 mRNA to ~40% of the wild-type levels within 8 h (Fig 3E). Interestingly, despite efficient transcription of the reporter VSG mRNA, only a faint protein band between 35 – 40 kDa was observed, indicating that the recombinant T. vivax VSG protein was poorly expressed (Fig 3F). This assignment remains tentative due to the lack of a specific antibody; however, the increased intensity of a band in the expected size range for the T. vivax VSG across all three induced clones is consistent with this interpretation.

To test whether the low detectability of the putative ILDat2.1 protein reflected proteostasis-dependent turnover, we treated induced 121^SP:ILDat2.1^tet cells with the p97/VCP inhibitor CB-5083 [47]. This treatment did not lead to a clear increase in the intensity of the putative ILDat2.1 band, although this analysis is limited by the absence of a specific antibody (S5 Fig).

The marked decrease in endogenous VSG mRNA resulted in depletion of wild-type VSG protein and eventually in cell death (Fig 3F, 3B). Together, these experiments indicate that successful ER targeting of the ectopic transcript is required to trigger a VSG mRNA balancing response, but that efficient VSG protein production is not.

We also analysed nuclear and kinetoplast configurations after induction. 121^SP:ILDat2.1^tet caused only a mild and heterogeneous shift in cell-cycle distribution, with a modest increase in 2K2N and abnormal cells by 24 h (Fig 3G). Population volume measurements did not reveal a pronounced uniform shift, consistent with the absence of a strong synchronous cell-cycle arrest (S7 Fig).

ER proximity of ectopic VSG transcripts depends on a functional ER import signal

To further confirm that an ILDat2.1 ER import signal mistargeted the mRNA and that indeed VSG mRNA must be targeted to the ER for VSG mRNA balancing, we investigated the cellular localisation of ILDat2.1 mRNA containing the native defective ER import signal and a chimera with a functional VSG121 ER import signal.

For this, we analysed the intracellular localisation of ILDat2.1 transcripts using single-molecule fluorescence in situ hybridisation (smFISH) combined with ER marker staining. These experiments directly test whether the ILDat2.1 signal peptide fails to direct transcripts to the ER.

The method preserves the integrity of cells and allows the detection of even highly abundant RNA as single molecules [48]. We used two trypanosome cell lines, ILDat2.1^tet and 121^SP:ILDat2.1^tet, which inducibly expressed ILDat2.1 VSG with either a defective or a functional ER import signal against a VSG221 background. The LR White embedded trypanosomes (8 h post induction) were probed with Affymetrix probe sets for VSG221 (yellow) and ILDat2.1 (magenta), with α-tubulin mRNA (magenta) serving as a marker for cytoplasmic mRNA. The samples were then incubated with an antibody against BiP, a protein that localises to the lumen of the endoplasmic reticulum (ER) (white). Subsequently, cells were prepared for scanning electron microscopy (as described in Methodology). Quantitative proximity analysis, based on local BiP fluorescence intensity at the site of individual mRNA molecules, showed that the endogenous VSG221 mRNA was located closer to the ER marker BiP than the cytoplasmic α-tubulin mRNA in both cell lines (Fig 4A). Like α-tubulin mRNA, ILDat2.1 transcripts carrying the native ILDat2.1 signal showed lower BiP-proximity values than VSG221 mRNA, whereas replacement with the functional VSG121 ER import signal increased transcript proximity to BiP to slightly above that of VSG221 transcripts (Fig 4B). These results indicate that the native ILDat2.1 signal peptide is defective in mediating ER engagement, while the VSG121 signal restores ER engagement of the transcript. This is consistent with the observation that only transcripts carrying a functional ER import signal trigger VSG mRNA balancing. Individual images corresponding to the overlays shown in Fig 4 are presented in S2 Fig, with additional analyses provided in S3 Fig.

Download:

Fig 4. ILDat2.1 mRNA is only efficiently transported to the ER when it contains a bona fide ER-import signal from a T. brucei VSG.

(A) Top: Representative correlative light (smFISH and immunofluorescence) and electron microscopy (inverted SEM) images of LR White-embedded trypanosomes expressing wild-type ILDat2.1 or 121^SP:ILDat2.1, showing the localisation of VSG221 mRNA (yellow), α-tubulin mRNA (magenta) and BiP protein (White). Scale bars: 2 µm. Bottom: Pairwise comparative quantitative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and α-tubulin (magenta) mRNA. The graph shows the intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and α-tubulin. The number (N) of individual mRNA molecules analysed are shown. Intensities are plotted sorted from lowest to highest intensity with the intensities given relative to the most intense BiP signal and the particles plotted normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves. (B) Top: Representative correlative light (smFISH and immunofluorescence) and electron microscopy (inverted SEM) images of LR White-embedded trypanosomes expressing wild-type ILDat2.1 or 121^SP:ILDat2.1, showing the localisation of VSG221 mRNA (yellow), ILDat2.1 mRNA (magenta) and BiP protein (White). Scale bars: 2 µm. Bottom: Pairwise comparative quantitative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and ILDat2.1 (magenta) mRNA. The graph shows the intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and ILDat2.1. The number (N) of individual mRNA molecules analysed are shown. Intensities are plotted sorted from lowest to highest intensity with the intensities given relative to the most intense BiP signal and the particles plotted normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves. Individual images of the composite images shown here are provided in S2 Fig. Additional analyses of mRNA proximity to the ER are shown in S3 Fig.

https://doi.org/10.1371/journal.ppat.1014518.g004

Non-VSG ER import signals target VSGs to the ER but differentially influence the regulation of total VSG mRNA levels

Having established that ER targeting of transcripts correlates with VSG mRNA balancing, we next asked whether this response requires VSG-specific ER import signals.

We selected the ER import signals of abundant GPI-anchored surface proteins of different insect stages of T. brucei (including the epimastigote-specific brucei alanine-rich protein (BARP) and the procyclic EP1 protein) as well as the non-abundant procyclic factor H receptor (FHR) [49–51]. These surface proteins, like the VSGs, traverse the secretory pathway. Thus, we generated VSG121 transgenes with BARP (UniProtKB: C9ZZN9), EP1 (UniProtKB: Q389V1) and FHR (UniProtKB: Q57Z47) ER import signals. This time, we decided to use constitutive expression from the VSG221 expression site. We have shown that integrating VSG121 downstream of the VSG221 results in a 70:30 expression ratio of VSG221 and VSG121 mRNA, respectively, relative to the respective wild-type amounts (S4 Fig).

We integrated the recombinant VSG genes just downstream of the active ES resident VSG221 to generate the cell lines 221^ES.BARP^SP:121, 221^ES.EP1^SP:121 and 221^ES.FHR^SP:121 (Fig 5A).

Download:

Fig 5. Non-VSG ER import signals target VSGs to the ER, but regulation of the endogenous VSG mRNA differs.

(A) Illustration of the constructs and expression strategy used to generate the 221^ES.BARP^SP:121, 221^ES.EP^SP:121 and 221^ES.FHR^SP:121 cell lines. The employed BARP, EP and FHR ER import signal sequences are provided in S3 Table. (B) Analysis of the growth curves showed only a slight reduction of growth in all of the generated cell lines as compared to the parental 13-90 cells. The data are presented as means ± SD of three independent clonal cell lines. (C) Relative quantification of VSG mRNA and (D) protein levels. VSG221 mRNA expression levels are relative to the parental (P) 13-90 VSG221 expression levels while VSG121 expression is relative to the wild-type (WT) VSG121 expression levels. The mRNA was normalised to tubulin mRNA whereas the VSG protein was normalised to the PFR protein. The values are presented as means ± SD of three independent clones for all cell lines except 221^ES.FHR^SP:121, where two independent clones were used for the quantification of VSG mRNA.

https://doi.org/10.1371/journal.ppat.1014518.g005

The three experiments yielded clonal trypanosome cell lines which showed only minor growth effects (Fig 5B). At the transcript level, a trans-regulation of the VSG mRNA was elicited in all three clones. In the 221^ES.BARP^SP:121 cell line, the endogenous VSG221 and the ectopic VSG121 were expressed at approximately 40% and 30% of the wild-type levels, respectively, whereas both VSGs were approximately 30% of the wild-type levels in the 221^ES.FHR^SP:121 cell line. In the 221^ES.EP1^SP:121 cell line, the endogenous VSG221 and the ectopic VSG121 were expressed at approximately 60% and 30% of the wild-type levels, respectively (Fig 5C). Although the trans-regulation mechanism was operational in the 221^ES.BARP^SP:121 and 221^ES.FHR^SP:121 cells, the total VSG mRNA was ~ 70% of the wildtype levels and the ectopic VSG121 protein appeared to be expressed more than the endogenous VSG221 (Fig 5D). Together, these results show that ER import signals from non-VSG surface proteins are sufficient to support VSG mRNA balancing.

ER-targeted GFP is sufficient to trigger VSG mRNA balancing

If ER-targeted transcripts are indeed the trigger for VSG mRNA balancing, then expression of a non-VSG transcript that is efficiently targeted to the ER should be sufficient to elicit the response. To test this prediction, we expressed GFP reporters either in the cytosol or targeted to the ER. The first reporter consisted of the GFP ORF and the VSG121 3′ UTR. This construct was integrated into an rDNA spacer to generate the 221^ES.GFP^tet cell line that inducibly expresses GFP in the cytosol. We also generated a second reporter for expression of ER-targeted GFP. In addition to the VSG 3′ UTR sequence, a procyclin (EP1) ER import signal was coupled to the 5′ end of the GFP ORF and integrated into a transcriptionally silent rDNA spacer, yielding the 221^ES.EP^SP:GFP^tet cell line that inducibly expresses an ER-targeted GFP reporter.

After inducing expression, fluorescence microscopy revealed a strong GFP signal in the cytoplasm and nucleus of the cell line expressing the GFP reporter lacking the ER import signal (Fig 6A). On the other hand, a patchy expression of GFP was observed in a compartment consistent with the ER after inducing the expression of ER targeted GFP (Fig 6B). A slight reduction in growth was recorded within the first 24 h of cytosolic reporter overexpression, after which the cell numbers began to decline (Fig 6C), likely reflecting the burden of high-level reporter expression [52]. In the cell line expressing the ER-targeted reporter, a rapid stalling in parasite growth was observed after inducing expression, followed by a decline in cell numbers within 6 h (Fig 6D). As we were specifically interested in very early effects after induction, this later growth defect did not affect the interpretation of the data. On the transcript level, quantitative dot blots showed an immediate increase in the GFP mRNA in the 221^ES.GFP^tet cell line, with peak GFP expression recorded between 2 – 6 h after induction, followed by a decline. The two VSG 16-mer containing GFP transcripts – one cytosolic, the other ER-targeted – differed in their capabilities to balance the endogenous VSG mRNA. There was no impact on the VSG mRNA levels within the first 6 h of inducing GFP lacking an ER-targeting signal. However, after 8 h, there was a reduction of both the VSG and GFP mRNAs. The VSG transcript reverted to wild-type levels after 24 h (Fig 6E).

Download:

Fig 6. High-level expression of ER-targeted GFP reporter causes downregulation of VSG mRNA amounts.

(A, B) Schematic of the GFP reporter constructs and fluorescence microscopy images of fixed cells showing the expression of GFP before (-tet) and 6 h post-induction of expression with 1 µg/ml tetracycline (+tet) in the 221^ES.GFP^tet cells expressing cytosolic and nuclear GFP (A), and 221^ES.EP^SP:GFP^tet cell line expressing GFP in the ER (B). GFP fluorescence is shown in green while parasite nuclei and kinetoplasts were stained with 4,6-diamidino-2-phenylindole (DAPI, shown in white). Scale bar: 5 µm. (C) Growth curves showing cumulative cell numbers of three clonal cell lines grown for 72 h in the absence (-tet) or presence (+tet) of cytosolic GFP reporter induction. (D) Growth curves showing cumulative cell numbers of two independent clones grown for 24 h in the absence (-tet) or presence (+tet) of ER targeted GFP reporter induction. The data in (C) and (D) are averages with error bars representing the SD. (E, F) Relative quantification of VSG (left y-axis) and GFP (right y-axis) mRNA levels during the course of tetracycline induced cytosolic (E) and ER targeted (F) GFP reporter overexpression. Total RNA samples were dot-blotted and hybridised with fluorescently labelled probes specific for VSG221, GFP and tubulin. The data was quantified by normalisation to tubulin. VSG mRNA expression is presented as percentage means ± SD for two independent clones normalised to the parental 13-90 cells expressing VSG221 whereas GFP expression values are relative to the non-induced cells, -Tet = 1. (G) Cell cycle analysis of 221^ES.EP^SP:GFP^tet (clone 2) at 0 h, 8 h and 24 h of induction with tetracycline. Approximately 400 cells were analysed per sample (see figure legend for the number of cells analysed for each sample). Cells were classified according to the number of kinetoplasts (K) and nuclei (N) present as 1K1N, 1K^d1N (dividing kinetoplast), 2K1N or 2K2N. Cells with aberrant K/N configurations were grouped as “others”.

https://doi.org/10.1371/journal.ppat.1014518.g006

In contrast, expression of the ER-targeted GFP reporter caused a rapid reduction of endogenous VSG mRNA. The endogenous VSG221 mRNA decreased to 20% of the wildtype level within 2 h of expression (Fig 6F). Because ER-targeted GFP caused a particularly strong growth phenotype, we next asked whether proteostasis contributed to GFP detectability and toxicity. CB-5083 treatment increased ER-targeted GFP levels by approximately 1.6–1.9-fold, consistent with partial proteostasis-dependent turnover of the reporter (S6 Fig). Thus, protein quality-control processes contribute to the downstream phenotype of ER-targeted GFP, but this does not alter the conclusion that early VSG mRNA attenuation is triggered by ER engagement rather than by a VSG open reading frame in the experimental setup used here. Cell-cycle analysis revealed a reproducible increase in 2K2N cells after induction of ER-targeted GFP expression (Fig 6G). This phenotype was more pronounced than for 121^SP:ILDat2.1^tet, indicating that different ER-engaged reporters can elicit distinct downstream cellular consequences despite triggering VSG mRNA balancing. Cell volume measurements and representative microscopy images are shown in S7 Fig and S8 Fig, respectively.

