Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Reduced inflammatory and Th1 transcriptional profiles in geriatric versus adult cotton rats infected with respiratory syncytial virus

  • Jonathan Miller ,

    Roles Conceptualization, Formal analysis, Investigation, Methodology, Validation, Writing – original draft

    jonathan.miller2@wsu.edu

    Affiliations Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio United States of America, Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University, Pullman, Washington United States of America

    ⨯
  • Cameron Leedale,

    Roles Investigation

    Affiliation Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio United States of America

    ⨯
  • Ayse Selen Yilmaz,

    Roles Formal analysis

    Affiliation Biomedical Informatics, College of Medicine, The Ohio State University, Columbus, Ohio United States of America

    ⨯
  • Emily Pawlack,

    Roles Investigation

    Affiliation Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio United States of America

    ⨯
  • Jèssica Gómez Garrido,

    Roles Resources

    Affiliations Centro Nacional de Análisis Genómico (CNAG), Barcelona, Spain, Universitat de Barcelona (UB), Barcelona, Spain

    ⨯
  • Tyler Alioto,

    Roles Resources

    Affiliations Centro Nacional de Análisis Genómico (CNAG), Barcelona, Spain, Universitat de Barcelona (UB), Barcelona, Spain

    ⨯
  • Lianbo Yu,

    Roles Formal analysis

    Affiliation Biomedical Informatics, College of Medicine, The Ohio State University, Columbus, Ohio United States of America

    ⨯
  • David E. Symer,

    Roles Resources

    Affiliation Division of Hematology and Oncology, Department of Medicine, VA Boston Healthcare System, US Department of Veterans Affairs, Boston, Massachusetts United States of America

    ⨯
  • Stefan Niewiesk

    Roles Conceptualization, Methodology, Resources, Supervision, Writing – review & editing

    Affiliation Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio United States of America

    ⨯

Abstract

Human respiratory syncytial virus (RSV) is a leading cause of severe respiratory disease in elderly populations. RSV clearance is delayed in individuals over 65 years of age, a finding that is recapitulated in the geriatric cotton rat model. Altered inflammatory responses in elderly populations have been implicated with impaired clearance of several pathogens but remain poorly described for RSV. We performed RNA sequencing (RNA-seq) and pathway analysis on lung tissue of RSV-infected adult and geriatric cotton rats to characterize differential host immune responses between these age groups. No differences in inflammatory gene expression were observed between uninfected adult and geriatric cotton rats. At day 1 post-infection, adult cotton rats expressed higher levels of genes encoding several cytokines and transcription factors associated with acute inflammation and initiation of a Th1 response, including IFN- β, IL12, and Tbet, compared to geriatric cotton rats. By day 4 post-infection, adult cotton rats additionally expressed higher levels of genes encoding effector molecules associated with Th1 responses, including IFN-γ. Pathway analysis showed significantly increased activation of several pro-inflammatory pathways in adults, including the Th1 pathway, macrophage classical (M1) activation, and pathogen-induced cytokine signaling. To evaluate lymphocyte Th1/Th2 polarization resulting from RSV infection in both age groups, we stimulated splenocytes with RSV antigen at day 28 post-infection and measured IFN-γ and IL-4 production by ELISA. Splenocytes of all adult cotton rats produced detectable IFN-γ and no IL-4, indicating Th1 polarization. Splenocytes of all geriatric cotton rats produced detectable IL-4, indicating Th2 polarization. Collectively, these results indicate that geriatric cotton rats exhibit impaired generation of a Th1 response and a decreased inflammatory response overall to RSV.

Author summary

Respiratory syncytial virus (RSV) is one of the leading causes of respiratory illness in humans worldwide and is of particular importance in elderly people. In individuals over 65 years of age, immune responses against RSV are less effective than in younger people, resulting in delayed clearance of the virus and increased rates of severe disease. To better understand how immune responses between elderly and younger populations may differ during the course of RSV infection, we gene expression in the lungs of geriatric and young adult cotton rats over several days of experimental infection. Cotton rats, the preferred small animal model for studying natural RSV infection, demonstrated significantly lower pro-inflammatory expression in the geriatric group, as measured by individual gene expression and pathway analysis. A prominent example in the geriatric cotton rats was decreased expression of the Th1 pathway, an immune response that is highly associated with effective antiviral immunity, with decreased production of key molecules such as the effector cytokine IFN-γ.

Citation: Miller J, Leedale C, Yilmaz AS, Pawlack E, Garrido JG, Alioto T, et al. (2026) Reduced inflammatory and Th1 transcriptional profiles in geriatric versus adult cotton rats infected with respiratory syncytial virus. PLoS Pathog 22(7): e1014323. https://doi.org/10.1371/journal.ppat.1014323

Editor: Barry Rockx, Wageningen Bioveterinary Research, NETHERLANDS, KINGDOM OF THE

Received: February 26, 2026; Accepted: May 29, 2026; Published: July 9, 2026

Copyright: © 2026 Miller et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: No novel structural determinations were generated. All sequences used are available in GenBank under the accession numbers described. All reagents utilized in this study are commercially available and any assistance with our described procedures will be provided upon request.

Funding: The authors have no known competing financial or personal interests to disclose. This work was supported by a Dean’s Distinguished graduate school fellowship (J.L.M) and research funds from the College of Veterinary Medicine at The Ohio State University (SN). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Respiratory syncytial virus (RSV) is a common respiratory infection throughout all age groups but is associated with disproportionately severe clinical consequences in high-risk groups including older individuals. In healthy adults, RSV infection typically results in mild respiratory signs resulting from replication and concomitant inflammation in the upper airways. In the elderly, the risk of more severe and prolonged disease resulting from RSV infection rises significantly. Among adults in the United States over 65 years of age, an estimated 60,000–160,000 hospitalizations and 6,000 – 10,000 deaths are attributed to RSV annually [1–4]. The true rate of hospitalizations and deaths resulting from RSV infection may be higher than reported, given that lower respiratory tract infection by RSV results in similar clinical signs as those caused by other respiratory viruses such as influenza [1,5]. Underlying chronic conditions and comorbidities including chronic obstructive pulmonary disease, diseases of immunosuppression, cystic fibrosis, and congestive heart failure are experienced at increased rates in the elderly, which can contribute to the severity of RSV-associated disease. However, elevated rates of these predisposing conditions do not fully account for the marked increase in severe clinical disease among RSV-infected elderly individuals, indicating that other age-associated factors contribute to susceptibility in this age group [6].

The increase in severity of respiratory infections in the elderly has been linked to numerous age-associated declines in innate and adaptive immunity, commonly referred to as immunosenescence [7–9]. Tissue level changes include thymic involution, resulting in reduced output of naïve T cells, and decreased germinal center differentiation, resulting in impaired antigen-specific B cell expansion [10–12]. Detrimental cellular changes associated with immunosenescence have been described in most leukocyte compartments. Neutrophils show decreased superoxide production and phagocytic activity, while aberrant chemotaxis results in poorly targeted and inappropriate inflammation [13–16]. Mononuclear phagocytes of aged individuals exhibit diminished antigen-presentation function upon stimulation and decreased responsiveness to signaling through pathogen pattern recognition receptors such as Toll-like receptors [17–20]. Stimulated natural killer cells of aged individuals and animal models demonstrate impaired cytotoxicity and produce reduced IFN-γ and TNF-α, potentially contributing to decreased responsiveness of T cells and dendritic cells [21–25]. B cells produce a less diverse antibody repertoire with age, while impaired class-switching and somatic recombination reduce the average affinity of antibodies and contribute to lower neutralizing antibody titers upon natural infection or vaccination [12,26–29]. T cell receptor diversity is decreased with age, in part due to the aforementioned atrophy of the thymus throughout life [30,31]. Increased expression of inhibitory receptors and decreased expression of costimulatory molecules is a hallmark of senescent T cells [32]. CD8 + T cells also produce lower levels of cytotoxic molecules such as perforins and granzymes. These perturbations and deficiencies across innate and adaptive immune compartments have been shown to play a role in susceptibility to a wide array of infectious and autoimmune diseases in the elderly. However, the relative importance of each immunosenescence-associated change varies by condition. The specific factors that lead to prolonged and enhanced disease in RSV-infected elderly individuals are incompletely characterized.

