https://orcid.org/0000-0002-3144-2026
Figures
Abstract
Schistosomiasis is a neglected tropical disease caused by parasitic flatworms of the genus Schistosoma, impacting hundreds of millions of people and animals globally. Disease pathology primarily originates from host immune responses to parasite eggs, which are produced only when female schistosomes are continuously paired with males. Past research focused on pairing-dependent female sexual maturation, while scarce data exist for the male’s reproductive biology. In this study, we characterized the G protein-coupled receptor Smgpcr9 (Smp_244240), an orphan Class A (Rhodopsin-like) GPCR. Previous bulk RNA-seq analyses of adult worms and their isolated gonads revealed that Smgpcr9 belongs to a subgroup of GPCR genes with abundant testis-preferential and pairing-influenced transcript levels in males but low and extremely low expression in unpaired and paired females, respectively. This male-/unpaired female-biased expression pattern mirrors that of neuropeptide (npp) genes of S. mansoni such as Smnpp26 and Smnpp41. In a deorphanization approach using yeast-two-hybrid analyses, GPCR internalization experiments, bioluminescence resonance energy transfer assays, and by modeling and docking analyses, we provide first evidence that both NPPs can interact with SmGPCR9. Furthermore, we optimized a GPCR RNAi approach and achieved efficient transcript knockdown (> 90%) enabling robust functional characterization of Smgpcr9. Following RNAi, physiological and morphological analyses revealed that SmGPCR9 regulates key aspects of male reproductive biology like testis morphology and sperm development. Remarkably, ovary structure and egg production were also affected in paired females post RNAi, which could be an indirect effect. We observed similar phenotypes plus motility constraints and reduced stem-cell proliferation in both sexes upon RNAi of Smnpp26 and Smnpp41. In all cases, RNAi downstream analyses by RT-qPCR of marker genes substantiated the observed phenotypic effects. These results strongly indicate the importance of SmGPCR9, SmNPP26, and SmNPP41 for spermatogenesis and further physiological processes in male and female S. mansoni.
Author summary
Research of the reproductive biology of schistosomes focused mainly on females so far, which upon pairing sexually mature to produce eggs that are important for the life cycle maintenance but also for the pathogenesis of schistosomiasis, the infectious disease caused by these parasites. We investigated a yet unknown G protein-coupled receptor, Smgpcr9, which showed a testis-preferential and pairing-influenced expression profile in Schistosoma mansoni males. To this end, we optimized an RNA interference (RNAi) approach for knockdown analysis, identified neuropeptides (NPPs) as potential ligands by different biochemical approaches and modeling and docking analyses, and we investigated the roles of SmGPCR9 and two interacting NPPs, SmNPP26 and SmNPP41, by physiological, microscopical, and molecular techniques. Our results strongly suggest that SmGPCR9 and both NPPs are functionally associated with spermatogenesis. Furthermore, we detected effects on ovary morphology, egg production, and stem-cell proliferation of paired females post RNAi, which could be an indirect effect. Taken together, we deorphanized SmGPCR9 and showed for the first time the essential role of a so far uncharacterized GPCR and two interacting neuropeptides for spermatogenesis. Our results shed first light on spermatogenesis regulatory processes controlled by GPCRs and neuropeptides in male S. mansoni and thus expand our understanding of the roles of GPCR-NPP signaling for schistosome reproductive biology.
Citation: Geetha S, Haeberlein S, Hahnel S, Li X, Sprague DJ, Peterson YK, et al. (2026) G protein-coupled receptor SmGPCR9 interacts with neuropeptides and controls spermatogenesis in Schistosoma mansoni. PLoS Pathog 22(7): e1014096. https://doi.org/10.1371/journal.ppat.1014096
Editor: Mary M. Stevenson, McGill University, CANADA
Received: March 16, 2026; Accepted: June 18, 2026; Published: July 7, 2026
Copyright: © 2026 Geetha et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All gene expression data from bulk and scRNA-seq analyses mentioned in the main text or the supplementary materials were obtained from the following open access sources: WormBase ParaSite database (https://parasite.wormbase.org/Schistosoma_mansoni_prjea36577/Info/Index/; [55]), SchistoCyte (https://www.collinslab.org/schistocyte/; [56]), and Schisto XYZ (https://schisto.xyz/).
Funding: This work was supported by a grant of the Deutsche Forschungsgemeinschaft 8 (DFG, German Research Foundation): GR1549/7-4 (CGG). DJS is grateful for funding from the MUSC Department of Biochemistry and Hollings Cancer Center. YKP is grateful for funding from the MUSC Office of the Vice President for Research for Drug Discovery Core services The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
In eukaryotes, GPCRs represent a large group of transmembrane receptors. GPCRs are involved in a great variety of physiological processes, including visual, olfactory and taste perception, neurotransmission, hormonal regulation, immune response, and reproduction, including spermatogenesis [1–9]. GPCRs interact with different classes of ligands, including hormones, neurotransmitters, gases, volatile compounds, biogenic amines, and neuropeptides [10–12]. In humans, Class A (Rhodopsin) is the most diverse subfamily of GPCRs. They comprise hormone, neuropeptide, neurotransmitter, and light receptors, which are ligand-activated to interact with guanine nucleotide-binding (G) proteins for signal transduction [13–19].
In parasite research, GPCRs have come into focus mainly due to their druggability and the necessity to find new treatment options for parasitic diseases [20–24]. Beyond that, in other organisms, few studies have addressed the biological function of GPCRs in protozoan and metazoan parasites [20,25–32]. Schistosomes are parasitic platyhelminths and responsible for schistosomiasis (bilharzia), a neglected tropical disease and zoonosis, which affects humans and animals mostly in the global south [33,34]. Despite its global burden, schistosomiasis is treated solely with the calcium channel antagonist praziquantel (PZQ), a drug effective mainly against adult worms but not juveniles or eggs. Clinical symptoms and pathology of schistosomiasis are induced by eggs, which are produced by paired females in the bloodstream of vertebrate hosts. In intestinal schistosomiasis, eggs find their way into the liver causing chronic granulomatous inflammation and fibrosis as main symptoms [34,35]. Egg production in turn is only achieved upon completion of differentiation of the female gonads (ovary and vitellarium), which depends on constant pairing with a male partner [36–38]. By inducing mitoses and differentiation processes in the reproductive organs, males play an essential role in regulating female sexual maturation [37,39–41]. Pairing even controls the expression of female-specifically expressed genes with functions in the gonads [42–44]. Past studies excluded sperm as a stimulus for female maturation because anorchid males, paired with females, induced maturation and egg production [45,46]. Hormonal factors or peptides delivered by males were also postulated [39,45–51]. Recently, a male-derived peptide-based pheromone, β-alanyl-tryptamine, was identified, regulating female sexual maturation [52]. The latter is supported by host vitamins, which in conjunction with the male-influence contribute to gonad differentiation in the female during pairing [44].
Bulk RNA-seq analyses of paired males (bisex males, bM) and unpaired males (single-sex males, sM) as well as paired and unpaired females (bF, sF, respectively), and their gonads, provided much information about sex-dependent, pairing-influenced, and/or gonad-specific or -preferential gene expression. This included gpcrs as differentially expressed genes [42]. Among these, a few gpcrs showed testis-preferential and pairing-influenced transcript profiles in males but low abundance transcripts in sF, and nearly no expression in bF [53]. Remarkably, the vast majority of npp genes appeared to be regulated in a sex- and pairing-dependent manner with a male/unpaired female bias [42,54]. Among the gpcr genes exhibiting a gonad-preferential and pairing-influenced expression pattern in males was Smp_244240, which we renamed Smgpcr9. This orphan receptor belongs to the Class A (Rhodopsin) subfamily of GPCRs in S. mansoni [42,53]. Here, our team provides first evidence for the interaction of SmGPCR9 with two neuropeptides, SmNPP26 and SmNPP41. Functional analyses of all three genes demonstrated (i) testis-preferential (Smgpcr9) and neuronal (Smnpp26, Smnpp41) transcript occurrence, (ii) roles in testis morphology, (iii) ovary morphology, (iv) egg production, and (v) stem-cell proliferation.
Results
Smgpcr9 is testis-preferentially expressed and potentially interacts with neuropeptides
Based on previous RNAseq data, we identified Smgpcr9 (Smp_244240) as a testis-preferentially and pairing-dependently transcribed gene in male S. mansoni [42,53–55]. This expression pattern was confirmed by RT-PCR and indirectly by single-cell RNA-seq data of S. mansoni, which independently showed transcription of Smgpcr9 in late male germ cells but also abundant transcript occurrence in the neuronal cell-cluster 3 (NC3) of males [56] (S1 Fig). Furthermore, based on phylogenetic analysis, Smgpcr9 was categorized as a member of the Class A (peptide activated) GPCR receptor subfamily in S. mansoni; and it is located on a sex chromosome [53,55]. These findings led us to characterize Smgpcr9 in more detail, including identifying potential interaction partners.
With the help of the membrane-anchored ligand and receptor yeast two-hybrid system (MALAR-Y2H) established in our lab [57], we searched for neuropeptide ligands (NPPs) of S. mansoni as potential interaction partners of Smgpcr9. We screened an in-house ligand library comprising 47 S. mansoni neuropeptides (SmNPPs). By robust yeast growth on SD/Trp ⁻ Leu ⁻ His ⁻ Ade⁻ selection plates, Smgpcr9 showed strongest interaction with SmNPP2a, SmNPP5b, SmNPP15b, SmNPP26a, SmNPP32.2, and SmNPP41. Weaker growth was observed with SmNPP1a and SmNPP24, while all other NPPs resulted only in moderate or no interactions [57] (S2 Fig). We selected the SmNPPs for agonist internalization experiments to obtain additional hints for interaction and functional responses.
Codon-optimized Smgpcr9 internalized in response to specific NPPs in HEK cells
To enhance expression in human cells, the Smgpcr9 coding sequence (CDS) was human codon-optimized (S3 Fig), tagged with dsRed and cloned into a modified pcDNA 3.1 vector containing the mCitrine coding sequence as an additional tag. With this construct, we transfected HEK293-6E suspension cells. To assess receptor-NPP interactions, synthetic SmNPPs were added to transfected cells. Internalization of the fluorescently labeled receptor upon ligand exposure served as a proxy for potential NPP binding and SmGPCR9 activation. Notably, except for SmNPPs 1a and 24, which failed to induce growth and β-Gal activity in the yeast experiments, all other tested NPPs induced internalization of SmGPCR9, as evidenced by the intracellular distribution of signals (Figs 1A-E; S4). These results suggested that the tagged version of SmGPCR9 is functionally expressed in HEK cells and bound by selected SmNPP ligands, which corresponded to the MALAR-Y2H data. This experiment remained as an indirect proxy for ligand-induced activation and does not establish receptor pharmacology.