The results of these experiments suggested that, in fact, the regulation of endogenous VSG did not require the ectopic VSG open reading frame or a VSG-specific ER import signal.

To further test whether VSG mRNA balancing depends on successful production of a functional surface coat, we analysed an ectopically expressed TY1-tagged VSG221 VSG. Induction of TY1-VSG221 caused rapid growth arrest, followed by a decline in cell numbers (Fig 7A). Within 6 h of induction, TY1-VSG221 transcripts accounted for the majority of total VSG221 mRNA, accompanied by a marked reduction of endogenous VSG221 mRNA (Fig 7B). This reciprocal shift is consistent with rapid VSG mRNA balancing.

Download:

Fig 7. Inducible expression of TY1-tagged VSG221 VSG triggers rapid mRNA balancing and acute growth arrest despite correct protein expression and localisation.

(A) Growth curves of three independent clones with or without tetracycline induction of TY1-VSG221 expression. Induction leads to rapid growth arrest within 6 h and a subsequent decline in cell numbers. (B) Quantification of endogenous and exogenous VSG221 mRNA levels before and 6 h after induction of TY1-VSG221 expression. Bars represent the relative contributions of endogenous VSG221 and exogenous TY1-VSG221 transcripts to total VSG221 mRNA. Exogenous transcript levels were calculated by subtracting endogenous M1.2 signal (detected using a 5′ UTR-specific probe), from total VSG221 mRNA (detected using a probe targeting the ORF). The values are presented as means ± SD of three independent clones. (C) Protein analysis by Western blot showing expression of TY1-VSG221 (TY1, red) following induction with tetracycline for 0, 6, 12, 18 and 24 h alongside total VSG221 levels (green). PFR (red) acts as a loading control. (D) Immunofluorescence analysis of cells before (0 h) and 24 h post induction of TY1-VSG221 expression demonstrates efficient trafficking of TY1-VSG221 to the cell surface. The parental 13–90 cells are shown as a control. Both endogenous and ectopic TY1-tagged VSG221 were detected with an anti-VSG221 antibody (green) with the ectopic TY1-VSG221 specifically detected with an anti-TY1 antibody (red). Kinetoplasts and nuclei were stained with DAPI (blue). Scale bar: 5 µm.

https://doi.org/10.1371/journal.ppat.1014518.g007

Importantly, TY1-VSG221 protein was detectable after induction and immunofluorescence analysis showed localisation of the tagged VSG at the cell surface (Fig 7C, 7D). Thus, the balancing response can be activated even when the resulting VSG fusion protein is deleterious. These data support the interpretation that VSG mRNA balancing is initiated upstream of final surface coat functionality, most plausibly at the level of abundant ER-engaged VSG transcripts.

Together, these experiments demonstrate that VSG mRNA balancing does not depend on the identity of the VSG open reading frame or on a VSG-specific signal peptide. Instead, the response is triggered specifically by the presence of abundant transcripts that engage the ER targeting machinery. Constructs that generate large numbers of ER-engaged transcripts consistently elicit attenuation of endogenous VSG mRNA, whereas highly expressed transcripts that remain cytosolic fail to do so. These observations indicate that the parameter monitored by the cell is the abundance of ER-engaged transcripts rather than VSG-specific sequence features or productive VSG protein synthesis.

We therefore conclude that, in the experimental systems analysed here, ER engagement is required for rapid attenuation of endogenous VSG mRNA.

This finding suggests that trypanosomes couple the cytoplasmic load of ER-targeted transcripts to regulation of the nuclear VSG expression site.

Discussion

In this study, we investigated the mechanism underlying the balancing of VSG mRNA levels in bloodstream-form Trypanosoma brucei. Previous work showed that when a second VSG is expressed, the total amount of VSG mRNA rapidly returns to approximately wild-type levels, suggesting the existence of a homeostatic regulatory mechanism. Here, we demonstrate that the conserved 16-mer, present in all expressed VSGs, alone is not sufficient to initiate balancing and instead this balancing response is triggered specifically by the presence of abundant transcripts that are targeted to the endoplasmic reticulum (ER). The response does not require the VSG open reading frame or efficient VSG protein production, as high-level expression of ER-targeted GFP is sufficient to elicit attenuation of endogenous VSG mRNA, whereas highly abundant transcripts lacking ER-targeting signals fail to do so. These findings indicate that the signal for VSG mRNA regulation is the presence of ER-engaged transcripts rather than VSG-specific sequence features. Together with previously published data, these findings support an ER-engagement-coupled homeostatic attenuation model in which an increased load of ER-targeted transcripts triggers DOT1B-dependent attenuation of the active VSG expression site, thereby rapidly restoring a steady-state set point for VSG mRNA abundance.

Antigenic variation is a powerful strategy employed by several pathogens to evade elimination by host immune responses. Monoallelic expression of surface antigens by parasitic pathogens, such as trypanosomes and Plasmodium falciparum, ensure that only a single antigen is expressed at a time from a vast repertoire of silent genes [53,54]. In trypanosomes, variation of the VSG antigens involves transcriptional switching or recombination events that introduce a new antigen into the active VSG expression site [55].

In a previous study, an in situ VSG switch was simulated by inducible and high-level expression of a second VSG from the ribosomal spacer [35]. When a VSG121 gene was expressed ectopically, an almost instantaneous reaction from the expression site was consistently found: the mRNA of the ES-resident VSG declined rapidly to low levels. It was further shown when overexpressing VSG121 in a VSG221 background that the parasites, in a next step, can attenuate the expression site in a DOT1B-dependent manner [35]. This, however, is a stochastic process. Using a pleomorphic trypanosome strain, it was shown that in a clonal population, ES-silencing occurred in some 50% of all cells, while all cells silenced the VSG. This means that ES-silencing is independent from VSG silencing [36]. This is also supported by the fact that the overexpression of VSG221 in VSG221 expressing monomorphic cells resulted in a VSG switch but had no significant effect on growth suggesting that only the VSG but not the ES was silenced [46]. Furthermore, not all ectopically expressed VSG genes were affecting the ES-resident VSG mRNA with equal efficiency, and not all ESs were equally responsive. Thus, trypanosomes exhibit a remarkable degree of phenotypic plasticity and high cell-to-cell variability. This makes perfect sense for a parasite that, during its life cycle, encounters extremely different microenvironments and that does not regulate gene expression by transcriptional control, as most other eukaryotes do. Instead, posttranscriptional control is paramount [23]. Previous studies established that ectopic VSG expression can trigger VSG mRNA balancing but did not identify which feature of the ectopic construct initiates the response. The experiments presented here progressively exclude several possibilities: the response does not require a particular VSG open reading frame, VSG protein identity, or a VSG-specific ER import signal. Instead, across the different constructs analysed, the common feature associated with rapid balancing is competence for ER engagement. We therefore consider the principal advance of this study to be the identification of ER engagement as an upstream requirement for the balancing response, while the molecular sensor and downstream mechanism remain to be determined.

Our results support an ER-engagement-coupled homeostatic attenuation mechanism for VSG mRNA balancing. In this framework, induction of an ectopic secretory-pathway transcript rapidly increases the pool of ER-engaged mRNAs (i.e., transcripts undergoing co-translational targeting/engagement with the ER import machinery). When this pool exceeds a functional set point for ER engagement capacity, the cell rapidly attenuates endogenous VSG mRNA levels via the expression-site attenuation mechanism described previously (e.g., DOT1B-dependent attenuation), thereby restoring ER-engaged transcript load toward baseline, below the functional set point. Our experiments do not exclude transcript turnover as an additional component of this response. Transcripts that exceed available ER-engagement capacity could potentially remain non-engaged and become selectively destabilised. Distinguishing altered transcription from differential transcript turnover will require direct kinetic measurements of both processes. Protein quality-control mechanisms may additionally influence the detectability and stability of some reporter proteins, particularly ILDat2.1 and ER-targeted GFP. However, these downstream processes are not required to explain the early VSG mRNA balancing response observed in the present study.

Our data further support the conclusion that the determining factor is the abundance of ER-engaged transcripts rather than the identity or translation efficiency of the encoded protein. Based on our previous work, expression-site attenuation represents one plausible downstream mechanism for reducing the dominant Pol I-derived VSG transcript pool when ER-engaged transcript load increases; however, this connection was not directly tested in the present study.

In all previous experiments, one observation was consistently made: the inducible expression of a second VSG only led to a very short period of overshooting total VSG mRNA, which then rapidly levelled to approximately wild-type amounts [35,36]. The simultaneous increase of ectopic VSG mRNA and decline of ES-resident VSG mRNA could be observed. This was not only documented by overexpressing VSGs, but also by generating so-called double expressor cell lines, in which two VSG genes are constitutively expressed in tandem from the same expression site. VSG double expressors were first generated in 1996 [32], but the levelling of VSG mRNAs long remained undetected or anecdotal. We propose that trypanosomes maintain secretory pathway homeostasis by preventing excessive accumulation of highly abundant ER-engaged transcripts [35,36]. We have shown that less than 50% of wild-type VSG mRNA levels is sufficient for VSG coat formation and hence the parasites seem to operate on the safe side [56]. In the present study, we have explored some basic features of the VSG mRNA that are involved in mRNA balancing. We first asked if the process requires a T. brucei VSG and hence if it is species-specific. The related African trypanosomes T. congolense and T. vivax also express VSGs on their cell surface and the VSG coat is subject to antigenic variation, however, the VSG proteins may be divergent from T. brucei. While we have studied VSGs from both species, for the present study, we decided to challenge T. brucei with overexpression of two T. vivax VSGs. This turned out to be more complex than we thought.

Inducing the expression of the T. vivax ILDat1.2 VSG resulted in a rapid reduction of the endogenous T. brucei VSG221 mRNA amounts, similar to the results obtained when T. brucei VSGs were overexpressed [35]. However, inducing the expression of another T. vivax VSG, ILDat2.1, did not affect the endogenous VSG221 mRNA levels, despite the efficient production of ILDat2.1 transcript. We initially thought that this result might reflect the high phenotypic flexibility of trypanosomes. However, we had never observed high-level expression of VSG mRNA not resulting in mRNA balancing. Therefore, we surmised that the ILDat2.1 transcript lacked an essential feature.

The first candidate was the ER import signal sequence, as ILDat2.1 transcripts failed to produce readily detectable protein. In the present work, we use ‘ER engagement’ operationally to denote functional coupling of the transcript to ER targeting/import, irrespective of the precise contribution of SRP-dependent versus SRP-independent routes [57]. This operational definition is consistent with current models in which ER-associated translation reflects the coordinated interaction of mRNAs, ribosomes and the ER translocation machinery, and is not solely explained by signal peptide-mediated targeting [12–14].

It has been suggested, however, that procyclic trypanosomes and S. cerevisiae appear to rely on the SRP-independent pathway for the translocation of GPI-anchored secretory proteins, and the SRP-dependent pathway for transmembrane-bearing proteins [58,59]. In S. cerevisiae, cytosolic factors including the Heat shock protein 40 (Hsp40), yeast dnaJ protein 1 (Ydj1), and Hsp70 are all involved in the SRP-independent translocation of GPI-anchored proteins [58].

Indeed, the expression of a transcript of a hybrid ILDat2.1 VSG reporter containing a bona fide T. brucei VSG ER import signal resulted in the expected balancing of endogenous VSG221 mRNA, proving that the process can be triggered by expression of a non-T. brucei VSG. The second insight from this experiment was that balancing is most probably independent from efficient VSG production, because, although the ER signal was functional, ILDat2.1 protein appeared to be poorly made. Lastly, the experiment strongly suggested that for mRNA balancing to operate, the transcripts need to be targeted to the ER.

The next questions we asked were (i) if the ER-signal must be VSG-specific and (ii) if mRNA balancing requires a VSG at all. The ER import signal peptides of GPI-anchored T. brucei proteins VSG, BARP, EP1 and FHR all conform to the general organisation of signal peptides [60,61]. In fact, we found that the ER import signals of BARP, EP1 and FHR can efficiently target VSGs to the ER. Interestingly, VSG mRNA was differentially regulated in VSG double expressor cell lines expressing ectopic VSG121 with BARP or FHR ER import signals, compared to cells expressing ectopic VSG121 with its native or EP1 ER import signal. The mRNAs of the endogenous VSG221 and ectopic VSG121 with its native (S4 Fig) or EP1 ER import signal were expressed at a 70:30 ratio. In contrast, equal transcript levels of endogenous VSG221 and ectopic VSG121 were observed in cell lines expressing ectopic VSG121 with BARP and FHR ER import signals. These results agree with previous findings which showed that ER import signals can differentially influence the translocation and processing of substrates [6,62,63]. It has been reported that specific motifs in the h-region can determine the efficiency of translocation of substrates into the ER of T. brucei [64]. Therefore, possibly the variations in VSG mRNA balancing were due to differences in the h-region motifs of the reporter VSG ER import signals. Importantly, however, the experiments clearly showed that the VSG ER import signal does not harbour special features required for the balancing of VSG mRNA.

