Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

Poliovirus 3Dpol polymerase region is essential for cleavage of poliovirus 3AB in vivo

  • Minetaro Arita

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    arita.m@jihs.go.jp

    Affiliation Department of Virology II, National Institute of Infectious Diseases, Japan Institute for Health Security, Gakuen, Musashimurayama-shi, Tokyo, Japan

    ⨯

Abstract

Poliovirus (PV) genome encodes a large single polyprotein that is processed by viral proteases to form an active replication complex through either cis or trans interactions between the viral proteins (i.e., interactions between viral proteins encoded on the same polyprotein molecule or between those encoded on different polyprotein molecules, respectively). In the processing of polyprotein, the cleavage of viral 3AB into 3A and 3B is unique, as it requires host factors (PI4KB/OSBP) and viral protease (3Cpro/3CDpro) in cultured cells (i.e., in vivo). Here, we show viral/host requirements for the cleavage of 3AB in vivo. In a polyprotein encoding 2BC3ABCD of PV, cleavage of 3AB requires the activity of PI4KB as well as the entire 3Dpol region; even a partial deletion of the 3Dpol region severely affects the cleavage in the polyprotein. The activity of OSBP and the binding activity of 3CDpro to negatively charged molecules are not required for the cleavage in the polyprotein. PV mutants with premature termination codons or in-frame deletions in the 3Dpol-coding region are generally quasi-infectious in trans-rescued replication with 3CDpro, causing extensive in-frame genome duplication or deletion. Surprisingly, some PV mutants lacking the C-terminal peptides of 3Dpol showed stable replication without any reversion in the presence of 3CDpro provided in trans; 3Dpol provided in trans could rescue the defect in 3AB cleavage via amino acid residues involved in 3Dpol-3AB and 3Dpol-3Dpol interactions, indicating a remarkable overlap with those required for the uridylylation of 3B. This work reveals novel roles of the 3Dpol region, offering insights into the polyprotein processing and recombination.

Author summary

Among the cleavages of the polyprotein of enteroviruses, including poliovirus, cleavage of 3AB into 3A and 3B is unique, as it requires both host factors (PI4KB/OSBP) and viral proteases. Moreover, the 3AB cleavage requires active viral proteases (3Cpro/3CDpro) encoded on the same polyprotein molecule (provided in cis). The present study reveals that cleavage of 3AB requires host PI4KB activity and, unexpectedly, the 3Dpol region of the polyprotein; the defect in 3AB cleavage in polyprotein variants lacking partial 3Dpol regions can be rescued by exogenously expressed 3Dpol (provided in trans). Amino acid residues required for the 3Dpol-3AB and 3Dpol-3Dpol interactions, most of which are also required for the uridylylation of 3B, are critical in the cleavage of 3AB. These results suggest that 3AB cleavage requires protease activity in cis, but the efficiency of cleavage is strongly affected by trans-acting viral/host proteins and cellular context, suggesting a hybrid mechanism. In addition, a novel role of the 3Dpol-coding region in the dynamic reconstruction of viral genome structure was also discovered during this study. Why such a complex mechanism has evolved in the cleavage of enterovirus 3AB protein remains an open question.

Citation: Arita M (2026) Poliovirus 3Dpol polymerase region is essential for cleavage of poliovirus 3AB in vivo. PLoS Pathog 22(5): e1014241. https://doi.org/10.1371/journal.ppat.1014241

Editor: George A. Belov, University of Maryland at College Park: University of Maryland, UNITED STATES OF AMERICA

Received: January 12, 2026; Accepted: May 5, 2026; Published: May 13, 2026

Copyright: © 2026 Minetaro Arita. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All the data are available in the figures or supplementary materials.

Funding: This work was supported by AMED (JP25fk0108716 to MA; JP26fk0108716 to MA). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Picornavirus is a small non-enveloped virus with a positive-sense single-stranded RNA genome of about 7,500 nt, including poliovirus (PV) as the typical member of this family (Enterovirus coxsackiepol species [previously called Enterovirus C species], the genus Enterovirus, the family Picornaviridae) [1]. The genome of PV encodes a single large polyprotein (about 2,200 amino acids [aa]) that is subsequently processed into each viral protein. The polyprotein is initially processed into three precursor proteins, P1 (coding VP4VP2VP3VP1), P2 (coding 2A2B2C), and P3 (coding 3A3B3C3D), by viral proteases (2Apro and 3Cpro/3CDpro/3ABCpro) [2–4]. P1 is further processed into each viral capsid protein, P2 is processed into proteins that have roles in viral RNA synthesis and in virion production/release (2Apro protease, 2B viroporin, 2CATPase/hel ATPase/helicase) [2,5–9], and P3 is processed into proteins that most directly serve for the RNA synthesis (3A [unknown enzymatic function/recruitment of host proteins GBF1/ACBD3/PI4KB], 3B [also known as VPg, the primer for RNA synthesis], 3Cpro protease, 3Dpol polymerase) [1,10–17]. Processing intermediates produced during the processing (i.e., 2BC, 3AB, 3CDpro, etc.) play critical roles in replication and virion production as well as the fully processed viral proteins [3,18–25]; no single disruption of viral protein [26], except for 2Apro [27], or of processing intermediate [28] allows replication.

Processing of the polyprotein is controlled in cis cleavage (i.e., cleavage of the polyprotein by viral proteases [2Apro/3Cpro/3CDpro/3ABCpro], which are encoded in the target polyprotein molecule itself, thus authentic self-cleavage) and in trans cleavage (i.e., cleavage of polyprotein by the proteases, which are encoded in polyprotein molecules other than the target polyprotein). Processing of P1, which is conducted by 3CDpro [3,22], occurs in trans [29]. Disruptions of the polyprotein synthesis [28] or introduction of mutations in the P2 or P3 regions, which do not affect the protease activity, cause aberrant processing and lethality of the virus [30–34], underscoring the structural integrity of polyprotein precursors for the processing. Replication of a PV mutant that encodes inactive 3CDpro could not be rescued by active 3CDpro provided in trans, indicating the essential cis role of 3CDpro [26].

Cleavage of 3AB into 3A and 3B is unique in polyprotein processing in vivo (i.e., in cultured cells), as it requires both host PI4KB/OSBP pathway and active viral 3Cpro/3CDpro provided in cis [16,26,35–38]; 3AB could be cleaved out from a PV polyprotein that encodes inactive 3Cpro/3CDpro by active 3CDpro provided in trans, however further processing of 3AB into 3A and 3B did not occur [26]. PI4KB is required for the early phase of replication [39,40], suggesting the importance of 3AB cleavage during this phase. In vitro (i.e., in a cell-free system), only the membrane-associated 3AB could be cleaved by 3Cpro/3CDpro [20], indicating the importance of the interaction between 3AB and lipids. PI4KB is a phosphatidylinositol-4 kinase that produces phosphatidylinositol 4-phosphate (PI4P) mainly at the Golgi [41], and serves as a host factor for enterovirus (EV) replication [16]. OSBP is a sterol/PI4P transporter that transfers cholesterol between the endoplasmic reticulum and the trans Golgi in a PI4P-dependent manner and contributes to the homeostasis of cholesterol and lipid [42–46] and also serves as a host factor for EV replication [35,47,48]. A functional link between PI4KB and OSBP in PV replication was revealed by common resistance mutations in 3A and 2B to PI4KB/OSBP inhibitors [40,49,50], PI4KB-dependent localization of OSBP to viral replication organelle (RO) and accumulation of cholesterol on the RO [51]. In a current model of EV replication, PI4KB is activated by the viral proteins (2CATPase/hel, 2BC, 3AB, 3CDpro, and 3Dpol) and provides PI4P to recruit OSBP, then OSBP accumulates cholesterol to facilitate cleavage of 3AB and the formation of RO for viral plus-strand RNA synthesis [36–40,47,50–53]. The mechanistic link between 3AB cleavage and the development of RO remains unknown [50]. There is a high genetic barrier to the independence of PV replication from this host pathway [54], indicating a strong dependence of EV replication on it and highlighting the enigmatic properties of 3AB cleavage, which evolved under uncharacterized selection pressure.

Here, we have analyzed viral and host factors required for the cleavage of 3AB into 3A and 3B in vivo. Cleavage of 3AB in a polyprotein encoding PV 2BC3ABCD requires the activity of PI4KB, but not that of OSBP. The entire 3Dpol region of the polyprotein is required for the cleavage of 3AB; the role of the 3Dpol region could be complemented by 3CDpro or 3Dpol provided in trans via 3Dpol-3AB and 3Dpol-3Dpol interactions. A role of the 3Dpol-coding region in the dynamic reconstruction of viral genome structure has also been shown.

Results

The cis role of 3CDpro in PV replication

To analyze the cis role of the 3CDpro protease and its coding region, trans-rescued replication of a total of four sets of PV mutants was analyzed with 3CDpro provided in trans [26] (Fig 1). 3CDpro provided in trans could efficiently rescue a defective PV replicon mutant that has a disrupted cleavage site between 3Cpro and 3Dpol (3C/D[A/G] mutant) [26]; however, why 3CDpro has to be provided in trans, remains to be clarified. For this aim, trans-rescued replication of PV mutants that have aa substitutions in the 3Cpro region, which affect interaction with negatively charged molecules (viral RNA and phospholipids) (3C-R13N, 3C-K82N, and 3C-R84S) [23,55–57] along with the disrupted cleavage site between 3Cpro and 3Dpol was analyzed (Fig 1A). In the 3Dpol-coding region, there are RNA structures that are required for the replication in cis: α (nt 6995–7069 in PV1[Mahoney] genome) and β (nt 7227–7264 in PV1[Mahoney] genome) [58], and 3D-7000 (nt 6920–7090 in PV1[Mahoney] genome) [59]. To determine the essential 3Dpol-coding region required for the trans-rescued replication, three sets of PV mutants were examined. The first set of PV mutants has a termination codon immediately after the 3Cpro-coding region, accompanied by deletions in the 3Dpol-coding region (Fig 1B). This set of PV mutants enables the evaluation of the importance of these RNA structures independently of the 3Dpol peptides encoded within them. The second set of mutants has deletions that are almost identical to those in the first set of mutants, but in-frame deletions without the termination codon immediately after the 3Cpro-coding region (Fig 1C). This set of mutants enables the evaluation of the importance of the encoded peptides within the RNA structures, thereby complementing the analysis using the first set of mutants. For the mutants that have in-frame deletions immediately after the 3Cpro-coding region (e.g., Δ5993–6844 mutant), the WT cleavage site between 3Cpro and 3Dpol was retained to minimize the potential steric hindrance caused by the fused 3Dpol peptides. The third set of mutants has premature termination codons in the 3Dpol-coding region (Fig 1D). The insertion of premature termination codons allows evaluation of the importance of the 3Dpol peptides independently of the RNA structures in the coding region. To minimize the potential pseudoreversion of the mutants in the introduced premature termination codons, tandem premature termination codons (TGATAA) were introduced in the 3Dpol-coding region.

thumbnail
Download:
Fig 1. Schematic view of PV replicon mutants used in this study.

