Figures
Abstract
The replacement of a single codon in the human prion gene, causing the substitution of glycine with valine at position 127 (G127V) of the prion protein (PrP), prevents development of prion disease. We set out to explore if prion disease survival extension manifests in mice if the V127 mutant is delivered through a recombinant adeno-associated virus (rAAV) packaged as a self-complementary DNA. The notorious delivery limitations of rAAV vectors were designed to be overcome using a cross-correction approach that relied on the expression of the mutation in the context of glycosylphosphatidylinositoI-anchorless (ΔGPI) PrP. In this proof-of-concept study, we inoculated Rocky Mountain Laboratory (RML) prions into knock-in mice, in which the endogenous murine prion protein gene (Prnp) was replaced with the bank vole prion protein gene (BvPrnp). Prion-inoculated mice that were retro-orbitally transduced with a protective rAAV vector encoding BvPrnpV127ΔGPI survived ~50 days longer than control mice that were unprotected. A deep proteomic analysis revealed that BvPrnpV127ΔGPI was protective by slowing perturbations to the proteome observed in late-stage RML prion disease. In addition to capturing details of synaptic decay and depletion of proteins in proximity to PrP, the proteomic dataset revealed the identity of proteins of potential diagnostic value that may be central to the brain’s attempt to fight prion disease by contributing to astrocytosis or microgliosis, by coping with calcium influx, or by enhancing the endoplasmic reticulum processing of essential proteins. Taken together, our results demonstrate that a gene therapy based on a GPI-anchorless PrP containing the G127V mutation can delay the onset of prion disease in mice, providing a framework for development of a corresponding therapy in humans.
Author summary
A rare change in the human prion protein, involving a single building block, has been linked to strong protection against prion diseases—fatal neurodegenerative disorders. This study tested whether that protective effect could be reproduced using gene therapy in mice. To this end, we exposed the animals to infectious prions and then delivered the protective version of the protein into mice using a viral carrier. Treated mice survived about seven weeks longer than untreated animals, showing that the approach can meaningfully slow disease progression. To understand why, we examined changes in brain proteins during disease and found that treatment helped preserve the normal protein levels of cellular proteins, particularly those involved in communication between nerve cells. The analysis also identified proteins altered in the disease that are linked to the brain’s defense responses, including inflammation, stress handling, and protein processing, some of which may serve as future disease markers. Importantly, the limited protection observed was not due to poor delivery of the therapy but likely reflects biological limits of the model used. Overall, the findings support the idea that gene therapies based on naturally protective human variants could help slow prion diseases and improve understanding of how the brain responds to them.
Citation: Zerbes T, Verkuyl C, Zhang C, Grunnesjoe S, Eid S, Arshad H, et al. (2026) A self-complementary recombinant adeno-associated virus vector coding for an anchorless prion protein carrying the G127V mutation extends survival in a rodent prion disease model. PLoS Pathog 22(8): e1014124. https://doi.org/10.1371/journal.ppat.1014124
Editor: Jason C. Bartz, Creighton University, UNITED STATES OF AMERICA
Received: March 26, 2026; Accepted: July 26, 2026; Published: August 4, 2026
Copyright: © 2026 Zerbes et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD076487.
Funding: Work on this project was supported by an operating grant of the Canadian Institutes for Health Research (CIHR) (grant number 202209PJT) and an infrastructure grant from the Canadian Foundation for Innovation and Ontario Research Fund (CFI/ORF) (project number 43017). GS received generous support from the Krembil Foundation and the Krembil Brain Institute. HW acknowledges support from a National Institutes of Health (NIH) award (grant number R01AI156037). None of the authors received a salary from the aforementioned funders. CV, AB, and SE were supported by Canada Graduate Scholarships. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: We have read the journal’s policy and the authors of this manuscript have the following competing interests: GS has filed an international patent application titled ‘Treatment of prion diseases using gene therapy’ (WO 2025/260196 A1) published under the patent cooperation treaty (PCT) based on innovations embedded in this manuscript and is engaged in the early development of a startup with a mandate to advance a treatment for prion diseases to the clinic. TZ, HA, WZ, and TO are unpaid contributors and JW and HW are unpaid scientific advisers to this same effort. This does not alter our adherence to PLOS policies on sharing data and materials.
Introduction
Prion diseases are neurodegenerative diseases that afflict humans and a subset of mammals [1]. To date, human manifestations of these diseases have remained incurable and are the cause of approximately 1 in 5,000 deaths [2]. In these diseases, the cellular prion protein (PrPC), a small GPI-anchored protein [3] that is expressed from the prion protein gene (Prnp) in most vertebrate cells, converts through templated polymerization into a β-sheet-rich alternative conformer, referred to as PrP Scrapie (PrPSc). In contrast to other neurodegenerative diseases whose etiologies are characterized by complex genetics contributing to disease risk, prion diseases are largely a one-gene disorder. Moreover, when working with prion-infected mice, these mice are not mere models for the disease but develop the disease with all its hallmarks, namely PrPSc deposition, astrogliosis, spongiform degeneration, and ultimately disease progression until death.
Several recent preclinical studies which evaluated PrP lowering approaches have generated optimism that an effective treatment can be found. Initially, a seminal proof-of-concept study of prion-infected mice, treated with antisense oligonucleotides (ASOs) designed to facilitate the destruction of Prnp transcripts and consequent lowering of PrPC levels in the brain, documented dose-dependent survival extension in the absence of overt phenotypes [4]. Despite this success, and evidence that the ASOs reached most brain cells, the study also revealed the limits of survival extension that may be achieved with this approach. When paired with the uncertainty of its translation into the clinic and the recurrent invasive intrathecal delivery required for ASOs, a need arises to continue exploring alternative therapy angles, including strategies based on rAAV vectors that deliver PrPC-lowering gene therapies. Amongst them are rAAV vectors coding for innovative payloads that silence prion gene expression by (i) directing compact epigenetic editors to the prion gene [5], (ii) instructing base editors to ablate prion gene transcription through the introduction of nonsense codons [6] and (iii) deploying zinc finger repressors (ZFRs) tailored to block prion gene transcription [7]. All the above gene therapies have been reported to lower brain-wide PrPC levels by more than 50%.
The ZFR-based strategy stands out because it was effective in vivo when delivered using PHP.B capsids as late as 120 days after the mice had been inoculated with prions, a time-point coinciding with the presentation of first overt prion disease symptoms in mice. Moreover, to overcome challenges with the delivery of rAAV vectors to human brain cells, the authors identified and made use of a capsid (STAC-BBB) whose brain tropism exceeded the corresponding tropism of AAV9 700-fold upon intravenous administration to cynomolgus monkeys. When administered to cynomolgus monkeys, the STAC-BBB-ZFR therapy achieved profound reduction in PrPC levels in a non-human primate after single intravenous dosing. A close look at the results from this study point toward two challenges. First, despite impressive performance characteristics of STAC-BBB, its PrPC lowering capacity in cynomolgus monkeys was inferior to the corresponding potency of the PHP.B capsid used in mice. Second, although the administration of AAV-ZFRs lowered Prnp mRNA levels by >95% in vitro and to near undetectable levels within individual transduced mouse neurons in vivo, all prion-inoculated mice, including those still alive at the 480-day study endpoint, exhibited weight loss and increased levels of the neurodegeneration biomarker neurofilament light, indicating that prion disease was not stopped altogether. The latter limitation indicates that therapies which merely lower PrPC (as opposed to fully eliminating its expression) may not manifest as a cure due to residual PrPC enabling prion replication and neurodegeneration. Consequently, there is a need to explore orthogonal gene therapy approaches that require the transduction of a lower percentage of brain cells for them to disarm the toxicity of PrPSc.
The human PrPV127 mutation, discovered in the geographic epicenter of the kuru endemic in Papua New Guinea, may offer an untapped opportunity in this context. It has been credited with the survival of dozens of individuals among the Fore people who had been exposed to kuru disease through the practice of ritualistic cannibalism [8]. Subsequent experimental work in mice, which were made co-transgenic for the human wild-type PRNP and mutant PRNPV127 genes, established that the V127 mutation confers protection against several human prion inocula even when co-expressed at three-fold lower levels alongside wild-type human PrPC [9]. Thus, if a rAAV vector would instruct brain cells to produce the V127 mutant, the level of transduction required to achieve complete protection from prion disease may be lower than what would be required for equivalent protection through a treatment approach that aims to silence PrP expression.
In prior transgenic work that validated the protective capacity of PrPV127, both wild-type PrP and PrPV127 were co-expressed at consistent ratios in all cells responsive to the Prnp promoter because their expression was driven by the germ-line integration of the transgenes [9]. In contrast, after virus transduction only a subset of cells will be positive for the rAAV vector-delivered transgene expressing PrPV127 and others will express none. Considering ways to address this potential shortcoming led us to cross-correction, a concept and mechanism that has had traction in the context of lysosomal storage disorders [10]. In cross-correction, a small number of cells are turned into factories that release a therapeutic agent. Thereby, the therapeutic agent can act not only on the cells that produce it but also on neighboring cells. We hypothesized that cross-correction can be implemented for prion diseases by expressing a protective PrPV127 mutant lacking the GPI-anchor that normally attaches PrPC to the outer leaflet of the cell membrane. This can be achieved by removing the sequence encoding the C-terminal GPI-anchor signal sequence from the prion gene [11].
It has been observed repeatedly that the lack of a GPI-anchor causes nascent PrPC to become less N-glycosylated during its passage through the secretory pathway [11]. Evidence suggests that both the PrP GPI-anchor and the N-glycans can pose steric hindrances to spontaneous and templated conversion into PrPSc. Indeed, in transgenic mice over-producing a GPI-anchorless, underglycosylated PrP variant, PrPΔGPI spontaneously aggregates and deposits within the brain, causing clinical disease that is accelerated when membrane-anchored PrPC is also present [12,13]. Anchorless PrPC has also been shown to undergo templated in vitro conversion reactions more readily [14] and was observed to form denser deposits than wild-type PrPC [11]. Similarly, the recruitment of PrPC into the templated polymerization can be hindered by N-glycans—a phenomenon that has been largely attributed to the negative charges contributed by the natural sialylation of N-glycans attached to PrPC [15]. In converse, PrPC lacking N-glycans avoids these constraints and serves as a malleable substrate that exhibits a low seeding barrier in the templated conversion of a wide range of prion strains [15]. Yet, as shown for RML strains, glycan-deficient recombinant and glycan-comprising brain-derived prion assemblies can give rise to identical parallel in-register intermolecular β-sheet (PIRIBS) structures [16]. Finally, it has been reported that the half-life of anchorless PrPC is six-fold longer than the corresponding value for GPI-anchored PrPC [17]; if this observation was to translate to brain-expressed protein, then it could boost the relative steady-state levels of anchorless PrPC. Although these characteristics of anchorless PrPC would be undesirable when applied to the wild-type PrPC sequence, as they would increase the risk of it acting as a substrate for spontaneous or templated polymerization, we hypothesized that in the context of anchorless PrPV127 they may turn into an advantage by helping the protective qualities of PrPV127 against prion diseases to manifest and by rendering it more effective against a wide range of prion strains.
Here, we began to put these ideas and concepts to the test in mice. In addition to asking if rAAV vectors that deliver the protective PrPV127ΔGPI mutant provide any protection, we characterized effects of RML prion disease on the brain proteome at an unprecedented level of depth. Although many of our observations were consistent with our expectations, others were not.
Results
Design and proof-of-concept in vitro testing of a GPI-anchorless V127-derived therapeutic agent of low immunogenicity
Although the precise mechanism by which V127 confers protection is still being debated, there is broad agreement that the protective mutant acquires the same fold as native PrPC, barring minor structural differences surrounding the mutated residue [18–21]. Similarly, when PrPC is expressed without its N-glycans, a natural consequence of the removal of the GPI-anchor attachment sequence, it will still acquire its natural PrP-fold [22–24] (Fig 1A and 1B). These insights are notable for immunological considerations, as they predict that an anchorless PrPV127ΔGPI therapeutic agent would have low immunogenicity. In contrast, rAAV capsids can be expected to elicit a moderate immune response in naïve mice. Whereas in humans prior exposure to natural AAVs represents a major consideration [25], for studies in mouse models this concern is small if no repeat administrations are planned. Consequently, so long as the design of the synthetic coding sequence for the transgenic expression of PrPV127 avoided highly immunogenic CpG islets [26], the packaged therapeutic construct was expected to exhibit low immunogenicity, largely restricted to the DNA payload. To mitigate immunogenicity of the latter, we capitalized on redundancies in the genetic code and eliminated most occurrences of CpGs (S1A Fig).
(A) Genome organization of the human (Hs) PRNP gene. Zoom-in depicts the sequence organization of the ORF. Colors highlight coding segments as follows: beige, signal peptide for co-translational ER targeting; blue, octarepeats; brown, hydrophobic region; green, β-sheets; red, α-helices; grey, signal sequence for attachment of GPI-anchor. (B) The protein structure model identifies the approximate position of the G127V residue within the tertiary fold of PrPC with a red circle. For ease of orientation, the image depicts a PrPC molecule that is inserted into a membrane bilayer with a GPI-anchor. Grey shapes protruding from the red-colored globular domain represent stylized N-glycosylations. (C) Cartoon depicting in vitro paradigm used to assess if a GPI-anchorless MoPrPV126ΔGPI expression product can lower the steady-state prion infection level of RML-inoculated CAD5 cells. The schematic of the cell culture dish was created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj (D) Side-by-side comparison of cellular extracts from RML-infected CAD5 cells that were transfected with plasmids coding for a negative control protein (spEGFP), MoPrPV126 or MoPrPV126ΔGPI. Note the additional relative fast migrating band reactive to the HuMD13-directed PrP antibody, whose appearance is consistent with the expression of unglycosylated MoPrPV126ΔGPI. (E) Proteinase K analysis of protein extracts shown in Panel C. The ectopic expression of MoPrPV126 or MoPrPV126ΔGPI lowered the intensity of Proteinase K-resistant PrPSc. (F) Relative quantitation of Proteinase K signals of RML-infected CAD5 cells transfected with plasmids coding for spEGFP, MoPrPV126 or MoPrPV126ΔGPI.