A-B, Selected examples of agonist-induced internalization experiments of the labelled version of SmGPCR9 (pcDNA_mCitrine_GPCR9_dsRed [N-terminal]) in HEK 293-6E cells upon stimulation with soluble SmNPP26b (A) and SmNPP41 (B), respectively (see also S4 Fig). In merged images, labelled SmGPCR9 appears as orange/yellow puncta (mCitrine + dsRed channels), indicated by red arrows. C, Negative control showing an overlay image of the labelled version of SmGPCR9 cells without ligand; as expected, signals are mainly found in the membrane. D, Positive control showing the internalization of the M2 muscarinic acetylcholine receptor following carbachol stimulation (green signals in the cytoplasm indicated by red arrows). E, Negative control for D showing M2-expressing HEK293 cells without carbachol stimulation. F-G, Results of Gαq recruitment assay showing positive responses for SmNPP26b (F) and SmNPP41 (G), respectively. Dashed lines indicate the FRET buffer control used for normalization. H, Positive control showing carbachol-activated muscarinic acetylcholine receptor. Scale bars as indicated (n = 2).
Gαq-signaling assay indicated SmGPCR9 activation by SmNPP26 and SmNPP41
Next, we performed BRET (Bioluminescence Resonance Energy Transfer) assays between Gαq-nluc and Gβ𝛾-YFP to find further evidence for SmGPCR9 interaction with the NPPs. Only SmNPP26a and SmNPP41 with the peptide sequences NFDPILF and FFCNPMGCV, respectively, triggered reproducible BRET signals indicating Gαq activation by SmGPCR9. In both cases, we observed a decrease in BRET signal intensity at 1 µM of the appropriate SmNPP (Figs 1F-H and S5A). To investigate whether the presence of the tagged receptor version may have influenced receptor function, we generated an additional construct encoding the untagged version of SmGPCR9 and cloned this variant directly into pcDNA3.1. HEK293T cells transfected with this construct were subjected to the same BRET assay protocol (S5B Fig). However, we observed no significant differences between these results and the previous ones. Again, SmNPP26 and SmNPP41 exhibited activity at 1 µM, thus confirming the results with the tagged receptor version. This suggests that the ligands may have lower binding affinity to the receptor under the used conditions and hence required a higher concentration to produce detectable BRET signal in the used in vitro system.
Potential binding poses of SmNPP26 and SmNPP41 in GPCR9
Since we obtained evidence for SmGPCR9 interaction with SmNPP26b and SmNPP41, we employed induced-fit molecular docking to predict binding poses of both SmNPPs in the extracellular domain of SmGPCR9. We first generated a homology model of SmGPCR9, based on the crystal structure of the human Neuropeptide FF receptor 2, PDB: 9M54. This template gave 74% coverage and 23% sequence identity to SmGPCR9 and resulted in a putative model (Fig 2A). While 23% identity may appear modest, this falls within the acceptable range for GPCR homology modelling, particularly given that the template is from the same receptor superfamily, shares the characteristic seven-transmembrane architecture, and functions as a peptide-activated GPCR. Importantly, experimental structures of related GPCRs capture biologically relevant conformational states and ligand-binding geometries that are critical for our downstream analyses. Alternatively, we also evaluated an AlphaFold model for SmGPCR9, however, there were significant limitations. Overall confidence metrics of the AlphaFold model achieved a pLDDT score of 75.5, which was fair, but AlphaFold treats the sequence like an independent protein, not knowing it is a GPCR. The extracellular loops, which are critical for ligand recognition and binding, showed poor prediction quality. Given that our study focused on potential binding poses of neuropeptides in the receptor, the quality of the extracellular and binding pocket regions was paramount. The structural artifacts in the AlphaFold model would likely produce different and less reliable results. The homology model based on PDB: 9M54, therefore, provided a more realistic representation of the ligand-accessible binding pocket and the extracellular architecture.
A, Molecular modeling of SmGPCR9. B-C, Space-filling model of SmNPP26b (purple), and SmNPP41 (blue) respectively in SmGPCR9 (grey) using induced-fit modeling. D, Predicted binding pose of SmNPP26b (purple) in GPCR9 (grey). Key interacting residues are labeled in orange. Clustering of the results showed a stable binding pose, in which SmNPP26 (purple) fits within an extracellular binding pocket of the receptor. Hydrogen bonds = yellow; aromatic hydrogen bonds = blue; salt bridge = purple. E, Predicted binding pose of SmNPP41 (blue) in GPCR9 (grey).
Next, we prepared the two most likely NPP binding partners for docking. SmNPP26b and SmNPP41 did not allow homology modeling because of their small sizes. We attempted to generate consensus conformers of SmNPP26b and SmNPP41 using a conformational search in the MOE computational suite. SmNPP41 returned 9 conformers that were almost identical, while SmNPP26b generated only a single conformer. Therefore, a single optimized conformer was used as the ligand for flexible docking into the receptor.
Having generated a receptor model and a stable conformer of the putative ligands, we then employed induced-fit docking, an approach in which both the ligands and receptor are flexible, to determine possible binding poses. After clustering of the results, we obtained stable binding poses for both SmNPP26b (Fig 2B) and SmNPP41 (Fig 2C) where both SmNPPs (purple and blue, respectively) tightly fit within an extracellular binding pocket of SmGPCR9 (grey). Predicted binding free energies were favourable for both peptides, with SmNPP26b exhibiting a docking score of −7.38 kcal/mol and SmNPP41 showing slightly stronger predicted binding at −8.02 kcal/mol. The extracellular binding domain is structurally constrained and well defined, consistent with canonical GPCR architecture and the homology template. GPCRs typically bind ligands near the centre of the transmembrane helical bundle, with an extracellular domain composed of beta-sheet structures from the amino terminus and the E4 loop (between TM4 and TM5). This architecture occludes a large portion of the extracellular surface, thereby creating a discrete and well-defined ligand-binding pocket that accommodates both SmNPP peptides. The peptide is predicted to be held into place via similar key hydrogen bonds in both cases. SmNPP26 is predicted to form hydrogen bonds with Y50, K214, R243, and Y333 (Fig 2D). SmNPP26 was also predicted to form a salt bridge with K214, and aromatic hydrogen bonds with E337. SmNPP41 was also predicted to be held in place with hydrogen bonds to the side chains of Y50, R243, Y333 and an aromatic hydrogen bond to the backbone carbonyl of K214 (Fig 2E). These interactions, combined with favourable hydrophobic and hydrophilic environments, seem to be key for productive binding of both NPPs to SmGPCR9. Superposition of the top-scoring docked poses for SmNPP26b and SmNPP41 revealed a root-mean-square deviation (RMSD) of 2.85 Å, indicating highly similar binding modes. Notably, the proline and two phenylalanine residues in both peptides adopt closely overlapping positions within the binding pocket, suggesting conserved structural determinants for receptor engagement. Importantly, these similarities emerged from independently optimized best-scoring poses for each peptide, rather than from constrained alignment, further supporting a shared and robust binding mode.
Smgpcr9 transcripts localized in testes and Smnpp26/Smnpp41 transcripts in neuronal cells
For further characterization, we performed whole-mount in situ hybridization (WISH) to localize the transcripts of Smgpcr9, Smnpp26, and Smnpp41 in pairing-experienced (bisex) males (bM), pairing-experienced (bisex) females (bF), pairing-inexperienced (single-sex) females (sF), and pairing-inexperienced (single-sex) males (sM). Smgpcr9 transcripts were mainly found in testes and weakly throughout the body in a stripe-like, punctiform pattern (Fig 3). The latter may result from Smgpcr9 expression in neuronal cell cluster 3 (Ncc3), as indicated by single-cell RNA-seq analysis [56] (S1 Fig). The WISH signals confirmed in more detail our previous results for Smgpcr9 transcript localization using a classical in situ hybridization technique of sections of male worms [58,59], which at that time failed to detect neuronal expression.
A, WISH localized Smgpcr9 transcripts weakly along the body but strongly in testes of male S. mansoni; the right part shows a close-up of the testes area. B, Also by a classical in situ hybridization technique of sections of male worms (technical details in 58), Smgpcr9 transcripts (red signals) dominated in the testes. C, Sense probe as negative control showed no signals.
Although we also performed WISH in females (bF and sF), and couples with varying concentrations of riboprobes, there were no remarkable signals observed in females (S6 Fig).
For Smnpp26 and Smnpp41, hybridization signals in males (bM and sM) exhibited punctiform distribution throughout the bodies (Fig 4A-B and 4E-F), which is typical for neuronal expression patterns [32,60,61]. Cell atlas data demonstrated a wider transcript occurrence of Smnpp26 and Smnpp41 in many male tissues but dominant transcript occurrence in neuronal clusters 4 (Smnpp26) and 8 (Smnpp41), respectively [56] (S7 Fig). In females, distinct expression differences were observed between sF and bF groups. In sF, WISH signals of both npp transcripts prominently occurred in punctiform patterns, similar to their occurrence in males but more concentrated at the body edges (Fig 4C-D and 4G-H). In contrast, signals were markedly reduced in bF. These findings perfectly correspond to the previous bulk RNA-seq data of male and female S. mansoni, which showed abundant transcripts of Smnpp26 and Smnpp41 in adult worms but not in their gonads (S7 Fig). Furthermore, transcript levels in females were found to be pairing-dependent, with clearly higher mRNA levels of both npps in sF compared to bF. We confirmed these transcription patterns by RT-qPCR (S8 Fig). Sense probes used as negative controls for each target gene yielded no detectable signal, confirming probe specificity. Furthermore, control probes for known marker genes validated the integrity and accuracy of the WISH procedure: Smtsp-2 transcripts were localized near the tegument, consistent with its known role as surface-associated tetraspanin [62], while Smmyst4 transcripts were restricted to the vitellarium, as expected for a female reproductive tissue marker [32] (S9 Fig).
A-D, WISH of Smnpp26 transcripts in neuronal cells occurred in the head parts and along the bodies of paired (bisex) males (bM; A); B, unpaired (single sex) males (sM); C, paired (bisex) females (bF; nearly no signals); D, unpaired (single sex) females (sF). E-H, WISH localised Smnpp41 transcripts in neuronal cells of paired (bisex) males (bM; E); I, unpaired (single sex) males (sM); G, paired (bisex) females (bF; nearly no signals); H, unpaired (single sex) females (sF). If not indicated by other sizes, scale bars: 200 µm. Abbreviations: te, testes; h, head (anterior) part. Images are representatives of 3-5 worms per group.