Introduced amino acid substitutions or deletions are shown. These replicons encode firefly luciferase as a reporter for the replication and can replicate only in the presence of the 3CDpro provided in trans. For the analysis of cis 3AB cleavage, mutations examined in (A) and (D) were introduced in a PV polyprotein (AG-PV-2B2CP3) expression vector. The positions of the nucleotides are of PV1(Mahoney) genome (GenBank accession number V01149.1). (A) The 3C-R13N, 3C-K82N, and 3C-R84S amino acid substitutions, which abolish the binding to viral RNA and phospholipids, were introduced to the PV(3C/D[A/G]) replicon. The PV(3C/D[A/G]) replicon has a disrupted cleavage site between the 3Cpro and 3Dpol. (B) Deletions were introduced in the 3Dpol-coding region of the PV(3C-TGA) replicon. The PV(3C-TGA) replicon has a termination codon (TGA) immediately after the 3Cpro-coding region. (C) In-frame deletions were introduced in the 3Dpol coding region of the PV(3C/D[A/G]) replicon. For the mutants with deletions immediately after the 3Cpro-coding region, the cleavage sites between 3Cpro and 3Dpol retain the WT sequence (Q/G) to minimize the potential steric hindrance from the partially deleted 3Dpol structure. (D) Tandem premature termination codons (TGATAA) were introduced in the 3Dpol-coding region of the PV(3C/D[A/G]) replicon. Location of the protein domains (thumb, palm, and fingers) of the 3Dpol is shown [100].

https://doi.org/10.1371/journal.ppat.1014241.g001

These mutations were introduced into the genome of the PV replicon mutant (3C/D[A/G] mutant) with a firefly luciferase reporter [26]. The replicon could express the 3CDpro variants in cis but not 3Cpro and 3Dpol, thus lacking polymerase activity and replicating only in the presence of 3CDpro provided in trans, which provides 3Dpol after the processing [26] (Fig 2A). Trans-rescued replication of the PV mutants was evaluated by transfection of the RNA transcripts or by infection with PV pseudovirus (PVpv) produced from these RNA transcripts. Infectivity of PVpv measured in the presence of GuHCl (a 2CATPase/hel inhibitor) can be attributed to the initial translation before replication from the viral genome introduced in the cells, thus reflecting the titer of PVpv, and that measured in the absence of GuHCl reflects both the titer of PVpv and the replication level of each mutant.

thumbnail
Download:
Fig 2. Experimental design for trans rescue of replication of PV replicons and infection of PVpv.

(A) Schematic view of the trans-rescue experiment. For the replication assay, PV 3CDpro was expressed in the presence of DOX (1 mg/mL) and GC376 (100 μM) at 37°C for 17 h. The RNA transcripts of each PV replicon mutant with a firefly luciferase reporter were transfected into the cells (4 × 104 cells) in the absence of DOX and GC376 and in the presence or absence of GuHCl (a 2C inhibitor, 2 mM). The luciferase signals in the cells were analyzed at 7 h p.t. For the infectivity assay, PV 3CDpro was expressed in the presence of DOX (1 mg/mL) and in the presence or absence of GuHCl (2 mM) at 37°C for 5 h. PVpv mutants with a firefly luciferase reporter were then added to the cells (8 × 103 cells). The luciferase signals in the cells were analyzed at 17 h p.i. (B) Replication and infectivity of PV mutants with amino acid substitutions that abolish the binding to viral RNA and phospholipids. The luciferase signals measured at 7 h p.t. of RNA or 17 h p.i. with PVpv are shown. Replication levels are the ratio of the luciferase activities observed in the absence of GuHCl to those observed in the presence of GuHCl. The data represent the mean and standard deviation of three independent experiments with two biological replicates.

https://doi.org/10.1371/journal.ppat.1014241.g002

PV mutants with the aa substitutions in the 3Cpro region (3C-R13N, 3C-K82N, and 3C-R84S) showed reduced replication levels in vivo (i.e., in cultured cells) after RNA transfection. While the 3C-R13N substitution may require additional aa substitutions to efficiently suppress replication in vitro (i.e., in a cell-free system) [60], the single 3C-R13N substitution affected in vivo PV replication (approximately 1/10 of that of the parental 3C/D[A/G] mutant), or only moderately with the 3C-K82N substitution (Fig 2B). In contrast to the relatively moderate effects observed in RNA transfection, the 3C-R13N and 3C-R84S substitutions severely reduced PVpv infectivity in vivo, both in the absence and in the presence of GuHCl, suggesting lower titers for these mutants. A relatively moderate effect of the K82N substitution compared with that of the R84S substitution was observed in PVpv infectivity, consistent with a previous report [61]. The replication levels measured by RNA transfection and PVpv infection showed a similar profile, except for the 3C-R84S mutant. Nevertheless, the replication levels of the 3C-R84S mutant were lower than those of the parental 3C/D(A/G) mutant in both systems. These results suggest that 3Cpro/3CDpro play substantial roles in replication and virion production in cis, via interactions with the negatively charged molecules.

PV mutants with a termination codon immediately after the 3Cpro-coding region, accompanied by deletions in the 3Dpol-coding region showed that nt 6975–7369, nt-5993–6973 and nt 7265–7369 (positions of the nucleotides are of PV1(Mahoney) genome [GenBank accession number V01149.1]) are essential for the replication (Fig 3), consistent with previous reports [58,59]. The introduction of the termination codon immediately after the 3Cpro-coding region (3C-TGA mutant) severely reduced the infectivity and replication level of PVpv (approximately 1/100 of those of the parental 3C/D[A/G] mutant). However, replication levels of mutants measured by RNA transfection showed almost the same or slightly reduced levels as those of the parental 3C/D(A/G) mutant, except for those of lethal replicons (3C-TGA-Δ6975–7369 and Δ3D mutants). These results suggest that the 3CDpro protein is essential for replication, as well as the RNA structures coded in the 3Dpol-coding region.

thumbnail
Download:
Fig 3. Replication and infectivity of PV mutants with deletions in the 3Dpol-coding region.

The luciferase signals measured at 7 h p.t. of RNA or 17 h p.i. with PVpv are shown. Replication levels are the ratio of the luciferase activities observed in the absence of GuHCl to those observed in the presence of GuHCl. Identified essential genomic regions are highlighted in a schematic view of the 3Dpol-coding region. The data represent the mean and standard deviation of three independent experiments with two biological replicates.

https://doi.org/10.1371/journal.ppat.1014241.g003

To identify the 3Dpol peptide region required in cis for trans-rescued replication, PV mutants that have in-frame deletions in the 3Dpol region were analyzed (Fig 4). The in-frame deletion immediately after the 3Cpro-coding region severely affected infectivity, similar to that observed for those with a termination codon immediately after the 3Cpro-coding region, and made a marked contrast to in-frame deletions of nt 7265–7369 or nt 7220–7369. Replication levels of the mutants, measured by transfection of RNA transcripts or PVpv infection, showed a different profile, except for the Δ7265–7369 and Δ7220–7369 mutants, for which the replication level was comparable to that of the parental 3C/D(A/G) mutant. However, most of the mutants showed reduced infectivity in the presence of GuHCl, suggesting a defect in virion production. These results suggest that the 3Dpol peptides encoded immediately after the 3Cpro-coding region or the coding region have essential roles in replication and virion production.

thumbnail
Download:
Fig 4. Replication and infectivity of PV mutants with in-frame deletions in the 3Dpol-coding region.

The luciferase signals measured at 7 h p.t. of RNA or 17 h p.i. with PVpv are shown. Replication levels are the ratio of the luciferase activities observed in the absence of GuHCl to those observed in the presence of GuHCl. Identified essential genomic regions are highlighted in a schematic view of the 3Dpol-coding region. The data represent the mean and standard deviation of three independent experiments with two biological replicates.

https://doi.org/10.1371/journal.ppat.1014241.g004

To determine the length of the N-terminal peptide of 3Dpol required for efficient replication, PV mutants with premature termination codons in the 3Dpol-coding region, thereby preserving the essential RNA structures, were analyzed (Fig 5). PV mutants that have less than 202 aa of the N-terminal 3Dpol showed reduced infectivity. Replication levels measured by RNA transfection or PVpv infection showed a similar profile, except for the 3D-0 aa and 3D-18 aa mutants. These results suggest that at least the N-terminal 202 aa of 3Dpol are sufficient for efficient replication and virion production.

thumbnail
Download:
Fig 5. Replication and infectivity of PV mutants with termination codons (TGATAA) in the 3Dpol-coding region.

The luciferase signals measured at 7 h p.t. of RNA or 17 h p.i. with PVpv are shown. Replication levels are the ratio of the luciferase activities observed in the absence of GuHCl to those observed in the presence of GuHCl. Identified essential coding regions are highlighted in a schematic view of the 3Dpol-coding region. The data represent the mean and standard deviation of three independent experiments with two biological replicates.

https://doi.org/10.1371/journal.ppat.1014241.g005

Viral and host factors required for cleavage of 3AB in vivo

To analyze the effects of viral and host factors required for cleavage of 3AB in vivo, a polyprotein of PV non-structural proteins (2BC3ABCD, here after 2B2CP3) as a form of an N-terminally Azami green (AG)-fused protein (AG-2B2CP3), which allowed a high expression level of protein [26,62], with the indicated aa substitutions in the 3Cpro region or the premature termination codons in the 3Dpol-coding region was expressed (Fig 1A and 1D). In this system, AG-2B2CP3 could be processed by the encoded 3Cpro/3CDpro in cis and trans in principle, depending on host factors, including PI4KB/OSBP and membrane structures in the cells. The effects of host factors PI4KB and OSBP on the cleavage in the polyprotein were analyzed using specific inhibitors to these proteins: T-00127-HEV1 (a PI4KB inhibitor) [49] and T-00127-HEV2, -HEV3, and -HEV4 (OSBP inhibitors) [35,62], which target OSBP with a high specificity among the members in the OSBP family [63]. To confirm the protease activity of the 3Cpro/3CDpro, polyprotein processing was monitored using an anti-2C antibody.

