This is an uncorrected proof.
Figures
Abstract
Epstein-Barr virus (EBV), an oncogenic virus, actively remodels the intracellular environment during its lytic (replicative/productive) phase to facilitate genome replication, virion packaging, and egress while attempting to evade immune responses. A key aspect of this remodeling is the downregulation of host gene expression, a phenomenon known as host shutoff. This process is prominently mediated by the EBV-encoded nuclease BGLF5, but BGLF5-independent mechanisms also contribute – most notably, the viral lytic switch protein ZEBRA, which can suppress host protein synthesis. Despite this broad suppression, the expression of certain host genes essential for lytic progression must be preserved or even enhanced. To investigate how such genes evade host shutoff, we analyzed the expression of a set of cellular transcripts in Burkitt lymphoma cells, sorted 24 hours after exposure to lytic triggers, into lytic and refractory (non-lytic) populations. We identified a subset of host transcripts consistently upregulated in lytic cells across Burkitt lymphoma lines reactivated by functionally distinct lytic stimuli, indicating that such upregulation is independent of pleiotropic lytic cycle inducing stimuli. Importantly, we found that while ZEBRA suppresses protein expression of some of these host (and select viral) genes, it also transcriptionally upregulates two related host genes, ELAVL4 and PABPC4L. Both encode RNA-binding proteins, and we found that they differentially modulate viral transcript abundance – enhancing some while repressing others – ultimately supporting the transcriptional demands, efficient genome replication and virion release during the EBV lytic cycle. These findings highlight the virus’s finely tuned regulation of both host and viral gene expression to ensure successful completion of the lytic cycle. Specifically, they suggest that EBV selectively upregulates critical host genes to counteract/escape host shutoff and promote virus propagation.
Author summary
During its lytic phase, Epstein-Barr virus (EBV) reprograms the host cell environment to support viral replication, packaging, and egress while evading immune responses. A key strategy is virus-mediated host shutoff, largely driven by the EBV BGLF5-encoded nuclease and the lytic switch protein ZEBRA, both of which suppress host gene expression. To understand how certain host genes critical for the lytic phase escape shutoff, we analyzed cellular transcripts in Burkitt lymphoma cells sorted into lytic and non-lytic populations. We identified a subset of transcripts consistently and selectively upregulated in lytic cells, regardless of the lytic trigger or cell line. Importantly, while ZEBRA suppresses select host and viral proteins, it also transcriptionally activates host genes such as ELAVL4 and PABPC4L – these encode two RNA-binding proteins that we find regulate the abundance of lytic transcripts and proteins, promoting EBV genome replication and virion release. These findings reveal that EBV fine-tunes host and viral gene expression during the lytic cycle, using ZEBRA to selectively upregulate critical host gene transcription in lytic cells to offset host shutoff, ensuring completion of the lytic phase.
Citation: Daigle D, Creasy-Marrazzo A, Gradoville L, El-Guindy A, Mukherjee R, Das S, et al. (2026) Playing both sides – Epstein-Barr Virus accumulates select cellular transcripts to counter virus-mediated host shut-off in lytic cells. PLoS Pathog 22(5): e1014211. https://doi.org/10.1371/journal.ppat.1014211
Editor: Sankar Swaminathan, University of Utah, UNITED STATES OF AMERICA
Received: January 14, 2026; Accepted: April 28, 2026; Published: May 11, 2026
Copyright: © 2026 Daigle et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All data supporting the conclusions are presented in the manuscript. There are no large datasets associated with this work.
Funding: The authors were supported by the following grants: NIH grants CA16038 and CA12055 to G.M, NIH 5 T32 GM07223 and Anna Fuller Fellowship for Cancer Research to D.D, NIH U01 CA275310, R01 DE034654, R01 DE032623, and the Children’s Miracle Network to S.B.M and M.T.M., the USDA-APHIS contract 6000027242 to M.T.M. The authors received no specific funding for this work. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Epstein-Barr virus (EBV) establishes lifelong latent infection in the vast majority of the global adult population. Although largely asymptomatic during latency, EBV was implicated in approximately 300,000 cancer cases and nearly 200,000 cancer-related deaths in 2020 [1]. A critical aspect of EBV’s long-term persistence is its ability to periodically reactivate into the lytic cycle, facilitating viral transmission. Importantly, while tumors arise from latently infected cells, lytic reactivation plays an important role in oncogenesis. To avoid immune recognition during the lytic phase, EBV co-opts host cellular pathways and employs a range of mechanisms to subvert both innate and adaptive immune responses [2]. Central to this strategy is the virus’s induction of global suppression of host gene expression – known as “host shutoff” – which is initiated during the early stages of the lytic cycle. This shutoff not only facilitates efficient transcription and replication of the viral genome while minimizing inflammatory and immune detection, but also redirects cellular resources toward virus production.
In gammaherpesviruses such as EBV and Kaposi’s Sarcoma-associated Herpesvirus (KSHV), host shutoff is classically mediated by lytic gene products. Chief among these are the EBV BGLF5 protein and the KSHV SOX protein, which, in addition to their roles as DNA alkaline exonucleases, promote host shutoff by destabilizing cellular mRNAs [3]. However, BGLF5-independent mechanisms – distinct from RNA degradation – also contribute significantly to this process. Previously, we demonstrated that the EBV lytic switch protein ZEBRA can suppress host protein synthesis by inhibiting translation and causing relocalization of PABPC (Poly(A)-binding protein, cytoplasmic) into the nucleus [4]. More recently, using nascent transcriptomic analysis, we also showed that transcriptional downregulation of host genes occurs both upstream and downstream of ZEBRA expression during the EBV lytic phase [5]. Consistent with these findings, a subsequent study revealed impaired host gene transcription and RNA processing in the absence of BGLF5, further underscoring the existence of BGLF5-independent pathways of host shutoff [6]. However, the expression of select host genes must be preserved, or even upregulated, in order to sustain essential cellular functions that support viral gene expression, genome replication, and the assembly and release of progeny virions. To better understand this balance, we sought to identify host transcripts that are upregulated during the EBV lytic phase, potentially as a preemptive or compensatory response to virus-mediated host shutoff.
Detailed molecular studies of the EBV lytic cycle are made possible by the use of cultured cell lines harboring the virus in a latent state. Treatment of EBV-positive Burkitt lymphoma cell lines with a variety of stimuli, including, but not limited to, histone deacetylase inhibitors (HDACi), DNA methyl transferase inhibitors, protein kinase C agonists, or anti-IgG immunoglobulin promotes reactivation of the viral lytic cycle [7–11]. One complicating factor in interpreting data from such experiments is that only a fraction of the cellular population is triggered into the lytic cycle by these inducing stimuli. Depending on the cell line and the stimulus, 5% to 40% of cells express viral lytic genes. The virus remains latent in the remainder of the treated population that is refractory to viral reactivation [9,12–14]. Thus, studies attempting to correlate cellular gene expression with viral reactivation, or conversely, the effects of the viral lytic cycle on expression of cellular genes, must deal with a large background of cellular gene expression in the majority of cells not supporting reactivation. To overcome this issue, we frequently use the Burkitt lymphoma cell line HH514–16 in which EBV is tightly latent at baseline but can be readily triggered into the lytic phase by HDACi such as sodium butyrate (NaB) and trichostatin A (TSA), or by the DNA methyltransferase inhibitor azacytidine (AzaCdR) [8,15]. HH514–16 was cloned from the P3J-HR1K cell line that, in turn, was derived from the Jijoye Burkitt lymphoma cell line [16]. Following lytic cycle induction with different stimuli, we use a FACS-based technique to efficiently separate subpopulations of HH514–16 cells that are refractory or responsive to lytic induction [13,14,17,18]. Cell separation enables detection of changes in cellular gene expression that occur within each subpopulation relative to each other or to untreated cells. This technique also removes much of the background cellular gene expression that each population contributes to the other when a mixture of unsorted cells is studied.
To understand how the host contributes to a successful lytic phase despite virus-mediated host shutoff, we used sorted HH514–16 cells to identify a set of cellular transcripts that were upregulated selectively in lytic cells following exposure to functionally diverse lytic stimuli. Of these, transcripts encoding two RNA-binding proteins, ELAVL4/HuD and PABPC4L, were also upregulated in lytically activated Akata Burkitt lymphoma cells. Both ELAVL4 and PABPC4L were transcriptionally activated by introduction of ZEBRA, though only in EBV-infected cells, to counter ZEBRA-mediated shutoff of ELAVL4 and PABPC4L proteins. Of note, we found that ZEBRA also selectively shut off viral proteins such as EA-D (BMRF1 gene product), thereby tightly regulating the lytic cycle. Importantly, upregulation of ELAVL4 and PABPC4L mRNA abundance offset ZEBRA-mediated shutoff of ELAVL4 and PABPC4L protein expression. We show that this process of modulating the abundance of select cellular transcripts in lytic cells is required to effectively support EBV genome replication and virion release.
Results
Distinct cellular gene expression patterns characterize refractory and lytic subpopulations
We previously reported that expression of several cellular genes, e.g., STAT3, FOS, and genes that encode components of the constitutive heterochromatin machinery including three members of the KRAB-ZFP family (SZF1/ZNF589, ZNF557, ZNF253) and the histone methyl transferase SETDB1, is up-regulated only in HH514–16 cells that are refractory to NaB-mediated lytic induction of EBV [14,17]. We also showed that the viral host cell shutoff mechanism, which is expected to function in the lytic, but not in the refractory subpopulation, does not prohibit increases in expression of all cellular genes; for example, IL6 transcript levels were increased preferentially in the lytic cell population as were transcripts of the inflammasome intermediary protein TXNIP [14,19]. To extend these observations, we sorted HH514–16 cells into refractory and lytic subpopulations 24 hours after treatment with NaB (as shown in S1 Fig) and compared cellular gene expression in each subpopulation with cells that had not been treated with NaB. We first examined the abundance of transcripts of a subset of cellular genes that we previously found were upregulated in the total cell population after treatment with the HDAC inhibitors NaB or TSA [14]. Following exposure to NaB, we observed increased levels of MAD1 and JUN transcripts in sorted refractory relative to untreated or sorted lytic cells (Fig 1A), adding to the set of cellular transcripts we had previously found upregulated in refractory cells [14,17]. Thus, although microarray analyses of total HH514–16 cell populations treated with NaB and TSA identified increases and decreases in expression of a large number of cellular genes [14], increases in transcript abundance of some of these genes occurred selectively in the subpopulation of cells that was refractory to lytic viral activation.
HH514-16 cells were untreated (control) or treated with NaB for 48 hours. The cells treated with NaB were sorted into lytic and refractory subpopulations. Control cells were mock sorted. Total RNA was isolated from each population. Levels of mRNA were measured by RT-qPCR using gene-specific primers. (A). Data are shown for MAD1 and JUN, genes that were preferentially expressed in the refractory population. (B). Levels of mRNA are shown for BZLF1, IL6R, PABPC4L, ELAVL4, RAB27B, RASA3, CAMK2B, and CAMTA1, genes that were selectively expressed in the lytic population. Error bars represent SD from three technical replicates.
As a preliminary guide to search for genes whose transcripts were preferentially upregulated in lytic cells, we examined microarrays that profiled gene expression in sorted cells [17]. Examples of a subset of genes whose expression was increased in the lytic population based on the microarray [17] are listed in Table 1. These genes were selected for validation and further study because of their potential biological properties. For example, cellular genes induced in the lytic sub-population included the IL6 cytokine that might have anti-apoptotic function in B cells, PABPC4L and ELAVL3 and ELAVL4, genes that might affect mRNA biogenesis or stability, and several genes that might specifically alter cell signal transduction. Examination of transcript abundance showed that as expected, BZLF1 transcripts were ~10 fold more abundant in NaB-exposed/sorted lytic compared to refractory and untreated control HH514–16 cells (Fig 1B). Also, as expected, the shut-off protein BGLF5 was observed almost exclusively in sorted lytic cells compared to sorted refractory and untreated cells (S2 Fig). As for cellular transcripts, we found that like IL6, whose upregulation we previously validated in sorted lytic cells [14], the remaining candidate genes from Table 1 all exhibited increased expression in lytic relative to untreated or refractory cells (Fig 2). Notably, based on the relative abundance of transcripts in lytic cells 24 hours after treatment with NaB, these genes fell into two groups: transcripts of PABPC4L, ELAVL4 and RAB27B, were markedly increased at 30–80-fold, whereas the expression of the other four genes increased 4- to 5-fold in the lytic population. Thus, several cellular transcripts demonstrated selective upregulation in lytic cells.