Animal models of RSV infection have shed some light on host immunological deficiencies in aging. Aged mice exhibit delayed RSV clearance, similar to kinetics observed in elderly humans, that correlate with impaired CD8 + T cell responses relative to young animals [33,34]. Cotton rats, the preferred small animal model for testing and developing therapeutics and vaccines for RSV, also demonstrate delayed RSV clearance and CD8 + T cell responses [35–38]. Cotton rats have a significantly shorter lifespan than mice, facilitating their use for studies using geriatric cohorts, and allow for productive RSV infection with replication of approximately 100-fold higher titer than seen in BALB/C mice [39]. In both aged mice and cotton rats, impaired generation of a CD8 + T cell response to RSV has been linked to decreased pulmonary dendritic cell maturation and migration to regional lymph nodes [38,40]. Humans and both animal models also show reduced humoral immune responses to RSV in aged cohorts. Decreased neutralizing antibody titers correlate with more severe clinical disease in elderly people and reduced duration of protective immunity in old mice and cotton rats [37,41,42]. The underlying basis of these diminished or delayed effector responses remains largely unexplored, although a few alterations in cytokine expression profiles of geriatric humans and animal models have been described. In individuals over 65 years of age, peripheral blood mononuclear cells (PBMCs) produce lower levels of several proinflammatory and antiviral cytokines and chemokines upon activation, including IFN-γ, type I IFNs, TNF-α, IL-6, CCL2, and CCL7 [43,44]. Among individuals over 75 years of age, PBMCs co-cultured with autologous dendritic cells and stimulated with RSV also produce lower levels of IFN-γ compared to younger cohorts [45]. Measurement of expression of select cytokines and chemokines in young and geriatric cotton rats infected with RSV found delayed peaks in expression of IFN-γ, IL-6, and IL-10 in older cohorts [35].

One throughline of these findings is a reduction in IFN-γ production in RSV-infected geriatric individuals and animals compared to young cohorts. IFN-γ is a critical propagator and effector molecule in Th1 responses, and its expression is strongly correlated with clearance of a variety of respiratory viruses including RSV [46–49]. More generally, these previous surveys of select cytokines and chemokines show a trend of decreased production of pro-inflammatory factors in the elderly. To investigate whether this trend of depressed inflammation would hold true across the lung transcriptome during RSV infection, we performed mRNA sequencing (RNA-seq) on lungs of young adult and geriatric cotton rats at various timepoints post-infection with RSV. We then performed pathway analysis of differentially expressed genes between the two age groups to investigate broader trends in inflammatory pathways during infection. To corroborate the magnitude of differentially expressed genes, we also performed digital droplet polymerase chain reaction (ddPCR) on lung samples for select inflammatory factors shown to be upregulated during RSV infection. Finally, we measured IFN-γ and IL-4 protein expression by splenocytes of previously infected cotton rats upon stimulation with RSV antigen as a measure of Th1 and Th2 differentiation.

Methods

Ethics Statement

All animal studies received approval by the Institutional Animal Care and Use Committee of The Ohio State University.

Animals

Inbred cotton rats (Sigmodon hispidus) were purchased from Inotiv (formerly Envigo; West Lafayette, IN). All cotton rats were maintained in NexGen Rat 900 polysulfone microisolator cages (Allentown Inc., Allentown, NJ) in a barrier facility with 12:12 hour light cycles, 22 ± 2 °C, and 20–70% relative humidity. Age ranges were 1–4 months for adult animals and >8 months for geriatric animals [35–38]. For mRNA-seq and qPCR experiments, adult groups were composed of 3 female and 3 male cotton rats, and geriatric groups were composed of 4 female and 2 male cotton rats. All studies received approval by the Institutional Animal Care and Use Committee of The Ohio State University.

Virus

RSV-A2 (NCBI taxonomy ID: 11259) stocks were propagated in HEp-2 cells in MEM (Thermo Fisher Scientific, Rockford, IL) supplemented with 2% fetal bovine serum and stored in liquid nitrogen as previously outlined [50]. Titers of RSV stocks were quantified by standard TCID50 assay, summarized briefly as follows. HEp-2 cells were seeded at 80% confluency on 48-well plates. 10-fold serial dilutions of RSV stocks were plated onto the cells with 500 µL MEM for one hour at 37°C and 5% CO2, using 6 wells per concentration. Cells were washed three times with PBS/0.1% FCS, after which 500 µL MEM/2% FCS was added to each well. Cells were incubated at 37°C and 5% CO2. Media was replaced on day 3. All wells were evaluated for viral cytopathic effect by light microscopy following 5 total days of incubation. Viral titer was calculated using the Reed-Muench method and expressed as the quantity of virus capable of infecting 50% of inoculated tissue culture monolayers (TCID50) [51].

Cotton rat infection and tissue collection

Cotton rats were anesthetized via isoflurane inhalation. RSV-A2 stocks were diluted in PBS and 105 TCID50 was administered intranasally in an inoculation volume of 100 µL. At indicated end-points, cotton rats were euthanized by CO2-induced asphyxiation followed by exsanguination. For RNA-seq and qPCR experiments, the left lung lobe was collected and placed in 2 mL RNAprotect (QIAGEN, Hilden, Germany) at room temperature. For splenocyte stimulation experiments, the spleen was collected and placed in 10 mL PBS on ice.

RNA extraction

Following euthanasia, lungs were placed in RNAprotect (QIAGEN) at room temperature for 30 minutes. 25–30 µg of each lung sample was removed by sterile dissection and placed in 2 mL Precellys bead tubes (Bertin Technologies, France) with 600 µL Buffer RLT Plus (QIAGEN) and 6 µL β-mercaptoethanol. Samples were homogenized at room temperature with a Precellys 24 tissue homogenizer (Bertin) at 6000 RPM, 3 cycles for 30 seconds each with 10-second breaks. The homogenate was passed through QIAshredder tubes (QIAGEN). RNA was extracted and isolated with RNeasy Plus Mini extraction kits (QIAGEN) following manufacturer instructions, with a final elution volume of 30 µL. RNA concentrations, 260/280 ratios, and 260/230 ratios were measured using a NanoDrop One spectrophotometer (Thermo Fisher), ensuring a minimum concentration of 100 ng/µL and 260/280 ratios between 1.8 and 2.2 for all extracted RNA samples.

Library preparation and mRNA-seq

RNAseq of all experimental samples was performed through the Genomics Shared Resource at the Ohio State University Comprehensive Cancer Center. The RNA Integrity Number (RIN) for DNase-treated total RNA were assessed using Agilent BioAnalyzer RNA Nano Kit (Agilent Technologies, Inc., Santa Clara, CA) and the RNA amount was assayed with the Invitrogen Qubit RNA HS Assay Kit (Thermo Fisher Scientific, Waltham, MA). Samples with RIN > 7 were used in mRNA-seq library generation using the QIAseq FastSelect RNA Lib Core Kit (QIAGEN) and the QIAseq Stranded mRNA Enrichment Kit (QIAGEN). Briefly, 100 ng DNase-treated total RNA was used as input for library generation. RNA fragmentation was set for 3 minutes at 94C. 17 PCR cycles were used in final library generation. Library quantification and characterization were assessed with Agilent BioAnalyzer HS DNA Kit and the Invitrogen Qubit DNA HS Assay Kit. Libraries were pooled together with other index – compatible RNA-seq libraries for sequencing on Illumina NovaSeq X Plus 10B (Illumina Technology, Portland, OR) flow cell lane to a minimum depth of 15–20 million clusters per sample.

Alignment and gene annotation

150 bp paired-end reads were aligned using Hisat2 version 2.1.0 [52] against the Sigmodon hispidus complete DNA reference assembly [53]. Alignment parameters were set with 2 mismatches permitted to allow for potential base-calling errors. Reads that aligned to multiple loci were discarded. Mapped reads were quantified using featureCounts software [54] and the Sigmodon hispidus annotation in gtf format. The resulting count matrix was annotated with Sigmodon hispidus gene IDs, associated Ensembl gene IDs, and mouse (Mus musculus) gene orthologs which was then used to perform the differentially expressed gene (DEG) analysis.