Processing of the AG-PV-2B2CP3(WT) protein occurred efficiently, including that of 3AB (approximately 70% of 3AB was cleaved), which was almost completely blocked in the presence of GC376 (a 3Cpro inhibitor) as reported previously [26] (Fig 6A). Cleavage of 3AB was inhibited by a PI4KB inhibitor (T-00127-HEV1), albeit to a lesser extent than with GC376 treatment. Unexpectedly, the 3AB cleavage was not affected by OSBP inhibitors (T-00127-HEV2, -HEV3, and -HEV4). This result differs from that observed with an OSBP inhibitor, OSW-1, on processing of the polyprotein of coxsackievirus B3 (CVB3) [37]. Therefore, we attempted to evaluate the stability of the OSBP inhibitors used in this study in vivo (S1 Fig). Treatment of cells with OSBP inhibitors rapidly changes the cellular localization of OSBP from the cytosol to the Golgi [64], due to the accumulation of PI4P at the Golgi following the inhibition of PI4P/cholesterol transfer by OSBP, which is recognized by a pleckstrin homology domain of OSBP for its localization [43,65]. We used this phenomenon as a sensitive index of the intracellular activity of OSBP inhibitors. The intracellular activity of OSBP inhibitors was evaluated in HEK293 cells stably expressing C-terminally EGFP-fused OSBP (OSBP-EGFP), which is expressed approximately 10 times more than endogenous OSBP [62]. In untreated cells, OSBP-EGFP was mainly localized in the cytosol, but treatment with OSBP inhibitors caused the rapid relocalization to the Golgi. Treatment with T-00127-HEV4 caused the relocalization within 30 min, but the effect was diminished at 18 h. In contrast, in the cells treated with T-00127-HEV2- or -HEV3, the relocalization was maintained even after 18 h of treatment, consistent with the stability of these compounds in aqueous solution [63]. These results suggest that the inhibitory effects of T-00127-HEV2 and -HEV3 on endogenous OSBP in the cells can be maintained for up to 17 h after treatment. Therefore, the observed difference in the effects of OSBP inhibitors on 3AB cleavage seemed to reflect the intrinsic nature of the viral species (Enterovirus betacoxsackie or Enterovirus coxsackiepol), the action of OSBP inhibitors (e.g., OSW-1 has specific activity to enhance degradation of OSBP, unlike other OSBP inhibitors) [66], or differences in the expression system of viral polyprotein.

thumbnail
Download:
Fig 6. Effect of host factors and mutations on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells expressing AG-PV-2B2CP3 proteins with the indicated amino acid substitutions or without the substitutions (i.e., wild type, WT). The cells were treated with DOX (1 mg/L) for 17 h in the presence or absence of a 3C protease inhibitor (GC376, 100 μM), a PI4KB inhibitor (T-00127-HEV1, 10 μM), or OSBP inhibitors (T-00127-HEV2, -HEV3, and -HEV4, 10 μM). Viral proteins were detected by anti-3A or -2C antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two to three biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g006

AG-PV-2B2CP3 proteins with aa substitutions in the 3Cpro region, which could affect interaction with negatively charged molecules (3C-R13N, 3C-K82N, and 3C-R84S aa substitutions) [23,55–57], showed no defect in the processing of the polyprotein, including 3AB cleavage (Fig 6B), in contrast to the defects in replication or PVpv infection caused by the individual aa substitution (Fig 2B). This suggests that PI4P produced by PI4KB is essential for the 3AB cleavage, but not via recruiting OSBP or 3Cpro/3CDpro.

Introduction of premature termination codons in the 3Dpol-coding region that result in the addition of the N-terminal 0, 18, 70, 202, 286, 329, 411, and 427 aa of 3Dpol to 3Cpro suppressed the 3AB cleavage (approximately only 20% of 3AB was cleaved), without affecting other processing of the polyprotein (Fig 7). This suggests that almost the entire region of 3Dpol is required for cleavage of 3AB in polyprotein in vivo.

thumbnail
Download:
Fig 7. Effect of insertion of premature termination codons (TGATAA) in the 3Dpol-coding region on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells expressing AG-PV-2B2CP3 proteins with the indicated length of the 3Dpol peptides or without the insertion (i.e., WT). The cells were treated with DOX (1 mg/L) for 17 h. The PV-2B2CP3(WT)-expressing cells were treated with DOX in the presence or absence of a 3C protease inhibitor (GC376, 100 μM) or a PI4KB inhibitor (T-00127-HEV1, 10 μM). Viral proteins were detected by anti-3A or -2C antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of two independent experiments with two to three biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g007

Genome structure of PVpv pseudorevertants

Efficient cleavage of 3AB requires almost the entire region of the 3Dpol-coding region (Fig 7), posing a contradiction with the observed replication of PV mutants (Fig 5). To analyze the potential role of revertants in the observed replication, the stability of the introduced mutations in the genomes of PVpv mutants, which were obtained after two rounds of passage, was analyzed. After two rounds of passage, most of the mutants exhibited a drastic increase in infectivity and replication level (approximately 10–1000-fold) (S2 Fig), suggesting that the mutants are quasi-infectious. A maximum of two independent clones per examined mutant were isolated after passage (a total of 46 clones) and subjected to whole-genome sequencing analysis by nanopore sequencing. The genomes of most mutants exhibited reversion or pseudoreversion (S1 Data); however, unexpectedly, this was not observed in the Δ7265–7369 and Δ7220–7369 mutants, as well as PV mutants that had 202 aa or more of the N-terminus of 3Dpol (Table 1). The genomes of the 3C-TGA mutants exhibited pseudoreversions, changing the introduced termination codon (TGA) to codons for cysteine (TGT or TGC) or tryptophan (TGG), thus regaining the following 3Dpol peptides. The genomes of PV mutants with premature termination codons in the 3Dpol-coding region and less than 202 aa of the N-terminal 3Dpol exhibited in-frame deletion or duplication to remove the introduced termination codon (TGATAA) and acquired an increased length of peptides after the 3Cpro (186–437 aa), supporting that more than 70 aa of the N-terminal 3Dpol after 3Cpro is required for efficient replication. Interestingly, the genomes of PV with deletions in the 3Dpol-coding region showed extensive in-frame duplication (Table 1). The in-frame duplication showed the junctions of 3C/2C, 3C/3B, 3C/3C, 3D/2C, and 3D/3C. The genomes of some pseudorevertants (i.e., 3C-TGA-Δ5993–6844 revertant clone 1, 3C-TGA-Δ5993–6974 revertant clone 1, 3C-TGA-Δ5993–6844, Δ7220–7369 revertant clone 1) showed the junction of 3C/2C, thus had almost two sets of the P3-coding region (i.e., the genome structure of 2B2C3A3B3C[partial]/2C[partial]3A3B3C3D[partial]) (S3 Fig). The in-frame duplication generally resulted in increased length of peptides after 3Cpro, but not for some pseudorevertants (Δ5993–6844 revertant clone 1, Δ5993–6973 revertant clone 1, and Δ5993–6844, Δ7220–7369 revertant clone 1), suggesting that the length of the peptide after 3Cpro is not the sole determinant that caused the duplication for these deletion mutants. The total length of the genomes of these pseudorevertants was consistently increased by duplication (an increment of 332–2139 nt), suggesting a minimum genome length of 5800 nt (without poly A) may be required to support efficient replication and virion production of these deletion mutants. To analyze the effect of genome length on in-frame duplication, the genomes of PVpv with a mCherry reporter (WT and 3C/D[A/G] mutant) (a genome length of 5580 nt and without poly A) [67] obtained after two rounds of passage were analyzed. No mutation was found in the genomes of the WT and 3C/D(A/G) mutant with a mCherry reporter (Table 1), suggesting that deletion in the 3Dpol-coding region is the determinant for the in-frame duplication rather than the genome length. In summary, these results suggest that viral genomes with deletions in the 3Dpol-coding region are genetically unstable and regain infectivity via extensive in-frame duplication.

thumbnail
Download:
Table 1. Genome structures of PVpv clones obtained after two rounds of passage.

https://doi.org/10.1371/journal.ppat.1014241.t001

3CDpro or 3Dpol provided in trans can rescue a defect in the cleavage of 3AB

PV mutants that encode equal or more than 202 aa of the N-terminal 3Dpol, which should have a defect in cleavage of 3AB (Fig 7), replicated efficiently and stably without reversion/pseudoreversion (S2 Fig and Table 1), posing an apparent contradiction. This prompted us to analyze the role of 3CDpro provided in trans in the cleavage of 3AB. 3CDpro or 3Dpol, as a form of an N-terminally AG-fused protein, was co-expressed with the polyproteins that have the premature termination codons in the 3Dpol-coding region, resulting in the addition of the N-terminal 70 or 202 aa of 3Dpol (Fig 8). While the PV mutant 3D-202 aa showed stable trans-rescued replication, the PV mutant 3D-70 aa was quasi-infectious, indicating a defect in the trans-rescued replication (S2 Fig and Table 1). Co-expression of AG-3CD or AG-3D slightly affected the expression of the polyproteins, probably due to their high-level expression that could cause competition in transcription/translation, in contrast to AG-3C expression (S4 Fig), but not the processing of 2B2C. The defect of the polyproteins (AG-2B2CP3[3D-202 aa] and AG-2B2CP3[3D-70 aa]) in the 3AB cleavage was rescued by the co-expression of AG-3CD or AG-3D, indicating that the 3Dpol region provided in trans is essential to rescue the defect in the cleavage of 3AB. These results suggest that the 3Dpol region provided in trans can rescue the defect in the 3AB cleavage of polyproteins or PV mutants, irrespective of the length of the encoded 3Dpol peptides.

thumbnail
Download:
Fig 8. The effect of 3CDpro and 3Dpol provided in trans on the cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells expressing AG-PV-2B2CP3 proteins that have premature termination codons (TGATAA) in the 3Dpol-coding region, resulting in partial 3Dpol peptides as indicated (70 or 202 aa of the N-terminal peptides), along with AG-3CD(WT) or AG-3D(WT) proteins. The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-3A, -2C, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g008

The 3AB cleavage in a polyprotein encoding an inactive 3Cpro/3CDpro was not rescued by an active 3 CDpro provided in trans [26]. To further determine the mode of action of 3Cpro/3CDpro in 3AB cleavage in a polyprotein encoding an active 3Cpro, the potential trans role of 3CDpro in the cleavage was evaluated (Fig 9). An inactive 3CDpro variant (C147A) was co-expressed with an AG-2B2CP3(3D-0 aa) polyprotein variant, which completely lacks 3Dpol peptides. The expressed AG-3CD(C147A) is processed only by 3Cpro encoded in the polyprotein in trans, showing different processing profiles compared to AG-3CD(WT), with a large amount of the precursor AG-3CD(C147A) remaining intact. Nevertheless, a substantial amount of 3CDpro(C147A), similar to that of 3CDpro(WT) produced from AG-3CD(WT), and a slightly smaller amount of 3Dpol(WT) were produced from AG-3 CD(C147A). Interestingly, the co-expression of AG-3CD(C147A) did not facilitate 3AB cleavage in the AG-2B2CP3(3D-0 aa) polyprotein, in marked contrast to the co-expression of AG-3CD(WT) or AG-3D(WT). This suggests that AG-3CD(C147A) or 3CDpro(C147A) antagonized the trans effect of 3Dpol(WT) produced from AG-3CD(C147A) to facilitate 3AB cleavage. To evaluate the potential dominant negative effect of AG-3CD(C147A) or 3CDpro(C147A) on 3AB cleavage, AG-3CD(C147A), AG-3CD(WT), or AG-3D(WT) was co-expressed with an AG-2B2CP3(WT) polyprotein, in which 3AB is cleaved by 3Cpro/3 CDpro encoded in the polyprotein (S5 Fig). The 3AB cleavage was not affected by the co-expression with AG-3CD(WT) or AG-3D(WT), but was partially suppressed by the co-expression with AG-3CD(C147A). This suggested that 3Cpro/3CDpro could affect 3AB cleavage in trans. Taken together, these results suggest that 3AB cleavage requires protease activity in cis, but the efficiency of cleavage is strongly affected by trans-acting viral/host proteins and cellular context, suggesting a hybrid mechanism.