HH514-16 cells were untreated or treated with the DNA methyltransferase inhibitor 5-aza-2’-deoxycytidine (AzaCdR) for 48 hours. The cells were sorted into lytic and refractory subpopulations as described in S1 Fig and total RNA extracted. Transcripts were quantified by RT-qPCR relative to untreated control using gene-specific primers. Data is shown for BZLF1, IL6, IL6R, PABPC4L, ELAVL3, ELAVL4, RAB27B, and RASA3. Error bars represent SD from three technical replicates.
Upregulation of cellular transcripts in the lytic subpopulation of HH514–16 cells is also observed after exposure to a mechanistically distinct lytic stimulus
One drawback of using HDAC inhibitors to induce the EBV lytic cycle is that these agents mediate extensive changes in cellular gene expression [5,14,20–23]. Therefore, we needed to consider that the observed increases in cellular transcripts in lytic cells did not correlate with viral activation but were at least partially due to direct effects of HDAC inhibition on cellular gene expression. An advantage of using HH514–16 cells for studying EBV reactivation is that two different classes of stimuli with distinct mechanisms of action induce the viral lytic cycle. Treatment of this cell line with AzaCdR, a DNA methyltransferase inhibitor, also activates the EBV lytic cycle. By comparison to HDAC inhibitors, AzaCdR promotes only slight changes in cellular gene expression [23]. To determine if the cellular transcripts observed to accumulate in lytic cells after NaB treatment were also upregulated in AzaCdR-induced lytic cells, HH514–16 cells were untreated or treated with AzaCdR for 48h and sorted into refractory and lytic subpopulations. RT-qPCR analysis showed that BZLF1 transcripts were markedly upregulated in lytic cells by comparison to refractory cells, indicating that the two subpopulations were separated efficiently (Fig 2). Six genes whose expression was increased in the lytic subpopulation of HH514–16 cells treated with NaB were also found to be upregulated in lytic cells following treatment with AzaCdR; these included IL6, PABPC4L, ELAVL3, ELAVL4, RAB27B and RASA3. Furthermore, as in NaB-induced sorted lytic cells (Fig 1B), PABPC4L, ELAVL4 and RAB27B transcripts demonstrated the highest fold elevation in lytic compared to refractory cells (Fig 2). As for IL6R, although transcripts were increased as in NaB-induced lytic cells (Fig 1B), they were also elevated in the refractory subpopulation relative to untreated cells (Fig 2). These results demonstrate that upregulation of a subset of cellular genes in HH514–16 cells is tightly correlated with activation of EBV lytic gene expression, and is observed with two lytic cycle inducing stimuli with different modes of action.
Valproic acid inhibits expression of cellular genes characteristic of lytic HH514–16 cells
We previously reported that in HH514–16 cells, the HDAC inhibitor valproic acid (VPA) antagonizes the lytic cycle-inducing activity of other stimuli, including other HDAC inhibitors and AzaCdR [23]. However, in this cell line VPA activates and suppresses expression of many cellular genes in a manner generally similar to other HDACi, such as NaB and TSA [24]. These findings offered the opportunity to further clarify the correlation of our candidate cellular genes with EBV lytic cycle activation. HH514–16 cells were untreated (control) or treated with NaB, VPA, or NaB combined with VPA for 24 hours and total RNA extracted. As expected, treatment with NaB activated BZLF1 and BGLF5 expression; however, as we had previously shown, treatment with VPA failed to activate expression of these EBV lytic genes, and combining VPA with NaB completely inhibited expression of BZLF1 and BGLF5 (Fig 3). We investigated the expression of five cellular genes, IL6, IL6R, PABPC4L ELAVL3, and, ELAVL4, which were induced in lytic HH514–16 cells after NaB or AzaCdR treatment. Expression of all five cellular genes was increased following treatment with NaB, while no significant increases were observed following VPA treatment (Fig 3). The combination of VPA with NaB completely inhibited the increases in expression of all five cellular genes that were observed following NaB treatment alone. In contrast, we had previously observed that treatment of HH514–16 cells with VPA or VPA plus NaB increased expression of cellular genes, such as STAT3, FOS, FRMD6, SEPP1 and MAD1 in cells refractory to lytic activation by NaB [23]. These results are consistent with the conclusion that expression of one subset of cellular genes is tightly associated with EBV lytic cycle activation whereas a different subset of cellular transcripts is upregulated in cells that fail to respond to lytic cycle inducing stimuli.
HH514-16 cells were untreated or treated with NaB, VPA, or NaB and VPA, harvested after 24 hours, and total RNA extracted. Levels of mRNA were measured by RT-qPCR relative to untreated control using gene-specific primers. Data is shown for BZLF1, BGLF5, IL6, IL6R, ELAVL3, ELAVL4, and PABPC4L, genes whose expression is upregulated in lytic cells. Data are representative of two biological replicates; error bars represent SD from three technical replicates.
Expression of cellular genes characteristic of lytic cells is induced in EBV(+), but not in EBV(-) Akata cells treated with anti-IgG
The foregoing results demonstrated a strong association between expression of several cellular genes and the EBV lytic cycle that was independent of the inducing stimulus. To assess generalizability beyond the HH514–16 cell line, we evaluated the expression of a subset of these genes, i.e., three RNA biogenesis-related cellular genes that mark lytic cells, in a different cellular background. The EBV-positive (+) Akata cell line derived from a Burkitt lymphoma can be activated into the lytic cycle by cross-linking the B-cell antigen receptor with anti-IgG. For comparison we also measured cellular gene expression in a derivative EBV-negative (-) Akata cell line from which the EBV genome has been lost. EBV(+) and EBV(-) Akata cells were untreated or treated with anti-IgG, harvested after 24 hours, and total RNA extracted. Expression of viral and cellular genes was analyzed by RT-qPCR relative to untreated controls. As expected, expression of the EBV early lytic transcripts BZLF1 and BGLF5 was observed in EBV(+), but not EBV(-), Akata cells following anti-IgG treatment (Fig 4A). Of the three genes tested, increased levels of transcripts of the cellular genes ELAVL4 and PABPC4L were detected in EBV(+) Akata cells after treatment with anti-IgG. Under the same conditions there was no increase in expression of these genes in EBV(-) Akata cells (Fig 4A). A slight increase in ELAVL3 transcripts was also observed in EBV(+) Akata cells, but was not as robust as the increases in ELAVL4 and PABPC4L transcripts. Of note, EBV(-) Akata cells did respond to anti-IgG treatment; transcripts of two cellular immediate-early genes, FOS and EGR1 [23], were elevated in response to anti-IgG treatment in both EBV(+) and EBV(-) Akata cells relative to untreated controls (Fig 4B). These results reinforce the conclusion that increased expression of some cellular genes is specifically associated with EBV lytic cycle induction.
EBV(+) Akata or EBV(-) Akata cells were untreated or treated with anti-IgG, harvested after 24 hours, and total RNA extracted. Transcripts were quantified by RT-qPCR relative to untreated controls and data are shown for (A) BZLF1, BGLF5, PABPC4L, ELAVL4, and ELAVL3 (genes whose expression is upregulated in lytic HH514-16 cells; Figs 1 and 2) and (B) FOS and EGR1, cellular immediate-early genes. Data are representative of two biological replicates; error bars represent SD from three technical replicates.
Expression of the cellular genes ELAVL4 and PABPC4L in lytic HH514–16 cells is kinetically downstream of EBV early lytic gene expression
The foregoing experiments identified a subset of cellular genes whose expression was preferentially stimulated within those HH514–16 or Akata cells in which the EBV lytic cycle was induced. Since these observations were made at a single time point, 24–48 hours after cells were treated with inducing stimuli, we could not establish from these experiments whether the changes in expression of the cellular genes were upstream or downstream of viral lytic activation. To determine when the increases in cellular gene expression occurred relative to increases in viral lytic gene expression, total RNA was extracted from HH514–16 cells that were untreated or treated with TSA or AzaCdR and harvested at 8, 12, 18, 24, or 48 hours. Levels of RNA for BZLF1, BGLF5, and two marker cellular genes, ELAVL4 and PABPC4L, whose expression was robustly stimulated in lytic cells after NaB and AzaCdR treatment (Figs 1B and 2), were measured by RT-qPCR at each time (Table 2). Previous experiments have shown that BZLF1 transcripts can be detected by 8h following treatment with NaB or AzaCdR [8,25]. In this experiment a low-level induction of BZLF1 and BGLF5 mRNA was observed by 8 hours following treatment with either TSA or AzaCdR; robust activation of the viral lytic mRNAs was observed at 12 hours. Increases in expression of BZLF1 reached a maximum level of approximately 35-fold the background of untreated cells at 18 hours after treatment with TSA, and about 22-fold at 24 hours after exposure to AzaCdR. By contrast to the lytic viral mRNAs, no increases in ELAVL4 and PABPC4L transcript levels above background were detected at 8 hours after exposure to either lytic cycle inducing agent. At 12 hours, ELAVL4 expression was elevated 5.8-fold in cells treated with TSA, but PABPC4L was at background levels; at this time neither cellular gene was expressed above background levels in cells exposed to AzaCdR. The maximum levels of expression of these two cellular genes was delayed to 24 or 48 hours after addition of the inducing stimulus.
Since steady state RNA levels do not distinguish between altered transcription rates and RNA stability, we examined a previously published nascent transcriptomic dataset [5] for evidence of transcriptional upregulation of ELAVL4 and PABPC4L. In those experiments, we mapped nascent transcripts by exposing HH514–16 cells to NaB for 3 hours (temporally upstream of BZLF1 expression) as well as 24 and 48 hours (temporally downstream of BZLF1 expression) and subjected them to Bru-Seq analysis. In Bru-Seq, RNA is tagged during synthesis with a 30-minute pulse of bromouridine (BrU) prior to harvest, followed by immuno-separation of tagged nascent RNA from total RNA using anti-BrdU antibodies, and sequencing of fragmented cDNA strands from reverse-transcribed purified nascent transcripts. For additional details, please see Frey et al. [5]. Normalized reads of nascent transcripts shown in Table 3 indicate that there was no transcription of ELAVL4 or PABPC4L at baseline or after 3 hours of exposure to NaB. However, consistent with our observations on steady state transcripts in Table 2, we noted transcriptional upregulation of both genes in both experimental replicates by 24 hours (~60–185 for ELAVL4 and 45–65 for PABPC4L) with no further increase at 48 hours. These results demonstrate that transcriptional upregulation of these two cellular genes that are induced specifically in HH514–16 cells in which the EBV lytic cycle has been activated, are kinetically downstream of the expression of EBV early lytic genes.
In assessing the relationship to viral genome replication that is temporally downstream of early gene expression, we found that ELAVL4 and PABPC4L transcripts rose in lytically induced HH514–16 cells even when viral genome replication was blocked by phosphonoacetic acid (PAA) (S3A and S3C Fig). In a lymphoblastoid cell line (LCL), lytic cycle induction also resulted in upregulation of both transcripts but PAA prevented the rise of PABPC4L transcripts (S3A and S3C Fig). Importantly, the HuD protein, encoded by ELAVL4, increased in both cell types regardless of PAA (S3B Fig). As expected, lytic cycle triggers induced the expression of BZLF1 transcripts (S3D Fig) while PAA suppressed viral genome replication (S3E Fig). Thus, ELAVL4/HuD and PABPC4L are induced downstream of early EBV genes but upstream of viral genome replication, with PABPC4L in LCL partially dependent on genome replication.