Differentially expressed genes and pathway analysis

R package limma [55] was used for analysis of DEGs. Read counts were normalized using TMM method [56]. DEGs were defined as transcripts with false discovery rate-adjusted p-values (q-values) of less than 0.05 and fold change values of greater than 2 or less than 0.5. Signaling and metabolic pathway analysis of DEGs was performed using the Ingenuity Pathway Analysis (QIAGEN) software package and the Ingenuity Knowledge Base reference database (accessed August 31, 2023). Significance of alterations between groups for a given canonical pathway was calculated using a Fisher’s exact test, with p-values of ≤ 0.05 considered significant. Up/down-regulation patterns between groups for canonical pathways were assigned an activation z-score using an asymptotic Gaussian approximation [57] with |z-scores| greater than 2 considered significant for directionality.

Digital droplet PCR

First-strand complementary DNA (cDNA) was generated with iScript cDNA Synthesis kits (Bio-Rad, Hercules, CA) following manufacturer-recommended instructions and thermal cycling conditions, using 1 µg of RNA samples extracted from whole lung as described above. cDNA concentrations were quantified with a NanoDrop One spectrophotometer (Thermo Fisher). Absolute quantification of CXCL10 (encoding IP-10), IL12A (IL-12p35), IFNG (IFN-γ), and CXCL1 (GRO) expression in 300 ng cDNA was measured by digital droplet polymerase chain reaction (ddPCR). Reactions were prepared with ddPCR Multiplex Supermix (Bio-Rad). All primers and probes were obtained from Integrated DNA Technologies (Coralville, IA). Primer concentrations of 900 nM and probe concentrations of 250 nM were used. For cotton rat CXCL10 (GenBank accession AF421394.1), the forward primer sequence was CGCCCTTTAACCAGAGAGAAG, the reverse primer sequence was GTAGAGAGAAGTGGTGGAGAGA, and the probe sequence was ACAGACGAGTGGCAGAGAGCC. For cotton rat CXCL1 (GenBank accession AF421393.1), the forward primer sequence was TCTCTGTCACTTGCTGATGC, the reverse primer sequence was AGCTTGCCTTAACCCTGAAG, and the probe sequence was TCTGGACAATCTTCTGGACCATGGG. For cotton rat IFNG (GenBank accession AF167349.1), the forward primer sequence was GTGCATCACTCCAACAAGTTC, the reverse primer sequence was GCAGAGAGAAGATGGATGACTT, and the probe sequence was TGCGCTGGACCTGAAGATCGTTTA. For cotton rat IL12A (GenBank accession AF421396.1), the forward primer sequence was GTGTCTCGCCCATTCTCAAA, the reverse primer sequence was CTTCAGCAGTGCAGGGATAAT, and the probe sequence was AACCACATGCTGGAGAAGGCCATA. Droplets were generated using a QX200 droplet generator (Bio-Rad) following manufacturer recommendations. A C1000 thermal cycler (Bio-Rad) was used for PCR amplification. Reactions began with enzyme activation step at 95°C for 10 min followed by 40 cycles with a denaturation temperature of 94°C for 30 seconds and annealing and extension at 65.6°C for 90 seconds. Reactions were terminated with an enzyme deactivation step at 98°C for 10 min. Droplet fluorescence for each gene fragment was measured with a QX600 droplet reader (Bio-Rad). QX Manager Standard Edition 2.0.0 (Bio-Rad) was used to set automatically-generated thresholds for positive events and determine the proportion of droplets with positive fluorescence. The concentration of each gene was calculated as copies/ng of cDNA. The total event count (droplet counts) for all samples was > 10,000.

Splenocyte stimulation and cytokine ELISA

5 adult (<2 months old) and 3 geriatric (>12 months old) cotton rats were infected with RSV. On day 27 post-infection, 96-well plates were coated with 200 µL of 10 µ/mL (50 μl/well) of sucrose gradient-purified, UV-inactivated RSV-A2 antigen in 200 mM Na2CO3 buffer (pH 9.6) at 4°C overnight. Cotton rats were euthanized on day 28 post-infection for spleen collection. All adipose and connective tissue at the splenic hilum was trimmed and spleens were gently pressed through 100 µm mesh cell strainers (Fisher Scientific) to generate single-cell suspensions. Splenocytes were washed 3 times with PBS and counted by trypan blue exclusion and light microscopic examination. 5 * 105 splenocytes were plated in each well of an RSV antigen-coated 96 well plate, with 4 replicates per animal. The splenocytes were incubated in 200 μL Advanced RPMI 1640 media (Thermo Fisher) with 2% cotton rat serum for 3 days. The concentration of cotton rat IFN-γ in the pooled supernatant of all replicates for each animal was measured by standard ELISA kit (R&D Systems) following manufacturer recommended protocols. The concentration of cotton rat IL-4 in the pooled supernatant of all replicates for each animal was measured with a biotinylated anti-cotton rat IL-4 antibody (R&D Systems) and following manufacturer recommended protocols, using R&D Systems Color Reagent A (H2O2) and Color Reagent B (tetramethylbenzidine) for substrate solution and 2N H2SO4 as stop solution. Both ELISAs were performed in Maxisorb (NUNC) 96-well ELISA plates, with washes between subsequent steps using 0.05% Tween 20 and blocking using 1% BSA. Optical densities of each well were measured with a Tecan microplate reader set to a target wavelength of 450 nm with subtraction of wavelength correction at 570 nm. Linear regression analysis was used to determine the concentration of samples against a standard curve run in duplicate.

Results

Lung transcriptome changes induced by RSV infection

Whole lung transcriptional profiles in adult and geriatric cotton rats were compared over the course of RSV infection and between age groups. Treatment groups were composed of 6 cotton rats between 1 and 4 months of age (adult) or over 8 months of age (geriatric). Samples of whole lung were obtained for RNA-seq at days 1 and 4 post-infection with RSV, or day 1 post-inoculation with PBS (uninfected). Differentially expressed genes (DEGs) were defined as genes with a fold-change (FC) in transcript counts of 2 or greater between groups and q-values of under 0.05. Pathway analyses were performed in Ingenuity Pathway Analysis based on the defined DEG thresholds, with activation |z-scores| of greater than 2 considered significant for directionality.

Compared to PBS-treated (Day 0 post-infection) animals, adult cotton rats demonstrated inflammatory transcriptional profiles at days 1 and 4 post-RSV infection, as expected for respiratory viral infection. At day 1, the most differentially regulated gene was CXCL10 (IP-10), with a FC in expression of 845 compared to uninfected cotton rats (q = 1.2E-12). IP-10, a chemokine associated with chemotaxis of a variety of leukocytes including dendritic cells, monocytes, natural killer (NK) cells, and T cells, has been shown to be highly upregulated both in vitro and in vivo in the early stages of RSV infection [58–60]. Other top inflammatory or antiviral DEGs at day 1 included IFNB1 (FC = 728, q = 3.9E-11), IL6 (FC = 168, q = 4.6E-5), ISG15 (FC = 97, q = 1.2E-15), IRF7 (FC = 91, q = 2.0E-13), CCL2 (FC = 72, q = 2.6E-5), and CXCL9 (FC = 71, q = 6.8E08). This acute inflammatory profile was reflected in the pathway analysis (Fig 1A), which demonstrates enrichment of pathways associated with inflammation (Pathogen Induced Cytokine Storm Signaling Pathway, Role of Hypercytokinemia/hyperchemokinemia in the Pathogenesis of Influenza), innate immune response (Role of Pattern Recognition Receptors (PRRs) in Recognition of Bacteria and Viruses, NOD1/2 Signaling Pathway, Role of PKR in Interferon Induction and Antiviral Response, ISGylation Signaling Pathway), and cellular immune response (Immunogenic Cell Death Signaling Pathway, Macrophage Classical Activation Signaling Pathway, Crosstalk between Dendritic Cells and Natural Killer Cells, Th1 Pathway).

thumbnail
Download:
Fig 1. Top differentially activated inflammatory pathways in adult cotton rats at days 1 and 4 post-RSV infection.