RNAi against Smgpcr9, Smnpp26, and Smnpp41 influenced morphology and physiology of adult S. mansoni
In contrast to effectively knocking-down npp genes in S. mansoni by RNAi, the Smgpcr9 transcript level was reduced by only about 50% with the standard method used in our lab (using a single dsRNA sequence per target gene) [44,60,63] (S10A Fig). This comparatively low RNAi efficiency resulted in hardly reproducible testes phenotypes of treated worms in vitro. To overcome this limitation, we designed a two-probes/per-target-gpcr (tp/pt-gpcr) RNAi approach choosing two different parts of Smgpcr9 for subcloning and dsRNA synthesis. SiRNA-finder (si-Fi) analysis supported the selection of suitable sequences, an approach which had been previously applied to optimize target-sequence selection by predicting potential off-target genes and to reduce or exclude off-target effects in S. mansoni [63,64]. For tp/pt-gpcr RNAi, we used a concentration of 15 µg/mL per dsRNA, i.e., 30 µg/mL total amount of dsRNA for Smgpcr9, which resulted in an increased knockdown (KD) efficiency of 90% ± 3% (S10B Fig). For RNAi against Smnpp26, and Smnpp41, we treated worms with 15 µg/mL each, resulting in KD efficiency of > 90% in each case. We performed RNAi using single dsRNAs each or Smnpp26, and Smnpp41, which resulted in KD efficiencies of 94% ± 2%, and 93% ± 2% respectively. Therefore, we continued with the single dsRNA approach in case of both NPPs (S10C-D Fig). We used 30 µg/mL of ampR dsRNA for control. To investigate RNAi effects for these three genes, we treated adult S. mansoni with the appropriate dsRNAs in vitro over a 15-day period.
By bright-field microscopy, we observed various phenotypic changes after dsRNA-treatment, especially in both npp RNAi groups. These phenotypes comprised curled and shrunken worm bodies, diminished motility, and the production of morphologically aberrant eggs. While RNAi of Smgpcr9 caused no obvious morphological changes, Smnpp26 RNAi worms exhibited curling and shrinkage of the worm body. A similar but weaker phenotype was seen after Smnpp41 RNAi (Fig 5).
Bright-field microscopy of S. mansoni couples revealed morphologic changes after treatment with dsRNAs targeting Smgpcr9, Smnpp26, and Smnpp41, as indicated. In contrast to the controls (untreated and ampR dsRNA-treated), RNAi against Smnpp26, and Smnpp41 induced curved and/or curled morphologies, and eventually shrinkage in size. Except slightly reduced motility after 12 d of dsRNA treatment (see text and S11 Fig), Smgpcr9 RNAi caused no further phenotypic changes (n = 3). Scale bars = 100 µm.
For all three genes, RNAi had no influence on pairing stability during the observation period. In all three cases, however, worm motility diminished throughout the treatment period. Smnpp26 and Smnpp41 RNAi showed significantly stronger effects at day 3, whereas Smgpcr9 RNAi caused decreasing motility only day 12 (S1-S3 Movies, S11 Fig). The controls showed normal movement (S4-S5 Movies, S11 Fig). Although the total number of eggs was similar among all treatment groups, egg morphology differed. In all target gene groups, the number of abnormal eggs significantly increased at the end of the observation period (Fig 6).
During the 15 days period, eggs were produced in vitro in each RNAi target groups and in control worms (untreated, no dsRNA; ampR, irrelevant dsRNA, as indicated). A, Egg production (total amount) was similar in all groups including the controls. A slight reduction of egg production was observed for worms of the Smnpp41 RNAi group. B, The number of deformed eggs significantly increased in RNAi target groups from day 9 of treatment on, not in the controls. Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05; ns, no significance (n = 3).
In contrast to the controls, in vitro-laid worm eggs of the other treatment groups exhibited various defects including size reduction, missing spines, and/or no zygotes from day 9 forward (S12 Fig).
These results revealed that RNAi against the three genes in focus caused effects on egg morphology over time but not on the number of eggs produced. These effects were independent of pairing stability, which was not influenced by RNAi, although worm motility was affected.
Following RNAi against all three genes, we investigated morphological changes in males and females by confocal laser scanning microscopy (CLSM). In males, Smgpcr9 RNAi resulted in shrunken testicular lobes and a clear reduction in sperm content. In 3/5 males, sperm were completely absent, whereas sperm count in the other 2 males was very low. Similar testes phenotypes were seen after RNAi against Smnpp26 and Smnpp41. In both control groups, untreated or treated with irrelevant dsRNA, none of these phenotypes occurred, and sperm vesicles were filled with differentiated sperm, as expected [65,66] (Fig 7A).
A, Following RNAi of the target genes (as indicated), CLSM of males revealed shrunken testicular lobes with lower numbers of spermatogonia compared to both control groups (untreated, no dsRNA; ampR, irrelevant dsRNA). Also sperm production was diminished in all three target RNAi groups. None of these phenotypes occurred in the controls, in which sperm vesicles were filled with differentiated sperm, as expected (65-66). Scale bars = 50 µm. Abbreviations: te, testes; sv, sperm vesicle; d, diameter. B, In females, all three target RNAi groups showed reduced sizes of the ovaries. Abbreviations: mo, mature oocytes; io, immature oocytes. d, diameter; te, testes; sv, seminal vesicle; io, part of the ovary containing immature oocytes; mo, part of the ovary containing mature oocytes. Scale bars = 50 µm.
In paired females, Smgpcr9 RNAi resulted in smaller ovaries, including reduced sizes of both the posterior part containing mature oocytes and the anterior part containing immature oogonia, which represent germinal stem cells (GSCs). Upon Smnpp26 and Smnpp41 RNAi, the size of the posterior part of the ovary was particularly reduced as well as the number of mature oocytes. As expected, ovary sizes were normal in females of both control groups, and numbers of immature and matures oocytes were high [65,66] (Figs 7B, 8).
For all groups (as indicated), we performed Image J-based determination of the size of the anterior part of the ovary containing immature, stem cell-like oogonia (Area of io; left diagram) and its posterior part containing mature oocytes (Area of mo; right diagram). Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05, ns, no significance; n = 5.
Next, we performed 5-ethynyl 2´-deoxyuridine (EdU) incorporation assays to find out whether the described RNAi phenotypes in both sexes were associated with disturbed stem-cell proliferation. In males, Smgpcr9 RNAi caused no significant alterations in the number of EdU-positive cells, neither in GSCs within the testes nor the somatic stem cells, the neoblasts, which occur along the worm body [67]. Thus, stem cell proliferation following RNAi appeared normal and was similar to that of the male control groups (treated with irrelevant RNA and untreated). In contrast, we observed a significant reduction in the number of EdU-positive GSCs and somatic stem cells for Smnpp41 but not for Smnpp26 following RNAi (Figs 9A, S13).
EdU staining (green) of male (A) and female (B) S. mansoni after RNAi against the three target genes and the controls, as indicated. (A), In testes (te), reduced numbers of EdU-positive GSCs (upper row) were mainly found following Smnpp41 RNAi, a tendency of reduction for Smnpp26 RNAi, but no reduction for Smgpcr9 and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA; see also S13 Fig). We detected comparable reductions for somatic stem cells (neoblasts (78), lower row). (B), In females, reduced numbers of EdU-positive GSCs (upper row) were found for Smnpp26 and Smnpp41, but no reduction for Smgpcr9 and the control groups (see also S13 Fig). In the vitellarium, a reduction of EdU-positive cells was mainly observed for Smnpp41 (lower row). EdU-positive vitelline stem cells are difficult to distinguish from neoblasts. Unexpectedly, we found strongly reduced staining in the ampR control. Hoechst served as counterstain (blue) (n = 3). Scale bars = 50 µm. Abbreviations: ov, ovary; vit, vitellarium; n, neoblast (somatic stem cell).
In females, reduced numbers of EdU-positive GSCs in the ovary were found for Smnpp26 and Smnpp41, but not for Smgpcr9 and the control groups. Part of the female gonad is the vitellarium [37], in which we observed a clear reduction of EdU-positive cells mainly after Smnpp41 RNAi. In contrast to the control without dsRNA (untreated), which expectedly showed much staining in the female gonads (ovary and vitellarium), we repeatedly (n = 3, five worms/n) found signals only in the ovary but sharply reduced in the vitellarium following ampR dsRNA treatment. This finding was unexpected and suggests a yet undetected [63] and vitellarium-specific effect of this “irrelevant” dsRNA on stem-cell activity in this organ (Figs 9B, S13D).
In summary, CLSM and EdU-assay data indicated that Smgpcr9 RNAi caused smaller testes and reduced sperm production in males without affecting stem-cell proliferation. In females, Smgpcr9 RNAi caused a similar gonadal phenotype, smaller ovaries without affecting stem-cell proliferation. Upon Smnpp26 and Smnpp41 RNAi, similar testes phenotypes were observed in males with respect to reduced testes size and sperm production. Here, significant effects on stem-cell proliferation were found for Smnpp41 but not for Smnpp26. In females, the size of the posterior part of the ovary and the number of mature oocytes were reduced in both the Smnpp26 and Smnpp41 RNAi groups, which was paralleled by significantly reduced stem cell proliferation in each case.
RNAi against Smgpcr9, Smnpp26, and Smnpp41 affected the expression of selected genes
To solidify the observed phenotypic effects in both sexes and to find further hints for their molecular basis, we investigated the expression profiles of selected genes by RT-qPCRs. As starting material, we used couples treated for 15 days in vitro with the appropriate dsRNAs. At the end of the experimental period, couples were manually separated, and RNA was separately isolated from females and males. As RT-qPCR control, Smletm1 was used as the reference gene based on its proven use for in vitro studies [68]. Following RNAi against each respective target gene, the expression levels of Smgpcr9 and Smnpp26 were significantly reduced in both sexes. Whereas the expression of Smnpp41 was also significantly reduced in males, it unexpectedly increased in females (Fig 10A).
A, Following RNAi against each target gene (as indicated), the transcript levels of Smgpcr9 and Smnpp26 were significantly reduced in male and female S. mansoni. Similarly, the expression of Smnpp41 was significantly reduced in males, however, it increased in females. Worms without dsRNA or treated with irrelevant dsRNA (ampR) served as controls. B-C, In males, significant reduction of the expression level of tektin a1 was observed following Smgpcr9 and Smnpp26 RNAi, while for tektin 2, significant reduction of its expression level was observed in all RNAi groups (as indicated). D, In females, expression of both egg synthesis-related genes, tyrosinase 1 and Smp14, was significantly downregulated following Smgpcr9 RNAi and Smnpp26 RNAi. Smnpp41 RNAi caused no significant change of tyrosinase 1 but an increase of Smp14 expression. E, nanos-1 expression was significantly reduced in the Smnpp26 RNAi groups of males and females, whereas Smgpcr9 RNAi caused no significant for this gene. Upon Smnpp41 RNAi, nanos-1 expression was significantly reduced in males but strongly upregulated in females. F, For nanos-2, significantly reduced expression was found after Smnpp26 RNAi in both sexes, whereas no difference occurred after Smgpcr9 and Smnpp41 RNAi. Fold changes of expression levels between dsRNA-treated worms and untreated control worms were calculated using the 2-ΔΔCt method. Data are representative of the mean ± SEM n = 3. Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05, ns, no significance.
With regard to the various RNAi phenotypes detected for Smgpcr9, Smnpp26, and Smnpp41, we selected the following genes for downstream analyses. Concerning the suspected deficiency of sperm differentiation in males, we focused on tektins because they represent marker genes for sperm differentiation coding for structural components of sperm flagella, which are responsible for sperm motility [69–71]. Based on their expression profiles in RNAseq studies, we selected two annotated tektins of S. mansoni, Smtektin-a1 (Smp_343970) and Smtektin-2 (Smp_046410; https://parasite.wormbase.org) [55]. Both tektins showed similar transcript profiles as Smgpcr9 with a clear testis-bias of expression according to bulk RNAseq data [42] (S14A-B Fig). Furthermore, scRNAseq data indicated the dominant occurrence of transcripts of both tektins in male testes but also in some Nccs and flame cells [56] (S14C-D Fig).