The EBV lytic switch gene BZLF1 activates expression of ELAVL4 and PABPC4L transcripts selectively in EBV-infected cells
Experiments described in Figs 1–4 demonstrated a correlation between expression of ELAVL4 and PABPC4L and EBV lytic cycle activation by a diverse array of lytic stimuli. The experiments in Tables 2 and 3, showing that expression of ELAVL4 and PABPC4L was delayed relative to expression of BZLF1 and BGLF5, EBV early lytic cycle genes, suggested that one or more EBV lytic products could be responsible for activating expression of these cellular genes. It was therefore essential to learn whether transcripts encoding the RNA binding proteins could be induced in the absence of pleiotropic stimuli such as HDAC inhibitors, AzaCdR, or anti-IgG. Accordingly, HH514–16 cells were transfected with a plasmid expressing ZEBRA. Cells that were mock electroporated or transfected with empty vector served as controls. In the same experiment, other batches of cells were untreated or treated with TSA which was known to activate these genes (Table 2). Cells were harvested at 24 hours and analyzed for expression of PABPC4L or ELAVL4 mRNAs (Fig 5A and 5B) or ZEBRA protein (Fig 5C). Transfection of BZLF1 strongly activated PABPC4L mRNA (102-fold) and ELAVL4 mRNA (49-fold). Consistent with the data in Table 2, TSA strongly activated both genes at 24 hours. The immunoblot (Fig 5C) confirmed expression of ZEBRA following electroporation or treatment with TSA.
HH514-16 cells were untreated or treated with TSA. Other aliquots were mock transfected by electroporation or transfected with CMV vector or CMV gZ, encoding BZLF1. RNA harvested after 24 hours was analyzed for expression of PABPC4L (A) or ELAVL4 (B) by RT-qPCR. Parallel samples from the same experiment were analyzed by immunoblotting for expression of ZEBRA protein and β-actin (C). Error bars, SD from three technical triplicates.
To address if ZEBRA also induced the expression of ELAVL4 and PABPC4L in EBV-uninfected cells, we introduced BZLF1 into HH514–16 cells and compared the response in the EBV-negative B lymphoma cell line BJAB. As shown in S4 Fig, although BZLF1 transcripts were abundantly expressed in both cell lines, ELAVL4 and PABPC4L transcripts were upregulated in HH514–16 cells but not in BJAB cells. This result was consistent with the observation that ELAVL4 and PABPC4L transcripts were upregulated in EBV(+) but not EBV(-) Akata cells crosslinked by anti-IgG (Fig 4A). These experiments demonstrated that EBV lytic activation caused by overexpression of the ZEBRA protein was sufficient to induce PABPC4L and ELAVL4 expression in EBV-infected cells; no exogenous chemical or biologic stimulus was required to activate transcription of these two genes that encode RNA binding proteins.
ZEBRA and BGLF5 protein turn down the expression of cellular proteins including IL6 and the RNA-binding proteins ELAVL4 and PABPC4L
In earlier work, we had shown that ZEBRA and the BGLF5 proteins contribute to host shutoff by inhibiting protein translation [4]. However, the cellular targets of such protein synthesis shut off remain unknown. Since certain cellular transcripts were upregulated in lytic cells (Table 1, Figs 1–4), we asked if such selective increases were intended to ramp up the abundance of transcripts expressed at low levels or to counter host shutoff. To address this question, we introduced the BZLF1, BRLF1 (encoding the other EBV lytic switch protein RTA), or ELAVL4 plasmid alone or in different combinations into HH514–16 cells (Fig 6). Analysis of cell lysates 24 hours later showed that the BGLF5 protein was expressed, providing evidence of lytic cycle activation by BZLF1 and BRLF1 but not by the empty vector control (CMV/RTS; Fig 6A). As expected, introduction of ELAVL4 resulted in expression of ELAVL4 RNA and protein (Fig 6A and 6C). However, co-expression of BZLF1 inhibited the expression of ELAVL4 protein by ~85% (Fig 6A, lane 6 versus 4) despite ~2-fold (or ~100%) increase in the expression of ELAVL4 transcripts when BZLF1 plus ELAVL4 were transfected compared to when ELAVL4 was transfected alone (Fig 6C). By comparison, BRLF1 did not blunt the expression of ELAVL4 protein. This result supported the idea that ZEBRA suppresses endogenous ELAVL4 protein expression – as indicated by BZLF1-mediated suppression of the endogenous ELAVL4 protein in lane 2 of Fig 6A despite a nearly 10-fold induction of the endogenous ELAVL4 transcripts by BZLF1 in Fig 6B. That said, it was difficult to distinguish whether BGLF5 protein also contributed to the suppression of ELAVL4 protein since, as expected, BGLF5 protein was expressed in cells induced into the lytic phase by BZLF1 introduction. We therefore performed a similar experiment in 293 cells wherein introduction of BZLF1 would not induce the expression of BGLF5 protein.
HH514-16 (A-C) and 293 (D-F) cells were transfected with empty vectors CMV/RTS or CMV alongside vectors expressing BZLF1 (Z), BRLF1 (R), BGLF5 (G5), ELAVL4, or combinations as indicated. Lysates were harvested after 24 hours and subjected to immunoblotting using indicated antibodies (A, D) or RT-qPCR analyses measuring endogenous (B, E) and ectopic ELAVL4 transcripts (C, F). Data are representative of two biological replicates; error bars represent SD from three technical replicates.
For the experimental results depicted in Fig 6D–6F, 293 cells were transfected with empty vector (CMV), BZLF1, ELAVL4, BGLF5, or indicated combinations of plasmids. As expected, introduction of BZLF1 resulted in expression of ZEBRA but not BGLF5 protein after 24 hours (Fig 6D). Also, as expected, BZLF1 did not induce ELAVL4 transcripts or protein (Fig 6D and 6E) – consistent with ZEBRA’s inability to induce ELAVL4 transcription in EBV(-) Akata cells or BJAB cells (Figs 4A and S4). BGLF5 also did not induce ELAVL4 transcripts or protein (Fig 6D and 6F). Importantly, however, although the presence of BZLF1 reduced the expression of the ELAVL4 plasmid by <50% (possibly due to the presence of more than one plasmid), the abundance of ELAVL4 protein was reduced by 81% (Fig 6F, Fig 6D lanes 3 versus 4). In comparison, co-transfection of BGLF5 resulted in ~20% reduction of ELAVL4 RNA but ~67% drop in the abundance of ELAVL4 protein (Fig 6F, Fig 6D lanes 3 versus 6). Lastly, the effect of adding both BZLF1 and BGLF5 plasmids to ELAVL4 plasmid was additive as ELAVL4 protein was reduced by >91% while its RNA abundance was reduced by ~50% (Fig 6F, Fig 6D lanes 3 versus 7). Thus, both ZEBRA and BGLF5 protein contributed to ELAVL4 protein shut off.
Mirroring the experimental set up in Fig 6, the experiments in Fig 7 examined the effects of BZLF1, BRLF1, and BGLF5 on the transcription and protein expression of IL6 whose transcripts we found were upregulated in lytic cells (Table 1, Figs 2 and 3). As shown in Fig 7A, BZLF1 and BRLF1 plasmids induced the expression of BGLF5 protein in HH514–16 cells. Like ELAVL4, endogenous IL6 protein was not observed after lytic activation by BZLF1, BRLF1, or both plasmids despite 15–20-fold induction of endogenous IL6 transcripts by BZLF1 and BZLF1 + BRLF1 (Fig 7A and 7B). Furthermore, while BZLF1 suppressed IL6 transcripts by 60% when co-transfected with IL6 plasmid compared to when IL6 plasmid was transfected alone, the suppressive effect of BZLF1 on the expression of ectopic IL6 protein was more dramatic, i.e., 95% (Fig 7A and 7C). Again, BRLF1 did not influence the expression of IL6. We note that transfection of BZLF1 and BRLF1 plasmids resulted in abundant expression of ZEBRA and RTA. Moreover, even though ZEBRA caused near total suppression of ELAVL4 and IL6 (Figs 6A and 7A), ELAVL4 and IL6 only modestly suppressed ZEBRA and RTA (S5 Fig).
HH514-16 (A-C) or 293 (D-F) cells were transfected with empty vectors CMV/RTS, CMV, or pcDNA alongside vectors expressing BZLF1 (Z), BRLF1 (R), BGLF5, IL6, or combinations as indicated. Lysates were harvested after 24 hours and subjected to immunoblotting using indicated antibodies (A, D) or RT-qPCR analyses measuring endogenous (B, E) and ectopic IL6 transcripts (C, F). Data are representative of two biological replicates; error bars represent SD from three technical replicates.
In 293 cells, BZLF1 transfection resulted in expression of ZEBRA but not BGLF5 protein, endogenous IL6 protein, or IL6 RNA (Fig 7D and 7E). Like ZEBRA, ectopic expression of BGLF5 did not induce endogenous IL6 protein (Fig 7D). As for ectopic expression of IL6 by an IL6 plasmid, while BZLF1, BGLF5, and BZLF1 + BGLF5 suppressed IL6 transcripts by ~50%, ~ 15%, and ~40%, respectively, the suppressive effects on IL6 protein were more dramatic at 80%, 89%, and 94%, respectively (Fig 7D and 7F). These observations again point towards suppression of IL6 protein by ZEBRA and BGLF5 protein.
Fig 8 summarizes aggregate results of the effects of ectopically expressed ZEBRA on the expression of ELAVL4, PABPC4L, and IL6 proteins following introduction of their respective plasmids in HH514–16 (Fig 8A) and 293 (Fig 8B) cells. We found that ZEBRA-induced lytic activation resulted in 80–90% suppression of the cellular proteins ELAVL4, PABPC4L, and IL6 when expressed from plasmids in HH514–16 cells (Fig 8A); in comparison, ZEBRA’s effects on the same proteins were less prominent in 293 cells (Fig 8B).
Twenty-four hours after transfection of plasmids encoding each of the three proteins ELAVL4, PABPC4L, or IL6 alone (-Z) or in combination with a BZLF1 plasmid (+Z), lysates from HH514-16 cells (A) and 293 cells (B) were subjected to immunoblotting with antibodies targeting the cellular proteins. The graph represents aggregate data from 3 to 6 biological replicates; error bars represent SEM; NS, not significant; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.
Serine 186 is a critical residue in ZEBRA that enables transcriptional activation of EBV early lytic genes; mutation at this site impairs viral genome replication and blocks progression of the lytic cycle [26–30]. Given the importance of this serine residue also in nuclear translocation of PABPC and ZEBRA-mediation translational shut off of proteins [4], we tested its contribution to ELAVL4 and PABPC4L protein shut off. Fig 9 shows that co-expression of wild-type ZEBRA suppressed the expression of ectopic ELAVL4 and PABPC4L in HH514–16 cells. However, although expressed well (Fig 9B), the S186A ZEBRA mutant was less effective at dampening the expression of ELAVL4 and PABPC4L proteins (Fig 9A). These results, demonstrating the importance of the S186 residue in suppressing protein levels of ELAVL4 and PABPC4L, are consistent with our prior observation that the S186 residue is important in shutting off protein expression [4]. A noteworthy observation in the collective context of these experiments, was that introduction of BZLF1 increased the expression of both endogenous and ectopic ELAVL4 and IL6 transcripts in HH514–16 cells in which BGLF5 protein was well expressed. This result suggests that ELAV4 and IL6 RNA may be resistant to the BGLF5 nuclease activity, i.e., the canonical mode of host shut off (Figs 6A–6C and 7A–7C).