To our knowledge, it had not been reported whether the absence of a GPI-anchor interferes with the protective capacity of the V127 mutant. To begin to answer this question, we preceded the in vivo work with proof-of-concept in vitro experiments in a mouse cell line (CAD5). CAD5 cells had been derived from an immortalized CNS catecholaminergic cells (Cath.a) [27] and shown to be susceptibility to RML prions [28]. To implement this pilot experiment, the cells were RML prion inoculated over a span of three weeks, then passaged onto fresh plates and transfected with MoPrPV126ΔGPI expression constructs (note that V126 in murine PrP is the ortholog of V127 in human PrP). To enhance expression the open reading frame was placed downstream of a CBh promoter and the coding sequence for the mouse PrP signal peptide for translocation into the endoplasmic reticulum (ER) was replaced with the human prolactin signal peptide (PRLss). Cell culture plates that were side-by-side transfected with the respective expression constructs coding for anchored MoPrPV126 or EGFP carrying a signal peptide for ER translocation (spEGFP) served as positive and negative controls. Five days after transfection, cellular extracts were either directly analyzed by western blotting or first digested with Proteinase K (Fig 1C). The western blots of total cellular extracts showed the expected cell-bound expression of anchored, and therefore N-glycosylated, PrPV126. In contrast, MoPrPV126ΔGPI was observed as a faster migrating and sharper band, consistent with it being expressed in unglycosylated form.
The Proteinase K-digested cellular extracts of all treatment conditions gave rise to the protease-resistant band pattern expected for this RML-infected cell model, consistent with the presence of unglycosylated and single or double N-glycosylated PrP contributing to the Proteinase K-resistant material. However, the intensity of the respective PrP-reactive signals differed, with negative control (spEGFP) expressing cultures giving rise to the strongest protease-resistant bands, and MoPrPV126ΔGPI-transfected cultures showing the lightest Porteinase K-resistant PrP signals (Fig 1D). The subsequent quantitation of PrP signals validated this visual impression but did not reach statistical significance in the direct comparison of the protective effect of MoPrPV126 versus MoPrPV126ΔGPI (Fig 1E). Together, this pilot data validated the notion that V126 can be protective also in the context of an anchorless expression constructed and hinted at cross-correction having contributed to the protection it conferred.
Retro-orbital injection of BvPrnpG127VΔGPI into prion-inoculated mice caused similar survival extension regardless of rAAV vector preparation method or capsid choice
Rather than working with wild-type mice, we selected for the in vivo work in this study the recently introduced bank vole knock-in (BvPrnp ki) model in which the endogenous mouse Prnp open reading frame (ORF) was replaced with the respective BvPrnp ORF encoding isoleucine at polymorphic codon 109 [29]. Two considerations guided this choice: 1) BvPrnp-expressing mice had been shown to develop disease faster than wild-type mice [30]. 2) In anticipation of future inoculation work with human prions, we hoped to capitalize on bank vole PrP’s universal prion acceptor characteristics, when we translate results from work with mouse prion inocula (this work) to future work with human prion inocula [31,32].
To maximize the expression of the heterologous BvPrnpV127ΔGPI, the payload was designed as a self-complementary DNA, thereby avoiding the replication step that single-stranded AAV vectors must undertake upon transduction [33], a limiting biology dependent on the availability of host cell factors (S1B Fig). Specifically, the expression cassette of the construct was flanked by inverted terminal repeats (ITRs) derived from the AAV2 serotype, with one of the ITRs carrying a small deletion within the terminal repeat sequence (TRS) motif known to manifest in self-complementarity [34]. The expression of BvPrnpV127ΔGPI was driven by the chimeric chicken β-actin promoter with intron (CBh) that had been shown to promote the steady expression of transgenes in mouse brains for extended periods [35].
While the study was underway, several advances were made in the rAAV field, including new purification methods and capsids with improved ability to cross the blood brain barrier (BBB). In line with the pilot nature of the study, we included comparisons of two of these developments: 1) an affinity capture-based purification method using AAVX matrices, which we compared to the commonly used iodixanol gradient centrifugation (S1 Fig) [36], and 2) the 9P31 (Voyager Therapeutics Inc.), which has been reported to achieve several-fold greater CNS penetrance than PHP.eB, a capsid widely for CNS targeting in mice after intravenous delivery [37].
Purity assessments of rAAV vectors that we prepared by AAVX affinity chromatography showed predominantly three bands derived from the three capsid isoforms VP1, VP2, and VP3 in the expected approximate ratio of 1:1:10 after SDS-PAGE separation (S1D Fig). To test the 9P31 vector, we assembled a self-complementary rAAV vector identical to the one described for the expression of BvPrnpV127ΔGPI, except that the BvPrnpV127ΔGPI ORF was replaced with a coding sequence for spEGFP (S1E Fig) [38]. In line with previous reports, the AAVX method led to cleaner preparations of the recombinant AAVs than iodixanol gradient centrifugations [36] and the 9P31 capsid led to greater CNS expression of the ectopic proteins than delivery in PHP.eB capsids [37,39].
As we were gearing up for the in vivo work, our breeding stock of BvPrnp ki mice produced relatively small litters, which forced us to replace plans of parallel inoculations with staggered inoculations. We hypothesized that the expression of V127 within the context of an anchorless BvPrnp expression construct (BvPrnpV127ΔGPI) might lead to the longest survival extension due to enhanced cross correction. Consequently, we began the in vivo studies by comparing side-by-side mice that had been prion-inoculated on the same day, then were either left untransduced or were intravenously (retro-orbital) transduced 60 days later with rAAV vectors coding for spEGFP (negative controls) or BvPrnpV127ΔGPI (Fig 2A). The latter cohort consisted of three sub-cohorts. Two of these were transduced with 9P31 vectors that had been purified either by iodixanol density centrifugation or AAVX affinity chromatography (S1C Fig). The third sub-cohort was transduced with rAAV vectors encapsulated in the PHP.eB capsid that had also been purified by AAVX affinity chromatography. Deferred were the analyses of mice transduced with 9P31 encapsulated vectors coding for anchored BvPrPV127.
(A) Timeline of pilot in vivo prion infection and treatment study in BvPrnp ki mice. Note that all endogenous and heterologous bank vole sequences employed in this work carried the I109 polymorphism. The schematic of the mouse was created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj (B) Kaplan-Meier chart comparing the survival of negative control mice and treated mice. (C) Weight analysis chart depicts the relative weights of mice shown in Panel B from the time of 100 dpi to the time of sacrifice when the animals met humane prion disease endpoints. Note that weights of individual mice were normalized to their weight at 100 dpi to account for individual weight differences and sex-specific weight differences. (D) Nesting analysis chart showing the nesting score of mice shown in Panel B from 100 dpi to the end of the study. (E) Chart documenting that the alternative rAAV vector preparation methods based on AAVX affinity capture or iodixanol gradient centrifugation for purifying the therapeutic 9P31-BvPrnpV127ΔGPI had an insignificant influence on survival extension. (F) No significant differences in the survival times afforded by the expression of BvPrnpV127ΔGPI was observed whether the therapeutic payload was encapsulated in the PHP.eB or 9P31 capsid. In all graphs, 95% confidence intervals are indicated by shading around the curves. Asterisks shown in the survival charts indicate time-points when mice were prematurely sacrificed during the study to serve as controls in downstream biochemical analyses. Consequently, these three mice were excluded from the statistical analyses.
As expected, RML-prion inoculated BvPrnp ki mice began to show symptoms 130–150 days post-inoculation (dpi) and had to be sacrificed shortly thereafter when they reached prion disease endpoint (Fig 2B). Whether the prion-inoculated mice were left untransduced or transduced with the negative control 9P31-spEGFP vector made only a small difference to their survival, with transduced mice succumbing slightly sooner. In contrast, the cohort of mice that had been made to express the therapeutic BvPrnpV127ΔGPI construct, survived approximately 50 days longer. One characteristic of the Kaplan-Meier curve for this cohort is a relatively broad spread of survival times from 150 to a maximum of 232 days, possibly reflecting variances associated with the administration of the therapeutic capsids (Fig 2B). Plotted results from monitoring body weights (Fig 2C) and nesting scores (Fig 2D) of the mice reflected both the survival extension as well as the more gradual decline in the BvPrnpV127-ΔGPI cohort. When the latter results were deconvoluted based on how the 9P31-BvPrnpV127ΔGPI capsids were prepared (Fig 2E) or whether the payload was encapsulated in 9P31 or PHP.eB, subtle shifts to longer survival time were observed when rAAV vectors had been AAVX purified and encapsulated in 9P31, but no significant differences emerged (Fig 2F). In particular, the finding that the increased ectopic expression conferred by 9P31 was not correlated with an increased survival extension was surprising as it points toward a ceiling efficacy in this paradigm.
Survival extension afforded by BvPrnpV127ΔGPI is accompanied by reduced PrPSc accumulation but does not correlate linearly with steady-state expression levels of therapeutic payload
To begin to understand how the expression of BvPrnpV127ΔGPI had delayed the disease, at 152 dpi, i.e., when the longest surviving prion-inoculated control mouse that had been transduced with the 9P31-spEGFP vector reached prion disease endpoint, a small number of BvPrnp ki mice, which had been treated with the 9P31 encapsulated vector coding for the BvPrnpV127ΔGPI mutant, were also sacrificed, along with naïve age-matched control BvPrnp ki mice that had neither been prion-inoculated nor transduced. Both, these naïve mice, and the RML-inoculated mice treated with 9P31-BvPrnpV127ΔGPI showed no overt signs of prion disease at the time of their sacrifice. Sagittal half brains of these mice were formalin-fixed, and the remaining half brains were homogenized and extracted, then processed for western blot analyses with or without prior digestion with Proteinase K. This analysis revealed the expected increase in total PrP levels, a result of the accumulation of PrPSc, in RML prion-inoculated mice (relative to uninoculated age-matched control mice) that had been transduced with 9P31-spEGFP negative control viruses (Fig 3A and 3B). In contrast, RML prion-inoculated mice that had been transduced with the therapeutic 9P31-BvPrnpV127ΔGPI vector showed lower levels of PrPSc accumulation but were not devoid of Proteinase K-resistant PrPSc (Fig 3C and 3D).
(A) Western blot analysis of extracts from sagittal half brains of BvPrnp ki mice that were either from a cohort of naïve mice, or RML-inoculated mice that were mock-treated with a 9P31-spEGFP vector or treated with the 9P31-BvPrnpV127ΔGPI vector. Note that all animals were sacrificed by 152 days, i.e., when the last surviving RML-inoculated, mock-treated cohort reached its prion disease endpoint. A western blot depicting steady-state beta actin (Actb) levels served as a loading control in this analysis. (B) Quantification of combined BvPrP and BvPrPV127ΔGPI signal levels (normalized to Actb levels) revealed significant differences (Student’s t-test) in the three cohorts compared in Panel A. (C) Analysis of Proteinase K-resistant PrPSc in protein extracts analyzed in Panel A. (D) Bar graph quantifying band intensities of Proteinase K-resistant PrPSc shown in Panel A The data were normalized to PrPSc levels in the mock-treated cohort transduced with the 9P31-spEGFP vector. (E) Therapeutic vectors encapsulated in 9P31 caused robust expression of BvPrnpV127ΔGPI that exceeded endogenous total PrP levels more than threefold. Western blot analysis of extracts from sagittal half brains of BvPrnp ki mice that were RML-inoculated but then were either mock-treated through transduction with the spEGFP vector or transduced with therapeutic vectors coding for BvPrnpV127ΔGPI. For this analysis, brains from all mice were harvested after the animals reached their individual prion disease endpoint as shown by their unique dpi. To facilitate the recognition of the therapeutic BvPrnpV127ΔGPI signal amongst a complex mixture of N-glycosylated endogenous BvPrP expression products, N-glycans were removed by PNGase F digestion prior to the western blot analysis. Note the pronounced signal of the BvPrnpV127ΔGPI band, which migrated as expected a bit faster than the endogenous wild-type full-length BvPrP band on account of it lacking the GPI-anchor. The detection of Actb served again as loading control in this analysis. (F) The bar graph quantifies the intensities of combined BvPrP and BvPrnpV127ΔGPI signal levels in the treatment cohorts depicted in Panel E. (G) Bar graph quantifying the intensities of C1 signals of treatment cohorts depicted in Panel E. Note the slight increase in both C1 and C2 levels in brain extracts of mice that had been transduced with 9P31 encapsulated rAAV vectors coding for BvPrnpV127ΔGPI, possibly indicating that the ectopic expression of this protein contributed to the total intensity of these proteolytic fragments. (H) Side-by-side analysis of one brain extract from each of the four treatment cohorts analyzed in Panel C with or without digestion with Proteinase K followed by digestion with PNGase F. Note that the bands visible in lanes 6, 9, and 12 don’t appear to constitute doublet signals, which would be expected if the anchorless BvPrPV127ΔGPI had contributed to the Proteinase K-resistant PrPSc. (I) Analysis of Proteinase K-resistant PrPSc levels in subset of brain extracts of mice analyzed in Panel E. This analysis focused on the mice that had been transduced with the 9P31-encapsulated and AAVX-purified rAAV vectors coding for BvPrnpV127ΔGPI, which showed the highest ectopic expression of BvPrnpV127ΔGPI. The western blot revealed no additional band whose migration would be consistent with the possible formation of Proteinase K-resistant BvPrnpV127ΔGPI.
Once the remaining cohort of the 9P31-BvPrnpV127ΔGPI-treated mice had reached the disease endpoint, we undertook additional western blot analyses, after processing their half brains as above. These experiments were guided by an interest in understanding why the sub-cohort, which had been treated with the PHP.eB-encapsulated payload coding for BvPrnpV127ΔGPI had shown a similar survival extension as the mice whose identical therapeutic construct had been encapsulated in the 9P31 capsid, a counterintuitive result based on our prior observation that 9P31 vectors mediated an approximately seven-fold higher CNS transduction than PHP.eB vectors when payloads, virus preparation, and administration steps were identical [39]. Since we were particularly interested in determining the steady-state BvPrnpV127ΔGPI expression levels that had been reached in the treated cohort, for this western blot analysis the total brain extracts were first digested with PNGase F so that PrP isoforms differing solely in their N-linked glycans would be reduced to a single band (Fig 3E and 3F). Intriguingly, this analysis corroborated the relative CNS transduction potencies of 9P31 and PHP.eB by showing that the BvPrnpV127ΔGPI-derived western blot signals were considerably stronger when the payload had been encapsulated in 9P31 than the respective signal in brain extracts of mice that had been transduced with the corresponding PHP.eB vector. In fact, the western blot signal that we interpreted to represent BvPrnpV127ΔGPI by its absence in non-transduced RML-inoculated mice or in mice that had been transduced with 9P31-spEGFP emerged as the strongest PrP antibody-reactive signal. The intensity of this band in 9P31-BvPrnpV127ΔGPI mice exceeded more than threefold the respective signals for endogenous wild-type BvPrP. This result indicated that the transduction worked better than we had anticipated but it also indicated that the therapeutic potency of BvPrnpV127ΔGPI, when measured based on the survival extension it conferred, did not correlate linearly to its expression level in BvPrnp ki mice. We also noted that C-terminal proteolytic bands of PrPC were slightly elevated in cohorts transduced with 9P31-encapsulated virus particles coding for 9P31-BvPrnpV127ΔGPI (Fig 3G), consistent with a scenario whereby the presence of the protective V127 variant may have allowed more of these fragments to accumulate before the mice reached the prion disease endpoint.