thumbnail
Download:
Fig 9. Effect of 3CDpro activity provided in trans on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells co-expressing AG-PV-2B2CP3(3D-0 aa) and AG-3CD variants (WT or C147A) or AG-3D(WT). The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two to three biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g009

To assess the importance of the specific functional interaction of 3Dpol provided in trans with 3AB in the cleavage, rather than the potential indirect effect via modification of the cellular environment, we analyzed the effect of aa substitution of the following aa residues in 3B and 3Dpol involved in 3AB-3Dpol or 3Dpol -3Dpol interactions, on the cleavage (Figs 10 and 11): P14 and R17 in 3B, which are essential for the binding of 3AB to 3Dpol [68], R379 in 3Dpol, which is essential for the binding of 3AB to 3Dpol and uridylation of 3B [69,70], K311, T312, Y313, G315, D317 in 3Dpol and P14 and R17 in 3B, which are located near the binding sites of 3Dpol and 3AB on the structural models predicted by Alphahold3 (S6 Fig), R455 in 3Dpol, which is essential for the interaction between 3Dpol and 3Dpol at the interface I [71] and also for the uridylation of 3B [72]. The aa substitutions in 3B were introduced in a polyprotein AG-2B2CP3, and those in 3Dpol were introduced in AG-3D, which was co-expressed with a polyprotein AG-2B2CP3(3D-0 aa) that completely lacked 3Dpol peptides.

thumbnail
Download:
Fig 10. Effect of aa substitution in the 3B region of a PV polyprotein on the cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells expressing AG-PV-2B2CP3 variants. The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g010

thumbnail
Download:
Fig 11. Effect of 3Dpol variants provided in trans on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells co-expressing AG-PV-2B2CP3(3D-0 aa) and AG-3D variants. The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of two independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.g011

The P14A substitution in a polyprotein significantly suppressed cleavage of 3AB, whereas the R17A and R17K substitutions showed no effect (Fig 10). While the expression of AG-3D variants (K311A, T312A, and D317A) facilitated the cleavage of 3AB in AG-2B2CP3 (3D-0 aa) as well as AG-3D(WT), the expression of AG-3D variants (Y313A, R379E, and R455D) completely lost the trans activity to support the 3AB cleavage. Expression of an AG-3D variant (G315A) only partially facilitated the cleavage, in contrast to AG-3D(WT) (Fig 11). These results suggest that cleavage of 3AB requires 3Dpol-3AB and 3Dpol-3Dpol interactions via P14 in 3B and Y313, G315, R379, and R455 in 3Dpol.

These results suggest that the 3Dpol region provided in trans can rescue the defect in 3AB cleavage of the PV polyprotein, independently of the 3Dpol peptides encoded in the polyprotein. The observed defect in replication of the PV mutant 3D-70 aa may occur at an uncharacterized step in addition to the 3AB cleavage.

Discussions

In this study, we investigated the role of 3CDpro in the cleavage of PV 3AB in vivo (i.e., in cultured cells). 3CDpro is a multifunctional RNA-binding protease that plays key roles in the replication, including efficient cleavage of P1 [3,22], switching of the viral genome from translation to RNA replication [23,24], stimulation of uridylylation of 3B [25], cis role in the cleavage of 3AB and provision of 3Dpol activity in trans [26]; however, the mechanism that supports these function remains largely unknown. As a mechanism of the 3CDpro function, the binding activity of the 3Cpro region to negatively charged molecules (RNA and phospholipids) has been reported [23,55–57]. Two 3Cpro molecules could bind to an RNA stem-loop in the 5’ cloverleaf structure of EV genomes [73]. PV mutants that lack this activity are lethal or quasi-infectious [61], underscoring the importance of this activity in infection. PV mutants with 3C-R13N, 3C-K82N, or 3C-R84S aa substitutions, which affect the binding activity [23,55–57], showed severely suppressed trans-rescued replication (Fig 2B), suggesting a critical cis role of binding activity of 3Cpro/3CDpro to negatively charged molecules.

In PV replication, host PI4KB provides PI4P, a negatively charged lipid, on the viral RO [16]. Therefore, the binding of 3CDpro to PI4P was considered a candidate mechanism to support the cleavage of 3AB. However, polyproteins that encode the 3CDpro variants showed efficient cleavage of 3AB (Fig 6B). Nevertheless, the activity of PI4KB was required for the cleavage, in contrast to the inhibition of OSBP, which had little effect on the cleavage in a polyprotein (Fig 6A). These results suggest that PI4P is essential for cleavage of 3AB but plays a role distinct from the recruitment of 3CDpro or OSBP to the RO for this step. PI4KB and OSBP support viral replication via the same functional pathway in EV replication [51]; however, PI4KB may have a more specific role in cleavage of 3AB in PV replication. In PV replication, resistance mutations in 3A, which promote cleavage of 3AB [36], showed a relatively weak effect against OSBP inhibitors compared to PI4KB inhibitors [50]. Observed 3AB cleavage in a polyprotein in the presence of OSBP inhibitors may suggest OSBP is involved in the function of 2B downstream of the 3AB cleavage in PV replication [50,54]. In support of this view, in encephalomyocarditis virus (EMCV) replication, a resistance mutation in 3A conferred resistance to a PI4KA (one of the four mammalian PI4Ks) inhibitor but not to OSBP inhibitors [74]. On the other hand, in CVB3 replication, a resistance mutation in 3A conferred a similar level of resistance to both a PI4KB inhibitor and to OSBP inhibitors [74,75]. These findings suggest that the roles of PI4KB/PI4KA and OSBP in 3AB cleavage vary among picornaviruses, and that OSBP may have a different function downstream of PI4KB/PI4KA activity.

The 3Dpol region of the PV genome has RNA structures that are important for replication and infectivity, named as α (nt 6995–7069 in PV1[Mahoney] genome), β (nt 7227–7264 in PV1[Mahoney] genome) [58], and 3D-7000 (nt 6920–7090 in PV1[Mahoney] genome) [59]. These structures are conserved in Enterovirus coxsackiepol species and required for replication and infectivity [58,59]. Since replication of a PV mutant that lacks the entire 3Dpol-coding region could not be trans-rescued by 3CDpro, these RNA structures should function in cis [26]. Consistent with a previous report [58], PV mutants with a deletion of both α and β were lethal (Figs 3–5). Only the 3Dpol region that is dispensable in trans-rescued replication was located between nt 7220 and 7369; PV mutants that had a deletion just before or within 3D-7000 were quasi-infectious and caused pseudoreversions after passages. Interestingly, all of these pseudorevertants exhibited extensive in-frame duplications (Table 1 and S3 Fig), some of which contained nearly two sets of the P3 region in their genomes, including 3B. Some uncharacterized activity of the large polyprotein precursor, P3, might have been required to support the replication of these mutants [60,76]. PV mutants with premature termination codons in the 3Dpol-coding region showed in-frame deletion rather than in-frame duplication after passages (Table 1). This suggested that deletion of the 3Dpol-coding region, rather than the 3Dpol peptide, was the driving force behind the in-frame duplication. In-frame duplication or non-homologous recombination between non-replicable EV RNA and replicable EV RNA has been well established [77,78]. The genome duplication observed in the current study was significantly larger (429–1593 nt) than that observed in non-replicable EV RNA recombination (approximately 100 nt), suggesting a functional requirement of the genome duplication to complement the uncharacterized defects in replication of the PV mutants. Only two genera in the family Picornaviridae (comprising 63 genera), i.e., Aphthovirus and Mosavirus, have multiple copies of 3B (three and two copies, respectively) in the genomes; however, two copies of 3B are unstable in the PV genome [79,80]. Therefore, acquiring multiple copies of 3B in picornavirus genomes may be a rare event in picornavirus evolution. A gene produced by duplication could evolve to have different functions [81]; the 3B1 gene in the FMDV genome is one such example in picornavirus evolution [82]. Gene duplication does not occur frequently in the evolution of RNA viruses [83]; some special interactions between picornaviruses, including trans complementation, might have triggered such a rare event during evolution.

The 3AB plays multiple roles in replication, in addition to providing 3B, which could serve as the primer for viral RNA synthesis after uridylylation [11], including stimulation of 3Dpol polymerase activity [19,20] and processing of 3CDpro [84]. The pathway to produce the functional uridylylated 3B as the primer for viral RNA synthesis has yet to be determined, since the 3B region of 3BC and 3BCD can also serve as substrates for uridylylation in vitro and can be found covalently linked to viral RNA in vivo [85,86], as well as 3B itself. On the other hand, cis-complementation studies have suggested that 3AB is the most likely precursor of 3B used for uridylylation in vivo [87]. Efficient trans-rescued replication of PV mutants that exclusively produce 3CDpro but not 3Cpro, suggesting that 3CDpro could play the cis role of 3Cpro, including the 3AB cleavage [26]. Cleavage of 3AB required the entire 3Dpol region of 3CDpro encoded in the polyprotein (Fig 7). Surprisingly, PV mutants that could express the N-terminal 202 aa or more of 3Dpol peptides can stably maintain the introduced mutations in trans-rescued replication (Table 1). We found that 3Dpol provided in trans could rescue the defect in 3AB cleavage in the corresponding polyproteins (Figs 8 and 9). The effect of 3Dpol or 3CDpro provided in trans on the 3AB cleavage was expression level-dependent and saturable (S7 Fig). Therefore, the 3Dpol region seems to function in trans in the 3AB cleavage, and in cis in the replication with the RNA structures coded in this region [58,59] and in the genetic stability of viral genome with the 3Dpol peptides (Table 1), via different regions (Figs 3–5, and 7). A cis role of 3Dpol in foot-and-mouth disease virus (FMDV) replication is involved in the replication via interaction with the 5’ untranslated region of the viral genome rather than via polyprotein processing [88]. To gain insight into the observed effect of the 3Dpol region, structural models were predicted using AlphaFold3 (S6 Fig), which include one to two molecules of 3AB and 3Dpol, considering both homotypic and heterotypic interactions between 3AB and 3Dpol [68,69,89–91]. It should be noted that the confidence metrics for the 3AB structures were generally low (pLDDT < 70) in the proposed models, likely reflecting the intrinsic disordered nature of 3AB. In addition, the models do not include contributions from other viral/host factors (e.g., proteins, RNA, and lipids) to recapitulate the 3Dpol-3AB interaction within a replication complex in vivo. Despite these limitations, some features established by previous studies were reproduced in the models, including the involvement of the 3B region in the 3Dpol-3AB interaction [68,90] and the interface I in the 3Dpol-3Dpol interaction [71]. However, the predicted binding sites of 3B on PV 3Dpol in the models (around Y313) were far from those suggested in PV 3Dpol (around R379) [69,70,89] and in a crystal structure of CVB3 3Dpol (around Y378) [92], but relatively close to that suggested in EV-A71 3Dpol (around T313) [93]. The Y313 and G315 residues of PV 3Dpol are located near the interface I, suggesting a potential involvement in the 3Dpol-3Dpol interaction. We found that aa substitutions at P14 in 3B and at Y313, G315, R379, and R455 in 3Dpol could significantly affect 3AB cleavage (Figs 10 and 11), indicating a remarkable overlap between the aa residues required for 3AB cleavage with those required for the uridylylation of 3B in vitro, including those required for the binding of 3B to 3Dpol as a prerequisite of the reaction [69,70,72,94]. This might suggest that cleavage of 3AB and the subsequent uridylylation of 3B occur in a coupled reaction to enhance the efficiency of uridylylation in vivo.