Regarding diminished egg production, egg malformation, morphological changes in the female ovary, and the observed stem cell-proliferation effects, we analyzed marker genes that were shown before to be involved in egg production and stem-cell proliferation: (i) the egg-shell biosynthesis enzyme tyrosinase 1 (Smtyr-1; Smp_050270) [72], (ii) the egg-shell precursor gene Smp14 (Smp_131110) [73], (iii) the vitelline and germline stem-cell (GSC) marker gene nanos-1 (Smp_055740) [44,56], and (iv) the neoblast and GSC marker gene nanos-2 (Smp_051920) [74].
Following Smgpcr9 RNAi, the transcript levels of both tektin genes were significantly reduced in males (Fig 10B and 10C). We also observed significantly reduced transcript levels of Smtyr-1 and Smp14 in females (Fig 8D). In contrast, expression levels of Smnanos-1 and Smnanos-2 were unaffected (Fig 10E and 10F).
Smnpp26 RNAi significantly reduced the expression levels of both tektin genes as well as nanos-1 and nanos-2 in males and females (Fig 10B-C and 10E-F). Furthermore, we detected a significantly reduced expression level of Smtyr-1 but not Smp14 (Fig 8D).
In males, Smnpp41 RNAi significantly reduced the expression levels of Smtektin-2 and Smnanos-1 but not Smtektin-a1 and Smnanos-2 (Fig 10B-C and 10E-F). In females, Smnpp41 RNAi significantly enhanced the expression level of Smnanos-1 but not Smnanos-2, Smtyr-1, and Smp14 (Fig 10D-F). With respect to the observed effects on marker gene expression in females, one must analyze the results with a degree of caution because the transcript level of Smnpp41 was significantly upregulated in females after RNAi (Fig 10A).
Discussion
Typically, platyhelminths are hermaphroditic organisms that follow the principle of protandry (male gonad development precedes female gonad development) as one of two possible forms of sequential hermaphroditism [75,76]. Against this background, schistosomes are exceptional in having evolved sexual dimorphism during evolution. On their evolutionary path, however, absolute dioecy has not yet been achieved, because female schistosomes depend on permanent pairing with their male partners to achieve complete sexual maturation, an obvious reminiscence to their protandric ancestors [77]. During constant pairing, the female lodges within the gynecophoral canal, a ventral groove formed by the male. This intimate contact can last for years as a prerequisite for continued production of eggs [36,37,39–41]. Since egg laying is a double-edged sword, ensuring life-cycle maintenance on the one hand, and on the other causing pathology in the final host [34], female gonad development has been in the focus of many studies, with little emphasis on studying gonadal processes in males.
In the past, mainly single gene and signalling cascade analyses were performed to study schistosome male reproductive biology. In this context, a Fushi-tarazu factor-1 nuclear receptor was localized in the testis of male and ovary of female S. mansoni [78]. Mediated by excretory-secretory products, roles for extracellular signal-regulated kinase (ERK) and p38 mitogen-activated protein kinase (p38 MAPK) pathways were shown to affect cell proliferation, the tegument, female gonads, and male testes [79]. Further, cytoplasmic protein tyrosine kinases of the Src (SmTK3), Src/Abl (SmTK6), Abl (SmAbl1, SmAbl 2), and Syk (SmTK4) families were shown to be expressed in male testes and to be involved in signal transduction pathways organizing the cytoskeleton in gonadal cells of S. mansoni [58,80–82]. The S. japonicum ortholog of SmTK4 was also shown to be important for gametogenesis [83]. Moreover, transcripts of the S. japonicum ortholog of pumilio, SjPum2, an RNA-binding protein, were found in testis and ovary. Sjpum2 RNAi resulted in morphological alterations of both male and female gonads [84]. The latter phenotype was also demonstrated following RNAi of Sjnanos1, which is a gonadal stem-cell marker in S. japonicum [85]. Additional comprehensive analyses of bM versus sM by Serial Analysis of Gene Expression and microarrays unraveled additional and pairing-influenced roles for TGFβ-signaling, with Smfst (follistatin) and Smbmp (bone morphogenic protein) expressed in testes and ovary [86]. Results of RNAseq analyses in S. mansoni suggested a complex scenario with even more molecular players that are differentially expressed upon pairing in both genders [42,54]. Similar complexity was found in an RNAseq study of S. japonicum [29], which suggests the genus-level commonality of these findings.
In S. mansoni, morphological studies by CLSM exhibited no substantial differences between testes of bM and sM; both have fully developed testicular lobes, spermatogonia, and fully differentiated sperm [65,66]. However, RNAseq identified 243 pairing-dependently expressed genes in the testis [42], which suggests the existence of regulatory processes “underneath” the visually detectable morphological level [54]. Among these was Smgpcr9, for which we confirmed transcriptional upregulation after pairing and predominant expression in the testes. Further WISH signals in the anterior “head” part and along the male body indicated additional expression in neurons. This coincided with scRNAseq data, which also detected Smgpcr9 transcripts in cells of the neuronal cluster 3 [56].
According to a previous classification based on phylogenetic analyses, Smgpcr9 is a member of the Rhodopsin-like GPCR family, connected to NPP signaling [53]. NPPs play important roles in reproduction as shown for organisms like Schmidtea mediterranea [87,88], a free-living flatworm closely related to schistosomes, and Drosophila melanogaster [89–91]. Therefore, we applied a deorphanization approach focusing on NPPs of S. mansoni cloned in a MALAR-Y2H library. The initial library screening identified five NPP candidates as ligands for SmGPCR9 [57]. In this study, we restricted the number of putative interaction partners using GPCR internalization experiments, BRET assays, and modeling approaches of the two most likely candidates, SmNPP26b and SmNPP41. Although BRET assays were conducted in heterologous system (in HEK cells), the receptor behavior in this system may not fully reflect the native schistosome context. Schistosome GPCRs include highly diverged and phylum-specific receptor families with unusual structural and signaling features, potentially requiring parasite-specific membrane environments, accessory proteins, or downstream coupling partners that are absent in mammalian cell lines [31,92]. The latter approach included the first homology model of SmGPCR9 based on the human neuropeptide FF receptor 2, the most suitable template for this receptor. As expected, the homology model predicted seven transmembrane helices, which form an extracellular binding domain within which SmNPP26b and SmNPP41 can dock. Induced-fit docking predicted both NPPs to fit into this pocket, forming several favorable van der Waals interactions in addition to being held in place by key hydrogen bonds and salt bridges. A weakness of our study is that NPP assignment was tested in different in vitro assays with corresponding results, but not in vivo. Therefore, we cannot exclude that the binding results in vitro and the coinciding RNAi effects observed for the receptor and the neuropeptides may have coincided even if these molecules may not represent binding partners in vivo.
Besides Smgpcr9 transcripts in the testes, localisation experiments revealed transcripts of all genes in various Nccs. Although the WISH signals for npps were mostly punctiform, the patterns differed in their positions. In males, Smgpcr9 transcripts occurred throughout the worm body along two parallel stripes, whereas the majority of Smnpp26 transcripts occurred closer to the tegumental surface area. Smnpp41 transcripts appeared more central, and patchy. These differences can be explained by scRNAseq results that detected Smgpcr9 transcripts (besides testes) mainly in Ncc3, Smnpp26 transcripts dominantly in Ncc4, and Smnpp41 transcripts dominantly in Ncc8. Comparing signal occurrence between sM and bM, it appeared as if the patterns were slightly different as well. Based on the fact that flatworms lack a coelom and a proper circulatory system, previous studies suggested that the nervous system controls growth and development by releasing of peptidergic signals into the intercellular space close of these worms to target cells or organs, in a synaptical or non-synaptical, paracrine way. This may be realized by the orthogonal architecture of the flatworm nerve system, which has a rectilinear, rope ladder-like structure of longitudinal nerve cords connected at regular hubs by transverse ring commissures [93]. This nerve net may occur close enough to organs like the gonads to mediate NPP signaling. Support for this assumption has been provided by studies in the free-living flatworm S. mediterranea, in which the gonadal system consists of a pair of ovaries located posterior to the cephalic ganglia, dorsolateral testes lobes, and accessory reproductive organs. An NPP called npy-8 was localized in cells of the central and peripheral nervous systems including the cephalic ganglia. FISH showed npy-8 transcripts also in cells close to the testes, and npy-8 RNAi finally led to the loss of sexual maturity including regressed testes and loss of the differentiation of mature sperm [88]. For Smnpp41, transcripts occurred closer to the edges of the worm body in sM, but more central in bM. This suggests migratory capacities of involved neuronal cells that might influence developmental changes post pairing. Indeed, dorsoventral and anterior-posterior migration of neuronal cells has been described for vertebrates and invertebrates, and it can be part of differentiation processes [94,95]. We observed an even clearer pairing-dependent difference in females. Whereas Smnpp26 and Smnpp41 transcripts dominated in sF, occurring beneath the tegument (Smnpp26) or more central (Smnpp41), in both cases WISH signals were nearly absent in bF. These results confirm previous bulk RNAseq data of adult S. mansoni and their gonads [42] as well as RT-qPCR results (this study), which showed significantly reduced transcript levels of both npps in females after pairing. These findings support the hypothesis that reduced npp expression in bF might indicate lower importance of female NPP activity after pairing. However, since NPP activities should be physiologically essential for both sexes, the question arises whether the male, after pairing, takes neuronal power over the female, and how? Part of this takeover is the reduced need for muscular activity of the female after she has lodged in the gynecophoral canal, which after pairing controls all locomotion activities of the couple. This exemplifies the separation of labour arrangement of the schistosome couple, a hypothesized evolutionary advantage that distinguishes the exceptional, sexually dimorphic schistosomes from other hermaphroditic platyhelminths [96]. Another part of this takeover may deal with the reproductive biology of the female, which is governed by the male. Our RNAi-based functional analyses of all three genes provided evidence for this. For an easier overview of the results, we summarize and discuss the phenotypes for all genes in focus in the following sections.
Smgpcr9
With the optimized tp/pt-gpcr RNAi approach, microscopy of dsRNA-treated worms showed no obvious morphological changes and no effect on pairing stability over 15 d. However, motility decreased from d 12 on. In males, CLSM demonstrated shrunken testicular lobes and reduced sperm production upon Smgpcr9 RNAi, and EdU-assay results indicated normal stem-cell proliferation. These findings suggest that Smgpcr9 plays no role in GSC activities in the testes, but a role for differentiation processes after stem-cell division that lead to spermatogonia. Support for this assumption was provided by RT-qPCRs demonstrating the downregulation of Smtektin-a1 and -2, marker genes for sperm differentiation. In contrast, Smnanos-1/2, marker genes for GSC proliferation, were transcribed at the same level as the controls.