Finally, we sought to determine if the highly expressed BvPrPV127ΔGPI contributed to the formation of Proteinase K resistant material in the treatment cohort after these mice had succumbed to prion disease. To reduce the complexity of signals expected if isoforms with varying N-glycan occupancy were present, we first digested representative brain extract from each of the four cohorts with Proteinase K, then removed N-glycans from the resolubilized PrPSc material by an additional digestion with PNGase F. The side-by-side analysis of the resultant PrP products next to undigested or only PNGase F digested samples revealed that mice, which expressed both the endogenous BvPrnp gene and the synthetic BvPrnpV127ΔGPI construct, still only gave rise to a single PrPSc signal which ran at the same level as the respective band in mice that were not transduced (Fig 3H). Previous work with prion-inoculated transgenic mice that expressed both wild-type PrP and anchorless PrPΔGPI documented that Proteinase K-resistant unglycosylated bands derived from anchorless PrPΔGPI run considerably faster than the corresponding wild-type-derived bands and can easily be distinguished in a western blot analysis [11]. No such bands were observed even in mice characterized by the highest ectopic expression of BvPrPV127ΔGPI (Fig 3I). These results suggested that BvPrPV127ΔGPI did not contribute in RML-infected mice to the formation of Proteinase K-resistant PrPSc, even though the mice expressed relatively high levels of the protective variant and died at ~200 dpi of symptoms consistent with a late-stage prion disease diagnosis.
More than threefold increase in total PrP and 20-fold higher levels of unglycosylated PrP in mice transduced with BvPrnpG127V-ΔGPI at gene levels equivalent to endogenous BvPrnp
Next, we sought to assess the extent to which the brain-wide delivery of the genetic payload of our gene therapy had occurred. To this end, we capitalized on nucleotide sequence differences in the endogenous BvPrnp ORF and the synthetic BvPrnpV127ΔGPI-ORF. Specifically, we identified a stretch within the respective ORFs that could be amplified with the same PCR primers because it was flanked by identical nucleotide sequences yet could only be digested by one or another restriction enzyme, namely EagI for endogenous BvPrnp gene sequences and CsiI for BvPrnpV127ΔGPI inserted into the genome following transduction (Fig 4A). By comparing the signal intensity of the fragments released by the respective restriction enzymes, this assay could inform about the relative amount of genomic DNA (gDNA) coding for BvPrP that was contributed by the endogenous and heterologous synthetic ORF. The analysis revealed that the relative amounts of genomic endogenous BvPrnp ORFs were approximately matched to those of the heterologous synthetic BvPrnpV127ΔGPI ORFs in mice that had been transduced with the 9P31- BvPrnpV127ΔGPI vectors (Fig 4B).
(A) Schematic of PCR and restriction enzyme (RE) digest analysis of genomic brain DNA preparations of mice for determining the relative abundance of endogenous and heterologous BvPrnp ORFs. (B) Transduction of mice with 9P31-BvPrnpV127ΔGPI gave rise to the detection of RE cleavage products specific for heterologous BvPrnpV127ΔGPI. Note that the signal intensities of RE digested PCR products in lanes 10 and 11 are approximately matched, indicating similar levels of BvPrnp and BvPrnpV127ΔGPI ORFs in the genome. (C) Schematic showing sample workup scheme for global proteome analysis. The image of the sagittal half brain was created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj. (D) MS2 spectrum of the tryptic peptide ESQAYYEGR contributed by endogenous and heterologous pools of BvPrP. (E) MS2 spectrum of the tryptic peptide GENFTETDVK comprising the second ‘NxT’ N-glycan acceptor consensus motif within BvPrP. (F-I) Quantitation of tryptic BvPrP peptides that are present in all BvPrP sequences analyzed (F), only observed in the sub pool of BvPrP that is non-glycosylated at GENFTETDVK. (G), only present in endogenous BvPrnp expression products (H), or only present in the heterologous BvPrnpV127ΔGPI expression product (I). (J) Steady-state total BvPrP levels, comprising both endogenous and heterologous BvPrP expression products, revealed in global proteomic analysis based on 52% sequence coverage and the assignment of 151 PSMs to 12 unique BvPrP-derived peptides.
Although instructive in their own right, the DNA-based comparison cannot inform about steady-state protein levels of the endogenous BvPrP versus the ectopically expressed BvPrPV127ΔGPI protein. This is because the method is agnostic to the influence of the promoters, with the expression of the BvPrnp knock-in being driven by the endogenous mouse Prnp promoter, and the ectopically expressed BvPrnpV127 relying on the CBh promoter. Moreover, the steady-state protein levels between the two proteins can also be expected to differ on account of the presence or absence of the GPI-anchor, which is known to influence the half-life of PrP. To dissect relative abundances of the endogenous and ectopic PrP in detail and deconvolute how the absence of the membrane anchor in BvPrPV127ΔGPI impacts the ratio of N-glycosylated to glycosylated PrP in a half-brain, we generated samples for orthogonal mass spectrometry analyses from the same samples we had subjected to western blot analysis (Fig 3A).
To this end, the total brain extracts were fully denatured in the presence of urea, then reduced and alkylated, and finally trypsinized. Using 30-minute gradients, tryptic mixtures were separated on a reversed phase column. The effluents from this separation were online coupled by nanospray ionization to an Orbitrap Astral mass spectrometer, which was operated in data-independent acquisition (DIA) mode (Fig 4C). The depth of the proteome dataset that the DIA mode afforded allowed specific BvPrP-derived tryptic peptides to be compared in their relative quantities.
We focused these analyses initially on three specific BvPrP-derived tryptic peptides in the nine samples, namely 1) the peptide ESQAYYEGR present in both endogenous and heterologous PrP (Fig 4D), 2) the peptide GENFTETDVK, harboring one of the two N-linked glycan acceptor sites (NxT) present in the protein (Fig 4E), and 3) the respective BvPrP peptides that surround the G127 or V127 residues and therefore can be unequivocally assigned to endogenous BvPrP or the heterologous BvPrPV127ΔGPI, respectively. These analyses detected the generic BvPrP peptide at lowest levels in the naïve mice, at slightly increased levels in RML-inoculated mice, and at 3.6fold higher levels in the 9P31-BvPrnpV127ΔGPI-ORF-transduced mice (Fig 4F). The peptide harboring the unmodified N-glycan acceptor site was present at approximately 20-fold higher levels in the BvPrnpV127ΔGPI-ORF-transduced mice. Considering the more than three-fold higher total BvPrP levels in these mice, this result suggests that the heterologous anchorless protein is approximately 6-fold less likely to carry the N-glycan at the respective acceptor site than the endogenous protein (Fig 4G). The BvPrP peptide comprising the wild-type BvPrP G127 residue was observed at about twice the level in the RML-inoculated samples (Fig 4H), consistent with the stabilization and overall increase in steady-state PrP levels that are commonly observed in prion-infected mice. Finally, as anticipated, the V127-comprising peptide was not detected in naïve or RML inoculated mice transduced with the control 9P31-spEGFP vector but was robustly detected in mice transduced with 9P31-BvPrnpV127ΔGPI (Fig 4I).
Consistent with the western blot data and the genomic DNA analyses, the mass spectrometry-based quantitation indicated that the total steady-state BvPrP levels in mice which had been transduced with the 9P31-BvPrnpV127ΔGPI-ORF vector were approximately 3.6-fold higher than the respective quantity in the naïve BvPrnp ki mice (Fig 4J).
However, these data also indicated that this increase at the protein level was not reflected at the gDNA level, where endogenous and heterologous BvPrnp ORFs were approximately matched in 9P31-BvPrnpV127ΔGPI transduced brains.
BvPrnpV127ΔGPI reduced levels of Proteinase K-resistant PrPSc relative to anchored BvPrnpV127
To begin to assess if cross-correction of an anchorless BvPrnpV127ΔGPI expression construct can supersede the protection conveyed by the expression of anchored BvPrnpV127, we next compared directly the survival curves of BvPrnp ki mice that had been transduced with 9P31-delivered virus vectors, whose therapeutic payload differed only in the inclusion or omission of the GPI-attachment sequence within the protective BvPrnpV127 ORF. Consistent with the hypothesis that cross-correction may enhance the protective capacity of BvPrnpV127ΔGPI transduced mice, the Kaplan-Meier curves of mice that had received retro-orbital injections of the 9P31-delivered vectors coding for anchored BvPrnpV127 led to a shorter survival extension of ~25 days (Fig 5A). This finding was validated by western blot analyses of brain extracts of age-matched mice from the two treatment cohorts. Specifically, these analyses documented that levels of Proteinase K-resistant PrPSc were significantly higher (30%, p < 0.05) in mice that had been treated with the expression construct coding for anchored V127 (Fig 5B and 5C). As in our previous western blot analyses (Fig 3), no evidence of Proteinase K-resistant BvPrnpV127ΔGPI was detected in these western blots when we analyzed samples of 9P31-BvPrnpV127ΔGPI-transduced mice.
(A) Comparison of survival extension in cohorts of BvPrnp ki mice following retro-orbital transduction of 9P31 encapsulated virus vectors coding for anchored BvPrPV127 versus anchorless BvPrnpV127ΔGPI. (B) Side-by-side comparison of steady state total PrP levels with and without prior Proteinase K digestion in end-stage prion disease BvPrnpV127ΔGPI transduced with the respective therapeutic constructs. (C) Relative quantification of Proteinase K-resistant signals in the western blot shown in Panel B. (D) IHC characterization of PrP-reactive signals within the hippocampal formation of an RML-inoculated BvPrnp ki positive control mouse that was not transduced. (E) Negative control IHC image of a hippocampus from a BvPrnp ki mouse that was not prion-inoculated but transduced with a 9P31-EGFP virus. (F) BvPrnp ki mice following retro-orbital transduction of 9P31 encapsulated virus vectors coding for anchorless BvPrnpV127ΔGPI at 196 dpi. The IHC images were counterstained with Hematoxylin-Eosin. Sizing bar is 100 µm.
When the brains of 9P31-BvPrnpV127ΔGPI-transduced mice were assessed by immunohistochemistry (IHC), next to negative control mice that had been RML-inoculated and mock transduced (Fig 5D) or non-inoculated mice that were transduced with an spEGFP coding vector (Fig 5E), the pattern of protein deposition differed slightly. Specifically, a subset of deposits in the hippocampus of mice transduced with BvPrnpV127ΔGPI tended to be larger than the corresponding hippocampal PrP deposits in mice transduced with spEGFP, which were smaller and more diffuse, as expected for the RML strain (Fig 5F). Further investigation of adjacent brain sections by IHC directed at Gfap or Iba1 validated the presence of astrocytosis and microgliosis in end-stage RML-infected mice but revealed no apparent difference in this regard in mice transduced with the 9P31-spEGFP or 9P31-BvPrnpV127ΔGPI viral vectors (S2 Fig). A previous report described a predominant perivascular deposition phenotype in transgenic mice engineered to overexpress anchorless mouse PrnpΔGPI without the protective mutation [11]. No conspicuous association of deposits with blood vessels was observed in 9P31-BvPrnpV127ΔGPI-transduced mice but this point warrants further investigation.
Expression of BvPrnpV127ΔGPI slows perturbations to the proteome observed in prion-inoculated mice
Although a fair bit is known about how prion diseases affect specific proteins, and it has been reported that the disease affects global protein synthesis following activation of the unfolded protein response [40], systematic in-depth proteome comparisons of age-matched naïve and prion-inoculated end-state prion disease brains have, to our knowledge, not been reported. Moreover, despite reports of V127 conferring some resilience to structural dynamics in vitro [21,41], our understanding of how V127 confers its protection against prion diseases remains limited. Although it is apparent that the expression of V127 slows the accumulation of PrPSc, it is not known if its protective effect manifests in a mere slowing of prion disease-associated perturbations or involves more specific protective changes to the proteome. To fill these knowledge gaps, we further interrogated the mass spectrometry dataset of brain extracts from age-matched naïve BvPrnp ki mice, and the corresponding prion-inoculated and mock 9P31-spEGFP- versus 9P31-BvPrnpV127ΔGPI-treated mice (Fig 4C).
A high degree of run-to-run proteomic sequence coverage afforded by the DIA acquisition mode obviated the need for isobaric labeling, thereby enabling MS2-based relative quantitation of consecutively analyzed samples. Taken together, this configuration allowed the deep unsupervised characterization of the mouse brain proteome, leading to the relative quantification of 4,874 proteins in all cohorts, comprised of three biological replicates for each of the three cohorts (Fig 6A). More than 800 of these proteins were identified based on peptide-to-spectrum matches (PSMs) that accounted for more than 50% coverage of their protein sequence, with approximately half of the protein identifications supported by ≥100 PSMs, and more than 4,800 protein identifications based on ≥10 PSMs. Even at cursory inspection, it was apparent that the three biological replicates for each cohort were more like one another than samples from other cohorts, an impression supported by results from an unsupervised hierarchical clustering analysis (see below).
(A) Global proteome summary diagram documenting benchmarks of the analysis, including the number of proteins whose steady-state levels in RML-inoculated and mock-treated brains were ≥ 33% altered relative to their average protein levels in naïve mouse brains. (B) Result from hierarchical clustering analysis of global proteome dataset. Note that the unbiased clustering analysis grouped the cohorts in accordance with the study design, i.e., it identified three groups of highly similar brain extracts. The global proteomic signature of the mice, which were RML-inoculated and transduced with 9P31-delivered BvPrnpV127ΔGPI vectors, places them between the naïve and the RML-inoculated but mock-treated mouse cohort. (C) Zoom-in into the hierarchical clustering results focused on proteins whose steady-state levels are upregulated in RML-inoculated mice. The graph indicates highly consistent changes in the direction of perturbation for a given protein and corroborates that many proteins are to a lesser degree altered in their steady-state levels in the 9P31-BvPrnpV127ΔGPI treatment cohort than the 9P31-spEGFP mock-treated cohort. (D) Short-listed results from KEGG pathway analyses undertaken with proteins whose levels were ≥ 33% up- or down-regulated.