(A) HH514-16 cells were transfected with plasmids encoding ELAVL4 or PABPC4L alone (-Z), or in combination with wild-type BZLF1 (+Z) or S186A mutant BZLF1 plasmid. Lysates were subjected to immunoblotting 24 hours later; graph shows aggregate data from two biological replicates. (B) Immunoblot of 24-hour lysates depicting the abundance of ZEBRA in the two biologic replicates.
ZEBRA uses protein shut off to tightly regulate the abundance of select viral proteins
To address if ZEBRA’s ability to shut off expression of cellular proteins also extended to viral proteins, we selected two key lytic phase proteins encoded by BMRF1 and BALF2. BMRF1 encodes EA-D, the DNA polymerase processivity factor, and BALF2 encodes the single-stranded DNA binding protein. Both proteins are critical for replication of the viral genome during the lytic phase. In addition, EA-D ensures a smooth transition from expression of early lytic genes to replication of the episomal genome early during the lytic phase [31]. In an experiment that was similar in design to those in Figs 6 and 7, introduction of BZLF1 into HH514–16 cells for 24 hours resulted in expression of ZEBRA, endogenous BGLF5 protein, and endogenous EA-D (Fig 10A). This result was expected as BGLF5 and BMRF1 are transcriptional targets of ZEBRA. Introduction of FLAG-tagged BALF2 and BMRF1 resulted in the expression of tagged proteins. When BZLF1 and BALF2 were co-transfected, there was no effect on the abundance of ectopically expressed BALF2 protein (lanes 3 versus 6); as expected, endogenous BGLF5 protein was also expressed. However, when BZLF1 was introduced alongside ectopic BMRF1, the abundance of FLAG-EA-D was dramatically reduced, i.e., by 97% compared to BMRF1 transfection alone (lanes 4 versus 7); of note, the reduction in endogenous EA-D was only 29% and BGLF5 protein was abundantly expressed. To assess the contribution of ZEBRA versus BGLF5 protein to the suppression of ectopic EA-D, we again utilized 293 cells. As shown in Fig 10B, the presence of ZEBRA minimally affected the expression of ectopic BALF2 protein (lanes 3 versus 5). However, co-expression of ZEBRA resulted in 94% suppression of EA-D (lanes 4 versus 6), thereby implicating ZEBRA in selective shut off of viral proteins to maintain “optimal” levels of such proteins during the lytic phase.
HH514-16 (A, C) and 293 (B, D) cells were transfected with an empty vector (CMV), BZLF1 plasmid (Z), BMRF1 plasmid, BALF2 plasmid, or combinations as indicated. Lysates were harvested 24 hours later and subjected to immunoblotting using indicated antibodies. Ectopically expressed BALF2 and BMRF1 proteins were detected using anti-FLAG antibodies while ectopically expressed ZEBRA and endogenous BMRF1 and BGLF5 were detected using target-specific antibodies. Graphs representing aggregate data from 3 to 6 biological replicates are depicted in C and D; error bars represent SEM; NS, not significant; ****, p < 0.0001.
Collectively, our results indicate that the EBV lytic switch protein ZEBRA shuts off the expression of cellular proteins such as the RNA binding factors ELAVL4 and PABPC4L while simultaneously activating their transcription – effecting escape from host shut off. Beyond cellular proteins, ZEBRA also tightly regulates the abundance of key viral proteins during the lytic phase.
ELAVL4 and PABPC4L, upregulated in lytic cells by ZEBRA, regulate EBV lytic transcript abundance, viral genome replication, and virus release
The paradoxical regulation by ZEBRA – upregulating ELAVL4 and PABPC4L transcription while simultaneously suppressing their protein abundance – prompted us to investigate whether ELAVL4 and PABPC4L functionally contribute to progression of the lytic cycle. We therefore depleted ELAVL4 and PABPC4L using siRNAs and quantified the amounts of encapsidated virus using qPCR of the EBV BALF5 (DNA polymerase) gene in DNase-treated culture supernatants. As shown in Fig 11A and 11B, induction of the lytic cycle in HH514–16 cells using NaB for 48 hours resulted in ~40-fold increase in the release of encapsidated EBV genomes. By comparison, virus release was almost completely abrogated when ELAVL4 or PABPC4L was depleted. We next asked if the loss of release of packaged EBV genomes from cells was due to a defect in replicating the viral genomes – and therefore assayed intracellular EBV genome amplification in HH514–16 cells using qPCR targeting BALF5. Twenty-four hours after NaB exposure, there was > 100-fold increase in the number of EBV genomes; however, compared to control siRNA, there was ~ 40% reduction in the number of intracellular genomes following siRNA-mediated depletion of ELAVL4; the effect was even greater, i.e., ~ 80% reduction in EBV genome amplification when PABPC4L was depleted (Fig 11C and 11D). Using shRNAs that target distinct regions of ELAVL4 and PABPC4L, we confirmed that knock down of these genes suppressed viral genome replication in both HH514–16 cells and an LCL (S6A and S6B Fig). As expected, siRNAs resulted in depletion of transcripts from their cognate targets (Fig 11E and 11F); similarly, shRNAs resulted in knockdown of ELAVL4 and PABPC4L transcripts and HuD protein (S6C and S6D Fig). Thus, ELAVL4 and PABPC4L contributed to viral genome replication, and ultimately, release of encapsidated virus.
HH514-16 BL cells were transfected with control/non-targeting siRNA (white bars) versus siRNAs targeting ELAVL4 (light gray bars) or PABPC4L (dark gray bars). After 24 hours, cells were treated with NaB to induce the lytic phase and harvested at different time points: At 48 hours post-induction, DNase-treated culture supernatants (A and B) or cell extracts (C and D) were analyzed by qPCR using primers targeting BALF5 to quantify encapsidated virus (A and B) or intracellular genomes (C and D). At 24 hours post-induction, ELAVL4 and PABPC4L transcripts were quantified using RT-qPCR (E and F). Data in A-D were normalized to untreated, control siRNA-transfected cells; data in E-F were normalized to control siRNA-transfected cells. Error bars, SEM of 3 biological replicates, with 3 technical replicates within each biological replicate; *, p < 0.05; ***, p < 0.001; ****, p < 0.0001.
EBV early lytic genes encode several key components of the DNA replication machinery and are therefore necessary for viral genome replication. To assess if the effects of the RNA binding factors ELAVL4 and PABPC4L on viral genome replication were related to the abundance of EBV early lytic transcripts, we used RT-qPCR to measure the steady state levels of transcripts from a dozen EBV early lytic genes after depletion of ELAVL4 or PABPC4L. Fig 12E shows that compared to control siRNA, depletion of ELAVL4 resulted in significant reduction of BXLF1 transcripts in NaB-exposed HH514–16 cells. In comparison, while depletion of PABPC4L similarly resulted in a reduction in BXLF1 transcripts, it also reduced the abundance of BALF5 transcripts (Fig 13E and 13F). As noted above, BALF5 encodes the viral DNA polymerase; BXLF1 encodes the enzyme thymidine kinase. While depletion of ELAVL4 or PABPC4L did not affect most of the other transcripts, BORF2, BaRF1, and BMLF1 transcripts were elevated upon depletion of either ELAVL4 or PABPC4L (Figs 12C, 12D, 12K, 13C, 13D and 13K). BORF2 and BaRF1 encode the large and small subunits of the viral ribonucleotide reductase, respectively; BMLF1 encodes SM, an RNA binding protein that post-transcriptionally regulates viral and cellular transcripts. Using antibodies that reliably detect two essential viral replication proteins, the DNA polymerase BALF5 and the DNA polymerase processivity factor EA-D, by immunoblotting, we also found that depletion of ELAVL4 or PABPC4L resulted in 50–60% reduction in EA-D protein (including the phosphorylated isoform; Fig 14A) and near-total loss of BALF5 (Fig 14B) in NaB-treated cells. Of note, the lack of effect of ELAVL4 depletion on BGLF5 transcripts (Fig 12L) was consistent with a lack of effect of ELAVL4 overexpression on BGLF5 protein in lytically induced HH514–16 cells in Fig 6A. These experiments support the conclusion that two RNA binding factors, that are subject to complex regulation during the lytic phase, in turn regulate the abundance of transcripts from select early lytic genes while also supporting the expression of key DNA replication proteins to ensure EBV genome replication, and ultimately, release of the virus.
HH514-16 BL cells transfected with control/non-targeting RNA (white bars) or siELAVL4 (gray bars) were treated with NaB to induce the lytic phase (as part of the experiment presented in Fig 11). Cells were harvested after 24 hours and subjected to RT-qPCR using primers targeting: (A) BZLF1, (B) BRLF1, (C) BORF2, (D) BaRF1, (E) BXLF1, (F) BALF5, (G) BMRF1, (H) BBLF2/3, (I) BALF2, (J) BGLF4, (K) BMLF1, and (L) BGLF5. Data were normalized to control siRNA-transfected cells. Error bars, SEM of 3 biological replicates, with 3 technical replicates within each biological replicate; ns, not significant; *, p < 0.05; **, p < 0.01.
HH514-16 BL cells transfected with control RNA (white bars) or siPABPC4L (gray bars) were treated with NaB to induce the lytic phase (as part of the experiment presented in Fig 11). Cells were harvested after 24 hours and subjected to RT-qPCR using primers targeting: (A) BZLF1, (B) BRLF1, (C) BORF2, (D) BaRF1, (E) BXLF1, (F) BALF5, (G) BMRF1, (H) BBLF2/3, (I) BALF2, (J) BGLF4, (K) BMLF1, and (L) BGLF5. Data were normalized to control siRNA-transfected cells. Error bars, SEM of 3 biological replicates, with 3 technical replicates within each biological replicate; ns, not significant; *, p < 0.05; **, p < 0.01; ****, p < 0.0001.
EBV+ HH514-16 BL cells were exposed to control siRNA versus siRNAs targeting ELAVL4 or PABPC4L followed by treatment with NaB 24 hours later. Cells lysates were processed after another 24 hours for immunoblotting with antibodies targeting the viral DNA polymerase processivity factor (EA-D; A) and DNA polymerase (BALF5; B).
Discussion
Lytic reactivation of EBV from latency is essential for propagation and maintenance of the virus within the human population. The lytic cycle is also a critical component of the pathogenesis of virus-associated diseases [32–37]. While large DNA viruses like EBV encode many RNAs and proteins necessary for their replication and persistence within host cells, many cellular gene products must also play an essential role in the viral life cycle. However, the contribution of cellular gene expression during the lytic phase of the EBV life cycle remains underexplored. Investigation of cellular events that occur at early times prior to reactivation may help elucidate the mechanism(s) regulating the switch between latency and the lytic cycle [38]. It is equally important to understand how the viral lytic cycle itself alters expression of cellular genes to ensure progress of the lytic phase. In this report, we concentrate on cellular gene expression that is specific to cells that enter the EBV lytic cycle; products of such genes are needed to overcome host shut off and ensure completion of the viral lytic cycle.
Our previous studies led to the concept that subpopulations of cells, either refractory or susceptible to EBV lytic reactivation exhibited different patterns of cellular gene expression [14,17,18,39]. Here, we identify additional cellular genes that are upregulated in the refractory cells but also identify the transcripts of several cellular genes that accumulate specifically in the lytic subpopulation of HH514–16 cells regardless of the inducing stimulus. Expression of these cellular genes is blocked by VPA that inhibits EBV lytic reactivation. These transcripts are also upregulated in EBV(+) but not in EBV(-) Akata cells treated with anti-IgG. The cellular transcripts are kinetically downstream of viral early lytic genes. Expression of a subset of cellular transcripts that encode two RNA binding proteins, ELAVL4 and PABPC4L, is triggered by introduction of a plasmid expressing the EBV lytic cycle activator ZEBRA only into EBV-infected cells – and help overcome ZEBRA and BGLF5-induced shut off of ELAVL4 and PABPC4L proteins. This escape strategy is important as we find that ELAVL4 and PABPC4L regulate the abundance of early lytic gene products that are essential for viral genome replication.