Unexpectedly, the number of deformed eggs significantly increased from d 9 on after Smgpcr9 RNAi, and CLSM of females exhibited smaller ovaries. Results of EdU assays, which showed no significant differences between the RNAi group and the controls, suggest that the gonadal phenotypes in females were independent of GSC proliferation. This corresponds to RT-qPCR results showing no effects on the expression levels of Smnanos-1/2. In contrast, the transcript levels of Smtyr-1 and Smp14, both differentiation markers for female vitellarium, as part of the female gonad, were downregulated. This suggests that Smgpcr9 RNAi likely affected differentiation processes post stem-cell division also in bF. These effects were unexpected since Smgpcr9, according to available RNAseq data for adult schistosomes, is a strictly controlled gene with a gonad-preferential, pairing-influenced, and Ncc3-associated expression profile in males. In females, bulk RNAseq data showed negligibly small transcript amounts; however, scRNAseq data also showed transcripts in other neuronal clusters (https://www.collinslab.org/schistocyte/search?gene=Smp_244240). The latter finding indicates a sex difference in Smgpcr9 transcription, which may contribute to the female phenotype. However, scRNAseq showed no Smgpcr9 transcripts in ovary or vitellarium. This could mean that the phenotype in females, including higher production of deformed eggs, reduced ovary size, and decreased vitellarium marker gene expression, resulted either from an additional but indirect role of Smgpcr9 in males or from the expression of this gene in female Nccs. If the effect originates from males, two scenarios are conceivable. Either sperm fluid transports factors produced downstream of SmGPCR9 activation in the testes that influence female gonad differentiation, or factors are transmitted to the female via excretory-secretory products (ESPs) during pairing. Indeed, a recent study demonstrated a role for ESPs in male-female interaction and reciprocal communication between the sexes [97].
Smnpp26
Smnpp26 RNAi resulted in strongly curled and constricted worm bodies from d 3 on, diminished motility, and the production of abnormal eggs, although pairing stability was unaffected. In males, CLSM revealed smaller testicular lobes and the absence of differentiated sperm. EdU assays showed a trend but no significant reduction of stem-cell proliferation, while RT-qPCRs showed significantly reduced transcript levels of Smnanos-1/2. Therefore, we cannot exclude a stem-cell effect in the male gonad. Nevertheless, the significantly reduced transcript levels of Smtektin-a1 and -2 substantiate the CLSM phenotype and suggest diminished sperm differentiation, part of which could perhaps be explained by an additional RNAi effect on stem-cell proliferation.
CLSM of the female revealed a smaller ovary, in which the posterior part was significantly smaller, as was the numbers of mature oocytes. Although no obvious reduction of the part of the ovary containing immature oocytes was microscopically observed, EdU assay results indicated less GSC proliferation. This is paralleled by reduced transcript levels of Smnanos-1/2. Since the transcript level of Smtyr-1 was also reduced, a differentiation effect on the vitellarium seems likely, which might explain the high number of deformed eggs because Smtyr-1 is responsible for egg-shell biosynthesis [72]. At the same time, Smp14 transcript levels were unchanged. This could be explained if both genes are targets of parallel but different pathways controlling female sexual maturation upon pairing. In this scenario, Smtyr-1 would be a target of a Smnpp26 pathway, while Smp14 would be the target of another pathway.
Smnpp41
Although not as intense as after Smnpp26 KD, Smnpp41 RNAi also caused early curling, body bending, and the production of abnormal eggs while maintaining pairing stability. In males, CLSM demonstrated similar testes phenotypes as for Smnpp26 RNAi; however, the diameter of the testicular lobes appeared to be even smaller. EdU incorporation was significantly lower upon KD, which corresponds to significant downregulation of Smnanos-1, the GSC marker gene. Furthermore, the transcript level of Smtektin-a1 was significantly reduced, but not that of Smtektin-2. Also both genes might be targets of at least two different pathways, with Smtektin-a1 under the control of Smnpp41.
In females, the results are more difficult to interpret because Smnpp41 transcript abundance was significantly higher following dsRNA treatment. Nonetheless, an ovary phenotype was obtained that resembled the one observed for Smnpp26 RNAi female worms. EdU assays showed significantly reduced GSC proliferation, and marker gene expression analyses revealed either upregulation for Smnanos-1 or unchanged expression for Smnanos-2. The Smtyr-1 transcript level was unchanged, and the level of Smp14 significantly upregulated. These findings indirectly support the theoretical scenario above that both genes could be targets of different pathways. Whether the upregulation of Smnanos-1 and/or Smp14 can explain the observed egg deformation in a gain-of-function/overexpression-like manner remains unclear.
The observed upregulation of Smnpp41 upon dsRNA treatment in females was unexpected, especially because the opposite (and expected downregulation) effect was found for males. Prokaryotes utilize distinct RNA-based adaptive immune system (CRISPR-Cas) for defending against “hostile” RNA sequences, such as mobile genetic elements or viral RNA [98]. In eukaryotes, RNAi has been a well-established mechanism coordinating complex gene regulation mechanisms. This can encompass epigenetic processes and chromatin with different outcomes, regulating transcription negatively and positively [99–101]. Against this background, the finding of opposing RNAi effects using the same dsRNA at the same time for paired male and female S. mansoni may be explained by regulatory mechanisms in the promoter region of the Smnpp41 gene that differ between the sexes. As the level of Smnpp41 transcripts is strongly reduced after pairing in females, opposite to males, it seems likely that epigenetic processes at the chromatin level might be involved. If this is the case, it is tempting to speculate that Smnpp41 dsRNA may interact with different epigenetic partners in males and females at this promoter region. Unless these assumptions may be proven in the future, the results obtained in this case should be considered with caution as this limitation is more explicitly reflected when linking RNAi phenotypes to gene function.
Moreover, we observed an improved KD efficiency with our tp/pt approach in case of Smgpcr9, whereas, in case of Smnpp26, and Smnpp41, the KD efficiencies were nearly the same with the conventional (single-probe) and the new (tp/pt) approach. Due to the smaller size of npp transcripts, they may probably form less complex secondary RNA structures and thus be easier to target by an individual dsRNA. Furthermore, it may be possible that target mRNAs in neurons are easier to access in contrast to epithelium-covered testes.
With respect to our novel observation of considerably reduced GSC proliferation in vitellaria of ampR dsRNA- treated females, we conclude that the ampR dsRNA is no suitable control for studies investigating vitellarium-specific stem-cell effect.
In summary, we identified the first GPCR of a parasitic flatworm with a proven role for being functionally associated with spermatogenesis. Our molecular analyses suggest that SmGPCR9 controls sperm differentiation, probably at the level of primary or secondary spermatocytes. Upregulation of SmGPCR9 expression in males after pairing may reflect the need for increased sperm production. In addition, SmGPCR9 appears to be involved in processes regulating female sexual maturation, as part of the complex male-female interaction. This finding extends results of a previous study that demonstrated the importance of NPP-stimulated GPCR signaling in the neuroendocrine control of germ cell differentiation in planarians, free-living platyhelminths [87]. Our ligand identification approaches based on different in vitro and in silico methods identified two neuropeptides, SmNPP26 and SmNPP41, as high-confidence candidate ligands. Their functional characterization showed phenotypes in both sexes that overlapped with those found after Smgpcr9 RNAi in both sexes. This substantiates their role as potential SmGPCR9 ligands. Further phenotypes without intersection with the Smgpcr9 KD results suggest that SmNPP26 and SmNPP41 probably bind also to other receptors. Indeed, SmNPP41 is a Crustacean Cardioactive Peptide (CCAP) and a highly conserved neurohormone as well as neurotransmitter in arthropods. A CCAP receptor homolog was identified in the S. mansoni genome [102].
As a side note, the strong curling and motility phenotype of Smnpp26 RNAi is remotely similar to that observed after PZQ treatment [103]. This indicates not only a further role of SmNPP26 in controlling neuromuscular activity, which might explain the curling phenotype, but also its role as candidate for target evaluation experiments with the aim to find urgently needed new drugs for schistosomiasis [104].
Materials and methods
Ethics statement
Experiments using Syrian hamsters (Mesocricetus auratus) as hosts were carried out in accordance with the European Convention for the Protection of Vertebrate Animals for Scientific and Experimental Purposes (ETS No. 123; revised Appendix A) following the 3R principles, and they were approved by the Regional Council in Giessen, Germany (V54-19c 20/15c no. V7/2023).
Experimental design describing the objectives and design of the study as well as respecified components
To characterize Smgpcr9 (Smp_244240), an orphan Class A (Rhodopsin-like) GPCR of S. mansoni, we performed a deorphanization approach using data of a previous Y2H analysis (57), GPCR internalization experiments, BRET assays, and modeling and docking analyses. Furthermore, with the help of an optimized RNAi approach, we investigated the knockdown effects of Smgpcr9 and two NPPs in adult S. mansoni in vitro. This included morphological (bright-field microscopy and CLSM) and physiological analyses (pairing stability, egg production, motility, EdU assays). Finally, we performed RT-qPCR analyses of selected marker genes to substantiate the observed phenotypic effects.
Maintenance of the Schistosoma mansoni life cycle
The S. mansoni life cycle was maintained in a controlled environment using Biomphalaria glabrata snails as intermediate hosts and Syrian hamsters (Mesocricetus auratus) as definitive hosts. Snails were either infected with a single miracidium to obtain unisexual (single-sex; ss) populations of cercariae, or with 10–15 miracidia for mixed-sex (bisex; bs) populations of cercariae. At day 46 (for bs) or 67 (for ss) after infection with the paddling method [105,106], hepatoportal perfusion of hamsters was performed to obtain adult worms and eggs. Worms were cultured in vitro in 3 mL M199 medium (Sigma-Aldrich) supplemented with 1% HEPES buffer (1 M), and 1% ABAM-solution (antibiotic-antimycotic) and 10% newborn calf serum (batch number: 23G274; Sigma-Aldrich) at 37°C with 5% CO2, as described before [42,44,60].
MALAR-Y2H
For the identification of potential interaction partners of Smgpcr9, we used the Membrane-Anchored Ligand and Receptor Yeast Two-Hybrid system (MALAR-Y2H) [57]. This system allows the detection of protein-protein interactions involving transmembrane proteins [107]. Prey plasmids were transformed into the Y187 strain, and bait plasmids were transformed into the AH109 strain, as described elsewhere in detail [57]. In short, transformed yeasts were selected by plating on synthetic dropout medium (SD) lacking tryptophane (SD/Trp−) or leucine (SD/Leu−). Mating was performed by resuspending 10 μL of each AH109 and Y187 clone in 500 μL YPDA medium and cultivating for 16 h at 30°C. Yeast hybrids carrying both plasmids were selected on SD/Trp− Leu− plates. Growth assays were done by plating a dilution series (OD600 = 1, 0.1, and 0.01) of two mated yeast clones (n = 2) on SD/Trp− Leu− His− Ade− plates. Interaction was documented after 72 h at 30°C. For β -galactosidase assays, colonies of mated cells were cultivated in SD/Trp− Leu− medium until OD600 reached 0.4 - 0.8, then 1 mL medium was centrifuged, and the cell pellet was dissolved in 400 μL Z-buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, and 1 mM MgSO4, pH 7.0). Afterwards, the cells were lysed by three freeze/thaw cycles in liquid nitrogen. The lysate was dissolved in 200 μL buffer containing 0.4% o-nitrophenyl-β-D-galactopyranoside (ONPG), followed by incubation for 30 min at 30°C. After centrifugation, we measured the absorbance of the supernatant at 405 nm and calculated the Miller units according to the equation: Miller Units = 1000 × OD405/t (min) × OD600.