The limitations of this study include the unknown mechanism of in-frame genome duplication by which PV mutants with partial deletions in the 3Dpol region regain fitness during trans-rescued replication. Because the defect of the 3AB cleavage of polyproteins could be rescued by 3Dpol provided in trans, independently of the 3Dpol peptides encoded in the polyproteins (Figs 8–10), it is plausible that some targets other than the 3AB cleavage would also have been involved in the trans-rescued replication and in the genetic stability of the viral genome via the peptides following 3Cpro. Elucidation of the binding site of PV 3B on 3Dpol will unambiguously clarify the role of aa residues examined in this study in 3AB cleavage, including Y313 of 3Dpol.

Collectively, this study reveals novel roles for the 3Dpol region in cleavage of PV 3AB and in the genetic stability of the viral genome. Our findings might be useful for the development of effective antivirals targeting the polyprotein processing and viral genome recombination.

Materials and methods

Cells

RD cells (human rhabdomyosarcoma cells) and HEK293 cells (human embryonic kidney cells) were cultured as monolayers in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% foetal calf serum (FCS). RD cells were used for virus titration. HEK293 cells were used for expression of PV non-structural proteins and for production of PV pseudovirus (PVpv).

Viruses

PVpv was produced with a firefly luciferase-coding or a mCherry-coding type 1 PV (PV1) Mahoney strain (GenBank accession number V01149.1) replicon and capsid proteins of PV1(Mahoney) [67,95].

Antibodies

Rabbit hyperimmune serum against PV 3A and 3D proteins were prepared in previous studies [36,51,96]. Rabbit hyperimmune serum against PV 2C was a kind gift from Tomoichiro Oka (National Institute of Health Sciences, Japan).

Chemicals

Doxycycline (DOX) was purchased from FUJIFILM Wako Pure Chemical Corporation (049–31121). Guanidine hydrochloride (GuHCl, a 2C inhibitor) was purchased from SIGMA (G-9284). GC376 (a 3C inhibitor) was purchased from Selleck Chemicals (S0475). T-00127-HEV1 was purchased from Pharmeks Ltd., Moscow, Russia (purity >99%). T-00127-HEV2 was kindly provided by Hirotatsu Kojima (Open Innovation Center for Drug Discovery, University of Tokyo, Tokyo, Japan, purity >99%). T-00127-HEV3 and -HEV4 were purchased from Enamine (#Z49616154 [purity 92%] and #Z49616105 [purity 92%], respectively). Stock solutions of DOX (2 g/L) and GuHCl (2 M) were prepared in Milli-Q water. Stock solutions of GC376 (100 mM) and rupintrivir (10 mM) were prepared in dimethyl sulfoxide.

General methods for molecular cloning

Escherichia coli strain XL10-Gold (Agilent, #200314) was used for the preparation of plasmids. Ligation of DNA fragments was performed using an NEBuilder HiFi DNA Assembly Master Mix (NEB, #E2621L). PCR was performed using KOD FX Neo DNA polymerase (Toyobo, #KFX-201X5). Sanger DNA sequencing was performed to confirm the presence of introduced mutations in the plasmids using a BigDye Terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems) and then analyzed with a 3500xL genetic analyzer (Applied Biosystems). Viral RNA was extracted from 200 μL of culture supernatant of PVpv-infected cells using a Quick-RNA Viral Kit (ZYMO RESEARCH, #R1035).

Plasmids

Lentivirus expression vectors for PV capsid proteins.

pTet-AG-PV1(Mahoney) capsid:

A cDNA fragment of the coding region of the capsid proteins of PV1(Mahoney) strain was obtained by PCR with pKS435-EGFP-PV CAPSID [95] as the template and following primer set 1. This DNA fragment was inserted into a DNA fragment of a lentivirus vector plasmid with a TRE3G promoter, which was obtained by PCR with pLJM1-TRE3G-His-AG-FLAG-PreScission-OSBP(406–807) [62] as the template and using primer set 2.

Primer set 1:

5’ GAAGTTCTGTTCCAGGGCGCCCAGGTTTCATCACAGAAAGTGGGC

3’

5’ TCTGAGTCCGGATCAATATGTGGTCAGATCCTTGGTGGAGAGG

3’

Primer set 2:

5’ CTGGAACAGAACTTCCAGCTTGTCGTCATC 3’

5’ TGATCCGGACTCAGATCTCGAGCTCAAGC 3’

Lentivirus expression vectors for PV non-structural proteins.

pTet-AG-PV-2B2CP3(3C-R13N, 3C-K82N, 3C-R84S, 3B-P14A, 3B-R17A, 3B-R17K):

Mutations for the aa substitutions were introduced in pTet-AG-PV-2B2CP3(WT) by PCR with primer sets in S1 Table.

pTet-AG-PV-2B2CP3(3D-0 aa, 3D-18aa, 3D-37aa, 3D-70 aa, 3D-202 aa, 3D-286 aa, 3D-329 aa, 3D-411 aa, 3D-427 aa):

Tandem termination codons (TGATAA) after the indicated sites in the 3Dpol region were introduced in pTet-AG-PV-2B2CP3(WT) by PCR with primer sets in S1 Table.

pTet-AG-PV-3CD(C147A):

Mutations for the aa substitution were introduced in pTet-AG-PV-3 CD(WT) by PCR with primer sets in S1 Table.

pTet-AG-PV-3D(K311A, T312A, Y313A, G315A, D317A, R379E, and R455D):

Mutations for the aa substitutions were introduced in pTet-AG-PV-3D(WT) by PCR with primer sets in S1 Table.

PV replicon mutants

pPV-Fluc mc (3C/D[A/G]-3C-R13N, 3C/D[A/G]-3C-K82N, 3C/D[A/G]-3C-R84S, 3C-TGA, 3C-TGA-Δ5990–6844, 3C-TGA-Δ5990–6974, 3C-TGA-Δ6975–7369, 3C-TGA-Δ7265–7369, 3C-TGA-Δ5990–6844, Δ7265–7369, 3C-TGA-Δ5990–6844 + Δ7220–7369, 3C-TGA-Δ5990–6973 + Δ7265–7369, 3C-TGA-Δ5990–6973 + Δ7220–7369, Δ5993–6844, Δ5993–6973, Δ6974–7369, Δ7265–7369, Δ7220–7369, Δ5993–6844 + Δ7265–7369, Δ5993–6844 + Δ7220–7369, Δ5993–6973 + Δ7265–7369, Δ5993–6973 + Δ7220–7369, 3D-0 aa, 3D-18aa, 3D-37aa, 3D-70 aa, 3D-202 aa, 3D-286 aa, 3D-329 aa, 3D-411 aa, 3D-427 aa):

Indicated mutations were introduced in pPV-Fluc mc with a hammerhead ribozyme at the 5’end of the replicon [67,97] by PCR with primer sets in S1 Table.

Preparation of lentivirus and PV-non-structural-proteins-expressing cells

HEK293 cells were transfected with the lentivirus expression vectors constructed as above, and packaging plasmids psPAX2 (a gift from Didier Trono, Addgene, 12260) and pVSV-G (Clontech, 631530) using a TransIT-PRO transfection kit (Mirus, MIR 5700). The supernatant of the cells was collected at 48 h and 72 h post-transfection and then mixed before storage at -80°C. HEK293 cells expressing the Tet-On 3G protein were infected with the lentiviruses in the presence of polybrene (4 μg/mL). For the preparation of cells that express capsid proteins of PV1(Mahoney) strain, Tet-AG-PV-3CD(WT) cells that express PV 3CDpro (WT) protein in the presence of DOX [26] were infected with the lentivirus (Tet-AG-PV-3 CD(WT)+PV1-capsid cells).

RNA transfection

RNA transcripts of PV replicons were obtained using a RiboMAX Express Large Scale RNA Production System (Promega, P1320) with DraI-linearized plasmids of PV replicons. RNA transcripts (0.025 μL) were transfected into the cells (4 × 104 cells per well in 100 μL medium) in a 96-well plate (Corning Incorporated, 3595) using TransIT-mRNA Transfection Kit (Mirus, MIR 2250).

Preparation of PV pseudovirus (PVpv) with a defective PV replicon

Tet-AG-PV-3CD(WT)+PV1-capsid cells (4 × 104 cells per well in 100 μL medium) in a 96-well plate (Corning Incorporated, 3516) were incubated in the presence of DOX (1 mg/L) at 37 °C for 20 h. RNA transcripts (0.025 μL) of defective PV replicons were transfected into monolayers of Tet-AG-PV-3CD(WT)+PV1-capsid cells expressing the capsid proteins and the 3CDpro protein. The cells were harvested at 24 h post-transfection of the RNA transcripts and then stored at -20 °C. To assess the stability of the genomes, the obtained PVpv was subjected to passage. PVpv solution (10 μL) was inoculated into the DOX-treated Tet-AG-PV-3CD(WT)+PV1-capsid cells (4 × 104 cells per well in 100 μL medium), and then the cells were harvested at day 1 or 2 p.i. Viral RNA was extracted from PVpv solution (100 μL) obtained after two rounds of passage.

Titration of defective PVpv

Tet-AG-PV-3CD(WT) cells (8 × 103 cells per well in 20 μL medium) in a 384-well plate (Greiner Bio-One, 781080) were incubated at 37 °C for 5 h in the presence of DOX (1 mg/L). The cells were inoculated with 5 μL of serially diluted PVpv solution (dilution of 1/1–1/105) and then incubated at 37 °C for 17 h. A 15 μL of the supernatant was removed from each well, and then 10 μL of Steady-Glo Reagent (Promega, E2520) was added to each well. Luciferase signals were measured using a 2030 ARVO X luminometer (Perkin-Elmer). The infectivity of PVpv solution was calculated from the signals in cells infected at an MOI of approximately 0.1.