To address the question whether the “signal” for mRNA balancing resides in the VSG open reading frame, we used ER-targeted GFP and GFP lacking an ER-targeting signal

coupled to the VSG 3′ UTR to ensure high levels of expression. In agreement with all data obtained so far, we showed that high expression levels of ER-targeted GFP from the rDNA spacer locus resulted in a trans-regulation of the VSG mRNA. This regulation was absent when the GFP reporter was not targeted to the ER. The GFP reporter expression experiments showed that VSG mRNA balancing is neither dependent on the VSG open reading frame nor on the VSG ER import signal.

These results demonstrate that, in our experimental framework, high-level expression of an ER-targeted transcript can be sufficient to trigger attenuation of endogenous VSG mRNA.

The only common denominator in all our experiments was the presence of an enigmatic 16‑mer motif in the 3′ UTR of the transcripts. This motif is essential for VSG mRNA stability in bloodstream stage parasites and is 100% conserved in all T. brucei VSG mRNAs. Interestingly, it is completely absent from the genomes of the related African trypanosome species T. congolense and T. vivax, which also have a VSG surface coat. The F-box RNA binding protein (CFB2) has been suggested as a limiting factor which interacts with the 16‑mer motif in the VSG 3′ UTR, thereby actively regulating VSG mRNA abundance [39]. As an alternative mechanism, VSG mRNA levels might be modulated by a feedback that is dependent on the production of functional GPI-anchored VSG protein [40].

In our experiments, the ectopic VSG121 and ILDat2.1 VSG reporters with an apparently dysfunctional ILDat2.1 VSG ER import signal, were both fused to a complete T. brucei VSG 3′ UTR with an intact 16-mer motif. High levels of 16-mer-containing mRNA accumulated without ER-proximal localisation. However, levels of endogenous VSG mRNA were not downregulated, suggesting that the total VSG mRNA greatly exceeded the wild-type amounts in these cells. This agrees with the study by Maudlin et al., which shows that VSG mRNA can be expressed above the wild-type levels [40]. These observations also imply that, in principle, the available CFB2 protein pool is sufficient to interact with the 16-mer of a second highly expressed VSG and can thus stabilise the mRNA. These observations argue against a simple counting mechanism based solely on 16-mer availability.

We, therefore, propose that though the interaction between the 16-mer and CFB2 is essential for high expression and stability of VSG mRNA [34,39], the steady-state VSG mRNA amount is regulated at a different level.

Maudlin et al. reported that introducing a premature termination codon (PTC) just before the ectopic VSG221 GPI signal altered the behaviour of VSG mRNA regulation [40]. One interpretation is that downstream events linked to GPI anchoring influence the response.

Our results instead support a model in which ER targeting/engagement is the initiating requirement for VSG mRNA attenuation, while downstream processing steps (including GPI anchoring and proteostasis) may modulate phenotypic outcomes depending on construct and expression-site context.

Previously published studies reported a 50:50 expression of VSG mRNA when the wild-type VSG was integrated upstream of the endogenous VSG into the VSG221 ES [32,33], whereas Maudlin et al., express the second VSG upstream of the endogenous VSG from the VSG121 ES and the VSG221:VSG121 levels had a 1:3 ratio [40]. Additionally, expressing ectopic VSG221 with PTCs at different locations activated a pathway that increased the total VSG mRNA amounts. These variations in the modulation of VSG mRNA levels when different ES are used suggests there might be additional intricacies for the regulation of VSG mRNA.

In summary, we have shown that VSG mRNA balancing is independent of the VSG’s ORF and of effective VSG production, but clearly dependent on high levels of ER-targeted transcripts. In view of the biology of trypanosomes this makes sense. Trypanosomes lack transcriptional control and highly abundant surface proteins are expressed by Pol I [23,65]. During antigenic variation, mRNA balancing would cause an exchange of the VSG mRNA population before the completion of an expression site switch. During developmental progression to the procyclic insect stage, high-level expression of ER-targeted procyclin mRNA could contribute to balancing the amount of VSG mRNA present in the cell. This would likewise be true when procyclin is replaced with BARP in the next step of life cycle progression. Thus, trypanosomes exploit a simple but very effective system of posttranscriptional transcript balancing that allows for high phenotypic plasticity and robustness. In some respects, transcript balancing in trypanosomes is reminiscent of a phenomenon called transcript buffering, which was first described in yeast [66,67]. Transcript buffering involves a complex interplay that regulates transcription rates in the nucleus and mRNA decay in the cytoplasm to ensure steady-state mRNA levels are maintained in the cell [68–70]. Transcript buffering has further been demonstrated in mammalian cells [71,72], indicating a conserved process in eukaryotes. Transcript buffering can either be gene-specific or global and is possibly regulated by distinct mechanisms. How signal for crosstalk between transcription and mRNA decay is perceived, and its directionality is not well understood. In yeast, central players in transcript buffering include transcription initiation and the mRNA decay pathway factors [73]. In trypanosomes, the situation is certainly different from yeast and mammals, as transcription is not regulated. However, the basic need for transcript buffering also applies. We call the phenomenon transcript balancing as just two players are involved; in bloodstream stage trypanosomes these are two populations of VSG mRNAs during antigenic variation.

We propose that trypanosomes balance abundant secretory-pathway transcripts to match ER engagement capacity and maintain secretory homeostasis. Identifying the molecular sensor that links ER engagement to VSG expression-site attenuation will be an important goal for future work. This mechanism may represent a specialised form of transcript buffering adapted to the extreme transcriptional architecture of trypanosomes.

The conceptual simplicity of the trypanosome system provides opportunities that are less accessible in opisthokont models. It has been suggested that mRNAs with longer half-lives are particularly suitable for studying transcript buffering [66]. Accordingly, the high-level expression and long half-life of VSG mRNA can be exploited to investigate transcript buffering in the tractable T. brucei system.

Methodology

Cultivation and genetic manipulation of trypanosomes

All cell lines generated in this study are based on monomorphic T. brucei 427 MITat1.2 13–90 bloodstream-form parasites expressing the T7-polymerase and tetracycline repressor [74]. The cells were maintained below 1 x 10⁶ cells/ml in HMI-9 medium supplemented with 10% heat-inactivated foetal calf serum (Sigma-Aldrich) at 37 °C and 5% CO₂. For transfections, 10 µg of linearised DNA was transfected into 3.0 x 10⁷ mid-log phase cells in Amaxa Basic Parasite Nucleofector Solution 1 using the X-001 program of an Amaxa Nucleofector II (Lonza, Switzerland). Hygromycin, G418, blasticidin and phleomycin were used at 5, 2.5, 5, and 1 µg/ml, respectively, for the selection of recombinant cell lines. Overexpression was induced with 1 µg/ml tetracycline. Growth rates were monitored for 24 – 120 h and cell densities determined after specified intervals using a Neubauer counting chamber.

Monomorphic wild-type T. brucei Lister 427 cells expressing VSG121 were cultivated in HMI-9 medium supplemented with 10% heat-inactivated foetal bovine serum (Sigma-Aldrich) at 37 °C and 5% CO₂ without antibiotics.

Plasmid construction and generation of cell lines

The ILDat1.2 and ILDat2.1 coding sequences [41–45], each fused to the 3′ UTR of MITat1.1 VSG, were synthesized with EcoRI restriction sites at the 5′ and 3′ ends and cloned into pBSK II (+), resulting in plasmids pBSK.ILDat1.2 and pBSK.ILDat2.1, respectively. As the published ILDat2.1 sequence lacks a start codon [44], the first two nucleotides (CC) were replaced with ATG to generate an in-frame open reading frame encoding a protein of 392 amino acids. The inserts were excised using HindIII and SmaI, followed by ligation into pLew82v4 plasmid that was linearised sequentially with XhoI (followed by refilling the overhangs with the Klenow fragment) and HindIII. The pLew.ILDat1.2 and pLew.ILDat2.1 plasmids were NotI-linearised and transfected into T. brucei 13–90 cells to generate the 221^ES.ILDat1.2^tet and 221^ES.ILDat2.1^tet cell lines, respectively.

Chimeric sequences were generated by PCR-driven overlap extension [75]. To replace the native ILDat2.1 ER import signal with a VSG121 ER import signal, ILDat2.1:M1.1 3′ UTR sequence without the ER import signal and the VSG121 ER import signal were amplified from plasmid pBSK.ILDat2.1 and pLew.121wt, respectively, using long primers that covered the overlap region of the two sequences. The products of the two PCR reactions were used as templates in a subsequent overlap PCR. Fusion of the two overlapping fragments occurred during the initial amplification cycles, after which the generated full-length product was amplified using primers annealing to the start of VSG121 ER import signal and the end of ILDat2.1:M1.1 3′ UTR sequence. The fused fragment was subcloned into pJet1.2 and pBSK II (+). The insert was excised and ligated into the pLew82v4 vector as described above to generate the 221^ES.121^SP:ILDat2.1^tet cell line. A similar approach was used to replace the native VSG121 ER import signal with that of ILDat2.1 VSG from plasmid pJET.121 and pBSK.ILDat2.1, respectively. Transfection of the linearised construct into the parental cells generated the 221^ES.ILDat2.1^SP:121^tet cell line.

To replace the ILDat1.2 GPI signal peptide, the ILDat1.2 GPI signal peptide was first predicted using the SignalP version 4.1 online server [76]. Next, the ILDat1.2 ORF lacking the native GPI signal coding sequence and MITat1.11 GPI signal coding sequence (TCCAGTTTTCTAGTAAGCAAACAATTCGCCCTAATGGTTTCTTCTGCATTTGCG GCCTTACTT TTTTAA) coupled to the MITat1.1 3′ UTR were separately amplified using long overlapping primers from the plasmid pBSK.ILDat1.2:M1.1 and pKD4.M1.11:M1.1UTR, respectively. The PCR products were fused in a second PCR reaction as described above. A similar approach was used to replace the predicted ILDat2.1 GPI signal peptide with that of MITat1.11 VSG. The ILDat2.1 ORF lacking the GPI signal peptide was amplified from plasmid pBSK.ILDat2.1:M1.1, while the MITat1.11 GPI signal sequence together with MITat1.1 3′ UTR was amplified from plasmid pKD4.M1.11:M1.1UTR. The generated hybrid gene fragments were cloned into the pLew82v4 overexpression vector and transfected into the parental T. brucei 13–90 cells.

The GFP coding sequence was amplified from plasmid p3822 (kindly provided by M. Carrington, Cambridge, UK) using primers CFP_U.HindIII and 04_GFP_BamHI_L and ligated into pBSK II (+) plasmid with SmaI and BamHI restriction sites. The VSG 3′ UTR was amplified from plasmid pBSK.M1.6-198 with primers M1.63′UTRBglII_U and M1.6_full_L and ligated after the GFP coding sequence using Bglll and BamHI restriction sites. The GFP:VSG121 3′ UTR hybrid was excised using HindIII and XbaI and cloned into pLew82v4 (Addgene plasmid #24009) to generate the pLew.GFP-198 construct. This construct was then linearised with NotI and transfected into the 13–90 parental cell line to generate the 221^ES.GFP^tet cell line. For the addition of an ER-import signal to the GFP reporter, the EP1 ER import signal sequence (EP^SP) was excised from plasmid pLew.SP:GFP:GPI-198 with BstEII. The EP^SP was ligated into BstEII linearized pLew.GFP-198 plasmid resulting in the pLew.EP^SP:GFP-198 plasmid which was NotI-linearised and transfected into 13–90 cells to generate the 221^ES.EP^SP:GFP^+tet cell line.

For constitutive expression of VSG121 downstream of the expression site resident VSG221, the VSG121 ORF was amplified from plasmid pRS.121 by PCR. The PCR product was blunted and ligated into pJET1.2:Blas:GFP:UTR after removal of the GFP ORF with PacI and PaeI restriction enzymes. Next, the Blas:VSG121:UTR was transferred from the pJET1.2:Blas:VSG121:UTR into a modified pbRN6 [77] and the upstream integration region extended as described above to generate pbRN6.M1.6wt plasmid. The construct was linearised with SacI and SalI and transfected into the 13–90 cells. To replace the VSG121 ER import signal with FHR signal, the region upstream of the VSG121 gene and the VSG121 sequence minus the signal peptide was amplified from plasmid pbRN6.M1.6wt using primers that contained the full signal sequence and fused as described above. Replacement of the VSG121 ER import signal with the BARP and EP1 signal sequences was carried out in a similar manner. The reporter sequences were cloned into pJET1.2, excised using EcoRI and HindIII, and cloned into pbRN6.M1.6wt plasmid that was linearized in the same way. Transfection of SacI and SalI linearised constructs into 13–90 cells created the 221^ES.FHR^SP:121 and the 221^ES.BARP^SP:121 cell lines. All enzymes were obtained from Thermo Fisher Scientific (USA). The primers are available on request.