When the relative abundances of individual proteins in all nine samples were computed by forming ratios of their combined ion intensities in each sample and their respective average ion intensities in the naïve BvPrnp ki cohort, it emerged that most proteins were not altered by more than 33% in their steady-state levels in the disease. Yet, taking the opposite perspective, 780 genes were ≥33% upregulated in their expression and 455 proteins were ≥33% down-regulated at end-stage prion disease, relative to age-matched naïve BvPrnp ki mice. BvPrnpV127ΔGPI-treated mice fell between these two extremes and, importantly, exhibited no proteomic drifts relative to naïve mice that were not also observed in the RML-inoculated mice sacrificed at the humane prion disease endpoint. However, the abundance changes were less pronounced for these treated mice than what was observed for the respective protein abundances in the 9P31-spEGFP-transduced mice (Fig 6B and 6C). Taken together, these observations were consistent with the interpretation that the expression of BvPrnpV127ΔGPI does not prolong survival by having a specific effect on a sub proteome which can compensate for prion disease-induced proteome perturbations.
We next undertook pathway analyses to investigate more systematically the changes to the proteome that manifested in RML-inoculated BvPrnp ki mice. To this end, we interrogated the KEGG pathway repository with identifiers of proteins that were either ≥33% upregulated or downregulated (Fig 6D). Because these analyses were secondary to the main objective to understand how mock-treated versus BvPrnpV127ΔGPI-treated mice differ, the data cannot delineate the possible contributions of the rAAV transduction from proteomic shifts caused by prion disease alone. Consistent with expectations for prion disease-associated perturbations, these analyses revealed a highly significant reduction in the steady-state levels of proteins associated with synaptic biology. Interestingly, within the diverse types of synapses, glutamatergic synapses were the most significantly impacted (p = 8.0 E-37), with the GABAergic (2.3 E-19), adrenergic (1.5 E-13), dopaminergic (5.9 E-13), and cholinergic synapses (1.2 E-12), showing lesser impacts but still returning highly significant p-values. Also consistent with known perturbations of prion diseases to sleep-wake patterns, the KEGG pathway defining components of circadian entrainment was also one of the most downregulated (p = 2.6 E-18).
Several pathways were upregulated (≥33%) relative to age-matched naïve BvPrnp ki mice. Chief among them are the KEGG pathway defining components that facilitate ‘Protein processing in the endoplasmic reticulum’ (p = 4.3 E-12). Along with ER proteins, spliceosome proteins were next in this category in the order of relative significance (p = 3.5 E-11). As such, these analyses added granularity to the notions that prion diseases are characterized by marked deficiencies in synaptic biology and synaptic entrainment. The latter manifested alongside attempts of brain cells to delay their demise by increasing their ER processing capacity.
Proteomic signature of RML prion disease marked by astrocytosis, microgliosis, complement activation, and cellular calcium influx recognizable in asymptomatic mice
To get a better understanding of the biological basis for the survival extension, we next sought to answer the question whether the proteins whose steady-state levels are most increased in prion disease, can also be seen to show the same pattern 50 days ahead of their death in animals that had been transduced with 9P31-BvPrnpV127ΔGPI vectors. We focused this analysis on gene products whose steady-state levels are most upregulated, as this would allow them to be positively identified. Consistent with the hierarchical clustering data, this analysis revealed that the treated animals not only showed the same proteins to be upregulated but the levels of their upregulation was mostly consistent and marked by a relatively high signal-to-noise, i.e., twofold to 25-fold steady-state protein levels relative to naïve mice, suggesting that the proteomic signature of these changes may become recognizable well ahead of the time point chosen for this pilot analysis (Fig 7). To understand the cellular context in which the proteins operate whose steady-state levels were most increased, we capitalized on the availability of an in-depth mouse brain single cell transcriptomics dataset [43], accessible through the Allen Brain Map, which can be interrogated with mouse gene lists through the ‘Transcriptomics Explorer’ algorithm. When we queried this algorithm with the 50 mouse genes whose protein products were most upregulated in RML-infected mouse brains, it returned almost exclusively assignments to brain cell types that are non-neuronal (Fig 7, heatmap data). Several of the expression products of the genes in the list, including GFAP and AIF, are known markers of astrocytosis and microgliosis, respectively, indicating the attempt of RML-infected brains to respond to injury.
Shortlist of proteins whose steady-state brain expression levels were most increased in RML-inoculated mice, relative to naïve control mice. Comparing the enrichment levels of individual proteins across the three treatment cohorts reveals that a proteomic signature similar to the 9P31-spEGFP transduced control mice (here shown as RML_1, RML_2, and RML_3) was already present in the 9P31-BvPrnpV127ΔGPI transduced mice (here shown as RML + V127-ΔGPI_1, RML + V127-ΔGPI_2, and RML + V127-ΔGPI_3) approximately 50 days before they reached their humane prion disease endpoint. The list is dominated by proteins known to play a role in astrocytosis (highlighted in red color), microgliosis (orange), or the complement response (yellow). Also note the enrichment of proteins known 1) to carry calcium binding domains or to be functionally dependent on calcium (blue colored), 2) to be functionally linked to the reorganization of the actin cytoskeleton (brown), or 3) to form a CD44-CD109 complex (magenta). The column headed ‘Aging mice’, identifies proteins whose transcripts were recently shown to be increased in aging mice [42], thereby possibly discouraging their use as specific prion disease biomarkers. On the right, a partial heat map (from the Allen Brain Map) indicates the brain cell types that were previously reported to express most prominently the transcripts of genes shown [43].
Since many of the same biological processes are also activated in the ageing brain, we wondered how the shortlist of 50 proteins compares to a similar shortlist of 73 transcripts that were recently observed to be most consistently increased in ageing mice [42]. Remarkably, 16 of the 50 genes that were most upregulated in prion disease were also most robustly increased in ageing mice. Three additional characteristics of the top 50 gene products are notable and may warrant further investigation to evaluate their usefulness for generating a shortlist of prion disease-specific biomarkers, namely, 1) the list being significantly enriched (p = 6.7 E-3) in proteins that carry calcium binding domains or whose function is calcium-dependent (S100a4, S100a11, S100a6, Anxa4, Itgb2, Tgm1), 2) three of the four most upregulated proteins, S100a4, Flnc, and Pdlim4, being functionally linked to actin cytoskeleton organization, 3) the presence of CD44 and CD109 in the list, which are known to form functional interactions and are neither associated with non-neuronal cells nor being activated in aging mice. Taken together, this analysis revealed a signature of prion disease perturbations of potential use for monitoring disease progression that is strongly blunted by the gene therapy and therefore may also serve to gauge treatment success.
Lower steady-state levels of cell surface proteins residing in proximity to PrPC cannot be accounted for by the loss of neurons that occurs late in the disease
In a prior report, we studied the molecular environment of PrPC in a mouse brain using an in vivo crosslinking affinity capture paradigm and had published the top-ranked 40 proteins [44]. With the deep global proteome analyses at hand, we revisited this shortlist to determine if proteins in proximity to PrPC await a specific fate late in the disease. All but one of the 40 proteins in the original paper were also identified in this global proteome analysis based on at least 10 unique peptides and a range of 185–1325 PSMs, thereby affording robust relative quantitation. Interestingly, at late-stage prion disease, none of these PrPC candidate interactors was upregulated, many were approximately two-fold down regulated, and only a few were not affected in their steady-state levels. A common feature of the latter subgroup seems to be that they encounter the prion protein within its passage along the secretory pathway, whereas the downregulated proteins reside next to PrP at the cell surface. Many of these proteins belong to the subset of proteins that were most strongly and consistently downregulated in the entire dataset (Fig 8A). In fact, if proteins which we had reported to reside in proximity to PrP at the cell surface were captured in a KEGG pathway, its downregulation would emerge among all known KEGG pathways annotations as a highly significantly downregulated pathway (p = 2.37E-25), with only three cell surface proteins, namely contactin-1, the amyloid precursor protein, and the myelin associated glycoprotein, bucking this trend.
(A) Proteins reported to reside in proximity to PrPC at the cell surface are downregulated in end-stage RML prion-inoculated mice. The list depicts previously reported proteins in an affinity-capture PrP interactome from in vivo crosslinked mouse brains [44]. The intensity of the red shading reflects the level of reduction of a given protein entry relative to its average steady-state levels in age-matched naïve control mice. Note the consistent red shading in proteins whose dominant subcellular compartment is the cell surface. (B) Although neurons are understood to die in late-stage prion disease, the steady-state levels of several neuronal markers (NeuN, nestin, or Tuj1) are not noticeably lowered in a sagittal half brain extracts generated at the prion disease end-stage, indicating that for a majority of brain neurons the disease merely causes the retraction of synapses but not their full disappearance. The table also shows well-known brain cell marker proteins that are preferentially expressed in astrocytes, microglia, or oligodendrocytes, indicating the activation of astrocytosis and microgliosis (recognizable by the blue shading that reflects upregulation), as well as consistent loss oligodendrocytes (recognizable by the consistent red shading of all oligodendrocyte marker proteins).
We next considered if a trivial explanation of neurons dying in late-stage prion diseases might account for this selective downregulation of cell surface proteins in proximity to PrP, since most of them are associated with neurons. To address this question, we extracted from the global proteome dataset the relative quantities of proteins, which are commonly associated with specific brain cell types. Specifically, this incomplete list was comprised of ten neuronal, eight astrocytic, four oligodendrocytic, and three microglia markers (Fig 8B). Within the ten neuronal markers, we observed that steady-state level of NeuN and Tuj1, proteins that are frequently used to quantify homeostatic and mature neurons, did not change in late-stage-disease. Neither did other neuronal markers which identify neuronal stem cells (Nestin) or specific subtypes of neurons (choline-O-acetyltransferase for cholinergic neurons and tyrosine 3-monooxygenase for dopaminergic or noradrenergic neurons). Only neuronal markers associated with synapses, including Synaptophysin or Synapsin, were observed to be downregulated. These results indicate that the mere neuronal death that occurs late in the disease does not account for the reduction in the steady-state levels of the previously reported interactors and candidate interactors of the prion protein.
Discussion
This report described results from a proof-of-concept study, which evaluated the therapeutic potential of a virus-delivered gene therapy based on a secreted bank vole PrPV127ΔGPI expression product. The study documented an approximately 50-day survival extension in RML prion-inoculated mice using this approach. The subsequent analyses of brain samples indicated that this survival extension was obtained irrespective of whether the heterologous therapeutic protein was expressed at low or high levels, suggesting a ceiling of therapeutic potency in this paradigm. A deep proteomic analysis of brain samples, collected at the time when negative control mice succumbed to prion disease, yet the treated mice were still free of overt symptoms, showed that the heterologous expression of BvPrnpV127ΔGPI mitigated proteomic perturbations observed in non-treated RML-inoculated mice and was not in itself causing specific changes to the proteome. Mice that were transduced with rAAV vectors coding for anchored BvPrnpV127 led to a shorter average survival extension of 25–30 days, consistent with the interpretation that cross-correction contributed to the enhanced potency of the secreted construct. Further investigation of the global proteome dataset established that both prion disease and BvPrnpV127ΔGPI overexpression (albeit it in a delayed manner) were associated with astrocytosis and microgliosis, as well as a deterioration of synapses and proteins underpinning the sleep-wake cycle. The proteomic data also revealed that the disease causes brain cells to invest in a rescue biology centered on cellular Ca2+ influx and a replenishment of cell surface proteins, prominently manifest in increases in steady state levels of an endoplasmic reticulum protein processing sub proteome and components of the spliceosome.
Since prion diseases require templated polymerization for their propagation, any mismatch in the prion sequence has the potential to hinder disease progression. The idea to harness the power of sequence variants for therapy is not new. In the prion field, this idea has had traction ever since sequence variants that manifest in animal and human populations as polymorphisms or mutations were shown to confer partial or full protection against prion diseases. Initial work in this area was mostly based on the transient or stable transfection of protective PrP mutants in vitro based on the ScN2a cell model and the measurement of Proteinase K resistance as a surrogate for disease burden [45,46].
To date, in vivo work investigating this concept has remained limited. For instance, it was shown that expressing the protective human prion gene polymorphisms Q167R or Q218K at the same level as wild-type PrP could slow prion disease in mice after prion inoculation but did not prevent it completely, unless the protective transgene was exclusively expressed [47]. A follow-on paper by one of the authors documented that the protective K218 variant could reduce the burden of Proteinase K-resistant PrPSc in ScN2a cells when the protein was added to the cell culture medium in recombinant form, lacking N-glycans and GPI anchor [48]. The subsequent infusion of the same recombinant protein into mouse brains through an intracerebroventricular catheter was reported to have prolonged the prion disease incubation period from 117 days to 131 days [49]. A separate report based on the same therapeutic concept, but a different means of delivery documented that the lentiviral transduction of a gene therapy coding for the protective R167 variant achieved a 30-day survival extension in prion-inoculated mice [50]. Several experimental differences to the work reported here stand in the way of interpreting differences in outcomes, including that the protective R167 mutant was expressed in the context of a mouse sequence that coded for the attachment of a GPI anchor, the use of the Me7 prion inoculum, the administration of the treatment through an intracerebral cannula implant, and the choice to administer repeat treatments at 80 and 95 dpi.
To our knowledge, this report is the first to evaluate the protective effect of the V127 mutation in vivo using a paradigm that introduced the therapeutic protein through viral delivery. Key differences of our experimental design to the natural protective V127 heterozygosity that evolved in the Kuru endemic region in Papua New Guinea are:
- 1) The heterologous germ-line expression of this protective mutant in all cells in humans reported to carry this mutation naturally versus the heterologous expression following the transduction of a subset of brain cells weeks after the brain had been exposed to the prion agent.
- 2) The human sequence context of the naturally evolved V127 mutation versus our decision to work with the BvPrP sequence. We had previously shown that the V127 mutation retains at least some of its protective capacity when it is embedded in the BvPrP sequence by showing that mouse CAD5 cells, in which we abrogated the expression of the endogenous mouse Prnp gene and instead expressed BvPrnpV127 as a transgene, became resistant to prion infection [51]. As we prepared this manuscript for publication, this finding was expanded on by another team; using the same CAD5 cell paradigm, as well as N2a cells, the authors showed that the protection conferred by V127 (V126 in mice) extends to several natural and artificial prion strains [52]. In a separate branch of their work the same team showed that the lentiviral delivery of the V127 mutation to primary cultures of hippocampal neuronal from PrP-null mice can prevent the prion-induced retraction of dendritic spines [53].