Host cell shut off of alpha- and gammaherpesviruses presents a dilemma: how are transcripts of viral genes, and of some cellular genes, protected from the shut off and in some instances upregulated? In Herpes simplex virus (HSV) infection, the virion host shutoff protein vhs, degrades both cellular and viral mRNA; the high transcription rate of the viral genes is thought to overwhelm this mechanism [40]. As for cellular genes, some are activated and their transcripts stabilized, at the same time that the vast majority of cellular gene expression is repressed [41,42]. The finding that vhs selectively degrades some mRNAs suggests that some intrinsic properties of transcripts, either specific sequences or structural motifs, may protect them from the host shut off [40]. Indeed, the 3’ untranslated regions of IL6, GADD45B, and C19ORF66 transcripts in KSHV-infected cells demonstrate the presence of SOX-resistance elements whose interactions with host ribonucleoprotein complexes mediate escape from host shut off [43–46]. Other cellular transcripts in KSHV-infected cells escape host shut off by the viral ORF50 protein-mediated transcriptional upregulation, demonstrated to occur even independently of the presence of the KSHV genome [47]. In an earlier study of nascent transcriptomes, we identified a set of upregulated cellular transcripts that contributed to EBV lytic reactivation and lytic cycle progress; however, whether these transcripts were upregulated by viral or cellular factors and whether such upregulation was required to overcome host shut off is unclear [5]. In the present study, we identified several cellular targets that are transcriptionally upregulated in lytic cells to counter host shut off that is also partially mediated by ZEBRA. We have previously shown that ZEBRA is a viral host shutoff factor that efficiently inhibits global protein synthesis in the absence of any other viral proteins [4].
Beyond turning the lytic phase on, ZEBRA also tightly regulates the abundance of viral gene products. While the single-stranded DNA binding protein (BALF2 gene product) and EA-D (BMRF1 gene product) are both essential for viral genome replication during the lytic phase, ZEBRA shuts off the ectopic expression of EA-D protein while permitting ectopic expression of the BALF2 protein. Although the reasons for such nuanced regulation are unclear, we speculate that it may be because EA-D performs several functions during the lytic cycle. Aside from serving as a clamp for the viral DNA polymerase to ensure processivity of genome replication, EA-D functions as a transcriptional coactivator, and importantly also, ensures a smooth transition from early lytic gene transcription to replication of the viral episome [31,48]. Untimely and excessive expression of EA-D may lead to deregulation of the kinetically coordinated events that ensure the completion of the lytic cycle. A second mechanism by which ZEBRA influences lytic gene expression is through induction of cellular RNA-binding proteins such as ELAVL4 and PABPC4L that modulate the abundance of early lytic transcripts and proteins. Depletion of these RNA-binding factors reduces BALF5 (viral DNA polymerase) transcripts and protein, BXLF1 (viral thymidine kinase) transcripts, and EA-D protein, consistent with impaired viral DNA replication. In contrast, an explanation for the concurrent increase in BORF2, BaRF1, and BMLF1 transcripts is less straightforward. Given their roles in maintaining the ribonucleotide pool (BORF2 and BaRF1, subunits of ribonucleotide reductase) and regulating post-transcriptional processes (BMLF1/SM protein), it is likely that ELAVL4 and PABPC4L fine-tune both nucleotide availability and RNA metabolism to support the transcriptional demands of the lytic cycle.
ZEBRA has been shown to be a potent activator of host shutoff in both EBV(+) and EBV(-) cell lines [4]. ZEBRA-induced host shutoff involves three mechanisms: global shut down of the initiation of protein synthesis, blockade of nuclear export of RNA, and nuclear translocation of cytoplasmic PABP. Point mutations of ZEBRA that caused diminished PABP nuclear translocation led to reduced inhibition of translation. Importantly, ZEBRA’s ability to induce these three activities in EBV(-) cells indicated that ZEBRA directly induces cellular host shutoff in the absence of any other viral factors, including the nuclease encoded by BGLF5 [4]. Our present work indicates that serine 186, a residue that is critical for ZEBRA’s recognition of methylated promoters and therefore transcriptional activation of early lytic genes, also contributes to its ability to suppress protein expression. ZEBRA-mediated transcriptional upregulation of endogenous ELAVL4 and PABPC4L transcripts to counter protein suppression only occurs in EBV-infected cells (but not in EBV(-) Akata cells, BJAB cells, or 293 cells), indicating that other viral factors likely regulate the specific increase in these transcripts; however, intriguingly, the abundance of PABPC4L transcripts appears to also depend on viral genome replication in LCLs (S3 Fig).
To distinguish transcript accumulation resulting from EBV lytic induction versus from pleiotropic effects of exogenous stimuli, we examined cellular gene expression following ZEBRA transfection. This revealed that genes encoding mRNA-binding proteins – ELAV-like and PABP-like – are specifically upregulated during the EBV lytic phase. Notably, of the ELAVL genes, ELAVL3 and ELAVL4, but not ELAVL1 or ELAVL2, were induced. While ELAVL1 is broadly expressed, ELAVL2–4 are largely neuronal and critical for differentiation and development [49–52]. ELAV proteins stabilize AU-rich mRNAs and can either repress or enhance translation depending on context [53–59]; for example, ELAVL4 interacts with eIF4A to promote cap- and poly(A)-dependent translation [60] – supporting our observation that depletion of ELAVL4 suppresses EA-D and BALF5 proteins even without affecting their respective transcripts. ELAVL4/HuD is also known to stabilize CDKN1A transcripts that encode p21, a CDK inhibitor that blocks G1-S transition, a key lytic phase observation attributed to ZEBRA [61,62]. Although ELAVL3 and ELAVL4 have not previously been linked to viral infection, related family members modulate diverse viruses: ELAVL1 regulates HPV late gene expression, supports HCV replication, stabilizes Sindbis virus RNAs, and is relocalized by KSHV kaposin-B to enhance mRNA stability [63–67]. Our findings show that ELAVL3 and ELAVL4, normally neuron-restricted, are robustly induced in EBV-lytic Burkitt lymphoma cells, where basal expression is otherwise minimal.
We found that ELAVL4 and PABPC4L are induced during the later stages of the EBV lytic cycle (12–24 hours post-reactivation), consistent with their observed roles in regulating transcripts and proteins encoded by early lytic genes. PABPC4L is a poorly characterized homolog of PABPC4 (inducible PABP, iPABP), which itself shares ~79% amino acid identity with the major cytoplasmic poly(A)-binding protein PABPC1 and is rapidly induced upon T-cell activation. Like PABPC1, iPABP contains four conserved RNA-recognition motifs (RRMs), an unstructured linker, and a C-terminal protein interaction domain. In contrast, PABPC4L encodes a predicted 370-aa protein containing the four RRMs but lacking the linker and C-terminal regions, with ~75% identity to iPABP across the RRMs [68,69]. The specific induction of PABPC4L during lytic EBV replication raises the possibility that it compensates for the loss of cytoplasmic PABPC1, which undergoes nuclear translocation during lytic reactivation of EBV and KSHV [4,70]. Analogous viral strategies support this idea: rotavirus NSP3 displaces PABP from eIF4G yet substitutes for its function to promote viral mRNA translation, while poliovirus protease 2A cleaves PABP, rendering host translation dependent on IRES-driven mechanisms [71–74]. Since EBV and KSHV transcripts resemble cellular mRNAs (5′ capped, polyadenylated, and spliced), they still require canonical translation machinery. Thus, induction of PABPC4L may preserve viral mRNA translation under conditions where PABPC1 is sequestered. Notably also, iPABP is thought to stabilize and promote translation of cytokine mRNAs during T-cell activation [69] – a situation reminiscent of the transcriptional surge during lytic EBV reactivation. By analogy, PABPC4L could support translation of viral and select host transcripts during lytic infection.
Our approach, using sorted lytic or refractory cells rather than bulk populations, allowed us to ask two questions: 1) Do refractory cells respond to the inducing stimulus? and 2) Does cellular gene expression in response to the inducing stimulus differ between those cells that enter the lytic cycle and those that remain refractory to lytic induction? Our initial analyses revealed that cells refractory to lytic induction do respond to the inducing stimulus. For example, when HH514–16 cells were treated with NaB and then sorted, both refractory and lytic subpopulations exhibited an increase in global acetylation on the tail of histone H3 [14]. This result indicated that refractory cells were responsive to the HDAC inhibitory effects of NaB. Moreover, in response to the HDAC inhibitors NaB or TSA, expression of some cellular genes, including STAT3, FOS and IL8, and those encoding components of the heterochromatin silencing machinery including KRAB-ZFPs and the histone methyltransferase SETDB1 were specifically increased in refractory cells [14,17]. In lytic cells, the transcript levels of most of the cellular genes we investigated were similar to or lower than untreated controls. However, several genes, including IL6, were preferentially upregulated in the lytic subpopulation [14,17]. Our present work indicates that this upregulation of IL6 mRNA mitigates ZEBRA-mediated shut off of IL6 protein. That IL6 expression is up-regulated in KSHV [75] and EBV infection suggests that the behavior of some cellular transcripts during viral lytic replication is conserved through evolution.
EBV infection and the IL6 pathway are closely linked. EBV infection induces B cells to express IL6 and IL6R [76,77]. Binding of the virion glycoproteins gp350 and gp220 to the cellular receptor CD21 leads to increases in IL6 transcript and protein levels [76]. Expression of the EBV latent membrane protein LMP1 also induces IL6 production [78]. Products of the early EBV lytic genes, BZLF1 and BRLF1 activate IL6 production in early-passage LCL [32]. The combination of BZLF1 and LMP1 increases IL6 levels significantly more than either protein alone [32]. Although LMP1 is not expressed in HH514–16 cells during latency, the LMP1 transcript and protein are highly expressed specifically in the lytic population [14]. LMP1 in lytic HH514–16 cells may cooperatively activate IL6 together with other EBV lytic proteins. IL6 is likely to play many roles in the viral life cycle and in EBV-associated diseases. IL6 can act via autocrine or paracrine mechanisms as a growth factor for EBV-infected lymphocytes [79,80]. High levels of IL6 inhibit the activity of natural killer cells that are a first-line innate defense that limits EBV-induced B cell transformation until adaptive virus-specific immune mechanisms develop [81,82]. Induction of IL6 during lytic infection could therefore enhance the transformation or growth of newly infected cells and mediate escape from innate immunity of the host [82]. Indeed, IL6 is thought to play a crucial role in EBV-induced lymphoproliferative diseases (LPD), and, neutralizing monoclonal antibodies to human IL6 enhanced the survival of SCID mice injected with human peripheral blood leukocytes isolated from EBV-positive donors [83]. In addition, EBV early lytic viral proteins enhance tumor formation in SCID mice, likely by enhancing IL6 secretion [32]. A clinical trial showed that treatment with a monoclonal anti-IL6 neutralizing antibody often resulted in remission of LPD [84]. Elevated levels of EBV DNA are often a predictive marker of LPD [85–87], and it has been suggested that lytic viral reactivation after organ transplant correlates strongly with the risk of LPD [88]. These studies suggest that activation of IL6 during the EBV lytic phase plays an important role in EBV-induced lymphoproliferation in cell culture, in experimental animals, and in humans.
Materials and methods
Cell lines
The EBV-infected HH514–16 Burkitt lymphoma cell line is a sub-clone of the P3J-HR1K Burkitt lymphoma cell line [16]. The EBV(+) and EBV(-) Akata Burkitt lymphoma cell lines were generously supplied by Kenzo Takada [11,89]. The LCL was previously published [90]. The B-cell lymphoma line, BJAB, served as an EBV-negative control as did 293 cells [91]. Cells were cultured in RPMI-1640 containing 8% or 10% fetal bovine serum, penicillin (50 U/ml), streptomycin (50 U/ml), and amphotericin B (1 µg/ml). Cells were grown at 37°C under 5% CO2.