RNA analysis

Total RNA was extracted from 1 x 10⁸ parasites using the RNeasy Mini Kit (Qiagen, Netherlands) as per the manufacturer’s instructions. For quantification of mRNA, 3 µg of total RNA was denatured with glyoxal at 50 °C for 40 min and transferred onto an N-Hybond nitrocellulose membrane (GE Healthcare, UK) using a Manifold Dot blotter (Schleicher & Schuell, Germany). The blots were hybridised overnight at 42 °C with oligonucleotide probes labelled with fluorescent IRDye 682 (VSG121 probe: GGCTGCGGTTACGTAGGTGTCGATGTCGAGATTAAG; VSG221 ORF probe: CAGCGTAAACAACGCACCCTTCGGTTGGTCGTCTAG; VSG221 5′ UTR probe: TTCGTGTCGCGTAGGAATAACTACAA;GFP probe: GCCGTTCTTCTGCTTGTCGGCCATGATATAGA; ILDat1.2 and 2.1 probe: TAGGATATCAAGCTTGTGAATTTTACTTTTTGG, targeting the GPEET 5′ UTR sequence present in these ectopically expressed transcripts) or IRDye 782 labelled tubulin probe: ATCAAAGTACACATTGATGCGCTCCAGCTGCAGGTC). Imaging and quantification of fluorescence was carried out using the Li-Cor Odyssey or Li-Cor Odyssey CLx system (Li-Cor, Netherlands) and Image Studio Lite.

Protein analyses

Trypanosomes were resuspended and lysed in protein sample buffer to yield equivalents of 2 x 10⁵ cells/µl. For quantification of VSG proteins by SDS-PAGE 5 µl of the protein sample, was resolved on 12.5% SDS-PAGE gels. For Western blots 2.5 µl was used and proteins were subsequently transferred onto a nitrocellulose membrane. For quantification by dot blots, 3 µl of the protein sample was applied directly to the nitrocellulose membrane. The membranes were blocked for 1 h at room temperature or overnight at 4 °C with 5% (w/v) milk powder in PBS. Next, the membranes were incubated with primary antibodies (rabbit anti-VSG221 (1:5,000, polyclonal), rabbit anti-VSG121 (1:2,000, polyclonal; kind gift from M. Carrington), rabbit anti-GFP (1:2,000, polyclonal; #A11122 Invitrogen), mouse anti-TY1 (1:2,000, monoclonal, BB2) and mouse anti-PFR (L13D6) (1:20, monoclonal; kind gift from P. Bastin)) diluted in PBS containing 1% (w/v) milk powder and 0.1% (v/v) Tween 20. After wash steps, the membranes were incubated with IRDye 800CW labelled goat-anti-rabbit and IRDye 680RD labelled goat-anti-mouse secondary antibodies (1:10,000; Li-Cor Biosciences) diluted in PBS containing 1% (w/v) milk powder and 0.1% (v/v) Tween 20. Coomassie-stained gels and Western/dot blots were imaged and quantified with the Li-Cor Odyssey system. Images of Coomassie-stained gels were also captured using an iBright CL1000 (Invitrogen).

Fluorescence microscopy

Parasites were fixed in a final concentration of 4% w/v formaldehyde and 0.05% v/v glutaraldehyde overnight at 4 °C. After fixation, the cells were washed twice with PBS and stained with 1 µg/ml of DAPI immediately before imaging. The cells were imaged using an iMIC widefield fluorescence microscope (FEI Photonics, Germany) fitted with a CCD camera (Sensicam qe, pixel size 6.45 μm, PCO, Germany) using a 100x (NA 1.4) objective (Olympus, Germany) and the filter cubes ET-GFP and DAPI (Chroma Technology CORP, USA). The set up was controlled by the Live Acquisition software (FEI Photonics, Germany). Alternatively, trypanosomes were viewed with an automated DMI6000B wide field fluorescence microscope (Leica Microsystems, Germany) equipped with a DFC365FX camera (pixel size 6.45 µm) and a 100x oil objective (NA 1.4). The images are displayed as maximum intensity projections of Z-stacks. Image analysis was carried out using Fiji [78].

Immunofluorescence microscopy

4 x 10⁶ parasites were harvested by centrifugation at 1,400 xg and 4 °C for 10 min and washed once in FCS free HMI-9. Cells were then fixed in a final concentration of 4% w/v formaldehyde for 30 minutes at room temperature. The fixative was removed by washing with vPBS (PBS supplemented with 46 mM sucrose and 10 mM glucose) and the resulting cell pellet was resuspended in 120 µl PBS. Per analysis 30 µl of the cell suspension was applied to poly-L-lysine coated slides and left to settle for 1 h in a humidifying chamber. Following a wash step with PBS, incubation for 10 min in PBS with 100 mM Tris-HCl and another PBS wash cells were blocked for 1h with 1% BSA in PBS. Cells were then incubated for 1 h with primary antibodies (rabbit anti-VSG221 (1:100) or mouse anti-TY1 (1:500, BB2)) in 0.1% BSA in PBS. Excess antibodies were removed by washing in PBS before incubation with secondary antibodies (Alexa Fluor 488 goat anti-rabbit or Alexa Fluor 594 goat anti mouse (both 1:500, Thermo Fisher Scientific)) in 0.1% BSA in PBS. Following removal of excess secondary antibodies by washes with PBS cells were incubated for 5 min at room temperature and in the dark with 0.5 µg/ml DAPI to stain kinetoplasts and nuclei. After a final wash step with PBS cells were mounted with 80% glycerol in PBS. The cells were imaged using an iMIC widefield fluorescence microscope (FEI Photonics, Germany) as described above.

LR White smFISH

Localisation of VSG mRNA molecules in relation to the ER was achieved by correlative single molecule FISH and immunofluorescence on LR White embedded trypanosome samples as described originally in Kramer et al. [48]. Around 4 x 10⁷ trypanosomes were harvested from cell culture and high pressure frozen before freeze substitution and LR White embedding. Sections of 100 nm thickness were generated and collected onto poly-L-lysine coated slides. Affymetrix smFISH, immunofluorescence staining and contrasting were performed sequentially. Affymetrix smFISH was performed following the protocol supplied with the QuantiGene ViewRNA ISH Cell Assay Kit (Glass Slide Format; Thermo Fisher Scientific) and modifications described in Kramer et al. [48]. The Affymetrix Probes used, targeted the mRNA of VSG221, ILDat2.1 and tubulin and probes were generated based on the entire open reading frames with the regions coding for the ER-import signal and GPI-signal omitted for ILDat2.1. The sequences used for probe design are shown in S2 Table. Slides were stored in PBS overnight prior to immunofluorescence staining. Slides were incubated for 15 min each in 20 mM glycine PBS and then 1% BSA in PBS prior to incubation with the primary antibody rabbit anti-BiP (1:10,000; kind gift from J. Bangs) in 0.1% BSA in PBS for 2 h. Following four 5 min washes with PBS, the samples were incubated for 40 min with the secondary antibody Alexa Fluor 568 (1:250 dilution) and 5 µg/ml Hoechst in 0.1% BSA in PBS. Cells were then washed again 4 times for 5 min with PBS before embedding in ProLong Diamond Antifade (Invitrogen).

For quantitative mRNA to ER proximity analysis, slides were imaged using a DMI8 inverted widefield microscope (Thunder Imager, Leica Microsystems) with an HCX PL APO CS objective (100x, NA = 1.4, Leica Microsystems) using Type F Immersion Oil (refractive index = 1.518, Leica Microsystems). The microscope was controlled by the LAS-X software (Leica Micro-systems). Samples were illuminated with an LED8 light source (Leica Microsystems). Excitation light was selected by using the filter sets: EX 462–496 nm; DC 500 nm; EM 506–532 (Alexa Fluor 488); EX 566–590 nm; DC 598 nm; EM602–680 nm (Alexa Fluor 568); EX 622–654 nm; DC 660 nm; EM 666–724 nm (Alexa Fluor 647); EX 374–407 nm; DC 415 nm; EM 420–450 nm (Hoechst). Image stacks containing 15 slices were captured using a K5 sCMOS camera (6.5 µm pixel size, Leica Microsystems).

Data was analysed with the aid of Fiji [78]. mRNA signals (VSG221 and α-tubulin or VSG221 and ILDat2.1) were localised on the in-focus plane of the acquired stack with the ‘find maxima’ function and saved in the ROI manager. Intensities of the BIP signal were then measured at these locations and plotted together for each image acquired. For this, the intensities were sorted from low to high and plotted relative to the most intense signal. As the amount of mRNA signals for the pair of mRNAs analysed varied in an image, particles were plotted as particle distribution where particle numbers were normalised to the total number present. This allows for a pairwise comparison of the measured signal intensities.

For image generation, data was acquired on an Elyra S.1 structured illumination microscope (Zeiss), equipped with a 63x oil immersion objective and an sCMOS-Camera (PCO Edge 5.5). Following acquisition of fluorescence images, the samples were prepared for acquisition of electron micrographs. First, remaining immersion oil was removed with 100% EtOH. Then, slides were incubated overnight in ultra-pure water in order to be able to remove the cover slips. Samples were then dried and the slides cut with a diamond pen to smaller pieces that could be mounted into the scanning electron microscope. The samples were then contrasted by incubation for 10 min in 2% aqueous uranyl acetate and, followed by three washes with water, incubation for 5 min with 50% Reynolds’ lead citrate [79] in water and two subsequent washes with water. After drying, the samples were imaged with a field emission scanning electron microscope (JEOL JSM-7500F) employing a LABE (low-angle backscattered electron) detector. Inversion of the acquired data leads to TEM-like contrasted images as shown. For a detailed description of this detection method see [80]. Inkscape was used to manually correlate fluorescent images with the electron micrographs using the nuclei and kinetoplasts as intrinsic landmarks [80].

Cell cycle analyses

For cell cycle analyses 1 x 10⁷ cells were harvested at 0, 8 and 24 h of induction with tetracycline by centrifugation at 1,400 xg and 4 °C for 10 min. The parasites were washed once in ice-cold TDB (5 mM KCl, 80 mM NaCl, 1 mM MgSO₄, 20 mM Na₂HPO₄, 2 mM NaH₂PO₄, 20 mM glucose, pH 7.6), adjusted to a concentration of 1 x 10⁸ cells/ml and incubated with 10 µM ATTO 488 NHS-ester (ATTO-TEC GmbH, Siegen) for 15 min on ice and in the dark. The cells were then washed three times with ice-cold TDB to remove any unbound dye and subsequently fixed in a final concentration of 2% w/v formaldehyde for 30 min at room temperature. After fixation, the cells were washed once with TDB and applied to a poly-L-lysine coated coverslip by centrifugation at 750 xg and room temperature for 1 min. Cells were mounted using Fluoromount-G with DAPI (Invitrogen). Slides were analysed directly using a DMI8 inverted widefield microscope (Thunder Imager, Leica Microsystems) or images were acquired for subsequent analysis as described above in the LR White smFISH section. Excitation light was selected by using the filter sets: EX 462–496 nm; DC 500 nm; EM 506–532 (ATTO 488); and EX 374–407 nm; DC 415 nm; EM 420–450 nm (DAPI). Image stacks containing 20 slices were captured using a K5 sCMOS camera (6.5 µm pixel size, Leica Microsystems).

CB-5083 treatment of cells

Cells were induced with 1 µg/ml tetracycline to express either 121^SP.ILDat2.1^tet (24 h) or LS.GFP-198 (4 h) before addition of 10 µg/ml CB-5083 in DMSO (#S8101, Selleckchem) for 4 h. Whole cell protein lysates were prepared and analysed as described under protein analyses. For Western and dot blot analysis of LS.GFP-198 a rabbit anti-GFP antibody (1:2,000, Invitrogen A11122) was used alongside a mouse monoclonal anti-PFR antibody (L13D6) (1:20; kind gift from P. Bastin).

T. brucei cell volume distribution measurements

Cell volumes were analysed at 0 h, 8 h and 24 h after induction of expression with tetracycline with a Coulter counter Multisizer 4e equipped with a 50 µm aperture tube (Beckman Coulter GmbH, Germany). Cells were cultured in 0.2 µm filtered medium to avoid clogging of the aperture. At each time point, a total of 30,000 cells were analysed in a size range of 3.0 to 30 µm equivalent spherical diameter (ESD). Data are shown as mean ±SD of three (121^SP.ILDat2.1^tet) or two independent clones (LS.GFP-198).

Supporting information

S1 Fig. Cumulative growth curve of the cell line expressing ILDat1.2 VSG, in which the native GPI signal was replaced with that from T. brucei VSG MITat1.11.

The growth was analysed for five days in the presence and absence of tetracycline. The parental 13–90 cells served as a control. Three independent clones were analysed, and data are presented as mean ± standard deviation (SD).

https://doi.org/10.1371/journal.ppat.1014518.s001

(PNG)

S2 Fig. ILDat2.1 mRNA is only efficiently transported to the ER when it contains a bona fide T. brucei VSG ER import signal.

(A) Example showing individual electron microscopy images (inverted SEM, labelled EM) and overlays of the EM image with correlative light data (smFISH and immunofluorescence) of LR White embedded trypanosomes showing the localisation of BiP protein (white), VSG221 mRNA (yellow), α-tubulin mRNA (magenta) and an overlay of all three fluorescence images and the EM image in the 121^SP:ILDat2.1^tet and the ILDat2.1^tet cell lines. Scale bars: 2 µm. The graphs show pairwise comparative quantitative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and α-tubulin (magenta) mRNA. The intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and α-tubulin is shown. The number (N) of individual mRNA molecules analysed are shown. Intensities are plotted sorted from lowest to highest intensity with the intensities given relative to the most intense BiP signal and the particles plotted normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves. (B) Example showing individual electron microscopy images (inverted SEM, labelled EM) and overlays of the EM image with correlative light data (smFISH and immunofluorescence) of LR White embedded trypanosomes showing the localisation of BiP protein (white), VSG221 mRNA (yellow), ILDat2.1 mRNA (magenta) and an overlay of all three fluorescence images and the EM image in the 121^SP:ILDat2.1^tet and ILDat2.1^tet cell lines. Scale bars: 2 µm. The graphs show pairwise comparative quantitative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and ILDat2.1 (magenta) mRNA. The intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and ILDat2.1 is shown. The number (N) of individual mRNA molecules analysed are shown. Intensities are plotted sorted from lowest to highest intensity with the intensities given relative to the most intense BiP signal and the particles plotted normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves. The overlays and graphs are identical with the images shown in Fig 4.

https://doi.org/10.1371/journal.ppat.1014518.s002

(PNG)

S3 Fig. ILDat2.1 with a bona fide ER import signal is localised to the ER.