Pathway analysis was based on DEGs (p < 0.05, FC > 2 or <0.5) in the lung of adult cotton rats at days 1 (A) or 4 (B) post-infection with RSV compared with that of uninfected adults. The orange line represents the threshold for significance in pathway activity (p = 0.05, -log(p) = 1.3). All shown pathways on both days 1 and 4 were more active in infected animals compared to baseline (z > 2). (n = 6 for all groups).

https://doi.org/10.1371/journal.ppat.1014323.g001

At day 4, CXCL10 remained the most highly differentially expressed gene (FC = 136, q = 1.02E-8) followed by IL22RA1 (FC = 112, q = 1.09E-6), encoding the unique alpha subunit of the IL-22 receptor. Other top inflammatory or antiviral DEGs on day 4 included CXCL9 (FC 41, q = 3.16E-6), IRF7 (FC 30, q = 1.19E-9), ISG15 (FC 26, q = 2.27E-11), CCL2 (FC 23, q = 2.74E-3), and OASL (FC 22, q = 5.4E-11). Many of the same inflammatory and immune pathways that were elevated at day 1 remained elevated at day 4 (Fig 1B). However, the most upregulated pathways at day 4 also included notable immunomodulatory/anti-inflammatory pathways (Th2 pathway, Macrophage Alternative Activation Signaling Pathway) and specifically the gene encoding the anti-inflammatory cytokine IL-10 which has been shown to have protective roles during later stages of RSV infection in humans by regulating excessive inflammation and reducing tissue injury [61–63].

Pro-inflammatory pathways are less active in RSV-infected geriatric cotton rats

Lung transcriptional profiles were compared between age groups to identify potential immunological differences in geriatric cotton rats that could contribute to delayed RSV clearance. Gene expression was compared between geriatric and adult cotton rats at day 0 (PBS treated), day 1, and day 4 post-RSV infection, with DEGs defined as transcripts with a FC > 2 or <0.5 and q-values of <0.05 (Fig 2). Lungs of uninfected cotton rats demonstrated similar mRNA transcription between age groups, with only 30 DEGs. The proportion of DEGs between adult and geriatric cotton rats dramatically increased during RSV infection. At day 1 post-infection, 358 DEGs were identified, with 195 genes more highly expressed in geriatric cotton rats and 163 genes more highly expressed in adults. This Fig increased by day 4, when 471 DEGs were identified; 269 genes more highly expressed in geriatrics and 202 more highly expressed in adults (DEGs listed as S3–S5 Tables).

thumbnail
Download:
Fig 2. Numbers of differentially expressed genes between adult and geriatric cotton rats with FC > 2 or <0.5 and q-values of <0.05.

Gene expression was compared between geriatric and adult cotton rats at day 0 (PBS treated), day 1, and day 4 post-RSV infection.

https://doi.org/10.1371/journal.ppat.1014323.g002

DEGs were used for pathway analysis, which demonstrated significantly lower enrichment of Pathogen Immunogenic Cell Death Signaling (Fig 3A), with several other inflammatory pathways differing significantly and trending higher in adult animals but without directional significance. The sole inflammatory pathway that was differentially enriched in geriatric cotton rats at day 1 was Neutrophil Extracellular Trap (NET) Signaling. Similarly, at day 4 post-infection, an expanded number of inflammatory and antiviral pathways were more highly enriched in adults compared to geriatric cotton rats (Fig 3B). Neutrophil Extracellular Trap Signaling and Macrophage Alternative Activation Signaling differed significantly between age groups and were more enriched in geriatrics to a degree that approached but did not reach directional significance. Collectively, these results show that RSV-infected geriatric cotton rats exhibit a lower inflammatory transcriptional profile compared to adults, including decreased enrichment of many of the pathways that are most active in RSV infection compared to baseline (Fig 1).

thumbnail
Download:
Fig 3. Differentially activated inflammatory pathways between adult and geriatric cotton rats at days 1 and 4 post-RSV infection.

Pathway analysis was based on DEGs (q < 0.05, FC > 2 or <0.5) between the lung of adult and geriatric cotton rats at days 1 (A) or 4 (B) post-infection with RSV. The orange line represents the threshold for significance in pathway activity (p = 0.05, -log(p) = 1.3). Inflammatory pathways with significant differential expression and |z| > 1 are displayed (see S1–S2 Tables for top 50 differentially expressed pathways). Bars in dark blue are more active in adults (z > 2) while those in light blue trend higher in adults but are not directionally significant (0 < z < 2). Bars in dark orange are more active in geriatric cotton rats (z < -2) while those in light orange trend higher in geriatric cotton rats but are not directionally significant (0 > z > -2). Line with black diamonds (secondary y axis) represents the number of DEGs for each pathway. (n = 6 for all groups).

https://doi.org/10.1371/journal.ppat.1014323.g003

Digital PCR of select inflammatory factors in adult and geriatric cotton rats

To corroborate mRNA-seq quantification results of key inflammatory factors, we performed ddPCR on RNA extracted from whole lung on days 1, 4, and 6 post-RSV infection, or day 1 post-inoculation with PBS (uninfected) measuring CXCL10 (encoding IP-10), CXCL1 (GRO), IFNG (IFN-γ), and IL12A (IL-12p35). IP-10 is well-characterized as a highly upregulated chemokine in RSV infection that plays an important role in generation of CD8 + T cell responses and RSV clearance [58–60,64,65]. Growth-related oncogene (GRO) is another chemokine that has been shown to be upregulated during RSV infection, with one study demonstrating increased expression in lungs of aged cotton rats at day 6 post-infection compared to adults [35,66,67]. IFN-γ plays critical roles as a generator and effector of Th1 function during viral infections, and its production has been shown to be lower in RSV-stimulated peripheral blood mononuclear cells of elderly humans [45]. A previous study in RSV-infected cotton rat lungs showed IFN-γ transcripts peaking earlier in infection in adults than geriatric animals, suggesting an age-associated delay in IFN-γ production [35]. IL-12 induces Th1 differentiation of CD4 + T cells and enhances CD8 + T cell activity and IFN-γ production during RSV infection [68]. IL-12p35 encodes the IL-12-specific alpha subunit, while IL-12B is a common subunit of both IL-12 and IL-23; as such, IL-12p35 was measured as a more specific marker of IL-12 expression.

Transcripts for all cytokines were increased by day 1 post-RSV infection in adult lungs, with the most striking increase occurring in IP-10 (Fig 4A) as was observed by RNA-seq. IP-10 and GRO expression in adult and geriatric lungs were similar throughout RSV infection (Fig 4A-4B), but IFN-γ and IL-12p35 transcripts were significantly reduced in geriatric cotton rats at day 1 compared to adults (Fig 4C-4D). GRO and IP-10 expression measured by ddPCR and RNA-seq align in the lack of observed significant difference. IFN-γ expression was lower in geriatric cotton rats on day 1 post-infection by both ddPCR and RNA-seq (Fig 5), although RNA-seq also showed differential expression on day 4. RNA-seq did not show significantly different IL-12p35 on day 1, although a similar fold-change difference between age groups was observed (1.6-fold higher in adults, p = 0.2). Although IL-12p35 expression did not differ significantly by RNA-seq, expression of the IL-12 beta subunit was significantly lower in geriatric animals at days 1 and 4 post-infection (Fig 5). No age-associated differences in expression of transcripts for IP-10, GRO, IFN-γ, or IL-12p35 were observed on day 6 post-infection.

thumbnail
Download:
Fig 4. Digital PCR demonstrates lower expression of transcripts for Th1-associated cytokines early in RSV infection in geriatric cotton rats.

Lung samples from adult or geriatric cotton rats at the indicated timepoints post-RSV infection were collected. Absolute quantification of gene expression for IP-10 (CXCL10), GRO (CXCL1), IFN-γ (IFNG), and IL-12p35 (IL12A) was performed by ddPCR of 300ng of cDNA for each sample. Chemokines IP-10 and GRO were upregulated early in RSV infection in both adult and geriatric cotton rats, with no age-associated differences. Th1 effector cytokine IFN-γ was upregulated at day 1 in adult but not geriatric cotton rats, with both age groups demonstrating an increase at day 6, around the time of viral clearance. Expression of IL-12p35 was also significantly lower in geriatric cotton rats at day 1 compared to adults. (n = 5 for all adult timepoints and geriatric day 6. n = 6 for geriatric days 0, 1, and 4).

https://doi.org/10.1371/journal.ppat.1014323.g004

thumbnail
Download:
Fig 5. Reduced activation of the Th1 pathway in geriatric cotton rats.