- 3) The expression of the naturally evolved protective PrPV127 mutant as a GPI-anchored protein versus our choice to secrete BvPrPV127ΔGPI to achieve cross-correction (Fig 9).
Whereas in germline-expressing heterozygous kuru survivors carrying the V127 mutation, PrPV127 is expressed in all cells, only a subset of cells will be transduced when the protective mutant is delivered through rAAV vectors. This deficiency may be partially compensated through an increase in the half-life of PrPV127ΔGPI, relative to PrPV127. (B) The secretion of PrPV127ΔGPI promotes local spread, thereby promoting access to extracellular PrPSc seeds. (C) Whereas the germline expressed PrPV127 is present in all brain areas due to its ubiquitous expression (symbolized by the smooth green color), PrPV127ΔGPI can be highly expressed only in a subset of brain cells. However, a strong promoter may allow it to achieve a similar brain-wide protection through its diffusion within extracellular spaces and the CSF. (D) The presence of a GPI-anchor and N-glycans has the capacity to slow access to nascent PrPSc. This may not be a hindrance if PrPV127 is germline expressed alongside wild-type PrP as the immediacy of contact between the conversion susceptible and refractory isoforms may still provide the earliest possible protection (here depicted as a capping mechanism, one of several possible scenarios through which the V127 may protect in a dominant negative fashion). Note that the size of PrPSc seeds is meant to indicate the readiness with which the V127 mutant can block aggregation, i.e., a capped aggregate comprising just one PrPSc and one V127 mutant molecule is meant to indicate ready inhibition, whereas four and eight building blocks in a PrPSc aggregate symbolize moderate and impaired inhibition of PrPSc accumulation, respectively. To simplify the cartoon, only one N-glycan is shown, and steric hindrances are indicated with red-crossed arrows. The brain cells and human brains shown in this cartoon were created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj.
Some level of cross-correction may occur naturally, because a subset of PrPC and its PrPV127 mutant are shed by a-disintegrin-and-metalloproteinase 10 (ADAM10) from the cell surface through endoproteolytic cleavage at a site located a few residues upstream of the GPI-attachment site [54], thereby giving rise to endoproteolytic products referred to as shed PrPC (sPrPC and sPrPV127) [55]. However, the natural proportion of sPrPC to total PrPC is low, estimated to be 7–10% in rodents [56]. Therefore, the natural ADAM10-mediated release of PrPC would provide limited protection to the brain if only a small subset of cells can be made to express the GPI-anchored PrPV127 mutant.
As far as we are aware, this report is also the first to capture changes to the levels of almost 5,000 proteins in late-stage prion disease. The value of this dataset exceeds its limited use in this study. For instance, the knowledge of proteins whose levels are profoundly up- or down-regulated may lead to disease-specific diagnostic markers that can be used to track disease progression. Although a few proteins, including GFAP [57], have long been known to be altered in their steady-state levels in prion disease, these proteins may have limited value as disease-specific markers and, as we showed, are also not the proteins whose levels are most altered in the disease. Neuronal cell surface proteins whose levels increase in a manner that tracks with disease progression, may not only be of diagnostic value but may also represent attractive targets for guiding therapies to the specific neurons that are most affected in the disease. A caveat of the proteomic data is that the RML-inoculated mice cohorts were also mock-treated or treated with a vector coding for BvPrnpV127ΔGPI, precluding a detailed delineation of proteomic changes caused by viral transduction versus RML prion disease. For the discovery of potential biomarkers, it also would be beneficial to determine when in the disease a particular protein is altered and whether such change can be monitored in accessible biofluids.
This proof-of-concept study had limitations. Most striking amongst them are the limited survival extension that was observed in the cohort of mice transduced with virus particles coding for PrPV127ΔGPI despite the pronounced brain-wide expression of the protective construct achieved. We are considering several potential causes for this limitation. We wonder if the BvPrP sequence, notorious for its standout propensity to convert easily to BvPrPSc and to act as a universal acceptor for prion strains from a wide range of species, might have blunted the protective capacity of the V127 mutation. A related concern is that little is known about how dominant negative mutations translate across species. There are many data points which established that several human PrP polymorphisms and mutations can confer protection also when inserted into the prion sequences of other species, most notably the mouse Prnp sequence. However, it would be surprising if all dominant negative mutations translated equally well in such cross-species experiments. In fact, unpublished work by others appears to indicate limits in the protection that the expression of V127 can confer toward certain prion strains, including RML. Specifically, a preliminary presentation of transgenic mice expressing mouse PrnpV126 in their germ-line revealed that these mice succumbed to RML prion disease albeit after a delayed disease course [58]. Thus, with the wisdom of hindsight it seems that our choice to work with the RML prion strain for this pilot study was poorly suited to assess the protective potency of a PrPV127ΔGPI therapy in vivo. Future work based on mice expressing human PRNP as a knock-in ORF, inoculated with human prion inocula, and treated with a virus-delivered gene therapy based on the expression of human PrPV127-ΔGPI may reveal the true impact of this limitation.
A weaker argument can be made that the treatment was administered too late. It has repeatedly been described that it takes approximately three weeks for transduced rAAV vectors to unleash the full expression of their payload [59]. Our choice to administer the treatment after 60 days therefore may have led therapeutic PrPV127ΔGPI levels to plateau only after approximately 81 dpi. When considering observations from the ASO treatment studies where a marked decline in therapeutic potency was observed when the therapy was administered later than 78 dpi, one may be tempted to conclude that our therapy came too late to confer its full protective effect [4]. However, this interpretation is tempered by a recent report on rAAV-delivered ZFRs, which documented that pronounced survival extension occurred even when this treatment modality was administered at 120 dpi [7]. Finally, a potential concern is that we observed subtle changes to the protein deposition phenotype in RML-infected mice when the ratio of protective BvPrPV127ΔGPI to wild-type expression was 3.6: 1. This concern may be less worrisome when considering that this expression level was unnecessarily high.
Conclusions
Results from this pilot study may be viewed both as disappointing and hopeful. Disappointing due to the limited survival extension of 50 days achieved. The data are hopeful because they validate the therapeutic concept of a rAAV-delivered gene therapy based on the V127 protective mutation. More work will be needed to establish if cross-correction afforded by the secretion of the anchorless protective mutant can supersede the protection offered when the V127 mutation is expressed in the context of GPI-anchored PrP. We were encouraged to find that the retro-orbital intravenous delivery of a brain penetrant gene therapy led to steady-state PrPV127ΔGPI levels that exceeded 3.6: 1 the endogenous expression levels of this highly expressed endogenous protein. This is hopeful as mice had been shown to be protected against human prion inocula when their germline encoded PRNPV127 and PRNP genes were present at a ratio of 1: 3 [9], i.e., we may have considerable titration room left to address this aspect of the gene therapy.
We also remain hopeful that the survival extension ceiling encountered in the BvPrnp sequence context can be lifted by moving this approach to human prion gene sequences and human prion inocula. In the context of human familial disease, it will be of interest to learn if it is favorable to deliver the V127 protection within a bespoke therapeutic construct that also comprises the specific disease-causing inherited mutation of the individual treated. It seems plausible that this additional design element would favor the disease blocking interactions of the protective protein with the respective disease-causing PrPSc conformers.
Materials and methods
Ethics statement
All animal procedures were based on guidelines by the Canadian Council on Animal Care and were authorized by the University Health Network (UHN) Animal Care Committee (Animal Use Protocol 6840). All personnel involved in animal care or surgical procedures received specialized training for their respective tasks to ensure the humane treatment of the animals.
Antibodies
Primary antibodies: Human monoclonal anti-prion F(ab’)2 antibody (epitope: residues 96–104 in mouse PrP) [60], clone HuM-D13, 1:5,000, generously provided by the laboratory of Dr. Emil F. Pai (University of Toronto, ON, Canada). Rabbit monoclonal anti-prion IgG antibody (epitope: 221SQA223 and Y225), clone EP1802Y, 1:10,000 (catalog number ab52604, Abcam, Cambridge, United Kingdom). Mouse monoclonal anti-PrP antibody, clone 9A2 1:500 (Wageningen Bioveterinary Research, Lelystad, Netherlands).
Mouse monoclonal anti-beta-actin (Actb) IgG2b antibody, clone BA3R, 1:40,000 (catalog number MA5–15739-HRP, Thermo Fisher Scientific, Waltham, MA, USA). Rabbit polyclonal anti-Gfap antibody, 1:4,000 (catalog number Z0334, Dako, Carpinteria, CA, USA). Rabbit anti-Iba1 antibody, 1:1,500 (catalog number 019–19741, Fujifilm Wako Pure Chemical Corporation).
Secondary antibodies: Goat anti-human IgG F(ab’)2 horseradish peroxidase (HRP) conjugated antibody, 1:5,000 (catalog number 31414, Thermo Fisher Scientific). Goat polyclonal anti-rabbit HRP secondary IgG antibody, 1:5,000 (catalog number 31460, Thermo Fisher Scientific).
Cloning
The synthetic BvPrnpV127 and MoPrnpV126 sequences avoiding CpG motifs were purchased from a local gene synthesis service (Bio Basic Inc, Markham, ON, Canada). For MoPrnpV126, a Q5 Site-Directed Mutagenesis Kit (catalog number E0554S, New England Biolabs, Ipswitch, MA, USA) was deployed to exchange the mouse PrP signal peptide for ER translocation with the corresponding signal peptide from human prolactin (PRL ss). To this end, the following primers where designed using the NEBaseChanger online tool (https://nebasechanger.neb.com) to exchange AA1–22 with the human PRL ss: Forward: 5’ – cttctggtgtccaatctgttactgtgccagtctgtggctcctaaaaagagaccaaagcctg– 3’, Reverse: 5’ – cagcagcagacttcccttccaggggctgcccttgatgttcatgggatccgatatctagatg – 3’. The final product was then transformed into NEB Stable Competent E. coli (catalog number C3040H, New England Biolabs) and sequence verified.
The self-complementary therapeutic BvPrnp and MoPrnp vectors were built using Gibson assembly. The backbone of the recombinant AAV transfer plasmid with regulatory elements, designated as pscAAV-CBh-Null-WPRE3-enSV40pA, was a gift from the Michael J Fox Foundation (catalog number 194245, Addgene, Watertown, MA, USA). The transfer plasmid was opened with StuI and AgeI restriction enzymes. In parallel, the desired inserts where amplified using a PCR reaction mix composed of Q5 High-Fidelity 2x Master Mix (catalog number M0492S, New England Biolabs), template DNA, and the following primers:
- BvPrnpV127ΔGPI:
- Forward: 5’– tcaggttggaccggctagcaccggtgccaccATGGCCAACCTCAGCTACTG – 3’,
- Reverse: 5’ – gtaatccagaggttgattaggTCATCTGCCCTCATAGTAGGCCTGGG – 3’.
- PRLssMoPrnpV126ΔGPI
- Forward: 5’– ttggaccggctagcagccaccATGAACATCAAGGGCAGCCCCT– 3’,
- Reverse: 5’ – gtaatccagaggttgattaggtcaGGATCTTCTCCCGTCGTAATAGGC– 3’.
- PRLssMoPrnp126
- Forward: 5’– ttggaccggctagcagccaCCATGAACATCAAGGGCAGCC – 3’,
- Reverse: 5’ – TAATCCAGAGGTTGATTAGGtcatcccacaatcaggaagatgaggaag – 3’.
All forward primers included the insertion of a canonical Kozak sequence while the reverse primers of all ΔGPI constructs removed the GPI signal sequence and added a translation termination nonsense codon. PCR was performed for 30 cycles in two phases: 15 cycles with an annealing temperature matched to the primer region complementary to the insert, followed by 15 cycles at 72°C once the full-length primer sequence had been incorporated into the PCR product. Finally, the gel-purified open vector backbone and insert sequences were assembled with the help of the HiFi DNA Assembly Master Mix (catalog number E2621L, New England Biolabs) during a 1-hour incubation at 50°C and then transformed into NEB Stable Competent E. coli. The scAAV CBh spEGFP construct was generated as previously described [39].
Cell culture and rAAV vector production
Murine CAD5 cells were a gift from Charles Weissmann. The cells were cultured in Opti-MEM reduced serum medium (catalog number 31985070, Thermo Fisher Scientific), supplemented with 10% FBS (catalog number 12483020, Thermo Fisher Scientific) and 1x Glutamax (catalog number 35050061, Thermo Fisher Scientific). They were infected with 0.1% RML-infected mouse brain homogenate and then passaged 3–6 times to chronically infect them with prions. These RML-infected CAD5 wild-type cells were than transfected with our desired constructs using a 1:2 ratio of DNA to lipofectamine 2000 (catalog # 11668027, Thermo Fisher Scientific). Briefly, 60mm dishes were plated with 1e6 cells, and then transfected at 80% confluency in serum-free Opti-MEM media. The transfection mixture was then replaced 24 hours later with 3 mL of complete Opti-MEM media containing FBS. Additional media was added to cells over the course of 120 hours, after which they were lysed and processed for western blotting.