Western blot

The cells (8 × 105 cells) were collected in 40 μL of cell lysis buffer (21 mM HEPES buffer [pH 7.4], 0.7 mM disodium hydrogenphosphate, 137 mM NaCl, 4.8 mM KCl, 0.5% Nonidet P-40 and 5 mM EDTA, supplemented with complete-mini protease inhibitor cocktail tablet [Roche, 04 693 159 001]), and then were subjected to e-PAGEL 5–20% gradient polyacrylamide gel electrophoresis (Atto Corporation) in a Laemmli buffer system. Proteins in the gel were transferred to a polyvinylidene difluoride filter (Millipore, Immobilon) and blocked in iBind solution (Thermo Fischer Scientific). Filters were incubated with anti-PV 2C or anti-PV 3A antibodies [36] (rabbit antisera, 1:500 and 1:200 dilution, respectively), then with secondary antibodies (Thermo Scientific, 32460, goat anti-rabbit IgG antibodies conjugated with horseradish peroxidase, 1:200 dilution) in iBind Western System (Thermo Fischer Scientific). Signals were detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, 34095), then analyzed with ImageQuant 800 (cytiva).

Whole genome sequence analysis of PVpv

cDNAs of PVpv genomes were obtained by reverse transcription-PCR (RT-PCR) using viral RNA as the template using a PrimeScript II High Fidelity One-step RT-PCR Kit (Takara Bio, #R026A) with the 5’ phosphorylated primers EcoRI-S2+ (5- TTAAGAATTCTTAAAACAGCTCTGGGGTTGTACCCACCC-3’) and EcoRI-PV-polyA- (5’- AAAAGAATTCTTTTTTTTTTTTTTTTTTTTTTTTTCTCCGAATTAAAGAAAAATTTACCC-3’). The RT-PCR condition consists of an RT step at 45°C for 15 min followed by inactivation at 94°C for 2 min, 52 cycles of thermal cycling at 98°C for 10 sec, 55°C for 15 sec, and 68°C for 80 sec, and a hold step at 10°C. The RT-PCR products were purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, #740609.250). T4 DNA ligase buffer (NEB, #B0202S) (3 μL) and T4 DNA ligase (NEB, #M0202L) (800 U, 2 μL) were added to the purified RT-PCR products (25 μL). The samples were incubated at room temperature for 2 h for circularization and then purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, #740609.250). Concentration of DNA in the samples was quantified using a Qubit Flex Fluorometer (ThermoFischer SCIENTIFIC) and then adjusted approximately to 50 ng/μL by water. The circularized DNA was analyzed by the nanopore sequencing method (Oxford Nanopore Technologies, SQK-RBK114, https://nanoporetech.com/document/rapid-sequencing-v14-plasmid-sequencing-sqk-rbk114-96) using the Plasmid EZ service (AZENTA) to obtain nearly complete genome sequences. Due to a technical limitation in the base calling of the system, one cytidine in nt 4806–4813 (8 consecutive cytidines) was missing in most of the sequence (42/ 46 samples).

Structural modeling

Structures of 3AB and 3Dpol complex were predicted using AlphaFold 3 server (DeepMind) using default parameters, following the official inference pipeline and model parameters obtained from Google DeepMind under the AlphaFold 3 Terms of Use [98]. The proposed structural models were viewed using The PyMOL Molecular Graphics System (version 3.1.6.1, Schrödinger, LLC) and Chimera [99].

Statistical analysis

Results of experiments are shown as means with standard deviations. The presented data are representative of at least two independent experiments with two or three biological replicates. Values of P < 0.01 by one-tailed t test were considered to indicate a significant difference and were indicated by asterisks (**P < 0.01, ***P < 0.001).

Supporting information

S1 Data. Nucleotide sequence of the genomes of PVpv isolates.

https://doi.org/10.1371/journal.ppat.1014241.s001

(TXT)

S1 Table. Plasmids and primers used in this study.

https://doi.org/10.1371/journal.ppat.1014241.s002

(XLSX)

S1 Fig. Analysis of the stability of activity of OSBP inhibitors on intracellular OSBP.

A PI4KB inhibitor (T-00127-HEV1) or OSBP inhibitors (T-00127-HEV2, -HEV3, or -HEV4) were added to HEK293 cells overexpressing C-terminally EGFP-fused OSBP (OSBP-EGFP). Subcellular localization of OSBP-EGFP was analyzed after 30 min and 18 h treatment.

https://doi.org/10.1371/journal.ppat.1014241.s003

(TIF)

S2 Fig. Infectivity and replication level of PVpv mutants obtained after two rounds of passage.

PV isolates that had pseudoreversion are highlighted in red. Ratio of the infectivity (without GuHCl) and ratio of the replication level of PVpv after the passages to those of the original PVpv are shown. The data are representative of two independent experiments with one or two isolates. ND; not detectable.

https://doi.org/10.1371/journal.ppat.1014241.s004

(TIF)

S3 Fig. Schematic view of a pseudorevertant derived from the 3C-TGA-Δ5990–6844 replicon (clone 1).

The genome region duplicated by slide-back or non-homologous recombination, possibly during the negative-strand synthesis, is highlighted in red.

https://doi.org/10.1371/journal.ppat.1014241.s005

(TIF)

S4 Fig. Effect of 3Cpro provided in trans on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells co-expressing AG-PV-2B2CP3(3D-0 aa) and AG-3C(WT) or AG-3D (WT). The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, -3C, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.s006

(TIF)

S5 Fig. Evaluation of the dominant-negative effect of an inactive 3CDpro variant on the cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells co-expressing AG-PV-2B2CP3(WT) and AG-3CD variants (WT or C147A) or AG-3D(WT). The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of three independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.s007

(TIF)

S6 Fig. Structural models of PV 3AB and 3Dpol.

Structural models of (A) two molecules of 3AB (highlighted in orange or green) and one molecule of 3Dpol (highlighted in purple) or (B) one molecule of 3AB (highlighted in green) and two molecules of 3Dpol (highlighted in purple and magenta) were generated by AlphaFold3. The 3B region in 3AB was highlighted in cyan. The aa residues analyzed in this study are highlighted in red, blue, or yellow.

https://doi.org/10.1371/journal.ppat.1014241.s008

(TIF)

S7 Fig. Effect of expression levels of 3CDpro or 3Dpol provided in trans on cleavage of 3AB in vivo.

Western blot analysis of viral proteins in the cells co-expressing AG-PV-2B2CP3(3D-0 aa) and AG-3CD(WT) or AG-3D(WT). For moderate or low expression of AG-3CD(WT) or AG-3D(WT), approximately 1/3 or 1/30 of the lentivirus solution, respectively, was used, compared to that used in other experiments. The cells were treated with DOX (1 mg/L) for 17 h. Viral proteins were detected by anti-2C, -3A, or -3D antibodies. The percentage of cleaved 3AB is highlighted in color. The data are representative of two independent experiments with two biological replicates. NS, not significant.

https://doi.org/10.1371/journal.ppat.1014241.s009

(TIF)

Acknowledgments

I am grateful to Yuzuru Aoi for her excellent technical assistance. I sincerely appreciate Aniko Paul for her critical reading, editing, and kind suggestions to improve the manuscript.