Expression of genes encoding Tbet (TBX21), IL-12b (IL12B), and IFN-γ (IFNG) in whole lung samples of adult or geriatric cotton rats at the indicated timepoints post-RSV infection are shown from RNA-seq libraries. Displayed reads per million mapped values are normalized using the trimmed mean of M values [56]. Expression of transcription factor TBX21 was significantly lower in geriatric than adult cotton rats at day 1. IL12B was lower in geriatric cotton rats on both days 1 and 4 post-infection. IFNG expression was lower in geriatric cotton rats on day 4 (q = 0.1 on day 1). (n = 6 for all groups).

https://doi.org/10.1371/journal.ppat.1014323.g005

RSV infection elicits reduced Th1 response in geriatric cotton rats

Generation of an effective Th1 response is critical for cell-mediated immunity and RSV clearance [69–72]. Pathway analysis of mRNA-seq data demonstrated a significant difference in the Th1 pathway between adult and geriatric cotton rats at days 1 and 4 post-RSV infection (Fig 3) based on five differentially expressed Th1-associated genes on day 1 and eight differentially expressed Th1-associated genes on day 4. Th1 pathway activity trended higher in adults on both days but was only directionally significant on day 4. Among the genes with increased upregulation in adult cotton rats compared to geriatrics were TBX21 (encoding the transcription factor Tbet), IL12B encoding the beta chain of Th1 stimulating factor IL-12, and IFNG encoding the canonical effector cytokine IFN-γ (Fig 5). No age-associated differences in expression of these genes were observed in uninfected animals, but mean expression of all three factors was lower in geriatric cotton rats at days 1 and/or 4 post-infection. Decreased expression was significant at day 1 post-infection for TBX21, on both days 1 and 4 post-infection for IL12B, and day 4 post-infection for IFNG. IL12B, although associated with the Th1 pathway, is a common subunit of both IL-12 and IL-23 and is thus not a specific marker of IL-12 expression. No significant differences in expression of the alpha subunits of IL-12 or IL-23 were observed between age groups. The measured magnitude of elevated expression of IFNG in adults compared to geriatrics following RSV infection was similar by both qPCR (Fig 4) and RNA-seq, although there was greater variance within groups by qPCR resulting in lack of statistical significance.

RSV-stimulated splenocytes of geriatric cotton rats show decreased IFN-γ production and increased IL-4 production

To assess Th1 and Th2 differentiation of CD4 + lymphocytes following RSV infection, we measured secretion of canonical Th1 and Th2 cytokines IFN-γ and IL-4 by stimulated splenocytes. Spleens were collected from adult and geriatric (>12 months of age) cotton rats at day 28 post-infection. Splenocytes were stimulated with UV-inactivated RSV antigen, with four replicates per animal. The supernatant of replicates was pooled, and IFN-γ and IL-4 were measured by ELISA. Stimulated splenocytes of all adult animals produced detectable levels of IFN-γ, while none produced detectable IL-4 (Fig 5). By contrast, only one of the three geriatric cotton rats produced detectable IFN-γ while all produced detectable IL-4 levels. This experiment was also performed on 5 younger geriatric cotton rats (>9 months, < 10 months of age) which did not result in production of detectable IL-4 upon stimulation in any individuals in the cohort. These results reinforce the results by RNA-seq demonstrating reduced Th1 activation during RSV infection in geriatric cotton rats (Figs 3B, 4). Further, IL-4 production upon stimulation indicates a Th2 response in geriatric cotton rats that was not observed in adults.

Discussion

A number of mechanisms have been shown to contribute to prolonged and more severe RSV infections in elderly individuals, and geriatric cotton rats have been a useful tool for demonstrating altered immune parameters that mirror age-associated changes in humans. Geriatric cotton rats exhibit delayed RSV clearance [35–37], delayed CD8 + T cell responses [38], decreased neutralizing antibody titers and B cell responses [37,42], a delayed peak expression of genes encoding select cytokines including IFN-γ, IL-6, and IL-10 [35]. This study provides the first transcriptomic evaluation of expression profiles in the lung of RSV-infected adult and geriatric cotton rats. While the transcriptomic profiles of uninfected adult and geriatric animals are very similar, we find striking differences in expression of numerous inflammatory molecules and pathways during RSV infection between age groups. These age-associated differences are broadly characterized by a decrease in activity of pro-inflammatory pathways in geriatric cotton rats. On day 1 post-infection, pathway analysis of DEGs between the two age groups shows greater enrichment of Immunogenic Cell Death Signaling pathways in adults compared to geriatrics (Fig 3A). The list of differentially enriched pathways expands on day 4 post infection, with the Th1, Crosstalk between DCs and NK cells, Macrophage Classical Activation Signaling, NOD1/2 Signaling, and HMGB1 Signaling pathways all significantly more active in adults than geriatrics (Fig 3B).

One of the most consistent and potentially consequential findings was a reduction in expression of Th1-associated signaling molecules and cytokines in the geriatric age group (Fig 5). As is true for respiratory viruses in general, initiation of an effective Th1 response is critical for generation of cell-mediated immunity. IFN-γ promotes numerous protective effects during viral infections, including paracrine activation of immune cells, modulating differentiation and maturation of T cells, inducing production of antiviral molecules, and inhibiting virus release by infected host cells [73–79]. A delayed or reduced Th1 response would be predicted to impair the antiviral immune response both through reduced IFN-γ and CD8 + T cell responses, the major driver of RSV clearance [50]. In other at-risk groups including infants, impaired Th1 responses and IFN-γ production are correlated with worse clinical outcomes [80,81]. These more severe RSV infections stem not only from the aforementioned impairments to viral clearance, but also from a propensity to develop a dysregulated Th2-type immune response [82–84]. In addition to our data showing suppressed Th1 responses characterized by reduced expression of genes encoding Tbet, IL-12, and IFN-γ in geriatric cotton rats, we found that splenocytes of previously infected geriatric cotton rats demonstrated a Th2-skewed cytokine profile upon stimulation with RSV peptides (Fig 6). While Th2 predisposition is typically associated with hypersensitivity responses, eosinophilia, and mucus hypersecretion in infants, clinical consequences in the elderly are more likely characterized by immunosuppression and delayed viral clearance [82]. The Th2 pathway does not show significantly increased activation in geriatric cotton rat lungs at our measured timepoints compared to adults, but IL-4 production by stimulated splenocytes is characteristic of a Th2 response. We propose that a reduced Th1 response is the underlying consequential factor in skewing leukocyte differentiation.

thumbnail
Download:
Fig 6. IFN-γ and IL-4 secretion by splenocytes of RSV-infected cotton rats.

Spleens of adult and geriatric (>12 months of age for this cohort) cotton rats were collected at 28 days post-RSV infection. Following stimulation with UV-inactivated RSV antigen, splenocytes of adult cotton rats produced IFN-γ but no detectable IL-4. RSV antigen-stimulated splenocytes of geriatric cotton rats produced IL-4, but stimulation only induced detectable secretion of IFN-γ for 1 animal. (n = 5 for adult cotton rats, n = 3 for geriatric cotton rats).

https://doi.org/10.1371/journal.ppat.1014323.g006

One age-associated factor that paradoxically contributes to impaired immune responses in some conditions in elderly populations is a chronic state of low-level, sterile inflammation. This phenomenon is known as “inflammaging”, which is characterized by elevated pro-inflammatory markers in serum, including IL-1, IL-6, and TNF-α [85,86]. This dysregulated chronic inflammatory state in the elderly can impair immune responses to pathogens by increasing expression of inhibitory ligands such as PDL-1 on antigen presenting cells [87], recruiting and increasing the immunosuppressive function of Foxp3 + Treg cells [88–90], and decreasing T cell receptor signaling and histiocyte phagocytosis [91,92]. Some studies in lungs of old mice have shown evidence of chronic, age-associated inflammation through PCR and transcriptomic profiling [93,94]. Interestingly, the latter study found increased antiviral IFN pathway activation in RSV-infected old mice compared to young animals, contrasting with our observation in cotton rats. That study found a limited number of differentially expressed genes in infected animals overall, possibly reflecting the lower permissiveness and immune response to RSV infection in immunocompetent mice. Treatment of geriatric cotton rats with non-steroidal anti-inflammatory drugs alleviates the delayed clearance kinetics of RSV in geriatric cotton rats, initially suggesting that inflammaging could be a contributing factor to reduced immunity in our model [37]. However, this phenomenon appears to be tied to a specific pathway involving generation of elevated prostaglandin D2 in infected geriatric cotton rats with subsequent delay in antigen presentation and CD8 + T cell responses [38]. Our transcriptomic results in this study indicate that geriatric cotton rats, both uninfected and at the measured timepoints post-RSV infection, do not exhibit elevated inflammatory markers compared to adults. This finding is in line with previous studies demonstrating no difference in cellular inflammation between old and young cotton rats by lung histology and bronchoalveolar lavage cytology [37]. As such, although geriatric cotton rats do develop visceral fat inflammation and other metabolic disturbances such as insulin resistance [95], gene expression analysis does not show a broad age-associated increase in inflammation in the lungs of geriatric cotton rats.