HEK293T cells were maintained in DMEM (catalog number 119650–92, Thermo Fisher Scientific) supplemented with 50 U/mL Pen/Strep (catalog number 15140122, Thermo Fisher Scientific), NEAA (catalog number 11140–050, Thermo Fisher Scientific) and 10% FBS (catalog number 12483020, Thermo Fisher Scientific). Cultures were grown at 37°C, in an atmosphere of 5% CO2 and 95% relative humidity. The media were replaced every 48–72 hours and the cells were passaged at 90% confluency in using 0.25% Trypsin-EDTA (catalog number 15050065, Thermo Fisher Scientific). The rAAV vector production and purification followed a previously established protocol [36]. In brief, HEK293T cells were cultured in a HYPERFlask (1,720 cm² surface area) with 560 mL of growth medium (catalog number CLS10031–4EA, MilliporeSigma). Upon reaching 70–80% confluence, the cells were transfected with three plasmids: an AAV packaging plasmid containing Rep and Cap genes, a helper plasmid encoding adenovirus genes E2A, E4, and VA, and the rAAV transfer plasmid. Four days post-transfection, the cell culture medium was supplemented with 3 mL of Triton-X 100 (catalog number ×100, Sigma-Aldrich), 250 µl of RNAse A (catalog number EN0531, Thermo Fisher Scientific), 56 µL of Pluronic F-68 (catalog number 24040–032, Thermo Fisher Scientific), and 56 µL of Turbonuclease (catalog number T4330, Sigma-Aldrich). The mixture was agitated at 150 RPM and 37 °C for 1 hour. Afterward, the lysate was collected and the HYPERFlask was washed with 140 mL of Dulbecco’s phosphate-buffered saline (PBS) (catalog number 14190–144, Thermo Fisher Scientific). The combined lysate and PBS wash were then centrifuged at 4,000 × g (RCF) for 30 minutes to pellet the cell debris. Finally, the supernatant was filtered through a 0.45 µm PES Autofil bottle top filter (catalog number 1143-RLS, Foxx Life Sciences).
rAAV vector purification method
The purification of rAAV vectors made use of 50 µm POROS CaptureSelect AAVX resins (catalog number A36652, Thermo Fisher Scientific). The resin was washed with 20 column volumes (CVs) of Low Salt Wash Buffer (50 mM Tris/HCl, pH 7.4, 150 mM NaCl, 0.01% Pluronic F-68 surfactant, 1% Triton-X100). The affinity capture step was initiated by the slow (0.3 mL/min) loading of rAAV vectors harvested from HEK293 supernatants onto the AAVX resins. Once the rAAV vectors were loaded, the resin was washed with 20 CVs of Low Salt Wash Buffer, 20 CVs of High Salt Wash Buffer (300 mM NaCl, 50 mM Tris/HCl, pH 7.4, 0.01% Pluronic F-68 surfactant), and 20 CVs of Low Salt Wash Buffer without Triton-X100. Elution was induced by pH drop (0.2 M glycine and 0.01% Pluronic F-68, pH 2-2.5) and led to the collection of 4 mL fractions, which were rapidly pH neutralized with 420 µL of neutralization buffer (1 M Tris/HCl, pH 8, 0.1% Pluronic F-68). Prior to use, rAAV preparations were filtered through 0.22 µM PES membranes using a Stericup Quick Release-GP filtration system (catalog number S2GPU11RE, MilliporeSigma Canada Ltd., Oakville, ON, Canada).
qPCR
Quantitative PCRs were undertaken to determine virus titers using a well-developed protocol (Challis et. al. 2019). Briefly, serial dilutions of DNA standards were generated using the respective transgene plasmids which were linearized with ScaI (catalog number R3122S, New England Biolabs). Viral preparations were digested with 50 U/mL of DNase I (catalog number EN0521, Thermo Fisher Scientific) in 2 mM CaCl2, 10 mM Tris-HCl, 10 mM MgCl2. Next, viral capsids were digested using Proteinase K (catalog number EO0491, Thermo Fisher Scientific) in 1M NaCl, 34 mM N-lauroylsarcosine. The final qPCR measurement was conducted using a LightCylcler 480 II (catalog number 05015278001, Roche Diagnostics, Indianapolis, IN, USA) with the help of the SYBR green master mix (catalog number 4367659, Thermo Fisher Scientific) as well as the following primers which target the CBh promoter: Forward: GTTACTCCCACAGGTGAGC and reverse: CCAACCAACCATCCCTTAAAC.
Animals
Animal studies were necessary to assess the in vivo efficacy of a rAAV vector delivered gene therapy that capitalizes on the protective V127 variant. C57BL/6J mice were obtained from the Princess Margaret Cancer Research Centre (University Health Network, Toronto, ON, Canada). Homozygous BvPrnp I109 ki mice (Background: C57BL/6J) were described before [61]. A maximum of five mice per cage were kept at artificial 12-hour day and night cycles, drinking water ad libitum, and given 18% protein chow as solid food source. The mice received daily checks to assess their health and appearance. Their cages were changed weekly. To immobilize mice to be inoculated, transduced with rAAV vectors, or euthanized, anesthesia was induced with inhaled 5% isoflurane. Subsequently, when survival of the animals was intended, isoflurane levels were maintained at 2%. The anesthetic depth was assessed by performing a toe pinch. Respiration was observed during surgery to ensure a regular respiratory pattern. Prion-inoculated mice were closely monitored for signs of distress or pain, and humane endpoints were predefined (>20% weight loss, abnormal posture, lethargy, and impaired ambulation). Mice meeting these criteria were euthanized. Nesting scores were assigned based on whether the mice built no nest (score = 0), built a flat nest (score = 1), or built a three dimensional nest (score = 2). The nesting material consisted of pulped cotton fiber supplied in sheets that break easily into nestlets (catalog number NES3600, Ancare Corp., Bellmore, NY, USA).
Intracerebral prion inoculations
Intracerebral prion inoculations were undertaken with 4–6-week-old mice. The inoculant was generated by infecting a C57BL/6J mouse with RML-prions, then sacrificing the animal when terminally ill with prion disease and homogenizing the brain to a final concentration of 3% brain extract in PBS (v/v). Following deep anesthesia, mice were free-hand injected into the right parietal lobe 20 µL of inoculant at a depth of 3 mm with a 29-gauge SafetyGlide insulin syringe (catalog number 305930, Becton Dickinson Canada, Mississauga, ON, Canada).
Retro-orbital injections
Ahead of this procedure, the mice were anesthetized as described in the ‘Animals’ section. Additionally, all mice received for this procedure one eye drop of 0.5% proparacaine hydrochloride ophthalmic solution as a local anesthetic before injection. The injections were administered into the right orbital sinus using a 28-gauge Micro-Fine IV insulin syringe (catalog number 329420, Becton Dickinson Canada). All animals received a single retro-orbital injection of 1 × 10¹² viral genomes (vg), diluted in PBS to a final volume of 100 µL. Six-week old female C57BL/6J mice were injected with 9P31-spEGFP to assess the CNS spread after retroorbital injection.
Mouse tissue collection
Mice were deeply anesthetized with isoflurane and euthanized by six-minute transcardiac perfusion with PBS. Next, the brains were carefully extracted, their meninges removed, and their brains split into two sagittal hemispheres. The right hemisphere was designated for biochemical analyses and kept at -80°C until homogenization. The left hemisphere was post-fixed for subsequent pathological analyses by immersion in 10 mL of neutral-buffered formalin (catalog number HT501128-4L, Sigma-Aldrich). If mouse hemispheres were assigned for cryo-sectioning, the post-fixation was limited to two hours at 4°C.
Cryo-sectioning of mouse brains for direct fluorescence detection
Mouse brains for cryo-sectioning were dissected at three weeks post-injection. After fixation, brains were cryoprotected by immersion in 30% sucrose in PBS at 4°C for up to 36 hours causing the brain tissue to sink. Brains were then incubated in a 1:1 mixture of 30% sucrose and Tissue-Tek O.C.T. Compound (catalog 25608–930, VWR, Radnor, PA, USA). Next, brains were positioned in a cryomold (catalog number 70182, Electron Microscopy Sciences, Hatfield, PA, USA) and embedded in O.C.T for another one hour at 4°C degrees. Finally, the brains were frozen by partially immersing the cryomolds in a liquid nitrogen-chilled 2-methylbutane bath for 2–3 mins until the O.C.T completely froze. The frozen blocks were briefly air-dried on dry ice to remove residual 2-methylbutane and stored at −80°C.
Before cryo-sectioning, brains were allowed to warm up in the Cryostat chamber (model HM525 NX, Thermo Fisher Scientific) to a temperature of −21°C during a two-hour acclimatization period. Finally, 16 µm sagittal sections were cut and collected using Kawamoto’s film method on a piece of adhesive Cryofilm (catalog number C-FUF303, Section-Lab Co. Ltd., Yokohama, Kanagawa Prefecture, Japan) [62]. Before imaging, sections were washed for five minutes in PBS and mounted with mounting media containing DAPI (catalog number ab104139, Abcam).
Immunohistochemical analyses of mouse brain sections
To prepare samples for immunohistochemical analyses, mouse brains were immersed for one hour in formic acid, then rinsed with water, and placed in a Leica Pearl for processing. After sectioning, the slides were dried overnight at 37°C. Ahead of the immunohistochemical staining, the slides were baked for an hour at 60°C to help the tissues to adhere better to the slides. Next the slides were dehydrated through a xylene and ethanol series. The immunodetection made use of the Mouse on Mouse (M.O.M) Elite Immunodetection Kit (catalog number PK-2200, Vector Laboratories, Newark, CA, USA) using the manufacturers instructions. As part of these instructions, the tissue sections underwent antigen retrieval with citrate, pH 6.0, and heat using a commercial Antigen Decloaker formulation (catalog number CB910M, Biocare Medical, Pacheco, CA, USA). Brain slices were incubated with a monoclonal mouse PrP antibody, 1:500 dilution (Wageningen Bioveterinary Research) for 30 min at 22 °C or with antibodies directed against Gfap, 1:4,000 (Dako), or Iba1, 1:1,500 (Fujifilm), overnight at 4 °C and images developed using the NovaRed system (Vector Laboratories Inc., Newark, CA, USA). Finally, brain tissue sections were counter-stained with hematoxylin and eosin, rapidly dehydrated, and cover-slipped for microscopy analyses.
Microscopy
Brain samples were imaged under #1.5 glass coverslips (catalog number 48393–060, VWR) on Fisherbrand Superfrost Plus microscope slides (catalog number 22-037-246, Thermo Fisher Scientific) using a Zeiss AXIO Observer 7 inverted LED fluorescence microscope (Carl Zeiss Canada Ltd., North York, ON, Canada). To reconstruct full sagittal brain views, individual fields of view were acquired sequentially across each section and digitally stitched into a composite image using ZEN Blue microscopy software (Carl Zeiss Canada Ltd.).
Homogenization and protein extraction
Mouse brain tissue was homogenized in 100 mM Tris-HCl (pH 8.3) using a Minilys homogenizer (catalog number P000673-MLYS0-A, Bertin Technologies, Rockville, MD, USA) and Zirconia beads (catalog number 11079110zx, Biospec, Bartlesville, OK, USA) with three sets of 30 second bead-beating pulses. The resulting 20% homogenates were aliquoted, and a protease inhibitor cocktail (catalog number 78425, Thermo Fisher Scientific) was added to all samples that were not designated for subsequent Proteinase K digestion. To extract proteins, a detergent stock solution giving rise to final concentrations of 0.5% deoxycholic acid (DOC) (catalog number DCA333.50, BioShop, Burlington, ON, Canada) and 0.5% NP-40 (catalog number NON505.100, BioShop) was added to the homogenate, followed by gentle vortexing and 30 minute incubation on ice. Next, insoluble debris were removed during consecutive five-minute spins at 500 × g and ten-minute spins at 5,000 × g (RCF). Total protein concentrations of the samples were determined using the Pierce BCA Protein Assay Kit (catalog number 23225, Thermo Fisher Scientific) and subsequently adjusted.
gDNA extraction and restriction digest
The gDNAs of study mice were extracted from brain homogenates with the Monarch Spin gDNA Extraction Kit (catalog number T3010S, New England Biolabs). For the subsequent PCR reaction, 50 ng of gDNA was amplified with Q5 Hot Start High-Fidelity 2X Master Mix (catalog number M0494S, New England Biolabs) and forward and reverse primers (final concentration 500 nM) that map to gDNA sequences shared by the endogenous and heterologous BvPrnp ORFs. Equal volumes of PCR product were then subject to a restriction enzyme (RE) digest with 1 µL of EagI (catalog number R3505S, New England Biolabs), CsiI (catalog number FD2114, Thermo Fisher Scientific), or both REs for cutting the endogenous or the heterologous amplicons or both, respectively. The RE digestion products were finally separated on a 1% agarose gel containing SYBR safe DNA gel stain (catalog number S33102, Thermo Fisher Scientific). The fluorescent image of the gel was captured with the ChemiDoc XRS+ System (Bio-Rad Laboratories, Hercules, CA, USA). Forward: AAGAAGCGGCCAAAG and reverse: TAGTAGGCCTGGGACTC.
PNGase F digest
To remove N-linked glycans by digestion with PNGase F (catalog number P0704S, New England Biolabs, Ipswich. MA, USA), we made use of supplier provided buffers. Specifically, equal amounts of proteins were denatured using 10 × Denaturing Buffer at 95˚C for 10 minutes. Next, NP-40, GlycoBuffer, and PNGase F enzyme were added to the denatured samples. To inhibit undesired proteolytic activity, 3 mM phenylmethanesulfonyl fluoride (PMSF) (catalog number PMS123.5, BioShop) was added to the reaction tubes. Next, samples were incubated for 2 h at 37°C with gentle shaking. Finally, an equal volume of 2 × LDS sample buffer containing 5% β-mercaptoethanol (BME) was added directly to the samples to stop the reaction and prepare the samples for western blot analyses.
Proteinase K digest
To assess the relative PrPSc content of brain extracts, 200 µg each of BCA-adjusted total proteins were treated with Proteinase K (catalog number 25530049, Thermo Fisher Scientific) at a final concentration of 50 µg/mL and a ratio of total protein to Proteinase K of 1:20. Next, samples were incubated for 45 min at 37°C under gentle shaking. The digestion was terminated by adding PMSF to a final concentration of 2 mM, followed by the addition of 2% Sarkosyl (catalog number SLS002.100, BioShop). Next, the digests were ultracentrifuged for 1 hour at 48,000 RPM and 4°C using an Optima TLX Ultracentrifuge (Beckman Coulter, Brea, CA, USA). Finally, the pelleted insoluble PrPSc was resuspended in 1x Bolt LDS sample buffer (catalog number B0007, Thermo Fisher Scientific), heat-denatured at 95°C for 10 minutes, then analyzed by western blotting. For cell culture experiments, the Proteinase K digestions were conducted on 500 µg of total lysate, with a ratio of 1:50 at a concentration of 50 µg/mL.
Western blotting
To detect total PrP within brain extract samples, proteins were denatured in 1x Bolt LDS sample buffer at a final concentration of 2 µg/µL. Next, samples were heated at 95 °C for 10 min, followed by briefly cooling on ice, immediately before gel loading. Proteins were separated by SDS-PAGE analysis on 10% Bolt Bis-Tris gels (catalog number NW00105BOX, Thermo Fisher Scientific). For PNGase F digested samples, 12% NuPage Bis-Tris gels (NP0342BOX, Thermo Fisher Scientific) were used. After the gel electrophoresis, proteins were transferred to 0.45 µm PVDF membranes (catalog number IPVH00010, Sigma-Aldrich, St. Louis, MO, USA). Following the blocking of the membrane in 5% skimmed milk (catalog number SKI400, BioShop Canada Inc) for 1 h at room temperature, membranes were incubated in primary antibodies overnight at 4°C with gentle rocking. Next, membranes were washed three times in 1x Tris-buffered saline containing 0.1% Tween-20 (TBST) (catalog number TWN508, BioShop) and incubated with the corresponding HRP-conjugated secondary antibodies for 1 h at room temperature. After washing the membranes trice again in 1x TBST, they were incubated for 1 min with Western Lightning Pro enhanced chemiluminescent (ECL) reagent (catalog number NEL120001EA, Revvity Health Sciences Inc., Mississauga, ON, Canada). Finally, membranes were exposed to autoradiography film (catalog number CLMS810, MedStore, Toronto, ON, Canada) and developed using a film developer.