References

  1. 1. Kitamura N, Semler BL, Rothberg PG, Larsen GR, Adler CJ, Dorner AJ, et al. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature. 1981;291(5816):547–53. pmid:6264310
  2. 2. Toyoda H, Nicklin MJ, Murray MG, Anderson CW, Dunn JJ, Studier FW, et al. A second virus-encoded proteinase involved in proteolytic processing of poliovirus polyprotein. Cell. 1986;45(5):761–70. pmid:3011278
  3. 3. Ypma-Wong MF, Dewalt PG, Johnson VH, Lamb JG, Semler BL. Protein 3CD is the major poliovirus proteinase responsible for cleavage of the P1 capsid precursor. Virology. 1988;166(1):265–70. pmid:2842953
  4. 4. Campagnola G, Peersen O. Co-folding and RNA activation of poliovirus 3Cpro polyprotein precursors. J Biol Chem. 2023;299(11):105258. pmid:37717698
  5. 5. Xia H, Wang P, Wang G-C, Yang J, Sun X, Wu W, et al. Human enterovirus nonstructural protein 2CATPase functions as both an RNA Helicase and ATP-independent RNA chaperone. PLoS Pathog. 2015;11(7):e1005067. pmid:26218680
  6. 6. Nieva JL, Madan V, Carrasco L. Viroporins: structure and biological functions. Nat Rev Microbiol. 2012;10(8):563–74. pmid:22751485
  7. 7. Yeager C, Carter G, Gohara DW, Yennawar NH, Enemark EJ, Arnold JJ, et al. Enteroviral 2C protein is an RNA-stimulated ATPase and uses a two-step mechanism for binding to RNA and ATP. Nucleic Acids Res. 2022;50(20):11775–98. pmid:36399514
  8. 8. Liu Y, Wang C, Mueller S, Paul AV, Wimmer E, Jiang P. Direct interaction between two viral proteins, the nonstructural protein 2C and the capsid protein VP3, is required for enterovirus morphogenesis. PLoS Pathog. 2010;6(8):e1001066. pmid:20865167
  9. 9. van Kuppeveld FJ, Hoenderop JG, Smeets RL, Willems PH, Dijkman HB, Galama JM, et al. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J. 1997;16(12):3519–32. pmid:9218794
  10. 10. Nomoto A, Detjen B, Pozzatti R, Wimmer E. The location of the polio genome protein in viral RNAs and its implication for RNA synthesis. Nature. 1977;268(5617):208–13. pmid:196204
  11. 11. Paul AV, Yin J, Mugavero J, Rieder E, Liu Y, Wimmer E. A “slide-back” mechanism for the initiation of protein-primed RNA synthesis by the RNA polymerase of poliovirus. J Biol Chem. 2003;278(45):43951–60. pmid:12937178
  12. 12. Sasaki J, Ishikawa K, Arita M, Taniguchi K. ACBD3-mediated recruitment of PI4KB to picornavirus RNA replication sites. EMBO J. 2012;31(3):754–66. pmid:22124328
  13. 13. Greninger AL, Knudsen GM, Betegon M, Burlingame AL, Derisi JL. The 3A protein from multiple picornaviruses utilizes the golgi adaptor protein ACBD3 to recruit PI4KIIIβ. J Virol. 2012;86(7):3605–16. pmid:22258260
  14. 14. Wessels E, Duijsings D, Niu T-K, Neumann S, Oorschot VM, de Lange F, et al. A viral protein that blocks Arf1-mediated COP-I assembly by inhibiting the guanine nucleotide exchange factor GBF1. Dev Cell. 2006;11(2):191–201. pmid:16890159
  15. 15. Belov GA, Feng Q, Nikovics K, Jackson CL, Ehrenfeld E. A critical role of a cellular membrane traffic protein in poliovirus RNA replication. PLoS Pathog. 2008;4(11):e1000216. pmid:19023417
  16. 16. Hsu N-Y, Ilnytska O, Belov G, Santiana M, Chen Y-H, Takvorian PM, et al. Viral reorganization of the secretory pathway generates distinct organelles for RNA replication. Cell. 2010;141(5):799–811. pmid:20510927
  17. 17. Dorobantu CM, van der Schaar HM, Ford LA, Strating JRPM, Ulferts R, Fang Y, et al. Recruitment of PI4KIIIβ to coxsackievirus B3 replication organelles is independent of ACBD3, GBF1, and Arf1. J Virol. 2014;88(5):2725–36. pmid:24352456
  18. 18. Suhy DA, Giddings TH Jr, Kirkegaard K. Remodeling the endoplasmic reticulum by poliovirus infection and by individual viral proteins: an autophagy-like origin for virus-induced vesicles. J Virol. 2000;74(19):8953–65. pmid:10982339
  19. 19. Paul AV, Cao X, Harris KS, Lama J, Wimmer E. Studies with poliovirus polymerase 3Dpol. Stimulation of poly(U) synthesis in vitro by purified poliovirus protein 3AB. J Biol Chem. 1994;269(46):29173–81. pmid:7961883
  20. 20. Lama J, Paul AV, Harris KS, Wimmer E. Properties of purified recombinant poliovirus protein 3aB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpol. J Biol Chem. 1994;269(1):66–70. pmid:8276867
  21. 21. Richards OC, Ehrenfeld E. Effects of poliovirus 3AB protein on 3D polymerase-catalyzed reaction. J Biol Chem. 1998;273(21):12832–40. pmid:9582311
  22. 22. Jore J, De Geus B, Jackson RJ, Pouwels PH, Enger-Valk BE. Poliovirus protein 3CD is the active protease for processing of the precursor protein P1 in vitro. J Gen Virol. 1988;69 (Pt 7):1627–36. pmid:2839599
  23. 23. Andino R, Rieckhof GE, Achacoso PL, Baltimore D. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5’-end of viral RNA. EMBO J. 1993;12(9):3587–98. pmid:8253083
  24. 24. Gamarnik AV, Andino R. Switch from translation to RNA replication in a positive-stranded RNA virus. Genes Dev. 1998;12(15):2293–304. pmid:9694795
  25. 25. Paul AV, Rieder E, Kim DW, van Boom JH, Wimmer E. Identification of an RNA hairpin in poliovirus RNA that serves as the primary template in the in vitro uridylylation of VPg. J Virol. 2000;74(22):10359–70. pmid:11044080
  26. 26. Arita M. An efficient trans complementation system for in vivo replication of defective poliovirus mutants. J Virol. 2024;98(7):e0052324. pmid:38837378
  27. 27. Igarashi H, Yoshino Y, Miyazawa M, Horie H, Ohka S, Nomoto A. 2A protease is not a prerequisite for poliovirus replication. J Virol. 2010;84(12):5947–57. pmid:20392856
  28. 28. Paul AV, Mugavero J, Molla A, Wimmer E. Internal ribosomal entry site scanning of the poliovirus polyprotein: implications for proteolytic processing. Virology. 1998;250(1):241–53. pmid:9770438
  29. 29. Ansardi DC, Porter DC, Morrow CD. Complementation of a poliovirus defective genome by a recombinant vaccinia virus which provides poliovirus P1 capsid precursor in trans. J Virol. 1993;67(6):3684–90. pmid:8388519
  30. 30. Kuhn RJ, Tada H, Ypma-Wong MF, Semler BL, Wimmer E. Mutational analysis of the genome-linked protein VPg of poliovirus. J Virol. 1988;62(11):4207–15. pmid:2845132
  31. 31. Paul AV, Molla A, Wimmer E. Studies of a putative amphipathic helix in the N-terminus of poliovirus protein 2C. Virology. 1994;199(1):188–99. pmid:8116242
  32. 32. Li X, Lu H-H, Mueller S, Wimmer E. The C-terminal residues of poliovirus proteinase 2A(pro) are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage. J Gen Virol. 2001;82(Pt 2):397–408. pmid:11161279
  33. 33. Herod MR, Gold S, Lasecka-Dykes L, Wright C, Ward JC, McLean TC, et al. Genetic economy in picornaviruses: foot-and-mouth disease virus replication exploits alternative precursor cleavage pathways. PLoS Pathog. 2017;13(10):e1006666. pmid:28968463
  34. 34. Pierce DM, Hayward C, Rowlands DJ, Stonehouse NJ, Herod MR. Insights into polyprotein processing and RNA-protein interactions in foot-and-mouth disease virus genome replication. J Virol. 2023;97(5):e0017123. pmid:37154761
  35. 35. Arita M, Kojima H, Nagano T, Okabe T, Wakita T, Shimizu H. Oxysterol-binding protein family I is the target of minor enviroxime-like compounds. J Virol. 2013;87(8):4252–60. pmid:23365445
  36. 36. Arita M. Mechanism of poliovirus resistance to host phosphatidylinositol-4 Kinase III β Inhibitor. ACS Infect Dis. 2016;2(2):140–8. pmid:27624965
  37. 37. Lyoo H, Dorobantu CM, van der Schaar HM, van Kuppeveld FJM. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein. Antiviral Res. 2017;147:86–90. pmid:29024767
  38. 38. Melia CE, van der Schaar HM, Lyoo H, Limpens RWAL, Feng Q, Wahedi M, et al. Escaping host factor PI4KB inhibition: enterovirus genomic RNA replication in the absence of replication organelles. Cell Rep. 2017;21(3):587–99. pmid:29045829
  39. 39. Ishitsuka H, Ohsawa C, Ohiwa T, Umeda I, Suhara Y. Antipicornavirus flavone Ro 09-0179. Antimicrob Agents Chemother. 1982;22(4):611–6. pmid:6295260
  40. 40. Heinz BA, Vance LM. The antiviral compound enviroxime targets the 3A coding region of rhinovirus and poliovirus. J Virol. 1995;69(7):4189–97. pmid:7769678
  41. 41. Balla T. Phosphoinositides: tiny lipids with giant impact on cell regulation. Physiol Rev. 2013;93(3):1019–137. pmid:23899561
  42. 42. Ngo M, Ridgway ND. Oxysterol binding protein-related Protein 9 (ORP9) is a cholesterol transfer protein that regulates Golgi structure and function. Mol Biol Cell. 2009;20(5):1388–99. pmid:19129476
  43. 43. Mesmin B, Bigay J, Moser von Filseck J, Lacas-Gervais S, Drin G, Antonny B. A four-step cycle driven by PI(4)P hydrolysis directs sterol/PI(4)P exchange by the ER-Golgi tether OSBP. Cell. 2013;155(4):830–43. pmid:24209621
  44. 44. Olkkonen VM, Li S. Oxysterol-binding proteins: sterol and phosphoinositide sensors coordinating transport, signaling and metabolism. Prog Lipid Res. 2013;52(4):529–38. pmid:23830809
  45. 45. Ridgway ND, Zhao K. Cholesterol transfer at endosomal-organelle membrane contact sites. Curr Opin Lipidol. 2018;29(3):212–7. pmid:29629999
  46. 46. Antonny B, Bigay J, Mesmin B. The oxysterol-binding protein cycle: burning off PI(4)P to transport cholesterol. Annu Rev Biochem. 2018;87:809–37. pmid:29596003
  47. 47. Strating JRPM, van der Linden L, Albulescu L, Bigay J, Arita M, Delang L, et al. Itraconazole inhibits enterovirus replication by targeting the oxysterol-binding protein. Cell Rep. 2015;10(4):600–15. pmid:25640182
  48. 48. Albulescu L, Bigay J, Biswas B, Weber-Boyvat M, Dorobantu CM, Delang L, et al. Uncovering oxysterol-binding protein (OSBP) as a target of the anti-enteroviral compound TTP-8307. Antiviral Res. 2017;140:37–44. pmid:28088354
  49. 49. Arita M, Kojima H, Nagano T, Okabe T, Wakita T, Shimizu H. Phosphatidylinositol 4-kinase III beta is a target of enviroxime-like compounds for antipoliovirus activity. J Virol. 2011;85(5):2364–72. pmid:21177810
  50. 50. Arita M, Bigay J. Poliovirus evolution toward independence from the phosphatidylinositol-4 Kinase III β/Oxysterol-binding protein family I pathway. ACS Infect Dis. 2019;5(6):962–73. pmid:30919621
  51. 51. Arita M. Phosphatidylinositol-4 kinase III beta and oxysterol-binding protein accumulate unesterified cholesterol on poliovirus-induced membrane structure. Microbiol Immunol. 2014;58(4):239–56. pmid:24527995
  52. 52. Rodriguez PL, Carrasco L. Gliotoxin: inhibitor of poliovirus RNA synthesis that blocks the viral RNA polymerase 3Dpol. J Virol. 1992;66(4):1971–6. pmid:1372367
  53. 53. Banerjee S, Aponte-Diaz D, Yeager C, Sharma SD, Ning G, Oh HS, et al. Hijacking of multiple phospholipid biosynthetic pathways and induction of membrane biogenesis by a picornaviral 3CD protein. PLoS Pathog. 2018;14(5):e1007086. pmid:29782554