Our results in cotton rats may be useful for identifying alterations in transcriptional profiles that contribute to impaired immune responses in the elderly. We demonstrate a reduced Th1 response in geriatric cotton rats infected with RSV, and a broadly reduced inflammatory response overall, compared to adults. This lower Th1 response may contribute to previously demonstrated deficiencies in geriatric cotton rats, including delayed CD8 + T cell responses and RSV clearance. Our model differs from natural RSV infections in elderly humans, who have been infected many times throughout life. Impaired responses to RSV in humans likely reflect deficiencies in secondary immune responses, whereas our model only assesses primary infections in cotton rats. Future studies in humans or more long-lived animal models are needed to assess the impact of alterations in activity of inflammatory pathways among the elderly on memory responses to RSV and other respiratory viruses.

Declaration of competing interest

The authors have no known competing financial or personal interests to disclose. This work was supported by a Dean’s Distinguished graduate school fellowship (J.L.M) and research funds from the College of Veterinary Medicine at The Ohio State University (SN). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Supporting information

S1 Table. Top 50 differentially expressed pathways between adult and geriatric cotton rats at day 1 post-RSV infection.

https://doi.org/10.1371/journal.ppat.1014323.s001

(DOCX)

S2 Table. Top 50 differentially expressed pathways between adult and geriatric cotton rats at day 4 post-RSV infection.

https://doi.org/10.1371/journal.ppat.1014323.s002

(DOCX)

S3 Table. Differentially expressed genes between adult and geriatric cotton rats at day 0 (uninfected) with FC > 2 or <0.5 and q-values of <0.05.

https://doi.org/10.1371/journal.ppat.1014323.s003

(DOCX)

S4 Table. Differentially expressed genes between adult and geriatric cotton rats at day 1 post-RSV infection with FC > 2 or <0.5 and q-values of <0.05.

https://doi.org/10.1371/journal.ppat.1014323.s004

(DOCX)

S5 Table. Differentially expressed genes between adult and geriatric cotton rats at day 4 post-RSV infection with FC > 2 or <0.5 and q-values of <0.05.

https://doi.org/10.1371/journal.ppat.1014323.s005

(DOCX)