Chemical treatment of cell lines
Cells were sub-cultured at 3–5 x 105/ml and 24–48 hours later treated with chemical stimuli. NaB (Sigma no. B5887) was used at 3 mM, TSA (Sigma #T8552; WAKO Chemicals USA #209–17563) was used at 5 μM, AzaCdR (Sigma #A3656) was used at 5 μM, VPA (Sigma #P4543) was used at 10 mM, TPA (Sigma #524400) was used at 20 ng/ml, and phosphonoacetic acid/PAA (Sigma #284270) was used at 300 µg/ml. Rabbit anti-human IgG (anti-IgG) (Dako #A042301-2) was used at 7.5 µg/ml.
Cell sorting
Separation of lytic and refractory cell populations was performed as described previously using reference EBV-positive and EBV-negative human sera [13].
Transfections
HH514–16 cells were sub-cultured to 3–5 x 105 cells/ml and transfected 24–48 hours later when cell counts were approximately 1 x 106/ml. 10μg of plasmid DNA were mixed with 1.5x106 cells in 400 ul of RPMI1640 plus 8% fetal bovine serum. The cells were exposed to 0.25 KV in a BioRad gene pulse unit. In the experiments shown in Figs 11–14 and S3, plasmid DNA (10–20μg) or siRNA (200pmol) were transfected into 1 x 106 cells using Ingenio solution (MIR50117, Mirus BioSolutions) and an Amaxa Nucleofector II (program A-024) as previously described [92]. Electroporated cells were sub-cultured at 1 x 106 cells/ml at 37°C in 5%CO2 and harvested at timepoints indicated in the respective figures. 293 cells were grown to 80% confluence at which time they were reseeded in a 6-well plate at 0.3 x 105/well in 2ml medium. In 2–3 days, when cells reached 50% confluence, they were transfected via Lipojet (SignaGen laboratories) or DMRIEC reagent (Life Technologies) and harvested at timepoints indicated in the figures.
Lentivirus transduction
HEK-293T cells at 70–80% confluence were transfected with lentiviral packaging plasmids and shRNA constructs. After 18–20 hours, the media were replaced, and viral supernatant was collected 48 h later. The supernatant was clarified by centrifugation at 350 × g for 5 min and filtered through a 0.45 μm PES syringe filter. Lentivirus was concentrated using Lenti Concentrator (Origene, cat# TR30026). HH514–16 Burkitt lymphoma cells and LCLs were transduced with 100 μl of concentrated virus in the presence of 8 μg/ml Polybrene. Spinoculation was performed at 800 × g for 90 min at room temperature. Transduction was performed on two consecutive days. For stable cell line generation, cells were selected in puromycin-containing media for 10 days.
Plasmids: FLAG-BZLF1 plasmid, used in S3 Fig, was described previously [31]. Other plasmids included CMV (pHD1013), CMV/FLAG/BALF2, CMV/FLAG/BMRF1, CMV/gZ [29], CMV/gZS186A [29], CMV/RTS [93], R(pRTS/RTA) [93], pcDNA3.1, pcDNA3.1/HuIL6, ELAVL4 (CMV/V6-XL5/ELAVL4 – Origene NM_021952#S0313227), and PABPC4L (pCMV6-ENTRY/PABPC4L/FLAG – Origene RC225562).
siRNAs: Sequences of siRNAs, ordered from Thermo Fisher, are shown below:
- ELAVL4 siRNA: 5’ GAAUAUGACCCAAGAAGAATT 3’
- PABPC4L siRNA: 5’ GGUGAUGAGUGAUGAUCAATT 3’
shRNA sequences are shown below:
ELAVL4: 5’ AAGTCACGAATCACCTTTACG 3’ (Horizon Discovery, Oligo ID: TRC0000038707
provided in the pLKO.1 lentivirus plasmid)
PABPC4L: 5’ TCTCCTGAGGATGCTACTAAA 3’ (Vector Builder, VectorID: VB260204–1449uwy; vector name pLV[shRNA]-Puro-U6 > hPABPC4L[shRNA#3])
Extraction of RNA and DNA
Total RNA was extracted from samples using Qiagen RNeasy/RNeasy Plus mini kits (#74106/74134) or Invitrogen Purelink RNA mini kit. Total genomic DNA was extracted using Invitrogen™ Purelink™ DNA mini kit. RNA/DNA concentration was determined using a NanoDrop (ThermoFisher).
RT-qPCR
The relative levels of selected transcripts were measured using RT-qPCR with gene-specific primers using the iScript SYBR Green RT-PCR kit (Bio-Rad). Relative expression levels were calculated using the ΔΔCt method, normalized to 18S rRNA. Individual samples were assayed in triplicate. SABiosciences was the source of primers for ELAVL3 (cat # PPH07095A) and ELAVL4 (cat # PPH09946A). All other primers were designed using Primer3 [94] or have been described previously [14,95,96]. See Table 4 for sequences of primers not previously described.
qPCR to quantify cell-associated viral genomes and released viral genomes
Cell-associated EBV DNA was extracted and relative viral DNA levels were quantified through qPCR by targeting the EBV BALF5 gene. To measure the relative amount of released EBV particles, equal volumes of culture supernatants were treated with DNase, and then qPCR was performed using primers specific to the EBV BALF5 gene. The data was fit to a standard curve generated by amplifying the BALF5 gene from 10-fold dilutions of the p2089 EBV bacmid used as template. The primers used to amplify EBV BALF5 gene were previously published [97].
Western blot analysis
Total cell extracts were electrophoresed in 8–12% SDS polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad). Polyclonal antibodies were raised in rabbits against the EBV BGLF5 polypeptide (aa1–470) expressed in E. coli and purified by Ni++ affinity [4]. Rabbit antibodies were used to detect acetylated histone H3 (Upstate #06–599), EBV BALF5 protein (MyBioSource #MBS968779), PABPC4L (Abgent #16381b), β-actin (Abcam #ab8227), GAPDH (Abcam #ab8245), ZEBRA (S1605) [98], RTA (Sydney) [93], and VCA/FR3 (S1931) [99]. Mouse monoclonal antibodies were used to detect IL6 (R&D Systems #MAB206), FLAG (Sigma #F1804) β-actin (Sigma #A5316 or Sigma-Aldrich #A1978), ELAVL4/HuD (Novus # H00001996-M01 and Santa Cruz #sc-48421), EA-D (Millipore-Sigma #MAB8186), and α-Actinin (ThermoFisher #MA5–36095), followed by rabbit anti-mouse HRP (ZyMAX #81–6700) or goat anti-mouse HRP (ThermoFisher #626520). Antibody-protein complexes were detected using 125I-labeled protein A or ECL Plus (GE Healthcare).
Statistical analysis
Student’s t-test was used to assess statistical significance when performing pair-wise comparisons. Results are expressed as the mean ± standard error of the mean (SEM) for experiments with three or more biological replicates or standard deviation (SD) for other experiments. P values, calculated using Microsoft Excel or GraphPad Prism5, are shown for experiments with at least 3 independent replicates.
Supporting information
S1 Fig. Separation of HH514–16 cells into lytic and refractory subpopulations.
HH514–16 cells were treated with NaB for 48 hours. They were incubated with EBV antibody-positive human serum from a healthy donor and FITC-conjugated anti-human IgG. The cells were separated into lytic and refractory subpopulations using a FACSVantage cell sorter. Pre-sorted cells and gating strategy are depicted by the histogram and dotplot on the left while purity of post-sorted lytic and refractory cells is shown using histograms on the right.
https://doi.org/10.1371/journal.ppat.1014211.s001
(TIF)
S2 Fig. BGLF5, the EBV protein that mediates host shut off, is selectively expressed in the lytic subpopulation of HH514–16 cells.
HH514–16 cells were treated with NaB for 48 hours. Total cell extracts from control, refractory or lytic subpopulations were electrophoresed on an 8% SDS-PAGE gel and immunoblotted using indicated antibodies.
https://doi.org/10.1371/journal.ppat.1014211.s002
(TIF)
S3 Fig. ELAVL4/HuD is induced upstream of viral genome replication in BL and LCL while PABPC4L is partially depending on replication in LCL.
HH514–16 cells and LCL were treated with NaB, TPA, and PAA as indicated for 24 hours. Total RNA was isolated and ELAVL4, PABPC4L, and BZLF1 transcripts were quantified using RT-qPCR (A, C, and D). Cell lysates were subjected to immunoblotting in B or analyzed by qPCR using primers targeting BALF5 to quantify intracellular viral genomes in E. Representative of biological duplicates shown; error bars, SD of technical triplicates.
https://doi.org/10.1371/journal.ppat.1014211.s003
(TIF)
S4 Fig. Expression of the EBV lytic cycle activator ZEBRA upregulates ELAVL4 and PABPC4L transcripts only in EBV-infected cells.
EBV-negative BJAB (A) and EBV-positive HH514–16 (B) cells were transfected with an empty vector (EV) or vector expressing BZLF1 (pBZLF1). After 24 hours, cell extracts were analyzed by RT-qPCR using primers targeting BZLF1, ELAVL4, and PABPC4L. Error bars, SEM of 3 biological replicates, with 3 technical replicates within each biological replicate; ***, p < 0.001; ****, p < 0.0001.
https://doi.org/10.1371/journal.ppat.1014211.s004
(TIF)
S5 Fig. Ectopic ELAVL4 and IL6 modestly suppress ZEBRA and RTA levels.
As part of the experiments shown in Figs 6A and 7A, HH514–16 cells were transfected with empty vector CMV/RTS alongside vectors expressing BZLF1 (Z), BRLF1 (R), ELAVL4, IL6, or combinations as indicated. Lysates were harvested after 24 hours and subjected to immunoblotting using indicated antibodies.
https://doi.org/10.1371/journal.ppat.1014211.s005
(TIF)
S6 Fig. shRNA-mediated depletion of ELAVL4 and PABPC4L transcripts suppresses lytic genome replication.
HH514–16 cells and LCL were transduced with lentivirus for control shRNA, ELAVL4 shRNA, or PABPC4L shRNA on two consecutive days. Twenty-four hours later, ELAVL4 shRNA-transduced cells were exposed to lytic cycle triggers (NaB or NaB + TPA) and harvested after another 24 hours. For PABPC4L shRNA-exposed cells, cells were exposed to 10 days of puromycin selection starting at 24 hours after the second transduction. Cells were then washed and placed in puromycin-free medium for 24 hours, and then treated with lytic cycle triggers for another 24 hours. Cells were harvested and subjected to BALF5 qPCR to quantify intracellular viral genomes (A and B), immunoblotting (C), and RT-qPCR analysis of PABPC4L transcripts (D). Representative of biological duplicates shown; error bars, SD of technical triplicates.
https://doi.org/10.1371/journal.ppat.1014211.s006
(TIF)
S1 Data. Minimal anonymized dataset necessary to replicate the findings.
https://doi.org/10.1371/journal.ppat.1014211.s007
(XLSX)
Acknowledgments
We thank the Keck lab at Yale University and Dr. Shrikant Mane and Sheila Westman for their generous assistance in microarray analysis. We thank Kenzo Takada for supplying EBV(+) and EBV(-) Akata cells. We are grateful to Joan Steitz, Daniel DiMaio, Ruth Wang’ondu and Kelly Gorres for helpful comments on the manuscript. We thank Susan Prisley for expert assistance with figure assembly and formatting.