(A) Comparative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and ILDat2.1 (magenta) (top graphs), and for VSG221 (yellow) and α-tubulin (magenta) mRNA (bottom graphs) in the ILDat2.1^tet cell line. The graph shows the intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and α-tubulin or ILDat2.1. The number of individual mRNA molecules (N) analysed are shown. Intensities are plotted sorted from lowest to highest with the intensities given relative to the most intense BiP signal and the particles plotted are normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves. (B) Comparative analysis of mRNA proximity to the ER (BiP signal) for VSG221 (yellow) and ILDat2.1 (magenta) (top graphs), and for VSG221 (yellow) and α-tubulin (magenta) mRNA (bottom graphs) in the 121^SP:ILDat2.1^tet cell line. The graphs show the intensity of the BiP signal at the respective location of individual mRNA molecules of VSG221 and α-tubulin or ILDat2.1. The number of individual mRNA molecules (N) analysed are shown. Intensities are plotted sorted from lowest to highest with the intensities given relative to the most intense BiP signal and the particles plotted are normalised to the total amount of particles analysed in each data set (particle distribution) to allow comparison of the two curves.

https://doi.org/10.1371/journal.ppat.1014518.s003

(PNG)

S4 Fig. Expression of VSG121 from downstream of the active BES-resident VSG221.

(A) Quantification of VSG221 and VSG121 mRNA and (B) VSG221 and VSG121 protein expression in the 221ES.121 cell line. VSG mRNA and protein were normalised to tubulin and PFR protein, respectively. Expression levels are presented as percentages relative to VSG expression in the parental 13–90 cells and wild-type VSG121 for VSG221 and VSG121, respectively. Values are given as means and the error bars show the SD of three independent clones.

https://doi.org/10.1371/journal.ppat.1014518.s004

(PNG)

S5 Fig. Treatment of 121^SP:ILDat2.1-expressing cells with CB-5083.

(A) Coomassie-stained gel showing 121^SP:ILDat2.1 expression of tetracycline induced cells treated with CB-5083 (+) or DMSO as a control (-). (B, C) Tentative relative quantification of 121^SP:ILDat2.1 expression based on the Coomassie gel shown in (A) with Tubulin used for normalisation. (B) Regions used to extract band intensities for tubulin and ILDat2.1 are marked in the gel. (C) No clear increase in expression of ILDat2.1 could be observed with fold changes between untreated and CB-5083 treated cells shown for the three clones analysed. As the quantification is based on Coomassie staining due to the absence of a specific antibody, the results should be interpreted cautiously.

https://doi.org/10.1371/journal.ppat.1014518.s005

(PNG)

S6 Fig. CB-5083 treatment increases protein levels of ER-targeted GFP.

(A) Western blot analysis showing LS.GFP-198 expression after treatment with CB-5083 (+) or treatment with DMSO as a control (-). PFR served as loading control. (B) Dot blot for quantification of GFP with and without CB-5083 treatment. (C) Fold change in GFP expression between untreated and CB-5083 treated cells.

https://doi.org/10.1371/journal.ppat.1014518.s006

(PNG)

S7 Fig. Cell volume distributions of cells at different time points of induction of 121SP:ILDat2.1 and ER-targeted GFP expression.

(A, B) Cell volume distributions were measured with a Coulter counter at 0 h, 8 h and 24 h of tetracycline induction. Data represent 30,000 cells per measurement and are shown as mean ± SD. (A) The graph is based on the analysis of three independent 121^SP:ILDat2.1^tet clones. (B) The graph is based on the analysis of two independent LS.GFP-198 clones.

https://doi.org/10.1371/journal.ppat.1014518.s007

(PNG)

S8 Fig. Overview images of cells at 0 h, 8 h and 24 h after induction of expression of LS.GFP-198 cells.

(A-C) Composite immunofluorescence images of cells labelled with ATTO 488 NHS-ester (shown in magenta) and DAPI (shown in cyan). (A) 0 h time point. (B) 8 h time point. (C) 24 h time point. Scale bar: 20 µm.

https://doi.org/10.1371/journal.ppat.1014518.s008

(PNG)

S1 Table. Full coding sequences of proteins analysed in this study.

Full coding sequences of all expressed proteins in this study are shown from start to stop codon.

https://doi.org/10.1371/journal.ppat.1014518.s009

(DOCX)

S2 Table. Sequence regions used for Affymetrix probe design.

Full coding sequences of transcripts targeted by Affymetrix probes are shown from start to stop codon. Sequence regions excluded from probe design are indicated in grey. The added start codon in ILDat2.1 is underlined.

https://doi.org/10.1371/journal.ppat.1014518.s010

(DOCX)

S3 Table. The grand average hydropathy (GRAVY) scores of select ER import signals.

The reported ILDat2.1 ER import signal is hydrophilic. The GRAVY scores were computed using Expasy ProtParam (https://web.expasy.org/protparam). A positive or negative GRAVY score indicates that the signal peptide is hydrophobic or hydrophilic, respectively. The hydrophobic core of the signal sequence (underlined) was predicted using Phobius (https://www.ebi.ac.uk/Tools/pfa/phobius/). The reported ILDat2.1 ER import signal peptide (Gardiner et al., 1996 [44]) could not be predicted by Phobius.

https://doi.org/10.1371/journal.ppat.1014518.s011

(DOCX)

S1 Raw images. Raw Coomassie gels, Western blots and dot blots.

https://doi.org/10.1371/journal.ppat.1014518.s012

(PDF)

S1 Data. Excel file containing all data tables for graphs shown in the manuscript.

https://doi.org/10.1371/journal.ppat.1014518.s013

(XLSX)

Acknowledgments

We thank Susanne Kramer for providing the Affymetrix probes, advice and critical reading of the initial manuscript and Bernardo Gabiatti for guidance in preparing samples for the smFISH experiments. We thank Reinhild Fischer for assistance with cell culture work. We thank Karin Römisch (Universität des Saarlandes) and her seminar class for reviewing this manuscript.