References

  1. 1. Thompson WW, Shay DK, Weintraub E, Brammer L, Cox N, Anderson LJ, et al. Mortality associated with influenza and respiratory syncytial virus in the United States. JAMA. 2003;289(2):179–86. pmid:12517228
  2. 2. Acero-Bedoya S, Wozniak PS, Sánchez PJ, Ramilo O, Mejias A. Recent trends in RSV immunoprophylaxis: clinical implications for the infant. Am J Perinatol. 2019;36:S63–7.
  3. 3. Hansen CL, Chaves SS, Demont C, Viboud C. Mortality associated with influenza and respiratory syncytial virus in the US, 1999-2018. JAMA Netw Open. 2022;5:e220527.
  4. 4. McLaughlin JM, Khan F, Begier E, Swerdlow DL, Jodar L, Falsey AR. Rates of medically attended RSV among US adults: a systematic review and meta-analysis. Open Forum Infect Dis. 2022;9:ofac300.
  5. 5. Simoes EA. Overlap between respiratory syncytial virus infection and influenza. Lancet. 2001;358(9291):1382–3. pmid:11705477
  6. 6. Alfano F, Bigoni T, Caggiano FP, Papi A. Respiratory Syncytial Virus Infection in Older Adults: An Update. Drugs Aging. 2024;41:487–505.
  7. 7. Fulton RB, Varga SM. Effects of aging on the adaptive immune response to respiratory virus infections. Aging health. 2009;5(6):775. pmid:20174457
  8. 8. Busse PJ, Mathur SK. Age-related changes in immune function: effect on airway inflammation. J Allergy Clin Immunol. 2010;126(4):690–9; quiz 700–1. pmid:20920759
  9. 9. Miller JL, Niewiesk S. Review of impaired immune parameters in RSV infections in the elderly. Virology. 2025;603:110395. pmid:39827596
  10. 10. Flores KG, Li J, Sempowski GD, Haynes BF, Hale LP. Analysis of the human thymic perivascular space during aging. J Clin Invest. 1999;104(8):1031–9. pmid:10525041
  11. 11. Johnson SA, Cambier JC. Ageing, autoimmunity and arthritis: senescence of the B cell compartment - implications for humoral immunity. Arthritis Res Ther. 2004;6:131–9.
  12. 12. Siegrist C-A, Aspinall R. B-cell responses to vaccination at the extremes of age. Nat Rev Immunol. 2009;9(3):185–94. pmid:19240757
  13. 13. Lord JM, Butcher S, Killampali V, Lascelles D, Salmon M. Neutrophil ageing and immunesenescence. Mech Ageing Dev. 2001;122(14):1521–35. pmid:11511394
  14. 14. Butcher SK, Chahal H, Nayak L, Sinclair A, Henriquez NV, Sapey E, et al. Senescence in innate immune responses: reduced neutrophil phagocytic capacity and CD16 expression in elderly humans. J Leukoc Biol. 2001;70:881–6.
  15. 15. Sapey E, Greenwood H, Walton G, Mann E, Love A, Aaronson N, et al. Phosphoinositide 3-kinase inhibition restores neutrophil accuracy in the elderly: toward targeted treatments for immunosenescence. Blood. 2014;123(2):239–48. pmid:24191150
  16. 16. Wenisch C, Patruta S, Daxböck F, Krause R, Hörl W. Effect of age on human neutrophil function. J Leukoc Biol. 2000;67(1):40–5. pmid:10647996
  17. 17. Herrero C, Sebastián C, Marqués L, Comalada M, Xaus J, Valledor AF, et al. Immunosenescence of macrophages: reduced MHC class II gene expression. Exp Gerontol. 2002;37:389–94.
  18. 18. Herrero C, Marqués L, Lloberas J, Celada A. IFN-gamma-dependent transcription of MHC class II IA is impaired in macrophages from aged mice. J Clin Invest. 2001;107:485–93.
  19. 19. Chelvarajan RL, Collins SM, Van Willigen JM, Bondada S. The unresponsiveness of aged mice to polysaccharide antigens is a result of a defect in macrophage function. J Leukoc Biol. 2005;77(4):503–12. pmid:15629885
  20. 20. Della Bella S, Bierti L, Presicce P, Arienti R, Valenti M, Saresella M, et al. Peripheral blood dendritic cells and monocytes are differently regulated in the elderly. Clin Immunol. 2007;122(2):220–8. pmid:17101294
  21. 21. Ogata K, An E, Shioi Y, Nakamura K, Luo S, Yokose N, et al. Association between natural killer cell activity and infection in immunologically normal elderly people. Clin Exp Immunol. 2001;124(3):392–7. pmid:11472399
  22. 22. Ogata K, Yokose N, Tamura H, An E, Nakamura K, Dan K, et al. Natural killer cells in the late decades of human life. Clin Immunol Immunopathol. 1997;84(3):269–75. pmid:9281385
  23. 23. Solana R, Mariani E. NK and NK/T cells in human senescence. Vaccine. 2000;18(16):1613–20. pmid:10689137
  24. 24. Hazeldine J, Lord JM. The impact of ageing on natural killer cell function and potential consequences for health in older adults. Ageing Res Rev. 2013;12(4):1069–78. pmid:23660515
  25. 25. Vitale M, Chiesa MD, Carlomagno S, Pende D, Aricò M, Moretta L, et al. NK-dependent DC maturation is mediated by TNFα and IFNγ released upon engagement of the NKp30 triggering receptor. Blood. 2005;106:566–71.
  26. 26. Frasca D, Riley RL, Blomberg BB. Humoral immune response and B-cell functions including immunoglobulin class switch are downregulated in aged mice and humans. Semin Immunol. 2005;17(5):378–84. pmid:15996480
  27. 27. Frasca D, Landin AM, Lechner SC, Ryan JG, Schwartz R, Riley RL, et al. Aging down-regulates the transcription factor E2A, activation-induced cytidine deaminase, and Ig class switch in human B cells. J Immunol. 2008;180(8):5283–90. pmid:18390709
  28. 28. Terrosi C, Di Genova G, Martorelli B, Valentini M, Cusi MG. Humoral immunity to respiratory syncytial virus in young and elderly adults. Epidemiol Infect. 2009;137(12):1684–6. pmid:19366492
  29. 29. Walsh EE, Peterson DR, Falsey AR. Risk factors for severe respiratory syncytial virus infection in elderly persons. J Infect Dis. 2004;189:233–8.
  30. 30. Pfister G, Weiskopf D, Lazuardi L, Kovaiou RD, Cioca DP, Keller M, et al. Naïve T Cells in the Elderly. Ann N Y Acad Sci. 2006;1067:152–7.
  31. 31. Weng N-P. Aging of the immune system: how much can the adaptive immune system adapt?. Immunity. 2006;24(5):495–9. pmid:16713964
  32. 32. Saurwein-Teissl M, Lung TL, Marx F, Gschösser C, Asch E, Blasko I, et al. Lack of antibody production following immunization in old age: association with CD8(+)CD28(-) T cell clonal expansions and an imbalance in the production of Th1 and Th2 cytokines. J Immunol. 2002;168(11):5893–9. pmid:12023394
  33. 33. Fulton RB, Weiss KA, Pewe LL, Harty JT, Varga SM. Aged mice exhibit a severely diminished CD8 T cell response following respiratory syncytial virus infection. J Virol. 2013;87(23):12694–700. pmid:24049171
  34. 34. Plowden J, Renshaw-Hoelscher M, Gangappa S, Engleman C, Katz JM, Sambhara S. Impaired antigen-induced CD8+ T cell clonal expansion in aging is due to defects in antigen presenting cell function. Cell Immunol. 2004;229(2):86–92. pmid:15474523
  35. 35. Boukhvalova MS, Yim KC, Kuhn KH, Hemming JP, Prince GA, Porter DD, et al. Age-related differences in pulmonary cytokine response to respiratory syncytial virus infection: modulation by anti-inflammatory and antiviral treatment. J Infect Dis. 2007;195(4):511–8. pmid:17230410
  36. 36. Curtis SJ, Ottolini MG, Porter DD, Prince GA. Age-dependent replication of respiratory syncytial virus in the cotton rat. Exp Biol Med (Maywood). 2002;227(9):799–802. pmid:12324660
  37. 37. Harder OE, Martinez M, Niewiesk S. Nonsteroidal anti-inflammatory drugs restore immune function to respiratory syncytial virus in geriatric cotton rats (Sigmodon hispidus). Virology. 2021;563:28–37. pmid:34411809
  38. 38. Miller JL, Leedale C, Kang D, Lilue J, Harder OE, Niewiesk S. Prostaglandin D2 delays CD8 T-cell responses and respiratory syncytial virus clearance in geriatric cotton rats. J Virol. 2025.
  39. 39. Byrd LG, Prince GA. Animal models of respiratory syncytial virus infection. Clin Infect Dis. 1997;25(6):1363–8. pmid:9431379
  40. 40. Zhao J, Zhao J, Legge K, Perlman S. Age-related increases in PGD(2) expression impair respiratory DC migration, resulting in diminished T cell responses upon respiratory virus infection in mice. J Clin Invest. 2011;121(12):4921–30. pmid:22105170
  41. 41. Cayatte C, Snell Bennett A, Rajani GM, Hostetler L, Maynard SK, Lazzaro M, et al. Inferior immunogenicity and efficacy of respiratory syncytial virus fusion protein-based subunit vaccine candidates in aged versus young mice. PLoS One. 2017;12:e0188708.
  42. 42. Guichelaar T, Hoeboer J, Widjojoatmodjo MN, Reemers SSN, van Els CACM, Otten R, et al. Impaired immune response to vaccination against infection with human respiratory syncytial virus at advanced age. J Virol. 2014;88(17):9744–50. pmid:24920795
  43. 43. Connors J, Taramangalam B, Cusimano G, Bell MR, Matt SM, Runner K, et al. Aging alters antiviral signaling pathways resulting in functional impairment in innate immunity in response to pattern recognition receptor agonists. Geroscience. 2022;44(5):2555–72. pmid:35849213
  44. 44. Metcalf TU, Cubas RA, Ghneim K, Cartwright MJ, Grevenynghe JV, Richner JM, et al. Global analyses revealed age-related alterations in innate immune responses after stimulation of pathogen recognition receptors. Aging Cell. 2015;14(3):421–32. pmid:25728020
  45. 45. Looney RJ, Falsey AR, Walsh E, Campbell D. Effect of aging on cytokine production in response to respiratory syncytial virus infection. J Infect Dis. 2002;185(5):682–5. pmid:11865426
  46. 46. McMaster SR, Wilson JJ, Wang H, Kohlmeier JE. Airway-Resident Memory CD8 T Cells Provide Antigen-Specific Protection against Respiratory Virus Challenge through Rapid IFN-γ Production. J Immunol. 2015;195(1):203–9. pmid:26026054
  47. 47. Lukens MV, Claassen EAW, de Graaff PMA, van Dijk MEA, Hoogerhout P, Toebes M, et al. Characterization of the CD8+ T cell responses directed against respiratory syncytial virus during primary and secondary infection in C57BL/6 mice. Virology. 2006;352(1):157–68. pmid:16730775