In vitro-culture conditions and RNAi
Worm couples were taken into culture at the day of perfusion and immediately transferred to supplemented M199 medium, as described before [32,44]. RNAi experiments of the genes of interest [Smp_244240 (Smgpcr9)] and neuropeptides [Smp_071050 (Smnpp26) and Smp_200800 (Smnpp41)] were conducted for a period of two weeks. KD efficiency was analyzed by RT-qPCR, and all experiments were performed in triplicates. For RNAi, a two-probe (per gene) RNAi approach was established to successfully knockdown Smgpcr9. To this end, two dsRNAs of this gene were synthesized from different sites of its coding sequence. The dsRNAs were PCR-amplified using gene-specific primers containing the T7 promotor sequence (CCTAATACGACTCACTATAGGGAGA) (S1 Table). After performing a PCR clean-up (Monarch PCR & DNA Cleanup Kit, NEB, T1030S), each of the respective PCR products were used as templates for the second round of PCR resulting in amplicons that served as templates for the in vitro transcription of Smgpcr9. For RNAi of Smnpp26 and Smnpp41, we performed the classical single dsRNA approach [44,60,63]. Each dsRNA was synthesized from 300-550 bp long PCR amplicons. As control, we used ampR (Escherischia coli, ampicillin resistance gene) dsRNA, which has been shown before to be a suitable control for RNAi experiments with adult S. mansoni in vitro [63]. The reaction mixture contained 10 µL 10 × reaction buffer (0.4M Tris, pH 8, 0.1M MgCl2, 20 mM spermidine, 0.1 M DTT), 5 µL PCR product (5 µg), 20 µL 25 mM rNTP (NEB, N0450S), 3 µL self-made T7 RNA polymerase, 1 µL inorganic pyrophosphatase (IPP) (NEB, M0361). The mixture was filled up to a final volume of 100 µL using diethyl decarbonate (DEPC) water. This reaction mixture was incubated overnight at 37°C followed by DNase I (5 µL) (2 U/µL, NEB, M0303) treatment for 30 min at 37°C. Subsequently, the mixture was precipitated with 7.5 M lithium chloride (LiCl) at -80°C for 1 h. After spinning down for 30 min at maximum speed at 4°C, the pellet was resuspended in 70% ethanol. Finally, the mixture was spinned down for 20 min at maximum speed at 4°C. The pellet was resuspended in an appropriate amount of DEPC water, and dsRNAs were stored at -20°C until further use.
For RNAi experiments in vitro, worm couples were treated with 15 µg/mL each of the two dsRNAs of Smgpcr9, and 15 µg/mL each of the respective dsRNAs of Smnpp26 and Smnpp41. Treated couples were maintained in vitro for two weeks with daily monitoring. Separated worms were discarded, and only paired worms considered for further analysis. Untreated (no dsRNA) worms and ampR dsRNA-treated worms were used as controls [63]. Culture medium and dsRNAs were refreshed every second to third day. Phenotypic effects of dsRNA-treated worms in culture were monitored by bright-field microscopy focusing on attachment capacity (ability to attach to the petri dish), motility, pairing stability, and egg production. All experiments were performed in independent biological replicates (n = 3) for each targeted gene. For each individual biological replicate, a total of 10 worm couples were used. Across the entire study, this makes to a total technical sample size of 30 worm couples per condition. After the experimental period of 15 d, from each biological batch of 10 couples: 5 couples each were allocated for carmine-red staining and EdU incorporation assays, 20 worms (10 couples) were taken for total RNA isolation and subsequent qPCR validation.
RNA isolation, cDNA synthesis, and RT-qPCR analysis
RNA isolation was carried out using Monarch Total RNA Miniprep Kit (NEB) and transcribed into cDNA with 100–150 ng of total RNA in a single reaction using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer´s instructions. RNA was quantified using spectrophotometer and 2100 Bioanalyzer instrument (Agilent Technologies, California, USA). Transcript levels were determined by RT-qPCR diluting the cDNAs 1:10 in nuclease-free water. Experiments were performed using 2x KAPA SYBR FAST Universal (Roche, KK4618).
Specific primers were designed to give an amplicon of 130–180 bp with a melting temperature of 55–60°C (Primer3Plus; https://www.primer3plus.com) (S2 Table). Primer efficiencies were determined as described elsewhere [68]. In short, primers were designed spanning exon–exon junctions, and melt curve analysis was performed after each amplification run. In all cases, melt curves showed a single distinct peak, confirming amplification of a single specific product. KD efficiencies were calculated using the 2-ΔΔCt method and showed >90% reduction in target gene expression. Primer efficiency was determined using standard curves generated from serial dilutions of cDNA and was between 90–110% in all cases.
The PCR conditions were optimized as follows: initial denaturation at 95°C for 3 min, followed by amplification of 40 cycles at 95°C for 10 s, 60°C for 15 s, and 72°C for 20 s, each with a final extension at 72°C for 2 min. The total reaction volume was 20 µL, and all reactions were performed in triplicates. The expression values were determined with a modified 2- ΔΔCt method [108], using Smletm1 (Smp_065110) as control for normalization. Smletm1 was shown before to be a suitable reference gene for gene expression studies with S. mansoni in vitro [68].
Cloning procedures
The complete coding sequence of Smgpcr9 was obtained from the WormBase Parasite database (https://parasite.wormbase.org/Schistosoma_mansoni_prjea36577/Info/Index/;). To enhance efficient expression in mammalian cells, the sequence was human codon-optimized using the GenScript online tool (Tool Version Beta 1.0). This optimization ensured enhanced translation efficiency in HEK293T cells [109]. The human codon-optimized Smgpcr9 had an improved GC content of 52%. To aid in the subsequent protein localization and visualization in transfected cells, the Smgpcr9 coding sequence was tagged with the red fluorescent protein (dsRed) at the N-terminus and mCitrine, as part of the modified pcDNA3.1(+) (Invitrogen). This construct was subcloned via NheI (5´) and HindIII (3´) into pcDNA 3.1 with mCitrine at the C-terminus, as described before [109]. The integrity of the plasmid construct was confirmed by Sanger sequencing across the dsRed-SmGPCR9 and SmGPCR9-mCitrine junctions (Microsynth). An unlabeled muscarinic acetylcholine receptor (mAChR) is used as the positive control in this study.
Cell culture, transfection, and agonist-induced receptor internalization experiments
Human embryonic kidney 293 (HEK293-6E) cells, licensed from the National Research Council Canada (NRC file 11565, HEK 293EBNA1-6E cell line), were cultured in FreeStyle 293 medium supplemented with Pluronic F-68 (colliphor 188) and maintained for at least two passages prior to experimentation [110]. Cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂. Prior transfection, cell viability was assessed using the TC20 Automated Cell Counter (Bio-Rad), with a viability threshold of >97% considered sufficient for transfection.
Transient transfections were performed using polyethyleneimine (PEI) with a DNA:PEI ratio of 1:3. DNA was diluted in culture medium at a final concentration of 1 µg/mL. For each transfection, DNA and PEI solutions were prepared separately. For a total transfection volume of 2 mL, 6 µg of PEI was diluted in 100 µL of culture medium in one microcentrifuge tube, while 2 µg of plasmid DNA (pcDNA_mCitrine_GPCR9_dsRed) was diluted in 100 µL of culture medium in a separate tube. Each solution was vortexed briefly three times (2 s each), after which the PEI and DNA solutions were combined and gently mixed. The resulting mixture was incubated at room temperature for 5 min prior to addition to the cells. Transfected cells were incubated overnight at 37°C under shaking conditions. Image acquisition was performed using fluorescence microscope (Leica DM IL LED Fluo).
Forty-eight hours post-transfection, cells were treated with 10 µM of neuropeptide agonists (Biomatik, Canada) for 1 h at 37°C. As a positive control, the muscarinic acetylcholine receptor was transfected and stimulated with 100 µM carbachol. Cells were fixed, mounted onto coverslips coated with poly-L-lysine, and visualized using CLSM (TCS SP5 vis confocal laser scanning microscope, Leica) to assess receptor internalization and subcellular localization [111].
BRET assays and measurements
Experiments were performed using HEK293T cells to investigate Gαq recruitment to the Smgpcr9 receptor. To this end, the cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (Pen-Strep; Gibco) at 37°C in a humidified incubator with 5% CO₂.
Transient transfection was carried out using polyethyleneimine (PEI; linear, 25 kDa, Polysciences Inc.) at a DNA (pcDNA_mCitrine_GPCR9_dsRed): PEI weight ratio of 1:3. Prior to transfection, cells were detached using 0.05% trypsin-EDTA (Thermo Fisher Scientific), with a maximum trypsinization time of 3 min. Trypsinization was terminated by adding 5 mL of complete medium per plate. Afterwards, the cells were collected by centrifugation at 1,000 rpm for 3 min at room temperature (RT). The supernatant was discarded, and the cell pellet was suspended in 3 mL of fresh medium per plate.
Cell density was determined using a hemocytometer (Neubauer chamber, depth 0.1 mm). Approximately 14 µL of the cell suspension was used for counting. For transfection, 100 µL of the mixture (containing the DNA:PEI, cells, and medium) was dispensed into each well of a 96-well white-walled plate. Plates were incubated for 48 h at 37°C with 5% CO₂.
Afterwards, cells were washed twice with FRET buffer (e.g., HBSS supplemented with 20 mM HEPES, pH 7.4). Coelenterazine H (Nanolight Technology) was used as the substrate for Renilla luciferase II (RlucII) [112–114]. Cells were incubated with coelenterazine H in the dark (being light sensitive) at RT for 10 min.
BRET (Bioluminescence Resonance Energy Transfer) measurements were performed using a TECAN Spark 20M plate reader (SparkControl software) equipped with dual-emission detection, with filters set at 410 ± 80 nm for RlucII (donor) and 515 ± 30 nm for rGFP (acceptor). After acquiring five basal BRET cycles, cells were stimulated with varying concentrations of neuropeptide ligands (NPPs) ranging from 1 µM to 0.01 nM. Emission signals were monitored for 35 cycles, approximately 1 h in total. Each ligand concentration was tested in triplicate. Ligand-induced BRET ratios were calculated by normalizing the emission intensity (rGFP/RlucII) during stimulation cycles relative to the basal signal.