References

1. Engstler M, Pfohl T, Herminghaus S, Boshart M, Wiegertjes G, Heddergott N, et al. Hydrodynamic flow-mediated protein sorting on the cell surface of trypanosomes. Cell. 2007;131(3):505–15. pmid:17981118
- View Article
- PubMed/NCBI
- Google Scholar
2. Mugnier MR, Cross GAM, Papavasiliou FN. The in vivo dynamics of antigenic variation in Trypanosoma brucei. Science. 2015;347(6229):1470–3. pmid:25814582
- View Article
- PubMed/NCBI
- Google Scholar
3. Pays E, Vanhamme L, Pérez-Morga D. Antigenic variation in Trypanosoma brucei: facts, challenges and mysteries. Curr Opin Microbiol. 2004;7(4):369–74. pmid:15288623
- View Article
- PubMed/NCBI
- Google Scholar
4. Kreil G. Transfer of proteins across membranes. Annu Rev Biochem. 1981;50:317–48. pmid:7023361
- View Article
- PubMed/NCBI
- Google Scholar
5. McConnell J, Gurnett AM, Cordingley JS, Walker JE, Turner MJ. Biosynthesis of Trypanosoma brucei variant surface glycoprotein. I. Synthesis, size, and processing of an N-terminal signal peptide. Mol Biochem Parasitol. 1981;4(3–4):225–42. pmid:6120455
- View Article
- PubMed/NCBI
- Google Scholar
6. Hegde RS, Bernstein HD. The surprising complexity of signal sequences. Trends Biochem Sci. 2006;31(10):563–71. pmid:16919958
- View Article
- PubMed/NCBI
- Google Scholar
7. Kunze M, Berger J. The similarity between N-terminal targeting signals for protein import into different organelles and its evolutionary relevance. Front Physiol. 2015;6:259. pmid:26441678
- View Article
- PubMed/NCBI
- Google Scholar
8. Nielsen H, Engelbrecht J, von Heijne G, Brunak S. Defining a similarity threshold for a functional protein sequence pattern: the signal peptide cleavage site. Proteins. 1996;24(2):165–77. pmid:8820484
- View Article
- PubMed/NCBI
- Google Scholar
9. von Heijne G. Patterns of amino acids near signal-sequence cleavage sites. Eur J Biochem. 1983;133(1):17–21. pmid:6852022
- View Article
- PubMed/NCBI
- Google Scholar
10. Owji H, Nezafat N, Negahdaripour M, Hajiebrahimi A, Ghasemi Y. A comprehensive review of signal peptides: Structure, roles, and applications. Eur J Cell Biol. 2018;97(6):422–41. pmid:29958716
- View Article
- PubMed/NCBI
- Google Scholar
11. Ng DT, Brown JD, Walter P. Signal sequences specify the targeting route to the endoplasmic reticulum membrane. J Cell Biol. 1996;134(2):269–78. pmid:8707814
- View Article
- PubMed/NCBI
- Google Scholar
12. Chen Q, Jagannathan S, Reid DW, Zheng T, Nicchitta CV. Hierarchical regulation of mRNA partitioning between the cytoplasm and the endoplasmic reticulum of mammalian cells. Mol Biol Cell. 2011;22(14):2646–58. pmid:21613539
- View Article
- PubMed/NCBI
- Google Scholar
13. Reid DW, Nicchitta CV. Primary role for endoplasmic reticulum-bound ribosomes in cellular translation identified by ribosome profiling. J Biol Chem. 2012;287(8):5518–27. pmid:22199352
- View Article
- PubMed/NCBI
- Google Scholar
14. Reid DW, Nicchitta CV. Diversity and selectivity in mRNA translation on the endoplasmic reticulum. Nat Rev Mol Cell Biol. 2015;16(4):221–31. pmid:25735911
- View Article
- PubMed/NCBI
- Google Scholar
15. Nilsson I, Lara P, Hessa T, Johnson AE, von Heijne G, Karamyshev AL. The code for directing proteins for translocation across ER membrane: SRP cotranslationally recognizes specific features of a signal sequence. J Mol Biol. 2015;427(6 Pt A):1191–201. pmid:24979680
- View Article
- PubMed/NCBI
- Google Scholar
16. Boothroyd JC, Paynter CA, Cross GA, Bernards A, Borst P. Variant surface glycoproteins of Trypanosoma brucei are synthesised with cleavable hydrophobic sequences at the carboxy and amino termini. Nucleic Acids Res. 1981;9(18):4735–43. pmid:6272213
- View Article
- PubMed/NCBI
- Google Scholar
17. Cross GA. Structure of the variant glycoproteins and surface coat of Trypanosoma brucei. Philos Trans R Soc Lond B Biol Sci. 1984;307(1131):3–12. pmid:6151686
- View Article
- PubMed/NCBI
- Google Scholar
18. Johnson PJ, Kooter JM, Borst P. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene. Cell. 1987;51(2):273–81. pmid:3664637
- View Article
- PubMed/NCBI
- Google Scholar
19. Siegel TN, Gunasekera K, Cross GAM, Ochsenreiter T. Gene expression in Trypanosoma brucei: lessons from high-throughput RNA sequencing. Trends Parasitol. 2011;27(10):434–41. pmid:21737348
- View Article
- PubMed/NCBI
- Google Scholar
20. De Lange T, Berkvens TM, Veerman HJ, Frasch AC, Barry JD, Borst P. Comparison of the genes coding for the common 5’ terminal sequence of messenger RNAs in three trypanosome species. Nucleic Acids Res. 1984;12(11):4431–43. pmid:6204273
- View Article
- PubMed/NCBI
- Google Scholar
21. Campbell DA, van Bree MP, Boothroyd JC. The 5’-limit of transposition and upstream barren region of a trypanosome VSG gene: tandem 76 base-pair repeats flanking (TAA)90. Nucleic Acids Research. 1984;12(6):2759–74. pmid:6324125
- View Article
- PubMed/NCBI
- Google Scholar
22. Michaeli S. Trans-splicing in trypanosomes: machinery and its impact on the parasite transcriptome. Future Microbiol. 2011;6(4):459–74. pmid:21526946
- View Article
- PubMed/NCBI
- Google Scholar
23. Clayton CE. Life without transcriptional control? From fly to man and back again. EMBO J. 2002;21(8):1881–8. pmid:11953307
- View Article
- PubMed/NCBI
- Google Scholar
24. Clayton C. Regulation of gene expression in trypanosomatids: living with polycistronic transcription. Open Biol. 2019;9(6):190072. pmid:31164043
- View Article
- PubMed/NCBI
- Google Scholar
25. Kramer S. Developmental regulation of gene expression in the absence of transcriptional control: the case of kinetoplastids. Mol Biochem Parasitol. 2012;181(2):61–72. pmid:22019385
- View Article
- PubMed/NCBI
- Google Scholar
26. Cross GAM, Kim H-S, Wickstead B. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427. Mol Biochem Parasitol. 2014;195(1):59–73. pmid:24992042
- View Article
- PubMed/NCBI
- Google Scholar
27. Hertz-Fowler C, Figueiredo LM, Quail MA, Becker M, Jackson A, Bason N, et al. Telomeric expression sites are highly conserved in Trypanosoma brucei. PLoS One. 2008;3(10):e3527. pmid:18953401
- View Article
- PubMed/NCBI
- Google Scholar
28. Budzak J, Kerry LE, Aristodemou A, Hall BS, Witmer K, Kushwaha M, et al. Dynamic colocalization of 2 simultaneously active VSG expression sites within a single expression-site body in Trypanosoma brucei. Proc Natl Acad Sci U S A. 2019;116(33):16561–70. pmid:31358644
- View Article
- PubMed/NCBI
- Google Scholar
29. Navarro M, Gull K. A pol I transcriptional body associated with VSG mono-allelic expression in Trypanosoma brucei. Nature. 2001;414(6865):759–63. pmid:11742402
- View Article
- PubMed/NCBI
- Google Scholar
30. Sheader K, Vaughan S, Minchin J, Hughes K, Gull K, Rudenko G. Variant surface glycoprotein RNA interference triggers a precytokinesis cell cycle arrest in African trypanosomes. Proc Natl Acad Sci U S A. 2005;102(24):8716–21. pmid:15937117
- View Article
- PubMed/NCBI
- Google Scholar
31. Ooi C-P, Smith TK, Gluenz E, Wand NV, Vaughan S, Rudenko G. Blocking variant surface glycoprotein synthesis alters endoplasmic reticulum exit sites/Golgi homeostasis in Trypanosoma brucei. Traffic. 2018;19(6):391–405. pmid:29533496
- View Article
- PubMed/NCBI
- Google Scholar
32. Muñoz-Jordán JL, Davies KP, Cross GA. Stable expression of mosaic coats of variant surface glycoproteins in Trypanosoma brucei. Science. 1996;272(5269):1795–7. pmid:8650579
- View Article
- PubMed/NCBI
- Google Scholar
33. Smith TK, Vasileva N, Gluenz E, Terry S, Portman N, Kramer S, et al. Blocking variant surface glycoprotein synthesis in Trypanosoma brucei triggers a general arrest in translation initiation. PLoS One. 2009;4(10):e7532. pmid:19855834
- View Article
- PubMed/NCBI
- Google Scholar
34. Ridewood S, Ooi C-P, Hall B, Trenaman A, Wand NV, Sioutas G, et al. The role of genomic location and flanking 3’UTR in the generation of functional levels of variant surface glycoprotein in Trypanosoma brucei. Mol Microbiol. 2017;106(4):614–34. pmid:28906055
- View Article
- PubMed/NCBI
- Google Scholar
35. Batram C, Jones NG, Janzen CJ, Markert SM, Engstler M. Expression site attenuation mechanistically links antigenic variation and development in Trypanosoma brucei. Elife. 2014;3:e02324. pmid:24844706
- View Article
- PubMed/NCBI
- Google Scholar
36. Zimmermann H, Subota I, Batram C, Kramer S, Janzen CJ, Jones NG, et al. A quorum sensing-independent path to stumpy development in Trypanosoma brucei. PLoS Pathog. 2017;13(4):e1006324. pmid:28394929
- View Article
- PubMed/NCBI
- Google Scholar
37. Berberof M, Vanhamme L, Tebabi P, Pays A, Jefferies D, Welburn S, et al. The 3’-terminal region of the mRNAs for VSG and procyclin can confer stage specificity to gene expression in Trypanosoma brucei. EMBO J. 1995;14(12):2925–34. pmid:7796818
- View Article
- PubMed/NCBI
- Google Scholar
38. Viegas IJ, de Macedo JP, Serra L, De Niz M, Temporão A, Silva Pereira S, et al. N⁶-methyladenosine in poly(A) tails stabilize VSG transcripts. Nature. 2022;604(7905):362–70. pmid:35355019
- View Article
- PubMed/NCBI
- Google Scholar
39. Melo do Nascimento L, Egler F, Arnold K, Papavasiliou N, Clayton C, Erben E. Functional insights from a surface antigen mRNA-bound proteome. Elife. 2021;10:e68136. pmid:33783358
- View Article
- PubMed/NCBI
- Google Scholar
40. Maudlin IE, Kelly S, Schwede A, Carrington M. VSG mRNA levels are regulated by the production of functional VSG protein. Mol Biochem Parasitol. 2021;241:111348. pmid:33352254
- View Article
- PubMed/NCBI
- Google Scholar
41. Barry JD, Gathuo H. Antigenic variation in Trypanosoma vivax: isolation of a serodeme. Parasitology. 1984;89 (Pt 1):49–58. pmid:6206455
- View Article
- PubMed/NCBI
- Google Scholar
42. Chamond N, Cosson A, Blom-Potar MC, Jouvion G, D’Archivio S, Medina M, et al. Trypanosoma vivax infections: pushing ahead with mouse models for the study of Nagana. I. Parasitological, hematological and pathological parameters. PLoS Negl Trop Dis. 2010;4(8):e792. pmid:20706595
- View Article
- PubMed/NCBI
- Google Scholar
43. Gardiner PR, Pearson TW, Clarke MW, Mutharia LM. Identification and isolation of a variant surface glycoprotein from Trypanosoma vivax. Science. 1987;235(4790):774–7. pmid:3810164
- View Article
- PubMed/NCBI
- Google Scholar
44. Gardiner PR, Nene V, Barry MM, Thatthi R, Burleigh B, Clarke MW. Characterization of a small variable surface glycoprotein from Trypanosoma vivax. Mol Biochem Parasitol. 1996;82(1):1–11. pmid:8943146
- View Article
- PubMed/NCBI
- Google Scholar
45. Greif G, Ponce de Leon M, Lamolle G, Rodriguez M, Piñeyro D, Tavares-Marques LM, et al. Transcriptome analysis of the bloodstream stage from the parasite Trypanosoma vivax. BMC Genomics. 2013;14:149. pmid:23497072
- View Article
- PubMed/NCBI
- Google Scholar
46. Jones NG, Engstler M. Structure-function analysis defines the minimal functional C-terminal domain of the variant surface glycoprotein of Trypanosomabrucei brucei. J Biol Chem. 2025;301(7):110260. pmid:40412524
- View Article
- PubMed/NCBI
- Google Scholar
47. Garrison P, Bangs JD. p97 Inhibitor CB-5083 Blocks ERAD in Trypanosoma brucei. Mol Biochem Parasitol. 2020;239:111313. pmid:32735998
- View Article
- PubMed/NCBI
- Google Scholar
48. Kramer S, Meyer-Natus E, Stigloher C, Thoma H, Schnaufer A, Engstler M. Parallel monitoring of RNA abundance, localization and compactness with correlative single molecule FISH on LR White embedded samples. Nucleic Acids Res. 2021;49(3):e14. pmid:33275141
- View Article
- PubMed/NCBI
- Google Scholar
49. Urwyler S, Studer E, Renggli CK, Roditi I. A family of stage-specific alanine-rich proteins on the surface of epimastigote forms of Trypanosoma brucei. Mol Microbiol. 2007;63(1):218–28. pmid:17229212
- View Article
- PubMed/NCBI
- Google Scholar
50. Roditi I, Carrington M, Turner M. Expression of a polypeptide containing a dipeptide repeat is confined to the insect stage of Trypanosoma brucei. Nature. 1987;325(6101):272–4. pmid:3808022
- View Article
- PubMed/NCBI
- Google Scholar
51. Macleod OJS, Bart J-M, MacGregor P, Peacock L, Savill NJ, Hester S, et al. A receptor for the complement regulator factor H increases transmission of trypanosomes to tsetse flies. Nat Commun. 2020;11(1):1326. pmid:32165615
- View Article
- PubMed/NCBI
- Google Scholar
52. Liu HS, Jan MS, Chou CK, Chen PH, Ke NJ. Is green fluorescent protein toxic to the living cells?. Biochem Biophys Res Commun. 1999;260(3):712–7. pmid:10403831
- View Article
- PubMed/NCBI
- Google Scholar
53. Borst P. Antigenic variation and allelic exclusion. Cell. 2002;109(1):5–8. pmid:11955440
- View Article
- PubMed/NCBI
- Google Scholar
54. Voss TS, Healer J, Marty AJ, Duffy MF, Thompson JK, Beeson JG, et al. A var gene promoter controls allelic exclusion of virulence genes in Plasmodium falciparum malaria. Nature. 2006;439(7079):1004–8. pmid:16382237
- View Article
- PubMed/NCBI
- Google Scholar
55. Horn D. Antigenic variation in African trypanosomes. Mol Biochem Parasitol. 2014;195(2):123–9. pmid:24859277
- View Article
- PubMed/NCBI
- Google Scholar
56. Bakari-Soale M, Batram C, Zimmermann H, Jones NG, Engstler M. The dual role of the 16mer motif within the 3’ untranslated region of the variant surface glycoprotein of Trypanosoma brucei. bioRxiv. 2023.
- View Article
- Google Scholar
57. Manna PT, Boehm C, Leung KF, Natesan SK, Field MC. Life and times: synthesis, trafficking, and evolution of VSG. Trends Parasitol. 2014;30(5):251–8. pmid:24731931
- View Article
- PubMed/NCBI
- Google Scholar
58. Ast T, Cohen G, Schuldiner M. A network of cytosolic factors targets SRP-independent proteins to the endoplasmic reticulum. Cell. 2013;152(5):1134–45. pmid:23452858
- View Article
- PubMed/NCBI
- Google Scholar
59. Goldshmidt H, Sheiner L, Bütikofer P, Roditi I, Uliel S, Günzel M, et al. Role of protein translocation pathways across the endoplasmic reticulum in Trypanosoma brucei. J Biol Chem. 2008;283(46):32085–98. pmid:18768469
- View Article
- PubMed/NCBI
- Google Scholar
60. von Heijne G. Life and death of a signal peptide. Nature. 1998;396(6707):111, 113. pmid:9823886
- View Article
- PubMed/NCBI
- Google Scholar
61. Walter P, Johnson AE. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu Rev Cell Biol. 1994;10:87–119. pmid:7888184
- View Article
- PubMed/NCBI
- Google Scholar
62. Levine CG, Mitra D, Sharma A, Smith CL, Hegde RS. The efficiency of protein compartmentalization into the secretory pathway. Mol Biol Cell. 2005;16(1):279–91. pmid:15496459
- View Article
- PubMed/NCBI
- Google Scholar
63. Martoglio B, Dobberstein B. Signal sequences: more than just greasy peptides. Trends Cell Biol. 1998;8(10):410–5. pmid:9789330
- View Article
- PubMed/NCBI
- Google Scholar
64. Duffy J, Patham B, Mensa-Wilmot K. Discovery of functional motifs in h-regions of trypanosome signal sequences. Biochem J. 2010;426(2):135–45. pmid:20017734
- View Article
- PubMed/NCBI
- Google Scholar
65. Günzl A, Bruderer T, Laufer G, Schimanski B, Tu L-C, Chung H-M, et al. RNA polymerase I transcribes procyclin genes and variant surface glycoprotein gene expression sites in Trypanosoma brucei. Eukaryot Cell. 2003;2(3):542–51. pmid:12796299
- View Article
- PubMed/NCBI
- Google Scholar
66. Haimovich G, Medina DA, Causse SZ, Garber M, Millán-Zambrano G, Barkai O, et al. Gene expression is circular: factors for mRNA degradation also foster mRNA synthesis. Cell. 2013;153(5):1000–11. pmid:23706738
- View Article
- PubMed/NCBI
- Google Scholar
67. Sun M, Schwalb B, Schulz D, Pirkl N, Etzold S, Larivière L, et al. Comparative dynamic transcriptome analysis (cDTA) reveals mutual feedback between mRNA synthesis and degradation. Genome Res. 2012;22(7):1350–9. pmid:22466169
- View Article
- PubMed/NCBI
- Google Scholar
68. Pérez-Ortín JE, de Miguel-Jiménez L, Chávez S. Genome-wide studies of mRNA synthesis and degradation in eukaryotes. Biochim Biophys Acta. 2012;1819(6):604–15. pmid:22182827
- View Article
- PubMed/NCBI
- Google Scholar
69. Shalem O, Dahan O, Levo M, Martinez MR, Furman I, Segal E, et al. Transient transcriptional responses to stress are generated by opposing effects of mRNA production and degradation. Mol Syst Biol. 2008;4:223. pmid:18854817
- View Article
- PubMed/NCBI
- Google Scholar
70. Sun M, Schwalb B, Pirkl N, Maier KC, Schenk A, Failmezger H, et al. Global analysis of eukaryotic mRNA degradation reveals Xrn1-dependent buffering of transcript levels. Mol Cell. 2013;52(1):52–62. pmid:24119399
- View Article
- PubMed/NCBI
- Google Scholar
71. Abernathy E, Gilbertson S, Alla R, Glaunsinger B. Viral Nucleases Induce an mRNA Degradation-Transcription Feedback Loop in Mammalian Cells. Cell Host Microbe. 2015;18(2):243–53. pmid:26211836
- View Article
- PubMed/NCBI
- Google Scholar
72. Singh P, James RS, Mee CJ, Morozov IY. mRNA levels are buffered upon knockdown of RNA decay and translation factors via adjustment of transcription rates in human HepG2 cells. RNA Biol. 2019;16(9):1147–55. pmid:31116665
- View Article
- PubMed/NCBI
- Google Scholar
73. Timmers HTM, Tora L. Transcript buffering: a balancing act between mRNA synthesis and mRNA degradation. Mol Cell. 2018;72(1):10–7. pmid:30290147
- View Article
- PubMed/NCBI
- Google Scholar
74. Wirtz E, Leal S, Ochatt C, Cross GA. A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol Biochem Parasitol. 1999;99(1):89–101. pmid:10215027
- View Article
- PubMed/NCBI
- Google Scholar
75. Heckman KL, Pease LR. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat Protoc. 2007;2(4):924–32. pmid:17446874
- View Article
- PubMed/NCBI
- Google Scholar
76. Nielsen H. Predicting secretory proteins with SignalP. Methods in Molecular Biology. 2017;1611:59–73. pmid:28451972
- View Article
- PubMed/NCBI
- Google Scholar
77. Janzen CJ, Lander F, Dreesen O, Cross GAM. Telomere length regulation and transcriptional silencing in KU80-deficient Trypanosoma brucei. Nucleic Acids Res. 2004;32(22):6575–84. pmid:15602000
- View Article
- PubMed/NCBI
- Google Scholar
78. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. pmid:22743772
- View Article
- PubMed/NCBI
- Google Scholar
79. Reynolds ES. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol. 1963;17(1):208–12. pmid:13986422
- View Article
- PubMed/NCBI
- Google Scholar
80. Markert SM, Bauer V, Muenz TS, Jones NG, Helmprobst F, Britz S, et al. 3D subcellular localization with superresolution array tomography on ultrathin sections of various species. Methods Cell Biol. 2017;140:21–47. pmid:28528634
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Engstler M, Pfohl T, Herminghaus S, Boshart M, Wiegertjes G, Heddergott N, et al. Hydrodynamic flow-mediated protein sorting on the cell surface of trypanosomes. Cell. 2007;131(3):505–15. pmid:17981118
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Mugnier MR, Cross GAM, Papavasiliou FN. The in vivo dynamics of antigenic variation in Trypanosoma brucei. Science. 2015;347(6229):1470–3. pmid:25814582
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Pays E, Vanhamme L, Pérez-Morga D. Antigenic variation in Trypanosoma brucei: facts, challenges and mysteries. Curr Opin Microbiol. 2004;7(4):369–74. pmid:15288623
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Kreil G. Transfer of proteins across membranes. Annu Rev Biochem. 1981;50:317–48. pmid:7023361
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. McConnell J, Gurnett AM, Cordingley JS, Walker JE, Turner MJ. Biosynthesis of Trypanosoma brucei variant surface glycoprotein. I. Synthesis, size, and processing of an N-terminal signal peptide. Mol Biochem Parasitol. 1981;4(3–4):225–42. pmid:6120455
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Hegde RS, Bernstein HD. The surprising complexity of signal sequences. Trends Biochem Sci. 2006;31(10):563–71. pmid:16919958
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Kunze M, Berger J. The similarity between N-terminal targeting signals for protein import into different organelles and its evolutionary relevance. Front Physiol. 2015;6:259. pmid:26441678
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Nielsen H, Engelbrecht J, von Heijne G, Brunak S. Defining a similarity threshold for a functional protein sequence pattern: the signal peptide cleavage site. Proteins. 1996;24(2):165–77. pmid:8820484
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. von Heijne G. Patterns of amino acids near signal-sequence cleavage sites. Eur J Biochem. 1983;133(1):17–21. pmid:6852022
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Owji H, Nezafat N, Negahdaripour M, Hajiebrahimi A, Ghasemi Y. A comprehensive review of signal peptides: Structure, roles, and applications. Eur J Cell Biol. 2018;97(6):422–41. pmid:29958716
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Ng DT, Brown JD, Walter P. Signal sequences specify the targeting route to the endoplasmic reticulum membrane. J Cell Biol. 1996;134(2):269–78. pmid:8707814
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Chen Q, Jagannathan S, Reid DW, Zheng T, Nicchitta CV. Hierarchical regulation of mRNA partitioning between the cytoplasm and the endoplasmic reticulum of mammalian cells. Mol Biol Cell. 2011;22(14):2646–58. pmid:21613539
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Reid DW, Nicchitta CV. Primary role for endoplasmic reticulum-bound ribosomes in cellular translation identified by ribosome profiling. J Biol Chem. 2012;287(8):5518–27. pmid:22199352
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Reid DW, Nicchitta CV. Diversity and selectivity in mRNA translation on the endoplasmic reticulum. Nat Rev Mol Cell Biol. 2015;16(4):221–31. pmid:25735911
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Nilsson I, Lara P, Hessa T, Johnson AE, von Heijne G, Karamyshev AL. The code for directing proteins for translocation across ER membrane: SRP cotranslationally recognizes specific features of a signal sequence. J Mol Biol. 2015;427(6 Pt A):1191–201. pmid:24979680
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Boothroyd JC, Paynter CA, Cross GA, Bernards A, Borst P. Variant surface glycoproteins of Trypanosoma brucei are synthesised with cleavable hydrophobic sequences at the carboxy and amino termini. Nucleic Acids Res. 1981;9(18):4735–43. pmid:6272213
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Cross GA. Structure of the variant glycoproteins and surface coat of Trypanosoma brucei. Philos Trans R Soc Lond B Biol Sci. 1984;307(1131):3–12. pmid:6151686
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Johnson PJ, Kooter JM, Borst P. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene. Cell. 1987;51(2):273–81. pmid:3664637
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Siegel TN, Gunasekera K, Cross GAM, Ochsenreiter T. Gene expression in Trypanosoma brucei: lessons from high-throughput RNA sequencing. Trends Parasitol. 2011;27(10):434–41. pmid:21737348
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. De Lange T, Berkvens TM, Veerman HJ, Frasch AC, Barry JD, Borst P. Comparison of the genes coding for the common 5’ terminal sequence of messenger RNAs in three trypanosome species. Nucleic Acids Res. 1984;12(11):4431–43. pmid:6204273
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Campbell DA, van Bree MP, Boothroyd JC. The 5’-limit of transposition and upstream barren region of a trypanosome VSG gene: tandem 76 base-pair repeats flanking (TAA)90. Nucleic Acids Research. 1984;12(6):2759–74. pmid:6324125
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Michaeli S. Trans-splicing in trypanosomes: machinery and its impact on the parasite transcriptome. Future Microbiol. 2011;6(4):459–74. pmid:21526946
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Clayton CE. Life without transcriptional control? From fly to man and back again. EMBO J. 2002;21(8):1881–8. pmid:11953307
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref24] 24. Clayton C. Regulation of gene expression in trypanosomatids: living with polycistronic transcription. Open Biol. 2019;9(6):190072. pmid:31164043
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref25] 25. Kramer S. Developmental regulation of gene expression in the absence of transcriptional control: the case of kinetoplastids. Mol Biochem Parasitol. 2012;181(2):61–72. pmid:22019385
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref26] 26. Cross GAM, Kim H-S, Wickstead B. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427. Mol Biochem Parasitol. 2014;195(1):59–73. pmid:24992042
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref27] 27. Hertz-Fowler C, Figueiredo LM, Quail MA, Becker M, Jackson A, Bason N, et al. Telomeric expression sites are highly conserved in Trypanosoma brucei. PLoS One. 2008;3(10):e3527. pmid:18953401
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref28] 28. Budzak J, Kerry LE, Aristodemou A, Hall BS, Witmer K, Kushwaha M, et al. Dynamic colocalization of 2 simultaneously active VSG expression sites within a single expression-site body in Trypanosoma brucei. Proc Natl Acad Sci U S A. 2019;116(33):16561–70. pmid:31358644
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref29] 29. Navarro M, Gull K. A pol I transcriptional body associated with VSG mono-allelic expression in Trypanosoma brucei. Nature. 2001;414(6865):759–63. pmid:11742402
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref30] 30. Sheader K, Vaughan S, Minchin J, Hughes K, Gull K, Rudenko G. Variant surface glycoprotein RNA interference triggers a precytokinesis cell cycle arrest in African trypanosomes. Proc Natl Acad Sci U S A. 2005;102(24):8716–21. pmid:15937117
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref31] 31. Ooi C-P, Smith TK, Gluenz E, Wand NV, Vaughan S, Rudenko G. Blocking variant surface glycoprotein synthesis alters endoplasmic reticulum exit sites/Golgi homeostasis in Trypanosoma brucei. Traffic. 2018;19(6):391–405. pmid:29533496
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref32] 32. Muñoz-Jordán JL, Davies KP, Cross GA. Stable expression of mosaic coats of variant surface glycoproteins in Trypanosoma brucei. Science. 1996;272(5269):1795–7. pmid:8650579
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref33] 33. Smith TK, Vasileva N, Gluenz E, Terry S, Portman N, Kramer S, et al. Blocking variant surface glycoprotein synthesis in Trypanosoma brucei triggers a general arrest in translation initiation. PLoS One. 2009;4(10):e7532. pmid:19855834
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref34] 34. Ridewood S, Ooi C-P, Hall B, Trenaman A, Wand NV, Sioutas G, et al. The role of genomic location and flanking 3’UTR in the generation of functional levels of variant surface glycoprotein in Trypanosoma brucei. Mol Microbiol. 2017;106(4):614–34. pmid:28906055
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref35] 35. Batram C, Jones NG, Janzen CJ, Markert SM, Engstler M. Expression site attenuation mechanistically links antigenic variation and development in Trypanosoma brucei. Elife. 2014;3:e02324. pmid:24844706
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref36] 36. Zimmermann H, Subota I, Batram C, Kramer S, Janzen CJ, Jones NG, et al. A quorum sensing-independent path to stumpy development in Trypanosoma brucei. PLoS Pathog. 2017;13(4):e1006324. pmid:28394929
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref37] 37. Berberof M, Vanhamme L, Tebabi P, Pays A, Jefferies D, Welburn S, et al. The 3’-terminal region of the mRNAs for VSG and procyclin can confer stage specificity to gene expression in Trypanosoma brucei. EMBO J. 1995;14(12):2925–34. pmid:7796818
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