Sample preparation for mass spectrometry
The protein concentration of brain extracts was adjusted to 4 µg/µL. To denature all proteins in the sample, including the PrPSc, 20 µg (in 5 µL) of total proteins were transferred to Protein LoBind (PLB, catalog number: PRE050LR-N, Diamed, Mississauga, ON, Canada) tubes and diluted with 9M urea (catalog number UR001.1, Bioshop) in a 1:2 ratio (v/v), achieving a 6 M urea concentration in the sample, followed by gentle vortexing and 30-minute incubation at room temperature to ensure complete denaturation. The pH of the samples was checked and, if below pH 8, increased to this pH using 1 M Triethylammonium Bicarbonate (TEAB) (catalog number 1861436, Thermo Fisher Scientific). Next the denatured proteins were reduced with 6.5 mM TCEP (catalog number TCE101, Bioshop) during a 30-minute incubation at 37°C, then alkylated for another 30 minutes in the dark at room temperature in the presence of 15 mM iodoacetamide (catalog number 1861445, Thermo Fisher Scientific).
Next, the proteins were subjected to solvent precipitation to maximize recovery for proteomic analyses [63]. To this end, samples were threefold diluted to prepare them for the precipitation. In parallel, silica beads of 9–13 μm mean particle diameter (catalog number 440345), which had been pre-cleaned and resuspended in acetonitrile (ACN) at a concentration of 70 µg/µL, were added at a 10:1 bead-to-protein ratio and the tubes were gently vortexed. Subsequently, 100% ACN was added to each sample at a 1:4 (v/v) ratio to achieve an 80% ACN concentration without pipette mixing, followed by gentle vortexing for 10 seconds. The precipitates were centrifuged for 5 minutes at 16,000 × g (RCF) and room temperature, before supernatants were carefully removed, using the tube hinge as a guide to avoid disturbing the pellet. To further remove non-protein contaminants, the pellets were washed three times with 80% ethanol, using at least twice the total precipitation volume for each wash, followed by 2-minute centrifugation at 16,000 × g (RCF) and room temperature.
After the final wash, the remaining supernatant was carefully removed, and the protein pellet resuspended by gently vortexing in 100 mM ABC with a 1:50 trypsin-to-protein ratio. To fully disrupt the pellet, the tubes were placed in a sonication bath for 2 minutes. To ensure complete digestion, the samples were then incubated at 37°C for 18 hours at 800 RPM in a thermomixer (Thermomixer Comfort). Following digestion, 1 µL of 10% formic acid (FA) (catalog number A117-50, Thermo Fisher Scientific) was added to each sample to adjust the pH to approximately pH 3. The beads and any insoluble debris were precipitated by 10-minute centrifugation at 16,000 × g (RCF) and room temperature, before transferring the peptide-enriched supernatants to a new tube. To further recover additional peptides from the silica beads, the centrifugation pellets were washed once with 2% ACN in 0.1% formic acid, and the resultant wash supernatants combined with the initial peptide-containing supernatants. The final peptide concentration was adjusted to 0.25 to 0.5 µg/µL in 1% acetonitrile with 0.1% formic acid.
Mass spectrometry data acquisition
Sample injected were three biological replicates from three treatment cohorts, with each sample composed of tryptic digests of 200 ng of total brain extract proteins. All data were acquired using a Vanquish Neo UHPLC system (Thermo Fisher Scientific) coupled to an Orbitrap Astral mass spectrometer (Thermo Fisher Scientific) through an EASY-Spray source (Thermo Fisher Scientific). Trap-and-Elute injection was based on PepMap Neo Trap Cartridge (catalog number 174500, Thermo Fisher Scientific) to filter impurities from peptide mapping samples. During peptide separation, a 15 cm EASY-Spray HPLC Column (catalog number ES900, Thermo Fisher Scientific) was maintained at 50°C. The mobile phase A consisted of 0.1% formic acid in water, while mobile phase B consisted of 0.1% formic acid and 80% acetonitrile in water. The gradient was as follows: the mobile phase was initially held at 2% B, increased from 2% to 4% in 0.5 min at a flow rate of 0.7 µL/min, then further increased to 5% B from 0.5 to 0.6 min, increased to 7% B from 0.6 to 1 min, ramped to 22.5% B from 1 to 18 min, then increased to 35% B from 18 to 25.5 min, and further increased to 50% B from 25.5 to 27 min. The flow rate was set to 0.5 µL/min. The column was then washed with 99% B from 27 to 30 min at a flow rate of 0.7 µL/min. Data were acquired in data independent acquisition (DIA) mode with a normalized collision energy of 25% and a default charge state of +2. MS1 spectra were acquired in the embedded orbitrap mass analyzer at a resolving power of 240,000 every 0.6 s. MS2 spectra were acquired in the embedded astral analyzer, with precursor isolation windows of 2 Th spanning the range of 380 − 980 Th. The custom normalized AGC target was set as 500% for both MS1 and DIA. The MS1 mass range was the same as the MS/ MS precursor range. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD076487.
Processing of global proteomic data set
Protein identification and peptide peak integration made use of Proteome Discoverer (PD) software (Version 3.2, Thermo Fisher Scientific) with CHIMERYS. These analyses interrogated the Mus musculus database (TaxID = 10090, release = 407, supplemented with the entry for the major prion protein from bank vole (Accession number Q8VHV5). The database search was restricted to tryptic peptides, allowing up to two missed cleavages per peptide. The maximum fragment mass tolerance was set to 10 ppm. Carbamidomethylation at cysteine residues was specified as a fixed modification, while oxidation at methionine residues was included as a variable modification. The sample-to-sample normalization in PD was based on the ‘Total Peptide Amount’ computed for each sample. Prion peptide comparisons were conducted using Skyline (Version 24.1) [64], with tubulin alpha and tubulin beta used for sample normalization. The assignment of peptide transitions to BvPrP were manually reviewed to ensure accurate peak integration. Both the Proteome Discoverer and Skyline data were exported to Excel for further conditional formatting.
Cluster and KEGG analyses
Hierarchical clustering was undertaken with Cluster (Version 3.0, using Clustering Library Version 1.59) [65,66]. Prior to clustering, data columns were generated that inform about steady-state protein level ratios, computed by dividing cumulative MS1 ion intensities assigned to a given protein in a specific brain extract to the average MS1 ion intensities for the same protein in brain extracts from naïve mice. Subsequently, these steady-state protein level ratio data for all proteins, i.e., the rows within the Excel dataset, were clustered using centroid linkage clustering methods based on a ‘City-block distance’ metric and the relationship across the brain samples, i.e., the columns within the Excel dataset were inferred by hierarchical clustering using a Spearman Rank Correlation metric. Finally, hierarchical cluster analysis results were visualized in Java TreeView (Version 1.21) open source software [65].
KEGG pathway analyses were undertaken with the DAVID Bioinformatics suite (release DAVID 2021, Version 2023q4) of functional annotation tools made available by the National Institutes of Health [67,68]. Briefly, to initiate the analyses, lists of official gene symbols of genes whose expression gave rise to top- or bottom-ranked proteins in the global proteomic dataset were uploaded into the DAVID Analysis Wizard along with the selection of Mus musculus as the biological sample source. Next, a KEGG_PATHWAY analysis was undertaken from within the Annotation Summary Results page.
Assignment of proteins increased in their steady-state levels in prion disease to mouse brain cell types
The cell type assignment made use of previously reported mouse brain cell type annotations, which were originally obtained through single-cell transcriptomic analyses [43]. To interrogate these data with genes coding for proteins whose steady-state levels were most increased in RML-infected mice, which had reached the humane prion disease end-stage, we submitted the shortlist of genes to the online Transcriptomics Explorer algorithm (https://portal.brain-map.org/atlases-and-data/rnaseq). Separately, the ggplot package within RStudio was used to depict the non-neuronal portion of the brain cell type dendrogram, which this analysis revealed to comprise the genes whose levels were most profoundly increased in RML prion disease.
Statistical analyses
Western blot signal intensities from three biological replicates were quantified by densitometric analysis using ImageJ software and corresponding statistics were performed using Microsoft Excel. First, cohorts were subject to an F-test to assess the variance of the two compared groups. A Welch’s t-test or pooled t-test was subsequently chosen to assess the statistical significance of the differences between the averages of cohorts that were compared. Results were considered significant if p < 0.05 or denoted as non-significant with “ns” if p > 0.05. Asterisks were used to signify varying levels of significance: p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).
Survival, weight, and nesting score charts were assembled in R using RStudio (Version 4.4.3). For all analyses, Excel raw data were uploaded into RStudio using the ‘readxl’ package. For the Kaplan-Meier analyses, the Greenwood formula computed a variance estimate, which was used by the Kaplan-Meier estimator (kmfit) to compute the 95% confidence interval. Plots were then generated with basic plotting functions embedded in ‘ggplot2’ and ‘ggfortify’ packages.
For generating the weight and nesting score charts, the geom_smooth() function within ggplot2 was used to depict the linear trend and the confidence interval using the Locally Estimated Scatterplot Smoothing ‘loess’ method.
We assumed a hypergeometric distribution when determining if it is statistically significant that 27 out of 30 cell surface proteins, which had been shown to reside in proximity to PrP in mouse brains [44], were downregulated ≥ 33% (out of 455 other proteins sharing this characteristic) in a global proteome dataset of 4874 proteins.
Supporting information
S1 Fig. Design of an all-in-one rAAV vector of low immunogenicity that can promote cross-correction.
(A) Nucleotide sequence of a codon-optimized, synthetic bank vole PrnpV127 coding sequence. The V127 codon and the GPI-SS are shown in red and green bold font, respectively. (B) Design of self-complementary rAAV vector for the expression of synthetic bank vole PrPV127ΔGPI. (C) Schematic summarizing key steps of rAAV purification method based on assembly of virus in Hyperflasks and AAVX affinity capture purification, created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj. (D) Assessment of purity and yield of representative rAAV vector preparations coding for wild-type BvPrnpV127ΔGPI or BvPrnpV127 using SDS-PAGE followed by Coomassie blue staining. VP1, VP2 and VP3 designate the three viral proteins that constitute the viral capsid in an expected 1:1:10 relative abundance ratio. (E) Representative image showing pronounced expression and brain-wide distribution of spEGFP signal in sagittal cut of brain three weeks after retro-orbital administration of 1012 9P31-spEGFP vectors into 6-week-old mouse. Note that at this gain setting, a control brain of a non-transduced mouse showed no detectable background signal. Scale bar = 100 µm. The schematic of the retro-orbital injection was created in BioRender. Schmitt-ulms, G. (2026) https://BioRender.com/hmig0pj.
https://doi.org/10.1371/journal.ppat.1014124.s001
(PDF)
S2 Fig. Immunohistochemical comparison of gliosis in brain sections of mice transduced with 9P31-BvPrnpV127ΔGPI versus control brains.
Additional immunohistochemical analyses of mouse brains studied in Panels D-F of Fig 5. (A) IHC characterization of Gfap-reactive signals within the hippocampal formation of an RML-inoculated BvPrnp ki positive control mouse that was not transduced. (B). Adjacent section from the same brain as in Panel A following IHC staining with anti-Iba1 antibody. (C) Negative control IHC image of a hippocampus formation from a BvPrnp ki mouse that was not prion-inoculated but transduced with a 9P31-EGFP virus and stained for Gfap-reactivity. (D) Adjacent brain section to Panel C with Iba1-directed antibody. (E) BvPrnp ki mice following retro-orbital transduction of 9P31 encapsulated virus vectors coding for anchorless BvPrnpV127ΔGPI at 196 dpi. (F). Adjacent brain section to Panel E with Iba1-directed antibody. All brain sections were counterstained with hematoxylin-eosin. Scale bar is 100 µm.
https://doi.org/10.1371/journal.ppat.1014124.s002
(PDF)
S3 Fig. Original images.
Raw western blot and gel images. The numbering of subpanels in this figure corresponds to the numbering in the respective figure files.
https://doi.org/10.1371/journal.ppat.1014124.s003
(PDF)
References
- 1. Prusiner SB. Prions. Proc Natl Acad Sci U S A. 1998;95(23):13363–83.
- 2. Minikel EV, Vallabh SM, Lek M, Estrada K, Samocha KE, Sathirapongsasuti JF, et al. Quantifying prion disease penetrance using large population control cohorts. Sci Transl Med. 2016;8(322):322ra9. pmid:26791950
- 3. Stahl N, Borchelt DR, Hsiao K, Prusiner SB. Scrapie prion protein contains a phosphatidylinositol glycolipid. Cell. 1987;51(2):229–40. pmid:2444340
- 4. Minikel EV, Zhao HT, Le J, O’Moore J, Pitstick R, Graffam S, et al. Prion protein lowering is a disease-modifying therapy across prion disease stages, strains and endpoints. Nucleic Acids Res. 2020;48(19):10615–31. pmid:32776089
- 5. Neumann EN, Bertozzi TM, Wu E, Serack F, Harvey JW, Brauer PP, et al. Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic editor. Science. 2024;384(6703):ado7082. pmid:38935715
- 6. An M, Davis JR, Levy JM, Serack FE, Harvey JW, Brauer PP, et al. In vivo base editing extends lifespan of a humanized mouse model of prion disease. Nat Med. 2025;31(4):1319–28. pmid:39810005
- 7. Chou SW, Mortberg MA, Marlen K, et al. Zinc finger repressors mediate widespread PRNP lowering in the nonhuman primate brain and profoundly extend survival in prion disease mice. bioRxiv. 2025.