References
- 1. Wong Y, Meehan MT, Burrows SR, Doolan DL, Miles JJ. Estimating the global burden of Epstein-Barr virus-related cancers. J Cancer Res Clin Oncol. 2022;148(1):31–46. pmid:34705104
- 2. Jangra S, Yuen KS, Botelho MG, Jin DY. Epstein-Barr virus and innate immunity: friends or foes? Microorganisms. 2019;7(6). pmid:31238570
- 3. Casco A, Johannsen E. EBV reactivation from latency is a degrading experience for the host. Viruses. 2023;15(3):726. pmid:36992435
- 4. Park R, El-Guindy A, Heston L, Lin S-F, Yu K-P, Nagy M, et al. Nuclear translocation and regulation of intranuclear distribution of cytoplasmic poly(A)-binding protein are distinct processes mediated by two Epstein Barr virus proteins. PLoS One. 2014;9(4):e92593. pmid:24705134
- 5. Frey TR, Brathwaite J, Li X, Burgula S, Akinyemi IA, Agarwal S, et al. Nascent transcriptomics reveal cellular prolytic factors upregulated upstream of the latent-to-lytic switch protein of Epstein-Barr virus. J Virol. 2020;94(7):e01966-19. pmid:31941784
- 6. Casco A, Ohashi M, Johannsen E. Epstein-Barr virus induces host shutoff extensively via BGLF5-independent mechanisms. Cell Rep. 2024;43(10):114743. pmid:39298313
- 7. Luka J, Kallin B, Klein G. Induction of the Epstein-Barr virus (EBV) cycle in latently infected cells by n-butyrate. Virology. 1979;94(1):228–31. pmid:220786
- 8. Countryman J, Gradoville L, Bhaduri-McIntosh S, Ye J, Heston L, Himmelfarb S, et al. Stimulus duration and response time independently influence the kinetics of lytic cycle reactivation of Epstein-Barr virus. J Virol. 2009;83(20):10694–709. pmid:19656890
- 9. Gradoville L, Kwa D, El-Guindy A, Miller G. Protein kinase C-independent activation of the Epstein-Barr virus lytic cycle. J Virol. 2002;76(11):5612–26. pmid:11991990
- 10. Davies AH, Grand RJ, Evans FJ, Rickinson AB. Induction of Epstein-Barr virus lytic cycle by tumor-promoting and non-tumor-promoting phorbol esters requires active protein kinase C. J Virol. 1991;65(12):6838–44. pmid:1658377
- 11. Takada K, Ono Y. Synchronous and sequential activation of latently infected Epstein-Barr virus genomes. J Virol. 1989;63(1):445–9. pmid:2462063
- 12. Prince S, Keating S, Fielding C, Brennan P, Floettmann E, Rowe M. Latent membrane protein 1 inhibits Epstein-Barr virus lytic cycle induction and progress via different mechanisms. J Virol. 2003;77(8):5000–7. pmid:12663807
- 13. Bhaduri-McIntosh S, Miller G. Cells lytically infected with Epstein-Barr virus are detected and separable by immunoglobulins from EBV-seropositive individuals. J Virol Methods. 2006;137(1):103–14. pmid:16843536
- 14. Daigle D, Megyola C, El-Guindy A, Gradoville L, Tuck D, Miller G, et al. Upregulation of STAT3 marks Burkitt lymphoma cells refractory to Epstein-Barr virus lytic cycle induction by HDAC inhibitors. J Virol. 2010;84(2):993–1004. pmid:19889776
- 15. Countryman JK, Gradoville L, Miller G. Histone hyperacetylation occurs on promoters of lytic cycle regulatory genes in Epstein-Barr virus-infected cell lines which are refractory to disruption of latency by histone deacetylase inhibitors. J Virol. 2008;82(10):4706–19. pmid:18337569
- 16. Heston L, Rabson M, Brown N, Miller G. New Epstein-Barr virus variants from cellular subclones of P3J-HR-1 Burkitt lymphoma. Nature. 1982;295(5845):160–3. pmid:6276755
- 17. Hill ER, Koganti S, Zhi J, Megyola C, Freeman AF, Palendira U, et al. Signal transducer and activator of transcription 3 limits Epstein-Barr virus lytic activation in B lymphocytes. J Virol. 2013;87(21):11438–46. pmid:23966384
- 18. Koganti S, Clark C, Zhi J, Li X, Chen EI, Chakrabortty S, et al. Cellular STAT3 functions via PCBP2 to restrain Epstein-Barr Virus lytic activation in B lymphocytes. J Virol. 2015;89(9):5002–11. pmid:25717101
- 19. Burton EM, Goldbach-Mansky R, Bhaduri-McIntosh S. A promiscuous inflammasome sparks replication of a common tumor virus. Proc Natl Acad Sci U S A. 2020;117(3):1722–30. pmid:31919284
- 20. Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov. 2006;5(9):769–84. pmid:16955068
- 21. Glaser KB, Staver MJ, Waring JF, Stender J, Ulrich RG, Davidsen SK. Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors: defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma cell lines. Mol Cancer Ther. 2003;2(2):151–63. pmid:12589032
- 22. Joseph J, Mudduluru G, Antony S, Vashistha S, Ajitkumar P, Somasundaram K. Expression profiling of sodium butyrate (NaB)-treated cells: identification of regulation of genes related to cytokine signaling and cancer metastasis by NaB. Oncogene. 2004;23(37):6304–15. pmid:15318170
- 23. Daigle D, Gradoville L, Tuck D, Schulz V, Wang’ondu R, Ye J, et al. Valproic acid antagonizes the capacity of other histone deacetylase inhibitors to activate the Epstein-Barr virus lytic cycle. J Virol. 2011;85(11):5628–43. pmid:21411522
- 24. Gorres KL, Reineke DM, Miller G. Transcriptome analysis of Burkitt lymphoma cells treated with anti-convulsant drugs that are inhibitors of Epstein-Barr virus lytic reactivation. PLoS One. 2024;19(4):e0299198. pmid:38635661
- 25. Ye J, Gradoville L, Daigle D, Miller G. De novo protein synthesis is required for lytic cycle reactivation of Epstein-Barr virus, but not Kaposi’s sarcoma-associated herpesvirus, in response to histone deacetylase inhibitors and protein kinase C agonists. J Virol. 2007;81(17):9279–91. pmid:17596302
- 26. Adamson AL, Kenney SC. Rescue of the Epstein-Barr virus BZLF1 mutant, Z(S186A), early gene activation defect by the BRLF1 gene product. Virology. 1998;251(1):187–97. pmid:9813214
- 27. Bhende PM, Seaman WT, Delecluse H-J, Kenney SC. BZLF1 activation of the methylated form of the BRLF1 immediate-early promoter is regulated by BZLF1 residue 186. J Virol. 2005;79(12):7338–48. pmid:15919888
- 28. Francis A, Ragoczy T, Gradoville L, Heston L, El-Guindy A, Endo Y, et al. Amino acid substitutions reveal distinct functions of serine 186 of the ZEBRA protein in activation of early lytic cycle genes and synergy with the Epstein-Barr virus R transactivator. J Virol. 1999;73(6):4543–51. pmid:10233912
- 29. Francis AL, Gradoville L, Miller G. Alteration of a single serine in the basic domain of the Epstein-Barr virus ZEBRA protein separates its functions of transcriptional activation and disruption of latency. J Virol. 1997;71(4):3054–61. pmid:9060666
- 30. El-Guindy A, Ghiassi-Nejad M, Golden S, Delecluse H-J, Miller G. Essential role of Rta in lytic DNA replication of Epstein-Barr virus. J Virol. 2013;87(1):208–23. pmid:23077295
- 31. Xu H, Akinyemi IA, Haley J, McIntosh MT, Bhaduri-McIntosh S. ATM, KAP1 and the Epstein-Barr virus polymerase processivity factor direct traffic at the intersection of transcription and replication. Nucleic Acids Res. 2023;51(20):11104–22. pmid:37852757
- 32. Jones RJ, Seaman WT, Feng W-H, Barlow E, Dickerson S, Delecluse H-J, et al. Roles of lytic viral infection and IL-6 in early versus late passage lymphoblastoid cell lines and EBV-associated lymphoproliferative disease. Int J Cancer. 2007;121(6):1274–81. pmid:17520680
- 33. Hong GK, Gulley ML, Feng W-H, Delecluse H-J, Holley-Guthrie E, Kenney SC. Epstein-Barr virus lytic infection contributes to lymphoproliferative disease in a SCID mouse model. J Virol. 2005;79(22):13993–4003. pmid:16254335
- 34. Ma S-D, Hegde S, Young KH, Sullivan R, Rajesh D, Zhou Y, et al. A new model of Epstein-Barr virus infection reveals an important role for early lytic viral protein expression in the development of lymphomas. J Virol. 2011;85(1):165–77. pmid:20980506
- 35. Montone KT, Hodinka RL, Salhany KE, Lavi E, Rostami A, Tomaszewski JE. Identification of Epstein-Barr virus lytic activity in post-transplantation lymphoproliferative disease. Mod Pathol. 1996;9(6):621–30. pmid:8782198
- 36. Mueller N, Evans A, Harris NL, Comstock GW, Jellum E, Magnus K, et al. Hodgkin’s disease and Epstein-Barr virus. Altered antibody pattern before diagnosis. N Engl J Med. 1989;320(11):689–95. pmid:2537928
- 37. Münz C. Latency and lytic replication in Epstein-Barr virus-associated oncogenesis. Nat Rev Microbiol. 2019;17(11):691–700. pmid:31477887
- 38. Ye J, Gradoville L, Miller G. Cellular immediate-early gene expression occurs kinetically upstream of Epstein-Barr virus bzlf1 and brlf1 following cross-linking of the B cell antigen receptor in the Akata Burkitt lymphoma cell line. J Virol. 2010;84(23):12405–18. pmid:20861250
- 39. Li X, Burton EM, Koganti S, Zhi J, Doyle F, Tenenbaum SA, et al. KRAB-ZFP repressors enforce quiescence of oncogenic human herpesviruses. J Virol. 2018;92(14):e00298-18. pmid:29695433
- 40. Esclatine A, Taddeo B, Roizman B. The UL41 protein of herpes simplex virus mediates selective stabilization or degradation of cellular mRNAs. Proc Natl Acad Sci U S A. 2004;101(52):18165–70. pmid:15596716
- 41. Kemp LM, Latchman DS. Induction and repression of cellular gene transcription during herpes simplex virus infection are mediated by different viral immediate-early gene products. Eur J Biochem. 1988;174(2):443–9. pmid:2838278
- 42. Taddeo B, Esclatine A, Roizman B. The patterns of accumulation of cellular RNAs in cells infected with a wild-type and a mutant herpes simplex virus 1 lacking the virion host shutoff gene. Proc Natl Acad Sci U S A. 2002;99(26):17031–6. pmid:12481033
- 43. Hutin S, Lee Y, Glaunsinger BA. An RNA element in human interleukin 6 confers escape from degradation by the gammaherpesvirus SOX protein. J Virol. 2013;87(8):4672–82. pmid:23408619
- 44. Muller M, Glaunsinger BA. Nuclease escape elements protect messenger RNA against cleavage by multiple viral endonucleases. PLoS Pathog. 2017;13(8):e1006593. pmid:28841715
- 45. Muller M, Hutin S, Marigold O, Li KH, Burlingame A, Glaunsinger BA. A ribonucleoprotein complex protects the interleukin-6 mRNA from degradation by distinct herpesviral endonucleases. PLoS Pathog. 2015;11(5):e1004899. pmid:25965334
- 46. Rodriguez W, Srivastav K, Muller M. C19ORF66 broadly Escapes virus-induced endonuclease cleavage and restricts kaposi’s sarcoma-associated herpesvirus. J Virol. 2019;93(12):e00373-19. pmid:30944177
- 47. Chandriani S, Ganem D. Host transcript accumulation during lytic KSHV infection reveals several classes of host responses. PLoS One. 2007;2(8):e811. pmid:17726541
- 48. Holley-Guthrie EA, Seaman WT, Bhende P, Merchant JL, Kenney SC. The Epstein-Barr virus protein BMRF1 activates gastrin transcription. J Virol. 2005;79(2):745–55. pmid:15613302