  48. 48. Otter CJ, Renner DM, Fausto A, Tan LH, Cohen NA, Weiss SR. Interferon signaling in the nasal epithelium distinguishes among lethal and common cold coronaviruses and mediates viral clearance. Proc Natl Acad Sci U S A. 2024;121(21):e2402540121. pmid:38758698
  49. 49. Eichinger KM, Egaña L, Orend JG, Resetar E, Anderson KB, Patel R, et al. Alveolar macrophages support interferon gamma-mediated viral clearance in RSV-infected neonatal mice. Respir Res. 2015;16:122. pmid:26438053
  50. 50. Wethington D, Harder O, Uppulury K, Stewart WCL, Chen P, King T, et al. Mathematical modelling identifies the role of adaptive immunity as a key controller of respiratory syncytial virus in cotton rats. J R Soc Interface. 2019;16(160):20190389. pmid:31771450
  51. 51. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol. 1938;27:493–7.
  52. 52. Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907–15. pmid:31375807
  53. 53. Lilue J, Corvelo A, Gómez-Garrido J, Akagi K, Yang F, Green G, et al. A chromosome-level genome assembly of the Hispid cotton rat (Sigmodon hispidus), a model for human pathogenic virus infections. BMC Biol. 2025;23(1):217. pmid:40682131
  54. 54. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30. pmid:24227677
  55. 55. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47. pmid:25605792
  56. 56. Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010;11(3):R25.
  57. 57. Krämer A, Green J, Pollard J Jr, Tugendreich S. Causal analysis approaches in Ingenuity Pathway Analysis. Bioinformatics. 2014;30(4):523–30. pmid:24336805
  58. 58. Miller AL, Bowlin TL, Lukacs NW. Respiratory syncytial virus-induced chemokine production: linking viral replication to chemokine production in vitro and in vivo. J Infect Dis. 2004;189(8):1419–30. pmid:15073679
  59. 59. Machado D, Hoffmann J, Moroso M, Rosa-Calatrava M, Endtz H, Terrier O, et al. RSV Infection in Human Macrophages Promotes CXCL10/IP-10 Expression during Bacterial Co-Infection. Int J Mol Sci. 2017;18:2654.
  60. 60. Oshansky CM, Barber JP, Crabtree J, Tripp RA. Respiratory Syncytial Virus F and G Proteins Induce Interleukin 1α, CC, and CXC Chemokine Responses by Normal Human Bronchoepithelial Cells. J Infect Dis. 2010;201:1201–7.
  61. 61. Sun J, Cardani A, Braciale T. Crucial role of effector T cell-derived IL-10 in regulating lung inflammation and pulmonary function during primary RSV infection. J Immunol. 2010;184:137.13.
  62. 62. Loebbermann J, Schnoeller C, Thornton H, Durant L, Sweeney NP, Schuijs M, et al. IL-10 regulates viral lung immunopathology during acute respiratory syncytial virus infection in mice. PLoS One. 2012;7(2):e32371. pmid:22393401
  63. 63. Sun L, Cornell TT, LeVine A, Berlin AA, Hinkovska-Galcheva V, Fleszar AJ, et al. Dual role of interleukin-10 in the regulation of respiratory syncitial virus (RSV)-induced lung inflammation. Clin Exp Immunol. 2013;172(2):263–79. pmid:23574323
  64. 64. Lindell DM, Lane TE, Lukacs NW. CXCL10/CXCR3-mediated responses promote immunity to respiratory syncytial virus infection by augmenting dendritic cell and CD8(+) T cell efficacy. Eur J Immunol. 2008;38(8):2168–79. pmid:18624292
  65. 65. Strickland BA, Rajagopala SV, Kamali A, Shilts MH, Pakala SB, Boukhvalova MS, et al. Species-specific transcriptomic changes upon respiratory syncytial virus infection in cotton rats. Sci Rep. 2022;12(1):16579. pmid:36195733
  66. 66. Nuriev R, Johansson C. Chemokine regulation of inflammation during respiratory syncytial virus infection. F1000Res. 2019;8:10.12688/f1000research.20061.1.
  67. 67. Zhang Y, Luxon BA, Casola A, Garofalo RP, Jamaluddin M, Brasier AR. Expression of respiratory syncytial virus-induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays. J Virol. 2001;75:9044–58.
  68. 68. Mbawuike IN, Acuna CL, Walz KC, Atmar RL, Greenberg SB, Couch RB. Cytokines and impaired CD8+ CTL activity among elderly persons and the enhancing effect of IL-12. Mech Ageing Dev. 1997;94(1–3):25–39. pmid:9147358
  69. 69. van Schaik SM, Obot N, Enhorning G, Hintz K, Gross K, Hancock GE, et al. Role of interferon gamma in the pathogenesis of primary respiratory syncytial virus infection in BALB/c mice. J Med Virol. 2000;62(2):257–66. pmid:11002257
  70. 70. Bueno SM, González PA, Cautivo KM, Mora JE, Leiva ED, Tobar HE, et al. Protective T cell immunity against respiratory syncytial virus is efficiently induced by recombinant BCG. Proc Natl Acad Sci U S A. 2008;105:20822–7.
  71. 71. Cannon MJ, Stott EJ, Taylor G, Askonas BA. Clearance of persistent respiratory syncytial virus infections in immunodeficient mice following transfer of primed T cells. Immunology. 1987;62(1):133–8. pmid:3498683
  72. 72. Muñoz JL, McCarthy CA, Clark ME, Hall CB. Respiratory syncytial virus infection in C57BL/6 mice: clearance of virus from the lungs with virus-specific cytotoxic T cells. J Virol. 1991;65:4494–7.
  73. 73. Takikawa O, Habara-Ohkubo A, Yoshida R. IFN-gamma is the inducer of indoleamine 2,3-dioxygenase in allografted tumor cells undergoing rejection. J Immunol. 1990;145:1246–50.
  74. 74. Karupiah G, Xie QW, Buller RM, Nathan C, Duarte C, MacMicking JD. Inhibition of viral replication by interferon-gamma-induced nitric oxide synthase. Science. 1993;261(5127):1445–8. pmid:7690156
  75. 75. Patterson CE, Lawrence DMP, Echols LA, Rall GF. Immune-mediated protection from measles virus-induced central nervous system disease is noncytolytic and gamma interferon dependent. J Virol. 2002;76(9):4497–506. pmid:11932415
  76. 76. Weizman O-E, Adams NM, Schuster IS, Krishna C, Pritykin Y, Lau C, et al. ILC1 Confer Early Host Protection at Initial Sites of Viral Infection. Cell. 2017;171(4):795-808.e12. pmid:29056343
  77. 77. Müller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, et al. Functional role of type I and type II interferons in antiviral defense. Science. 1994;264(5167):1918–21. pmid:8009221
  78. 78. Huang S, Hendriks W, Althage A, Hemmi S, Bluethmann H, Kamijo R, et al. Immune response in mice that lack the interferon-gamma receptor. Science. 1993;259(5102):1742–5. pmid:8456301
  79. 79. Fong CH-Y, Lu L, Chen L-L, Yeung M-L, Zhang AJ, Zhao H, et al. Interferon-gamma inhibits influenza A virus cellular attachment by reducing sialic acid cluster size. iScience. 2022;25(4):104037. pmid:35330686
  80. 80. Stern DA, Guerra S, Halonen M, Wright AL, Martinez FD. Low IFN-gamma production in the first year of life as a predictor of wheeze during childhood. J Allergy Clin Immunol. 2007;120(4):835–41. pmid:17689598
  81. 81. Gern JE, Brooks GD, Meyer P, Chang A, Shen K, Evans MD, et al. Bidirectional interactions between viral respiratory illnesses and cytokine responses in the first year of life. J Allergy Clin Immunol. 2006;117(1):72–8. pmid:16387587
  82. 82. Hassantoufighi A, Oglesbee M, Richter BWM, Prince GA, Hemming V, Niewiesk S, et al. Respiratory syncytial virus replication is prolonged by a concomitant allergic response. Clin Exp Immunol. 2007;148(2):218–29. pmid:17335559
  83. 83. Hassan MA, Eldin AME, Ahmed MM. T - helper2 /T - helper1 imbalance in respiratory syncytial virus bronchiolitis in relation to disease severity and outcome. Egypt J Immunol. 2008;15(2):153–60. pmid:20306698
  84. 84. Srikiatkhachorn A, Braciale TJ. Virus-specific CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection. J Exp Med. 1997;186(3):421–32. pmid:9236194
  85. 85. Chambers ES, Akbar AN. Can blocking inflammation enhance immunity during aging? J Allergy Clin Immunol. 2020;145:1323–31.
  86. 86. Franceschi C, Garagnani P, Parini P, Giuliani C, Santoro A. Inflammaging: a new immune–metabolic viewpoint for age-related diseases. Nat Rev Endocrinol. 2018;14:576–90.
  87. 87. Lim S-O, Li C-W, Xia W, Cha J-H, Chan L-C, Wu Y, et al. Deubiquitination and Stabilization of PD-L1 by CSN5. Cancer Cell. 2016;30(6):925–39. pmid:27866850
  88. 88. Chen X, Bäumel M, Männel DN, Howard OMZ, Oppenheim JJ. Interaction of TNF with TNF receptor type 2 promotes expansion and function of mouse CD4+CD25+ T regulatory cells. J Immunol. 2007;179(1):154–61. pmid:17579033
  89. 89. Vukmanovic-Stejic M, Sandhu D, Sobande TO, Agius E, Lacy KE, Riddell N, et al. Varicella zoster-specific CD4 Foxp3 T cells accumulate after cutaneous antigen challenge in humans. J Immunol. 2013;190:977–86.
  90. 90. Vukmanovic-Stejic ME, Agius N, Booth PJ, Dunne KE, Lacy JR, Reed TO, et al. The kinetics of CD4+Foxp3+ T cell accumulation during a human cutaneous antigen-specific memory response in vivo. J Clin Invest. 2008;118:3639–50.
  91. 91. Cope AP, Liblau RS, Yang XD, Congia M, Laudanna C, Schreiber RD, et al. Chronic tumor necrosis factor alters T cell responses by attenuating T cell receptor signaling. J Exp Med. 1997;185(9):1573–84. pmid:9151895
  92. 92. Puchta A, Naidoo A, Verschoor CP, Loukov D, Thevaranjan N, Mandur TS, et al. TNF Drives Monocyte Dysfunction with Age and Results in Impaired Anti-pneumococcal Immunity. PLoS Pathog. 2016;12(1):e1005368. pmid:26766566
  93. 93. Aoshiba K, Nagai A. Chronic lung inflammation in aging mice. FEBS Lett. 2007;581:3512–6.
  94. 94. Pennings JLA, Mariman R, Hodemaekers HM, Reemers SSN, Janssen R, Guichelaar T. Transcriptomics in lung tissue upon respiratory syncytial virus infection reveals aging as important modulator of immune activation and matrix maintenance. Sci Rep. 2018;8(1):16653. pmid:30413794
  95. 95. Nakamura T, Ichii O, Irie T, Kouguchi H, Sotozaki K, Chihara M, et al. Cotton rat (Sigmodon hispidus) develops metabolic disorders associated with visceral adipose inflammation and fatty pancreas without obesity. Cell Tissue Res. 2019;375(2):483–92. pmid:30155650