- 8. Mead S, Whitfield J, Poulter M, Shah P, Uphill J, Campbell T, et al. A novel protective prion protein variant that colocalizes with kuru exposure. N Engl J Med. 2009;361(21):2056–65. pmid:19923577
- 9. Asante EA, Smidak M, Grimshaw A, Houghton R, Tomlinson A, Jeelani A, et al. A naturally occurring variant of the human prion protein completely prevents prion disease. Nature. 2015;522(7557):478–81. pmid:26061765
- 10. Biffi A. Gene therapy for lysosomal storage disorders: A good start. Hum Mol Genet. 2016;25(R1):R65-75. pmid:26604151
- 11. Chesebro B, Trifilo M, Race R, Meade-White K, Teng C, LaCasse R, et al. Anchorless prion protein results in infectious amyloid disease without clinical scrapie. Science. 2005;308(5727):1435–9. pmid:15933194
- 12. Stöhr J, Watts JC, Legname G, Oehler A, Lemus A, Nguyen H-OB, et al. Spontaneous generation of anchorless prions in transgenic mice. Proc Natl Acad Sci U S A. 2011;108(52):21223–8. pmid:22160704
- 13. Watts JC, Giles K, Bourkas MEC, Patel S, Oehler A, Gavidia M, et al. Towards authentic transgenic mouse models of heritable PrP prion diseases. Acta Neuropathol. 2016;132(4):593–610. pmid:27350609
- 14. Kocisko DA, Come JH, Priola SA, Chesebro B, Raymond GJ, Lansbury PT, et al. Cell-free formation of protease-resistant prion protein. Nature. 1994;370(6489):471–4. pmid:7913989
- 15. Katorcha E, Makarava N, Savtchenko R, D’Azzo A, Baskakov IV. Sialylation of prion protein controls the rate of prion amplification, the cross-species barrier, the ratio of PrPSc glycoform and prion infectivity. PLoS Pathog. 2014;10(9):e1004366. pmid:25211026
- 16. Hoyt F, Standke HG, Artikis E, Schwartz CL, Hansen B, Li K, et al. Cryo-EM structure of anchorless RML prion reveals variations in shared motifs between distinct strains. Nat Commun. 2022;13(1):4005. pmid:35831291
- 17. Campana V, Caputo A, Sarnataro D, Paladino S, Tivodar S, Zurzolo C. Characterization of the properties and trafficking of an anchorless form of the prion protein. J Biol Chem. 2007;282(31):22747–56. pmid:17556367
- 18. Sangeetham SB, Engelke AD, Fodor E, Krausz SL, Tatzelt J, Welker E. The G127V variant of the prion protein interferes with dimer formation in vitro but not in cellulo. Sci Rep. 2021;11(1):3116. pmid:33542378
- 19. Huang JJ, Li XN, Liu WL. Neutralizing mutations significantly inhibit amyloid formation by human prion protein and decrease its cytotoxicity. J Mol Biol. 2020;432:828–44.
- 20. Hosszu LLP, Conners R, Sangar D, Batchelor M, Sawyer EB, Fisher S, et al. Structural effects of the highly protective V127 polymorphism on human prion protein. Commun Biol. 2020;3(1):402. pmid:32728168
- 21. Zheng Z, Zhang M, Wang Y, Ma R, Guo C, Feng L, et al. Structural basis for the complete resistance of the human prion protein mutant G127V to prion disease. Sci Rep. 2018;8(1):13211. pmid:30181558
- 22. Riek R, Hornemann S, Wider G. NMR structure of the mouse prion protein domain PrP(121-231). Nature. 1996;382:180–2.
- 23. Donne DG, Viles JH, Groth D, Mehlhorn I, James TL, Cohen FE, et al. Structure of the recombinant full-length hamster prion protein PrP(29-231): the N terminus is highly flexible. Proc Natl Acad Sci U S A. 1997;94(25):13452–7. pmid:9391046
- 24. Zahn R, Liu A, Lührs T, Riek R, von Schroetter C, López García F, et al. NMR solution structure of the human prion protein. Proc Natl Acad Sci U S A. 2000;97(1):145–50. pmid:10618385
- 25. Gross D-A, Tedesco N, Leborgne C, Ronzitti G. Overcoming the challenges imposed by humoral immunity to AAV vectors to achieve safe and efficient gene transfer in seropositive patients. Front Immunol. 2022;13:857276. pmid:35464422
- 26. Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995;374(6522):546–9. pmid:7700380
- 27. Qi Y, Wang JK, McMillian M, Chikaraishi DM. Characterization of a CNS cell line, CAD, in which morphological differentiation is initiated by serum deprivation. J Neurosci. 1997;17(4):1217–25. pmid:9006967
- 28. Mahal SP, Baker CA, Demczyk CA, Smith EW, Julius C, Weissmann C. Prion strain discrimination in cell culture: The cell panel assay. Proc Natl Acad Sci U S A. 2007;104(52):20908–13. pmid:18077360
- 29. Surabhi M, Matthew ECB, Lech K, et al. Convergent generation of atypical prions in knock-in mouse models of genetic prion disease. bioRxiv. 2023.
- 30. Watts JC, Giles K, Stöhr J, Oehler A, Bhardwaj S, Grillo SK, et al. Spontaneous generation of rapidly transmissible prions in transgenic mice expressing wild-type bank vole prion protein. Proc Natl Acad Sci U S A. 2012;109(9):3498–503. pmid:22331873
- 31. Nonno R, Di Bari MA, Cardone F, Vaccari G, Fazzi P, Dell’Omo G, et al. Efficient transmission and characterization of Creutzfeldt-Jakob disease strains in bank voles. PLoS Pathog. 2006;2(2):e12. pmid:16518470
- 32. Watts JC, Giles K, Patel S, Oehler A, DeArmond SJ, Prusiner SB. Evidence that bank vole PrP is a universal acceptor for prions. PLoS Pathog. 2014;10(4):e1003990. pmid:24699458
- 33. Fu H, Muenzer J, Samulski RJ, Breese G, Sifford J, Zeng X, et al. Self-complementary adeno-associated virus serotype 2 vector: Global distribution and broad dispersion of AAV-mediated transgene expression in mouse brain. Mol Ther. 2003;8(6):911–7. pmid:14664793
- 34. McCarty DM, Fu H, Monahan PE, Toulson CE, Naik P, Samulski RJ. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 2003;10(26):2112–8. pmid:14625565
- 35. Gray SJ, Foti SB, Schwartz JW, Bachaboina L, Taylor-Blake B, Coleman J, et al. Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors. Hum Gene Ther. 2011;22(9):1143–53. pmid:21476867
- 36. Florea M, Nicolaou F, Pacouret S, Zinn EM, Sanmiguel J, Andres-Mateos E, et al. High-efficiency purification of divergent AAV serotypes using AAVX affinity chromatography. Mol Ther Methods Clin Dev. 2022;28:146–59. pmid:36654797
- 37. Nonnenmacher M, Wang W, Child MA, Ren X-Q, Huang C, Ren AZ, et al. Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning. Mol Ther Methods Clin Dev. 2020;20:366–78. pmid:33553485
- 38. Zhao W, Eid S, Sackmann C. Transient receptor potential vanilloid channel 2 contributes to multi-modal endoplasmic reticulum and perinuclear space dilations that can also be observed in prion-infected mice. bioRxiv. 2024.
- 39. Verkuyl C, Belotserkovsky A, Zerbes T, Williams D, Krishnan MR, Zhu S, et al. Toward an all-in-one recombinant adeno-associated virus vector for functionally ablating the prion gene using CRISPR-Cas technology. PLoS One. 2025;20(11):e0336578. pmid:41202069
- 40. Moreno JA, Radford H, Peretti D, Steinert JR, Verity N, Martin MG, et al. Sustained translational repression by eIF2α-P mediates prion neurodegeneration. Nature. 2012;485(7399):507–11. pmid:22622579
- 41. Zhou S, Shi D, Liu X, Liu H, Yao X. Protective V127 prion variant prevents prion disease by interrupting the formation of dimer and fibril from molecular dynamics simulations. Sci Rep. 2016;6:21804. pmid:26906032
- 42. Wang L, Cui C-Y, Lee CT, Bodogai M, Yang N, Shi C, et al. Spatial transcriptomics of the aging mouse brain reveals origins of inflammation in the white matter. Nat Commun. 2025;16(1):3231. pmid:40185750
- 43. Yao Z, van Velthoven CTJ, Nguyen TN, Goldy J, Sedeno-Cortes AE, Baftizadeh F, et al. A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell. 2021;184(12):3222-3241.e26. pmid:34004146
- 44. Williams D, Mehrabian M, Arshad H, Eid S, Sackmann C, Zhao W, et al. The cellular prion protein interacts with and promotes the activity of Na,K-ATPases. PLoS One. 2021;16(11):e0258682. pmid:34847154
- 45. Zulianello L, Kaneko K, Scott M, Erpel S, Han D, Cohen FE, et al. Dominant-negative inhibition of prion formation diminished by deletion mutagenesis of the prion protein. J Virol. 2000;74(9):4351–60. pmid:10756050
- 46. Kaneko K, Zulianello L, Scott M, Cooper CM, Wallace AC, James TL, et al. Evidence for protein X binding to a discontinuous epitope on the cellular prion protein during scrapie prion propagation. Proc Natl Acad Sci U S A. 1997;94(19):10069–74. pmid:9294164
- 47. Perrier V, Kaneko K, Safar J, Vergara J, Tremblay P, DeArmond SJ, et al. Dominant-negative inhibition of prion replication in transgenic mice. Proc Natl Acad Sci U S A. 2002;99(20):13079–84. pmid:12271119
- 48. Kishida H, Sakasegawa Y, Watanabe K, Yamakawa Y, Nishijima M, Kuroiwa Y, et al. Non-glycosylphosphatidylinositol (GPI)-anchored recombinant prion protein with dominant-negative mutation inhibits PrPSc replication in vitro. Amyloid. 2004;11(1):14–20. pmid:15185494
- 49. Furuya K, Kawahara N, Yamakawa Y, Kishida H, Hachiya NS, Nishijima M, et al. Intracerebroventricular delivery of dominant negative prion protein in a mouse model of iatrogenic Creutzfeldt-Jakob disease after dura graft transplantation. Neurosci Lett. 2006;402(3):222–6. pmid:16759805
- 50. Toupet K, Compan V, Crozet C, Mourton-Gilles C, Mestre-Francés N, Ibos F, et al. Effective gene therapy in a mouse model of prion diseases. PLoS One. 2008;3(7):e2773. pmid:18648643
- 51. Arshad H, Patel Z, Amano G, Li LY, Al-Azzawi ZAM, Supattapone S, et al. A single protective polymorphism in the prion protein blocks cross-species prion replication in cultured cells. J Neurochem. 2023;165(2):230–45. pmid:36511154
- 52. Gatdula JRP, Orbe IC, Tolton SG. Leveraging the dominant-negative effect of the kuru-protective G127V prion protein variant as a novel therapeutic strategy. bioRxiv. 2026.
- 53. Gatdula JRP, Mercer RCC, Alepuz Guillen JA, Vultaggio JS, Harris DA. Membrane-anchored PrPSc is the trigger for prion synaptotoxicity. PLoS Pathog. 2026;22(1):e1013911. pmid:41604429
- 54. Song F, Kovac V, Mohammadi B, Littau JL, Scharfenberg F, Matamoros Angles A, et al. Cleavage site-directed antibodies reveal the prion protein in humans is shed by ADAM10 at Y226 and associates with misfolded protein deposits in neurodegenerative diseases. Acta Neuropathol. 2024;148(1):2. pmid:38980441
- 55. Song F, Kovac V, Mohammadi B, Pippi JE, Curin Serbec V, Glatzel M, et al. Proteolytic shedding of the prion protein: Uncovering “new” biological implications of a conserved cleavage event. Neural Regen Res. 2026;21(6):2329–30. pmid:40637559
- 56. Vanni I, Iacobone F, D’Agostino C, Giovannelli M, Pirisinu L, Altmeppen HC, et al. An optimized Western blot assay provides a comprehensive assessment of the physiological endoproteolytic processing of the prion protein. J Biol Chem. 2023;299(2):102823. pmid:36565989
- 57. Kordek R, Liberski PP, Yanagihara R, Isaacson S, Gajdusek DC. Molecular analysis of prion protein (PrP) and glial fibrillary acidic protein (GFAP) transcripts in experimental Creutzfeldt-Jakob disease in mice. Acta Neurobiol Exp (Wars). 1997;57(2):85–90. pmid:9407695
- 58.
Horn N, Tomlinson A, Jakobcova T, et al. Exploring the protective roles of prion protein polymorphisms in novel gene targeted mouse models. 2025.
- 59. Hollidge BS, Carroll HB, Qian R, Fuller ML, Giles AR, Mercer AC, et al. Kinetics and durability of transgene expression after intrastriatal injection of AAV9 vectors. Front Neurol. 2022;13:1051559. pmid:36452163
- 60. Williamson RA, Peretz D, Pinilla C, Ball H, Bastidas RB, Rozenshteyn R, et al. Mapping the prion protein using recombinant antibodies. J Virol. 1998;72(11):9413–8. pmid:9765500
- 61. Mehra S, Bourkas ME, Kaczmarczyk L, Stuart E, Arshad H, Griffin JK, et al. Convergent generation of atypical prions in knockin mouse models of genetic prion disease. J Clin Invest. 2024;134(15):e176344. pmid:39087478
- 62.
Kawamoto T, Kawamoto K. Preparation of Thin Frozen Sections from Nonfixed and Undecalcified Hard Tissues Using Kawamoto’s Film Method (2020). Hilton MJ. Skeletal Development and Repair: Methods and Protocols. New York, NY: Springer US, 2021, 259–81.
- 63. Johnston HE, Yadav K, Kirkpatrick JM, Biggs GS, Oxley D, Kramer HB, et al. Solvent Precipitation SP3 (SP4) Enhances Recovery for Proteomics Sample Preparation without Magnetic Beads. Anal Chem. 2022;94(29):10320–8. pmid:35848328
- 64. Pino LK, Searle BC, Bollinger JG, Nunn B, MacLean B, MacCoss MJ. The Skyline ecosystem: Informatics for quantitative mass spectrometry proteomics. Mass Spectrom Rev. 2020;39(3):229–44. pmid:28691345
- 65. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A. 1998;95(25):14863–8. pmid:9843981
- 66. de Hoon MJL, Imoto S, Nolan J, Miyano S. Open source clustering software. Bioinformatics. 2004;20(9):1453–4. pmid:14871861
- 67. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 2009;4(1):44–57. pmid:19131956
- 68. Sherman BT, Hao M, Qiu J, et al. DAVID: A web server for functional enrichment analysis and functional annotation of gene lists (2021 update). Nucleic Acids Res 2022;50:W216–w221.