- 49. Wakamatsu Y, Weston JA. Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development. 1997;124(17):3449–60. pmid:9310339
- 50. Akamatsu W, Okano HJ, Osumi N, Inoue T, Nakamura S, Sakakibara S, et al. Mammalian ELAV-like neuronal RNA-binding proteins HuB and HuC promote neuronal development in both the central and the peripheral nervous systems. Proc Natl Acad Sci U S A. 1999;96(17):9885–90. pmid:10449789
- 51. Good PJ. A conserved family of elav-like genes in vertebrates. Proc Natl Acad Sci U S A. 1995;92(10):4557–61. pmid:7753842
- 52. Dobashi Y, Shoji M, Wakata Y, Kameya T. Expression of HuD protein is essential for initial phase of neuronal differentiation in rat pheochromocytoma PC12 cells. Biochem Biophys Res Commun. 1998;244(1):226–9. pmid:9514914
- 53. Brennan CM, Steitz JA. HuR and mRNA stability. Cell Mol Life Sci. 2001;58(2):266–77. pmid:11289308
- 54. Fan XC, Steitz JA. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 1998;17(12):3448–60. pmid:9628880
- 55. Peng SS, Chen CY, Xu N, Shyu AB. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 1998;17(12):3461–70. pmid:9628881
- 56. Pascale A, Gusev PA, Amadio M, Dottorini T, Govoni S, Alkon DL, et al. Increase of the RNA-binding protein HuD and posttranscriptional up-regulation of the GAP-43 gene during spatial memory. Proc Natl Acad Sci U S A. 2004;101(5):1217–22. pmid:14745023
- 57. Galbán S, Kuwano Y, Pullmann R Jr, Martindale JL, Kim HH, Lal A, et al. RNA-binding proteins HuR and PTB promote the translation of hypoxia-inducible factor 1alpha. Mol Cell Biol. 2008;28(1):93–107. pmid:17967866
- 58. Hinman MN, Lou H. Diverse molecular functions of Hu proteins. Cell Mol Life Sci. 2008;65(20):3168–81. pmid:18581050
- 59. Kullmann M, Göpfert U, Siewe B, Hengst L. ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5’UTR. Genes Dev. 2002;16(23):3087–99. pmid:12464637
- 60. Fukao A, Sasano Y, Imataka H, Inoue K, Sakamoto H, Sonenberg N, et al. The ELAV protein HuD stimulates cap-dependent translation in a Poly(A)- and eIF4A-dependent manner. Mol Cell. 2009;36(6):1007–17. pmid:20064466
- 61. Joseph B, Orlian M, Furneaux H. p21(waf1) mRNA contains a conserved element in its 3’-untranslated region that is bound by the Elav-like mRNA-stabilizing proteins. J Biol Chem. 1998;273(32):20511–6. pmid:9685407
- 62. Silvestri B, Mochi M, Garone MG, Rosa A. Emerging roles for the RNA-binding protein HuD (ELAVL4) in nervous system diseases. Int J Mol Sci. 2022;23(23):14606. pmid:36498933
- 63. Koffa MD, Graham SV, Takagaki Y, Manley JL, Clements JB. The human papillomavirus type 16 negative regulatory RNA element interacts with three proteins that act at different posttranscriptional levels. Proc Natl Acad Sci U S A. 2000;97(9):4677–82. pmid:10781073
- 64. Korf M, Jarczak D, Beger C, Manns MP, Krüger M. Inhibition of hepatitis C virus translation and subgenomic replication by siRNAs directed against highly conserved HCV sequence and cellular HCV cofactors. J Hepatol. 2005;43(2):225–34. pmid:15964661
- 65. Sokoloski KJ, Dickson AM, Chaskey EL, Garneau NL, Wilusz CJ, Wilusz J. Sindbis virus usurps the cellular HuR protein to stabilize its transcripts and promote productive infections in mammalian and mosquito cells. Cell Host Microbe. 2010;8(2):196–207. pmid:20709296
- 66. Sokolowski M, Furneaux H, Schwartz S. The inhibitory activity of the AU-rich RNA element in the human papillomavirus type 1 late 3’ untranslated region correlates with its affinity for the elav-like HuR protein. J Virol. 1999;73(2):1080–91. pmid:9882309
- 67. Spangberg K, Wiklund L, Schwartz S. HuR, a protein implicated in oncogene and growth factor mRNA decay, binds to the 3’ ends of hepatitis C virus RNA of both polarities. Virology. 2000;274(2):378–90. pmid:10964780
- 68. Mangus DA, Evans MC, Jacobson A. Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol. 2003;4(7):223. pmid:12844354
- 69. Yang H, Duckett CS, Lindsten T. iPABP, an inducible poly(A)-binding protein detected in activated human T cells. Mol Cell Biol. 1995;15(12):6770–6. pmid:8524242
- 70. Lee YJ, Glaunsinger BA. Aberrant herpesvirus-induced polyadenylation correlates with cellular messenger RNA destruction. PLoS Biol. 2009;7(5):e1000107. pmid:19468299
- 71. Montero H, Rojas M, Arias CF, López S. Rotavirus infection induces the phosphorylation of eIF2alpha but prevents the formation of stress granules. J Virol. 2008;82(3):1496–504. pmid:18032499
- 72. Piron M, Vende P, Cohen J, Poncet D. Rotavirus RNA-binding protein NSP3 interacts with eIF4GI and evicts the poly(A) binding protein from eIF4F. EMBO J. 1998;17(19):5811–21. pmid:9755181
- 73. Thompson SR, Sarnow P. Regulation of host cell translation by viruses and effects on cell function. Curr Opin Microbiol. 2000;3(4):366–70. pmid:10972496
- 74. Vende P, Piron M, Castagné N, Poncet D. Efficient translation of rotavirus mRNA requires simultaneous interaction of NSP3 with the eukaryotic translation initiation factor eIF4G and the mRNA 3’ end. J Virol. 2000;74(15):7064–71. pmid:10888646
- 75. Glaunsinger B, Ganem D. Highly selective escape from KSHV-mediated host mRNA shutoff and its implications for viral pathogenesis. J Exp Med. 2004;200(3):391–8. pmid:15289507
- 76. Tanner JE, Alfieri C, Chatila TA, Diaz-Mitoma F. Induction of interleukin-6 after stimulation of human B-cell CD21 by Epstein-Barr virus glycoproteins gp350 and gp220. J Virol. 1996;70(1):570–5. pmid:8523572
- 77. Klein SC, Jücker M, Abts H, Tesch H. IL6 and IL6 receptor expression in Burkitt’s lymphoma and lymphoblastoid cell lines: promotion of IL6 receptor expression by EBV. Hematol Oncol. 1995;13(3):121–30. pmid:7622142
- 78. Eliopoulos AG, Stack M, Dawson CW, Kaye KM, Hodgkin L, Sihota S, et al. Epstein-Barr virus-encoded LMP1 and CD40 mediate IL-6 production in epithelial cells via an NF-kappaB pathway involving TNF receptor-associated factors. Oncogene. 1997;14(24):2899–916. pmid:9205097
- 79. Tosato G, Tanner J, Jones KD, Revel M, Pike SE. Identification of interleukin-6 as an autocrine growth factor for Epstein-Barr virus-immortalized B cells. J Virol. 1990;64(6):3033–41. pmid:2159561
- 80. Tanner JE, Tosato G. Regulation of B-cell growth and immunoglobulin gene transcription by interleukin-6. Blood. 1992;79(2):452–9. pmid:1370387
- 81. Tanner J, Tosato G. Impairment of natural killer functions by interleukin 6 increases lymphoblastoid cell tumorigenicity in athymic mice. J Clin Invest. 1991;88(1):239–47. pmid:1647416
- 82. Strowig T, Brilot F, Arrey F, Bougras G, Thomas D, Muller WA, et al. Tonsilar NK cells restrict B cell transformation by the Epstein-Barr virus via IFN-gamma. PLoS Pathog. 2008;4(2):e27. pmid:18266470
- 83. Mauray S, Fuzzati-Armentero MT, Trouillet P, Rüegg M, Nicoloso G, Hart M, et al. Epstein-Barr virus-dependent lymphoproliferative disease: critical role of IL-6. Eur J Immunol. 2000;30(7):2065–73. pmid:10940896
- 84. Haddad E, Paczesny S, Leblond V, Seigneurin JM, Stern M, Achkar A, et al. Treatment of B-lymphoproliferative disorder with a monoclonal anti-interleukin-6 antibody in 12 patients: a multicenter phase 1-2 clinical trial. Blood. 2001;97(6):1590–7. pmid:11238096
- 85. Rooney CM, Loftin SK, Holladay MS, Brenner MK, Krance RA, Heslop HE. Early identification of Epstein-Barr virus-associated post-transplantation lymphoproliferative disease. Br J Haematol. 1995;89(1):98–103. pmid:7833284
- 86. Kenagy DN, Schlesinger Y, Weck K, Ritter JH, Gaudreault-Keener MM, Storch GA. Epstein-Barr virus DNA in peripheral blood leukocytes of patients with posttransplant lymphoproliferative disease. Transplantation. 1995;60(6):547–54. pmid:7570949
- 87. Limaye AP, Huang ML, Atienza EE, Ferrenberg JM, Corey L. Detection of Epstein-Barr virus DNA in sera from transplant recipients with lymphoproliferative disorders. J Clin Microbiol. 1999;37(4):1113–6. pmid:10074534
- 88. van Esser JW, van der Holt B, Meijer E, Niesters HG, Trenschel R, Thijsen SF, et al. Epstein-Barr virus (EBV) reactivation is a frequent event after allogeneic stem cell transplantation (SCT) and quantitatively predicts EBV-lymphoproliferative disease following T-cell--depleted SCT. Blood. 2001;98(4):972–8. pmid:11493441
- 89. Shimizu N, Tanabe-Tochikura A, Kuroiwa Y, Takada K. Isolation of Epstein-Barr virus (EBV)-negative cell clones from the EBV-positive Burkitt’s lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV. J Virol. 1994;68(9):6069–73. pmid:8057484
- 90. Willman GH, Xu H, Zeigler TM, McIntosh MT, Bhaduri-McIntosh S. Polymerase theta is a synthetic lethal target for killing Epstein-Barr virus lymphomas. J Virol. 2024;98(7):e0057224. pmid:38860782
- 91. Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol. 1977;36(1):59–74. pmid:886304
- 92. Li X, Burton EM, Bhaduri-McIntosh S. Chloroquine triggers Epstein-Barr virus replication through phosphorylation of KAP1/TRIM28 in Burkitt lymphoma cells. PLoS Pathog. 2017;13(3):e1006249. pmid:28249048
- 93. Ragoczy T, Miller G. Role of the epstein-barr virus RTA protein in activation of distinct classes of viral lytic cycle genes. J Virol. 1999;73(12):9858–66. pmid:10559298
- 94. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–86. pmid:10547847
- 95. Lefever S, Vandesompele J, Speleman F, Pattyn F. RTPrimerDB: the portal for real-time PCR primers and probes. Nucleic Acids Res. 2009;37(Database issue):D942-5. pmid:18948285
- 96. Keller C, Steensberg A, Hansen AK, Fischer CP, Plomgaard P, Pedersen BK. Effect of exercise, training, and glycogen availability on IL-6 receptor expression in human skeletal muscle. J Appl Physiol (1985). 2005;99(6):2075–9. pmid:16099893
- 97. Xu H, Hutchinson TE, Koganti S, Rousseau BA, Xia D, McIntosh MT, et al. Leveraging the interconnected unfolded protein response and NLRP3 inflammasome pathways to reactivate Epstein-Barr virus in diffuse large B-cell lymphomas. NAR Cancer. 2025;7(2):zcaf017. pmid:40330549
- 98. Taylor N, Countryman J, Rooney C, Katz D, Miller G. Expression of the BZLF1 latency-disrupting gene differs in standard and defective Epstein-Barr viruses. J Virol. 1989;63(4):1721–8. pmid:2538652
- 99. El-Guindy A, Heston L, Miller G. A subset of replication proteins enhances origin recognition and lytic replication by the Epstein-Barr virus ZEBRA protein. PLoS Pathog. 2010;6(8):e1001054. pmid:20808903