Molecular docking
Molecular docking studies were performed using the Molecular Operating Environment (MOE 2024.06) software package (Chemical Computing Group, Montreal, CA). SmNPP26b and SmNPP41 were modeled using the MOE Conformational Search in lowModeMD with the following settings: rejection limit 100, iteration limit 100, RMS gradient 0.005, MM iteration limit 500, MM iteration limit 500, RMSD limit 0.25, energy window 7, and conformation limit 200. SmNPP26b generated 1 conformer, and SmNPP41 generated 9 conformers, and these conformers were used as the ligands for docking studies. A homology model of SmGPCR9 (Smp_244240) was created based on the human NPP FF receptor 2, PDB: 9M54, a closely related GPCR [115]. The SmGPCR9 amino acid sequence was aligned to the NPP FF receptor 2 using the BLOSUM64 matrix, revealing 32% similarity and 23% identity. The template structure was corrected for missing atoms or fractional occupancy based on the amino acid sequence, and the final protein was protonated at T = 310 K, pH = 7.3, [NaCl] = 200 mM, using GB/VI electrostatics. This produced ten intermediate models which were scored based on the electrostatic solvation energy, and the structures were energy minimized using the AMBER12:ETH force field. The final model was determined based on the most favorable electrostatic solvation energy. For docking, the extracellular domain of SmGPCR9 was used as the ligand binding site. Initial placement was calculated for 30 poses per molecule using triangle matching with London dG scoring. The top hits were refined, calculating five poses per molecule with flexible drug and flexible receptor (induced-fit modelling) and Affinity dG scoring, which provides an estimated binding free energy in kcal/mol. The final poses were overlayed via superposition to explore conservation and distances measured between residues of SmNPP26b and SmNPP41 docked to SmGPCR9.
Whole mount in situ hybridization (WISH) and imaging
A modified WISH protocol was used to visualize GPCR transcripts [61]. As samples for analyses, S. mansoni couples were first separated using 0.25% tricaine (ethyl 3-aminobenzoate methane sulfonate, Sigma-Aldrich) and killed using 0.6 M MgCl2 for 1 min. Then they were fixed in 4% formaldehyde in PBSTx for 4 h followed by rinsing twice with PBSTx and stored in 100% methanol at -20⁰C until further use. Worms were rehydrated by incubation in 50% methanol dissolved in PBSTx followed by bleaching for 1.5 h under light. Samples were then rinsed with PBSTx before proteinase K (20 mg/mL, Ambion, AM2546) treatment. WISH was performed with pairing-experienced bisex males (bM), pairing-experienced bisex females (bF), pairing-inexperienced single-sex females (sF), and pairing-inexperienced single-sex males (sM) to localize transcripts of Smgpcr9, Smnpp26, and Smnpp41. As positive controls, we used Smtsp-2 (Smp_335630) [32,62] and Smmyst4 (Smp_165360) [32,42,44]. Samples were treated with 4% formaldehyde for 30 min. Riboprobes were generated using DTG (digoxigenin)-11-UTP (Jena Bioscience, NU-821-DIGX, Germany). Riboprobe templates were synthesized from gene-specific inserts cloned into the pJC53.2 plasmid (a kind gift of Jim Collins, Texas) using Q5 High-Fidelity DNA Polymerase (40 U/µL, NEB, M0491S). The purified PCR products were used as templates to finally generate the riboprobes by in vitro transcription using T3 (Roche, 11031163001) or SP6 RNA polymerases (Roche, 11487671001). The primers used in this study were listed in S3 Table. Varying concentrations of riboprobes ranging from 25ng-200ng/mL hybridization buffer were used to select the desired concentration. The optimal concentration of riboprobes that produced signals was 50 ng/mL hybridization solution. The reaction mixture contained 100–500 ng PCR product, 2 μL 10x transcription buffer (Roche, 11465384001), 1 µL T3 or SP6 RNA polymerase, 2 µL DIG-NTP mix (10 mM ATP, CTP, GTP and 7 mM UTP, 3.5 mM DTG-11-UTP), 0.6 µL Murine RNase inhibitor (40 U/µL, NEB, M0314S), and nuclease-free water (NEB, T2006-1) to make up the final volume to 20 µL. The reaction mixture was then incubated at 28°C for 16 h. Subsequently, 1 µL of RNase-free DNase I (2 U/µL, NEB, M0303S) was added, and the mix was incubated for 20 min at 37°C. An anti-DIG-AP (1:2,000, Millipore Sigma, 11093274910) antibody was incubated in colorimetric blocking solution [7.5% heat-inactivated horse serum (Sigma-Aldrich, #H1138) in TNT] overnight at 4°C for the colorimetric detection and developed with nitro-blue tetrazolium (Roche, 14799526) and 5-bromo-4-chloro-3′-indolyphosphate (Roche, 13513022). Experiment was performed with a technical sample size of 5 individual worms per riboprobe for Smgpcr9, Smnpp26, and Smnpp41.
Samples were mounted in 80% glycerol under coverslips and imaged.
Supporting information
S1 Fig. Smgpcr9 transcript profile in adult S. mansoni according to bulk RNAseq, RT-PCR, and scRNAseq analyses.
A-B, Former data from bulk RNAseq analyses of adult S. mansoni and their gonads identified two Smp numbers, Smp_080820.1 and Smp_132220.1, for Smgpcr9, based on version 5 of the genome (42). Recent genome updates, versions 7 and 10, provided the new number Smp_244240 for this gene (55; https://parasite.wormbase.org/Schistosoma_mansoni_prjea36577/Info/Index/); C, RT-PCR analysis confirmed the testes-preferential and pairing-influenced transcript profile of Smgpcr9 in males. D, Single-cell RNAseq showed preferential expression of Smp_244240 in late male germ cells (MGSC) and the neuronal cell cluster 3 (Ncc3) of S. mansoni males (56). Abbreviations: bM, males with pairing experience; sM, males without pairing experience; bT, testes of bM; sT, testes of sM; bF, females with pairing experience; sF, females without pairing experience; bO, ovaries of bF; sO, ovaries of sF; Ncc, neuronal cell cluster.
https://doi.org/10.1371/journal.ppat.1014096.s001
(TIF)
S2 Fig. Y2H interaction studies provided first evidence for SmNPPs as potential interaction partners of SmGPCR9.
A, MALAR-Y2H assay to detect protein-protein interactions between Smgpcr9 and neuropeptides (NPPs) of S. mansoni. Shown are results of cell growth assays of yeast strain AH109 transfected with plasmids expressing ligand fusion proteins (NPPs), which was mated with yeast strain Y187 transfected with plasmids expressing Smgpcr9 (57). Three different OD600 concentrations of diploid yeast cells were dropped onto SD/Trp− Leu − His − Ade − and Trp − Leu − plates, which served as growth control. Colony growth was monitored after 48 and 72 h, respectively. B, ONPG-assays to determine β-Gal activity of diploid cells (as in A; 57) showed strongest interactions for SmNPPs 2a, 5b, 15b, 26a, 32.2, and 41, whereas 1a and 24 appeared to be weak putative interaction partners. Shown are the mean values of two clones (n = 2; 57).
https://doi.org/10.1371/journal.ppat.1014096.s002
(TIF)
S3 Fig. The Smgpcr9 coding sequence adapted to human codon usage to optimise HEK293 cell expression.
The Smgpcr9 coding sequence (CDS) of S. mansoni was adapted to human codon usage to optimise expression in HEK293-6E cells. Shown here are the optimised Smgpcr9 CDS (A) and the corresponding amino acid sequence (B).
https://doi.org/10.1371/journal.ppat.1014096.s003
(TIF)
S4 Fig. Agonist-induced HEK293 transfection experiments showed Smgpcr9 internalization with selected NPPs.
HEK293-6E cells transiently expressing pCDNA_mCitrine_GPCR9_dsRed were stimulated with the selected, soluble NPPs for 30 min at 37⁰C. Colocalizing signals were observed as internalized dots. SmNPP11a and SmNPP24 failed to show internalization signals. Scale bars = 30 µm. Experiments were performed in two independent biological replicates.
https://doi.org/10.1371/journal.ppat.1014096.s004
(TIF)
S5 Fig. Gαq activation by SmGPCR9 following interaction with the selected SmNPPs.
Schematic representations of the same Gαq activation assays showing specific protein–protein interactions of SmGPCR9 with SmNPPs (as indicated). In A, the tagged version of SmGPCR9 was used and in B the untagged version. SmNPPs 26b and 41, which showed highest evidence for interaction, are part of Fig 1.
https://doi.org/10.1371/journal.ppat.1014096.s005
(TIF)
S6 Fig. Localisation of Smgpcr9 transcripts showed no WISH signals in females.
No clear signals were observed upon WISH in bisex females (bF), single-sex females (sF), and in paired females (see couple), whereas Smgpcr9 transcripts were observed in male testes, as expected (see couple). Scale bars = 200 µm. Abbreviations: te, testes; h, head (anterior) part; m, male; f, female.
https://doi.org/10.1371/journal.ppat.1014096.s006
(TIF)
S7 Fig. Smnpp26 and Smnpp41 transcript occurrence in adults and specific neuronal cell clusters.
According to the previous bulk RNA-seq study of adult S. mansoni and their gonads, Smnpp26 (Smp_071050; A) and Smnpp41 (Smp_200800; C) are mainly transcribed in adult worms but not their gonads, with a pairing-dependent expression profile in females, and a bias for unpaired females. Single cell RNA-seq data exhibited dominant expression for Smnpp26 in neuronal cell cluster 4 (Ncc4; B), whereas Smnpp41 dominates in neuronal cell cluster 8 (Ncc8; D) (56). Abbreviations: bM, males with pairing experience; sM, males without pairing experience; bT, testes of bM; Ncc, neuronal cell cluster; sT, testes of sM; bF, females with pairing experience; sF, females without pairing experience; bO, ovaries of bF; sO, ovaries of sF.
https://doi.org/10.1371/journal.ppat.1014096.s007
(TIF)
S8 Fig. RNA-seq and RT-qPCR-based transcript profiles of Smnpp26, and Smnpp41 in adults and gonads.
Shown are transcript profiles of Smnpp26 (A), and Smnpp41 (B) obtained by bulk RNA-seq analysis of female and male S. mansoni and their gonads (42). RT-qPCR confirmed the transcript patterns of Smnpp26 (C), and Smnpp41 (D) including their pairing-influenced transcriptions in females. Abbreviations: bM, bisex males (pairing-experienced); sM, single-sex males (pairing-unexperienced); bT, testes of bM; sT, testes of sM; bF, bisex females (pairing-experienced); sF, single-sex females (pairing-unexperienced); bO, ovaries from bF; sO, ovaries from sF. Average expression (Avg Expr) was based on RPKM (Reads Per Kilobase per Million mapped reads) values. Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05, ns, no significance.
https://doi.org/10.1371/journal.ppat.1014096.s008
(TIF)
S9 Fig. Results of WISH control experiments.
A, As positive controls for WISH, we used the tegumentally expressed Smtsp-2 (62) and the vitellarium-specifically expressed Smmyst4 (32); all of which showed expected transcript patterns. B, As negative controls, we used sense probes of the genes, which showed no signals upon hybridisation. Scale bars = 200 µm.
https://doi.org/10.1371/journal.ppat.1014096.s009
(TIF)
S10 Fig. Knocking-down transcript levels was more efficient for Smgpcr9 using a two-probes/per-target (tp/pt) RNAi approach.