  54. 54. Arita M. High-order epistasis and functional coupling of infection steps drive virus evolution toward independence from a host pathway. Microbiol Spectr. 2021;9(2):e0080021. pmid:34468191
  55. 55. Blair WS, Parsley TB, Bogerd HP, Towner JS, Semler BL, Cullen BR. Utilization of a mammalian cell-based RNA binding assay to characterize the RNA binding properties of picornavirus 3C proteinases. RNA. 1998;4(2):215–25. pmid:9570321
  56. 56. Amero CD, Arnold JJ, Moustafa IM, Cameron CE, Foster MP. Identification of the oriI-binding site of poliovirus 3C protein by nuclear magnetic resonance spectroscopy. J Virol. 2008;82(9):4363–70. pmid:18305026
  57. 57. Shengjuler D, Chan YM, Sun S, Moustafa IM, Li Z-L, Gohara DW, et al. The RNA-binding site of poliovirus 3C protein doubles as a phosphoinositide-binding domain. Structure. 2017;25(12):1875-1886.e7. pmid:29211985
  58. 58. Song Y, Liu Y, Ward CB, Mueller S, Futcher B, Skiena S, et al. Identification of two functionally redundant RNA elements in the coding sequence of poliovirus using computer-generated design. Proc Natl Acad Sci U S A. 2012;109(36):14301–7. pmid:22886087
  59. 59. Burrill CP, Westesson O, Schulte MB, Strings VR, Segal M, Andino R. Global RNA structure analysis of poliovirus identifies a conserved RNA structure involved in viral replication and infectivity. J Virol. 2013;87(21):11670–83. pmid:23966409
  60. 60. Spear A, Ogram SA, Morasco BJ, Smerage LE, Flanegan JB. Viral precursor protein P3 and its processed products perform discrete and essential functions in the poliovirus RNA replication complex. Virology. 2015;485:492–501. pmid:26303005
  61. 61. Hämmerle T, Molla A, Wimmer E. Mutational analysis of the proposed FG loop of poliovirus proteinase 3C identifies amino acids that are necessary for 3CD cleavage and might be determinants of a function distinct from proteolytic activity. J Virol. 1992;66(10):6028–34. pmid:1326654
  62. 62. Kobayashi J, Arita M, Sakai S, Kojima H, Senda M, Senda T, et al. Ligand recognition by the lipid transfer domain of human OSBP is important for enterovirus replication. ACS Infect Dis. 2022;8(6):1161–70. pmid:35613096
  63. 63. He N, Depta L, Rossetti C, Caramelle L, Cigler M, Bryce-Rogers HP, et al. Inhibition of OSBP blocks retrograde trafficking by inducing partial Golgi degradation. Nat Chem Biol. 2025;21(2):203–14. pmid:38907112
  64. 64. Ridgway ND, Dawson PA, Ho YK, Brown MS, Goldstein JL. Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding. J Cell Biol. 1992;116(2):307–19. pmid:1730758
  65. 65. Péresse T, Kovacs D, Subra M, Bigay J, Tsai M-C, Polidori J, et al. Molecular and cellular dissection of the oxysterol-binding protein cycle through a fluorescent inhibitor. J Biol Chem. 2020;295(13):4277–88. pmid:32075908
  66. 66. Roberts BL, Severance ZC, Bensen RC, Le AT, Kothapalli NR, Nuñez JI, et al. Transient compound treatment induces a multigenerational reduction of oxysterol-binding protein (OSBP) levels and prophylactic antiviral activity. ACS Chem Biol. 2019;14(2):276–87. pmid:30576108
  67. 67. Arita M. Essential domains of oxysterol-binding protein required for poliovirus replication. Viruses. 2022;14(12):2672. pmid:36560676
  68. 68. Strauss DM, Wuttke DS. Characterization of protein-protein interactions critical for poliovirus replication: analysis of 3AB and VPg binding to the RNA-dependent RNA polymerase. J Virol. 2007;81(12):6369–78. pmid:17409142
  69. 69. Lyle JM, Clewell A, Richmond K, Richards OC, Hope DA, Schultz SC, et al. Similar structural basis for membrane localization and protein priming by an RNA-dependent RNA polymerase. J Biol Chem. 2002;277(18):16324–31. pmid:11877407
  70. 70. Boerner JE, Lyle JM, Daijogo S, Semler BL, Schultz SC, Kirkegaard K, et al. Allosteric effects of ligands and mutations on poliovirus RNA-dependent RNA polymerase. J Virol. 2005;79(12):7803–11. pmid:15919933
  71. 71. Hobson SD, Rosenblum ES, Richards OC, Richmond K, Kirkegaard K, Schultz SC. Oligomeric structures of poliovirus polymerase are important for function. EMBO J. 2001;20(5):1153–63. pmid:11230138
  72. 72. Pathak HB, Ghosh SKB, Roberts AW, Sharma SD, Yoder JD, Arnold JJ, et al. Structure-function relationships of the RNA-dependent RNA polymerase from poliovirus (3Dpol). A surface of the primary oligomerization domain functions in capsid precursor processing and VPg uridylylation. J Biol Chem. 2002;277(35):31551–62. pmid:12077141
  73. 73. Das NK, Patel A, Abdelghani R, Koirala D. Structural basis for 3C and 3CD recruitment by enteroviral genomes during negative-strand RNA synthesis. Nat Commun. 2025;16(1):9293. pmid:41120315
  74. 74. Dorobantu CM, Albulescu L, Lyoo H, van Kampen M, De Francesco R, Lohmann V, et al. Mutations in Encephalomyocarditis Virus 3A Protein uncouple the dependency of genome replication on host factors phosphatidylinositol 4-Kinase IIIα and oxysterol-binding protein. mSphere. 2016;1(3):e00068-16. pmid:27303747
  75. 75. Albulescu L, Strating JRPM, Thibaut HJ, van der Linden L, Shair MD, Neyts J, et al. Broad-range inhibition of enterovirus replication by OSW-1, a natural compound targeting OSBP. Antiviral Res. 2015;117:110–4. pmid:25752737
  76. 76. Towner JS, Mazanet MM, Semler BL. Rescue of defective poliovirus RNA replication by 3AB-containing precursor polyproteins. J Virol. 1998;72(9):7191–200. pmid:9696813
  77. 77. Lowry K, Woodman A, Cook J, Evans DJ. Recombination in enteroviruses is a biphasic replicative process involving the generation of greater-than genome length “imprecise” intermediates. PLoS Pathog. 2014;10(6):e1004191. pmid:24945141
  78. 78. Muslin C, Joffret ML, Pelletier I, Blondel B, Delpeyroux F. Evolution and emergence of enteroviruses through intra- and inter-species recombination: plasticity and phenotypic impact of modular genetic exchanges in the 5’ untranslated region. PLoS Pathog. 2015;11(11):e1005266. pmid:26562151
  79. 79. Cao X, Kuhn RJ, Wimmer E. Replication of poliovirus RNA containing two VPg coding sequences leads to a specific deletion event. J Virol. 1993;67(9):5572–8. pmid:8394461
  80. 80. Cao X, Wimmer E. Genetic variation of the poliovirus genome with two VPg coding units. EMBO J. 1996;15(1):23–33. pmid:8598203
  81. 81. Koonin EV, Dolja VV, Krupovic M. The logic of virus evolution. Cell Host Microbe. 2022;30(7):917–29. pmid:35834963
  82. 82. Ferrer-Orta C, Ferrero DS, Verdaguer N. Dual role of the foot-and-mouth disease virus 3B1 protein in the replication complex: as protein primer and as an essential component to recruit 3Dpol to membranes. PLoS Pathog. 2023;19(5):e1011373. pmid:37126532
  83. 83. Simon-Loriere E, Holmes EC. Gene duplication is infrequent in the recent evolutionary history of RNA viruses. Mol Biol Evol. 2013;30(6):1263–9. pmid:23486612
  84. 84. Molla A, Harris KS, Paul AV, Shin SH, Mugavero J, Wimmer E. Stimulation of poliovirus proteinase 3Cpro-related proteolysis by the genome-linked protein VPg and its precursor 3AB. J Biol Chem. 1994;269(43):27015–20. pmid:7929442
  85. 85. Pathak HB, Oh HS, Goodfellow IG, Arnold JJ, Cameron CE. Picornavirus genome replication: roles of precursor proteins and rate-limiting steps in oriI-dependent VPg uridylylation. J Biol Chem. 2008;283(45):30677–88. pmid:18779320
  86. 86. Oh HS, Pathak HB, Goodfellow IG, Arnold JJ, Cameron CE. Insight into poliovirus genome replication and encapsidation obtained from studies of 3B-3C cleavage site mutants. J Virol. 2009;83(18):9370–87. pmid:19587035
  87. 87. Liu Y, Franco D, Paul AV, Wimmer E. Tyrosine 3 of poliovirus terminal peptide VPg(3B) has an essential function in RNA replication in the context of its precursor protein, 3AB. J Virol. 2007;81(11):5669–84. pmid:17360746
  88. 88. Herod MR, Ferrer-Orta C, Loundras E-A, Ward JC, Verdaguer N, Rowlands DJ, et al. Both cis and trans activities of foot-and-mouth disease virus 3D polymerase are essential for viral RNA replication. J Virol. 2016;90(15):6864–83. pmid:27194768
  89. 89. Hope DA, Diamond SE, Kirkegaard K. Genetic dissection of interaction between poliovirus 3D polymerase and viral protein 3AB. J Virol. 1997;71(12):9490–8. pmid:9371611
  90. 90. Xiang W, Cuconati A, Hope D, Kirkegaard K, Wimmer E. Complete protein linkage map of poliovirus P3 proteins: interaction of polymerase 3Dpol with VPg and with genetic variants of 3AB. J Virol. 1998;72(8):6732–41. pmid:9658121
  91. 91. Tellez AB, Crowder S, Spagnolo JF, Thompson AA, Peersen OB, Brutlag DL, et al. Nucleotide channel of RNA-dependent RNA polymerase used for intermolecular uridylylation of protein primer. J Mol Biol. 2006;357(2):665–75. pmid:16427083
  92. 92. Gruez A, Selisko B, Roberts M, Bricogne G, Bussetta C, Jabafi I, et al. The crystal structure of coxsackievirus B3 RNA-dependent RNA polymerase in complex with its protein primer VPg confirms the existence of a second VPg binding site on Picornaviridae polymerases. J Virol. 2008;82(19):9577–90. pmid:18632861
  93. 93. Sun Y, Wang Y, Shan C, Chen C, Xu P, Song M, et al. Enterovirus 71 VPg uridylation uses a two-molecular mechanism of 3D polymerase. J Virol. 2012;86(24):13662–71. pmid:23055549
  94. 94. Paul AV, Peters J, Mugavero J, Yin J, van Boom JH, Wimmer E. Biochemical and genetic studies of the VPg uridylylation reaction catalyzed by the RNA polymerase of poliovirus. J Virol. 2003;77(2):891–904. pmid:12502805
  95. 95. Arita M, Nagata N, Sata T, Miyamura T, Shimizu H. Quantitative analysis of poliomyelitis-like paralysis in mice induced by a poliovirus replicon. J Gen Virol. 2006;87(Pt 11):3317–27. pmid:17030866
  96. 96. Arita M, Wakita T, Shimizu H. Valosin-containing protein (VCP/p97) is required for poliovirus replication and is involved in cellular protein secretion pathway in poliovirus infection. J Virol. 2012;86(10):5541–53. pmid:22379090
  97. 97. Herold J, Andino R. Poliovirus requires a precise 5’ end for efficient positive-strand RNA synthesis. J Virol. 2000;74(14):6394–400. pmid:10864650
  98. 98. Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024;630(8016):493–500. pmid:38718835
  99. 99. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, et al. UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem. 2004;25(13):1605–12. pmid:15264254
  100. 100. Watkins CL, Kempf BJ, Beaucourt S, Barton DJ, Peersen OB. Picornaviral polymerase domain exchanges reveal a modular basis for distinct biochemical activities of viral RNA-dependent RNA polymerases. J Biol Chem. 2020;295(31):10624–37. pmid:32493771