[ref38] 38. Viegas IJ, de Macedo JP, Serra L, De Niz M, Temporão A, Silva Pereira S, et al. N⁶-methyladenosine in poly(A) tails stabilize VSG transcripts. Nature. 2022;604(7905):362–70. pmid:35355019
View Article
PubMed/NCBI
Google Scholar

[150] View Article

[151] PubMed/NCBI

[152] Google Scholar

[ref39] 39. Melo do Nascimento L, Egler F, Arnold K, Papavasiliou N, Clayton C, Erben E. Functional insights from a surface antigen mRNA-bound proteome. Elife. 2021;10:e68136. pmid:33783358
View Article
PubMed/NCBI
Google Scholar

[154] View Article

[155] PubMed/NCBI

[156] Google Scholar

[ref40] 40. Maudlin IE, Kelly S, Schwede A, Carrington M. VSG mRNA levels are regulated by the production of functional VSG protein. Mol Biochem Parasitol. 2021;241:111348. pmid:33352254
View Article
PubMed/NCBI
Google Scholar

[158] View Article

[159] PubMed/NCBI

[160] Google Scholar

[ref41] 41. Barry JD, Gathuo H. Antigenic variation in Trypanosoma vivax: isolation of a serodeme. Parasitology. 1984;89 (Pt 1):49–58. pmid:6206455
View Article
PubMed/NCBI
Google Scholar

[162] View Article

[163] PubMed/NCBI

[164] Google Scholar

[ref42] 42. Chamond N, Cosson A, Blom-Potar MC, Jouvion G, D’Archivio S, Medina M, et al. Trypanosoma vivax infections: pushing ahead with mouse models for the study of Nagana. I. Parasitological, hematological and pathological parameters. PLoS Negl Trop Dis. 2010;4(8):e792. pmid:20706595
View Article
PubMed/NCBI
Google Scholar

[166] View Article

[167] PubMed/NCBI

[168] Google Scholar

[ref43] 43. Gardiner PR, Pearson TW, Clarke MW, Mutharia LM. Identification and isolation of a variant surface glycoprotein from Trypanosoma vivax. Science. 1987;235(4790):774–7. pmid:3810164
View Article
PubMed/NCBI
Google Scholar

[170] View Article

[171] PubMed/NCBI

[172] Google Scholar

[ref44] 44. Gardiner PR, Nene V, Barry MM, Thatthi R, Burleigh B, Clarke MW. Characterization of a small variable surface glycoprotein from Trypanosoma vivax. Mol Biochem Parasitol. 1996;82(1):1–11. pmid:8943146
View Article
PubMed/NCBI
Google Scholar

[174] View Article

[175] PubMed/NCBI

[176] Google Scholar

[ref45] 45. Greif G, Ponce de Leon M, Lamolle G, Rodriguez M, Piñeyro D, Tavares-Marques LM, et al. Transcriptome analysis of the bloodstream stage from the parasite Trypanosoma vivax. BMC Genomics. 2013;14:149. pmid:23497072
View Article
PubMed/NCBI
Google Scholar

[178] View Article

[179] PubMed/NCBI

[180] Google Scholar

[ref46] 46. Jones NG, Engstler M. Structure-function analysis defines the minimal functional C-terminal domain of the variant surface glycoprotein of Trypanosomabrucei brucei. J Biol Chem. 2025;301(7):110260. pmid:40412524
View Article
PubMed/NCBI
Google Scholar

[182] View Article

[183] PubMed/NCBI

[184] Google Scholar

[ref47] 47. Garrison P, Bangs JD. p97 Inhibitor CB-5083 Blocks ERAD in Trypanosoma brucei. Mol Biochem Parasitol. 2020;239:111313. pmid:32735998
View Article
PubMed/NCBI
Google Scholar

[186] View Article

[187] PubMed/NCBI

[188] Google Scholar

[ref48] 48. Kramer S, Meyer-Natus E, Stigloher C, Thoma H, Schnaufer A, Engstler M. Parallel monitoring of RNA abundance, localization and compactness with correlative single molecule FISH on LR White embedded samples. Nucleic Acids Res. 2021;49(3):e14. pmid:33275141
View Article
PubMed/NCBI
Google Scholar

[190] View Article

[191] PubMed/NCBI

[192] Google Scholar

[ref49] 49. Urwyler S, Studer E, Renggli CK, Roditi I. A family of stage-specific alanine-rich proteins on the surface of epimastigote forms of Trypanosoma brucei. Mol Microbiol. 2007;63(1):218–28. pmid:17229212
View Article
PubMed/NCBI
Google Scholar

[194] View Article

[195] PubMed/NCBI

[196] Google Scholar

[ref50] 50. Roditi I, Carrington M, Turner M. Expression of a polypeptide containing a dipeptide repeat is confined to the insect stage of Trypanosoma brucei. Nature. 1987;325(6101):272–4. pmid:3808022
View Article
PubMed/NCBI
Google Scholar

[198] View Article

[199] PubMed/NCBI

[200] Google Scholar

[ref51] 51. Macleod OJS, Bart J-M, MacGregor P, Peacock L, Savill NJ, Hester S, et al. A receptor for the complement regulator factor H increases transmission of trypanosomes to tsetse flies. Nat Commun. 2020;11(1):1326. pmid:32165615
View Article
PubMed/NCBI
Google Scholar

[202] View Article

[203] PubMed/NCBI

[204] Google Scholar

[ref52] 52. Liu HS, Jan MS, Chou CK, Chen PH, Ke NJ. Is green fluorescent protein toxic to the living cells?. Biochem Biophys Res Commun. 1999;260(3):712–7. pmid:10403831
View Article
PubMed/NCBI
Google Scholar

[206] View Article

[207] PubMed/NCBI

[208] Google Scholar

[ref53] 53. Borst P. Antigenic variation and allelic exclusion. Cell. 2002;109(1):5–8. pmid:11955440
View Article
PubMed/NCBI
Google Scholar

[210] View Article

[211] PubMed/NCBI

[212] Google Scholar

[ref54] 54. Voss TS, Healer J, Marty AJ, Duffy MF, Thompson JK, Beeson JG, et al. A var gene promoter controls allelic exclusion of virulence genes in Plasmodium falciparum malaria. Nature. 2006;439(7079):1004–8. pmid:16382237
View Article
PubMed/NCBI
Google Scholar

[214] View Article

[215] PubMed/NCBI

[216] Google Scholar

[ref55] 55. Horn D. Antigenic variation in African trypanosomes. Mol Biochem Parasitol. 2014;195(2):123–9. pmid:24859277
View Article
PubMed/NCBI
Google Scholar

[218] View Article

[219] PubMed/NCBI

[220] Google Scholar

[ref56] 56. Bakari-Soale M, Batram C, Zimmermann H, Jones NG, Engstler M. The dual role of the 16mer motif within the 3’ untranslated region of the variant surface glycoprotein of Trypanosoma brucei. bioRxiv. 2023.
View Article
Google Scholar

[222] View Article

[223] Google Scholar

[ref57] 57. Manna PT, Boehm C, Leung KF, Natesan SK, Field MC. Life and times: synthesis, trafficking, and evolution of VSG. Trends Parasitol. 2014;30(5):251–8. pmid:24731931
View Article
PubMed/NCBI
Google Scholar

[225] View Article

[226] PubMed/NCBI

[227] Google Scholar

[ref58] 58. Ast T, Cohen G, Schuldiner M. A network of cytosolic factors targets SRP-independent proteins to the endoplasmic reticulum. Cell. 2013;152(5):1134–45. pmid:23452858
View Article
PubMed/NCBI
Google Scholar

[229] View Article

[230] PubMed/NCBI

[231] Google Scholar

[ref59] 59. Goldshmidt H, Sheiner L, Bütikofer P, Roditi I, Uliel S, Günzel M, et al. Role of protein translocation pathways across the endoplasmic reticulum in Trypanosoma brucei. J Biol Chem. 2008;283(46):32085–98. pmid:18768469
View Article
PubMed/NCBI
Google Scholar

[233] View Article

[234] PubMed/NCBI

[235] Google Scholar

[ref60] 60. von Heijne G. Life and death of a signal peptide. Nature. 1998;396(6707):111, 113. pmid:9823886
View Article
PubMed/NCBI
Google Scholar

[237] View Article

[238] PubMed/NCBI

[239] Google Scholar

[ref61] 61. Walter P, Johnson AE. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annu Rev Cell Biol. 1994;10:87–119. pmid:7888184
View Article
PubMed/NCBI
Google Scholar

[241] View Article

[242] PubMed/NCBI

[243] Google Scholar

[ref62] 62. Levine CG, Mitra D, Sharma A, Smith CL, Hegde RS. The efficiency of protein compartmentalization into the secretory pathway. Mol Biol Cell. 2005;16(1):279–91. pmid:15496459
View Article
PubMed/NCBI
Google Scholar

[245] View Article

[246] PubMed/NCBI

[247] Google Scholar

[ref63] 63. Martoglio B, Dobberstein B. Signal sequences: more than just greasy peptides. Trends Cell Biol. 1998;8(10):410–5. pmid:9789330
View Article
PubMed/NCBI
Google Scholar

[249] View Article

[250] PubMed/NCBI

[251] Google Scholar

[ref64] 64. Duffy J, Patham B, Mensa-Wilmot K. Discovery of functional motifs in h-regions of trypanosome signal sequences. Biochem J. 2010;426(2):135–45. pmid:20017734
View Article
PubMed/NCBI
Google Scholar

[253] View Article

[254] PubMed/NCBI

[255] Google Scholar

[ref65] 65. Günzl A, Bruderer T, Laufer G, Schimanski B, Tu L-C, Chung H-M, et al. RNA polymerase I transcribes procyclin genes and variant surface glycoprotein gene expression sites in Trypanosoma brucei. Eukaryot Cell. 2003;2(3):542–51. pmid:12796299
View Article
PubMed/NCBI
Google Scholar

[257] View Article

[258] PubMed/NCBI

[259] Google Scholar

[ref66] 66. Haimovich G, Medina DA, Causse SZ, Garber M, Millán-Zambrano G, Barkai O, et al. Gene expression is circular: factors for mRNA degradation also foster mRNA synthesis. Cell. 2013;153(5):1000–11. pmid:23706738
View Article
PubMed/NCBI
Google Scholar

[261] View Article

[262] PubMed/NCBI

[263] Google Scholar

[ref67] 67. Sun M, Schwalb B, Schulz D, Pirkl N, Etzold S, Larivière L, et al. Comparative dynamic transcriptome analysis (cDTA) reveals mutual feedback between mRNA synthesis and degradation. Genome Res. 2012;22(7):1350–9. pmid:22466169
View Article
PubMed/NCBI
Google Scholar

[265] View Article

[266] PubMed/NCBI

[267] Google Scholar

[ref68] 68. Pérez-Ortín JE, de Miguel-Jiménez L, Chávez S. Genome-wide studies of mRNA synthesis and degradation in eukaryotes. Biochim Biophys Acta. 2012;1819(6):604–15. pmid:22182827
View Article
PubMed/NCBI
Google Scholar

[269] View Article

[270] PubMed/NCBI

[271] Google Scholar

[ref69] 69. Shalem O, Dahan O, Levo M, Martinez MR, Furman I, Segal E, et al. Transient transcriptional responses to stress are generated by opposing effects of mRNA production and degradation. Mol Syst Biol. 2008;4:223. pmid:18854817
View Article
PubMed/NCBI
Google Scholar

[273] View Article

[274] PubMed/NCBI

[275] Google Scholar

[ref70] 70. Sun M, Schwalb B, Pirkl N, Maier KC, Schenk A, Failmezger H, et al. Global analysis of eukaryotic mRNA degradation reveals Xrn1-dependent buffering of transcript levels. Mol Cell. 2013;52(1):52–62. pmid:24119399
View Article
PubMed/NCBI
Google Scholar

[277] View Article

[278] PubMed/NCBI

[279] Google Scholar

[ref71] 71. Abernathy E, Gilbertson S, Alla R, Glaunsinger B. Viral Nucleases Induce an mRNA Degradation-Transcription Feedback Loop in Mammalian Cells. Cell Host Microbe. 2015;18(2):243–53. pmid:26211836
View Article
PubMed/NCBI
Google Scholar

[281] View Article

[282] PubMed/NCBI

[283] Google Scholar

[ref72] 72. Singh P, James RS, Mee CJ, Morozov IY. mRNA levels are buffered upon knockdown of RNA decay and translation factors via adjustment of transcription rates in human HepG2 cells. RNA Biol. 2019;16(9):1147–55. pmid:31116665
View Article
PubMed/NCBI
Google Scholar

[285] View Article

[286] PubMed/NCBI

[287] Google Scholar

[ref73] 73. Timmers HTM, Tora L. Transcript buffering: a balancing act between mRNA synthesis and mRNA degradation. Mol Cell. 2018;72(1):10–7. pmid:30290147
View Article
PubMed/NCBI
Google Scholar

[289] View Article

[290] PubMed/NCBI

[291] Google Scholar

[ref74] 74. Wirtz E, Leal S, Ochatt C, Cross GA. A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in Trypanosoma brucei. Mol Biochem Parasitol. 1999;99(1):89–101. pmid:10215027
View Article
PubMed/NCBI
Google Scholar

[293] View Article

[294] PubMed/NCBI

[295] Google Scholar

[ref75] 75. Heckman KL, Pease LR. Gene splicing and mutagenesis by PCR-driven overlap extension. Nat Protoc. 2007;2(4):924–32. pmid:17446874
View Article
PubMed/NCBI
Google Scholar

[297] View Article

[298] PubMed/NCBI

[299] Google Scholar

[ref76] 76. Nielsen H. Predicting secretory proteins with SignalP. Methods in Molecular Biology. 2017;1611:59–73. pmid:28451972
View Article
PubMed/NCBI
Google Scholar

[301] View Article

[302] PubMed/NCBI

[303] Google Scholar

[ref77] 77. Janzen CJ, Lander F, Dreesen O, Cross GAM. Telomere length regulation and transcriptional silencing in KU80-deficient Trypanosoma brucei. Nucleic Acids Res. 2004;32(22):6575–84. pmid:15602000
View Article
PubMed/NCBI
Google Scholar

[305] View Article

[306] PubMed/NCBI

[307] Google Scholar

[ref78] 78. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012;9(7):676–82. pmid:22743772
View Article
PubMed/NCBI
Google Scholar

[309] View Article

[310] PubMed/NCBI

[311] Google Scholar

[ref79] 79. Reynolds ES. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol. 1963;17(1):208–12. pmid:13986422
View Article
PubMed/NCBI
Google Scholar

[313] View Article

[314] PubMed/NCBI

[315] Google Scholar

[ref80] 80. Markert SM, Bauer V, Muenz TS, Jones NG, Helmprobst F, Britz S, et al. 3D subcellular localization with superresolution array tomography on ultrathin sections of various species. Methods Cell Biol. 2017;140:21–47. pmid:28528634
View Article
PubMed/NCBI
Google Scholar

[317] View Article

[318] PubMed/NCBI

[319] Google Scholar

This is an uncorrected proof.

Figures

Abstract

Author summary

Introduction

Results

Different T. vivax VSGs elicit distinct VSG mRNA balancing responses in T. brucei

Functional ER import signals determine whether ectopic VSG transcripts trigger mRNA balancing

ER proximity of ectopic VSG transcripts depends on a functional ER import signal

Non-VSG ER import signals target VSGs to the ER but differentially influence the regulation of total VSG mRNA levels

ER-targeted GFP is sufficient to trigger VSG mRNA balancing

Discussion

Methodology

Cultivation and genetic manipulation of trypanosomes

Plasmid construction and generation of cell lines

RNA analysis

Protein analyses

Fluorescence microscopy

Immunofluorescence microscopy

LR White smFISH

Cell cycle analyses

CB-5083 treatment of cells

T. brucei cell volume distribution measurements

Supporting information

S1 Fig. Cumulative growth curve of the cell line expressing ILDat1.2 VSG, in which the native GPI signal was replaced with that from T. brucei VSG MITat1.11.

S2 Fig. ILDat2.1 mRNA is only efficiently transported to the ER when it contains a bona fide T. brucei VSG ER import signal.

S3 Fig. ILDat2.1 with a bona fide ER import signal is localised to the ER.

S4 Fig. Expression of VSG121 from downstream of the active BES-resident VSG221.

S5 Fig. Treatment of 121SP:ILDat2.1-expressing cells with CB-5083.

S6 Fig. CB-5083 treatment increases protein levels of ER-targeted GFP.

S7 Fig. Cell volume distributions of cells at different time points of induction of 121SP:ILDat2.1 and ER-targeted GFP expression.

S8 Fig. Overview images of cells at 0 h, 8 h and 24 h after induction of expression of LS.GFP-198 cells.

S1 Table. Full coding sequences of proteins analysed in this study.

S2 Table. Sequence regions used for Affymetrix probe design.

S3 Table. The grand average hydropathy (GRAVY) scores of select ER import signals.

S1 Raw images. Raw Coomassie gels, Western blots and dot blots.

S1 Data. Excel file containing all data tables for graphs shown in the manuscript.

Acknowledgments

References

S5 Fig. Treatment of 121^SP:ILDat2.1-expressing cells with CB-5083.