For this experimental approach, male cDNA was used as template for RT-qPCR. A, Compared to the controls (untreated, no dsRNA; ampR, irrelevant dsRNA), using a single dsRNA resulted in the reduction of the Smgpcr9 transcript level of about 50% after 15 days in vitro treatment. B, Using the two-probes/per-target approach, KD efficiency of Smgpcr9 was 90% ± 3%. For Smnpp26 RNAi (C) and Smnpp41 RNAi (D), using single dsRNAs in each case resulted in KD efficiencies of 94% ± 2%, and 93% ± 2%, respectively. Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014096.s010
(TIF)
S11 Fig. RNAi against Smgpcr9, Smnpp26, and Smnpp41 showed no effects on pairing stability but reduced motility.
Untreated S. mansoni couples (without dsRNA) and couples treated with irrelevant ampR dsRNA served as controls. All worms were kept under the same in vitro-culture conditions for 15 d. A, We observed no effect for pairing stability. B, Compared to the controls, motility was significantly reduced for all target genes (as indicated) but at different time points, with Smgpcr9 showing the slowest significant effect on motility following RNAi. There were no distinct effects observed with ampR dsRNA treatment as shown in figures. Significant differences were determined by t-test and indicated as: ***P < 0.001, **P < 0.01, *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014096.s011
(TIF)
S12 Fig. RNAi against Smgpcr9, Smnpp26, and Smnpp41 caused egg deformation.
Starting between days 9–12 after dsRNA treatment, deformed eggs were produced in all RNAi groups, as indicated, except the control groups (ampR and untreated). Even after 15 days, worms of both control groups produced eggs of normal size with visible zygotes (red circles) and normal spines (blue squares). In contrast, eggs of worms of all RNAi groups showed various defects like size reduction, missing spines, and/or no zygotes.
https://doi.org/10.1371/journal.ppat.1014096.s012
(TIF)
S13 Fig. RNAi affected gonadal stem-cell proliferation in S. mansoni for Smnpp26 and Smnpp41, not for Smgpcr9.
Image J-based quantification of the amounts of EdU-stained cells in the gonads of males (testes) and females (ovary) treated with dsRNA against (A) Smgpcr9 (B) Smnpp26, and (C) Smnpp41 versus controls (untreated and ampR dsRNA- treated). EdU quantification was also done for the vitellarium of females, showing minimal fluorescence only for females following ampR dsRNA treatment (D).
https://doi.org/10.1371/journal.ppat.1014096.s013
(TIF)
S14 Fig. Transcript profiles of two tektin orthologs of S. mansoni according to different RNAseq analyses.
Previous bulk RNA-seq data of adult S. mansoni and their gonads (42) showed testis-preferential expression in tektin a1 (A; previous gene number: Smp_147440; according to the new annotation: Smp_343970) and tektin 2 (B; Smp_046410). C-D, Single cell RNA-seq data exhibited dominant expression for both tektins in neuronal cell clusters 2-6 and 30 (Ncc), flame cells Fc, and late male germ cells (MGSC) (56). Abbreviations: bM, males with pairing experience; sM, males without pairing experience; bT, testes of bM; sT, testes of sM; bF, females with pairing experience; sF, females without pairing experience; bO, ovaries of bF; sO, ovaries of sF; NCC, neuronal cell cluster; Fc, flame cell.
https://doi.org/10.1371/journal.ppat.1014096.s014
(TIF)
S1 Movie. RNAi against Smnpp26 and Smnpp41 caused morphological changes in adult S. mansoni.
Smgpcr9. Short video clip of the motility phenotypes of S. mansoni couples observed after 6 days of RNAi against the target genes, as indicated, and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA).
https://doi.org/10.1371/journal.ppat.1014096.s015
(MP4)
S2 Movie. RNAi against Smnpp26 and Smnpp41 caused morphological changes in adult S. mansoni.
Smnpp26. Short video clip of the motility phenotypes of S. mansoni couples observed after 6 days of RNAi against the target genes, as indicated, and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA).
https://doi.org/10.1371/journal.ppat.1014096.s016
(MP4)
S3 Movie. RNAi against Smnpp26 and Smnpp41 caused morphological changes in adult S. mansoni.
Smnpp41. Short video clip of the motility phenotypes of S. mansoni couples observed after 6 days of RNAi against the target genes, as indicated, and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA).
https://doi.org/10.1371/journal.ppat.1014096.s017
(MP4)
S4 Movie. RNAi against Smnpp26 and Smnpp41 caused morphological changes in adult S. mansoni. ampR.
Short video clip of the motility phenotypes of S. mansoni couples observed after 6 days of RNAi against the target genes, as indicated, and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA).
https://doi.org/10.1371/journal.ppat.1014096.s018
(MP4)
S5 Movie. RNAi against Smnpp26 and Smnpp41 caused morphological changes in adult S. mansoni. Untreated.
Short video clip of the motility phenotypes of S. mansoni couples observed after 6 days of RNAi against the target genes, as indicated, and the controls (untreated, no dsRNA; ampR, irrelevant dsRNA).
https://doi.org/10.1371/journal.ppat.1014096.s019
(MP4)
S1 Table. Primers used for dsRNA synthesis of Smgpcr9, Smnpp26, and Smnpp41.
https://doi.org/10.1371/journal.ppat.1014096.s020
(XLSX)
Acknowledgments
We thank Natalia Delis and Sandra Engel for their excellent technical assistance. We thank Christina Scheld for maintaining the Schistosoma lifecycle. The striking image was created with BioRender.com (https://BioRender.com/cl1xhcw).
References
- 1. Fredriksson R, Schiöth HB. The repertoire of G-protein-coupled receptors in fully sequenced genomes. Mol Pharmacol. 2005;67(5):1414–25. pmid:15687224
- 2. Stevens RC, Cherezov V, Katritch V, Abagyan R, Kuhn P, Rosen H, et al. The GPCR Network: a large-scale collaboration to determine human GPCR structure and function. Nat Rev Drug Discov. 2013;12(1):25–34. pmid:23237917
- 3. Vassart G, Costagliola S. G protein-coupled receptors: mutations and endocrine diseases. Nat Rev Endocrinol. 2011;7(6):362–72. pmid:21301490
- 4. Thompson BA, Spurdle AB, Plazzer J-P, Greenblatt MS, Akagi K, Al-Mulla F, et al. Application of a 5-tiered scheme for standardized classification of 2,360 unique mismatch repair gene variants in the InSiGHT locus-specific database. Nat Genet. 2014;46(2):107–15. pmid:24362816
- 5. Szymańska K, Kałafut J, Przybyszewska A, Paziewska B, Adamczuk G, Kiełbus M, et al. FSHR Trans-Activation and Oligomerization. Front Endocrinol (Lausanne). 2018;9:760. pmid:30619090
- 6. Radomsky T, Anderson RC, Millar RP, Newton CL. Restoring function to inactivating G protein-coupled receptor variants in the hypothalamic-pituitary-gonadal axis1. J Neuroendocrinol. 2024;36(9):e13418. pmid:38852954
- 7. Lankford CK, Laird JG, Inamdar SM, Baker SA. A Comparison of the Primary Sensory Neurons Used in Olfaction and Vision. Front Cell Neurosci. 2020;14:595523. pmid:33250719
- 8. Nakanishi S. Molecular mechanisms of intercellular communication in the hormonal and neural systems. IUBMB Life. 2006;58(5–6):349–57. pmid:16754330
- 9. Hashemi Karoii D, Bavandi S, Abroudi AS, Djamali M, Azizi H, Skutella T. Microarray and Single-Cell RNA Sequencing Reveals G-Protein Gene Expression Signatures of Spermatogonia Stem Cell. Stem Cell Rev Rep. 2025;21(7):2136–56. pmid:40694278
- 10. Hoyer D, Bartfai T. Neuropeptides and neuropeptide receptors: drug targets, and peptide and non-peptide ligands: a tribute to Prof. Dieter Seebach. Chem Biodivers. 2012;9(11):2367–87. pmid:23161624
- 11. Mizuno H, Kihara Y. Druggable lipid GPCRs: past, present, and prospects. Adv Exp Med Biol. 2020;1274:223–58.
- 12. Pándy-Szekeres G, Munk C, Tsonkov TM, Mordalski S, Harpsøe K, Hauser AS, et al. GPCRdb in 2018: adding GPCR structure models and ligands. Nucleic Acids Res. 2018;46(D1):D440–6. pmid:29155946
- 13. Kolakowski LF Jr. GCRDb: a G-protein-coupled receptor database. Recept Channels. 1994;2(1):1–7.
- 14. Bockaert J, Pin JP. Molecular tinkering of G protein-coupled receptors: an evolutionary success. EMBO J. 1999;18(7):1723–9. pmid:10202136
- 15. Fredriksson R, Lagerström MC, Lundin L-G, Schiöth HB. The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Mol Pharmacol. 2003;63(6):1256–72. pmid:12761335
- 16. Zhou Q, Yang D, Wu M, Guo Y, Guo W, Zhong L. Common activation mechanism of class A GPCRs. Elife. 2019;8:e50279.
- 17. Chung KY, Rasmussen SGF, Liu T, Li S, DeVree BT, Chae PS, et al. Conformational changes in the G protein Gs induced by the β2 adrenergic receptor. Nature. 2011;477(7366):611–5. pmid:21956331
- 18. Du Y, Duc NM, Rasmussen SGF, Hilger D, Kubiak X, Wang L, et al. Assembly of a GPCR-G Protein Complex. Cell. 2019;177(5):1232–42.e11. pmid:31080064
- 19. Liu X, Xu X, Hilger D, Aschauer P, Tiemann JKS, Du Y, et al. Structural Insights into the Process of GPCR-G Protein Complex Formation. Cell. 2019;177(5):1243–51.e12. pmid:31080070
- 20. Wang X, Fang C, Cheng G. Genome-wide identification and functional characterization of GPCR family genes reveal their key roles in the vitellarium development and egg production in Schistosoma japonicum. Parasit Vectors. 2025;18(1):286. pmid:40676690
- 21. Montazeri M, Fakhar M, Keighobadi M. The Potential Role of the Serotonin Transporter as a Drug Target against Parasitic Infections: A Scoping Review of the Literature. Recent Adv Antiinfect Drug Discov. 2022;17(1):23–33. pmid:35249526
- 22. McVeigh P, McCusker P, Robb E, Wells D, Gardiner E, Mousley A, et al. Reasons to Be Nervous about Flukicide Discovery. Trends Parasitol. 2018;34(3):184–96. pmid:29269027
- 23. Kaiser A. Druggable Targets in Cyclic Nucleotide Signaling Pathways in Apicomplexan Parasites and Kinetoplastids against Disabling Protozoan Diseases in Humans. Int J Mol Sci. 2019;20(1):138. pmid:30609697
- 24. Duguet TB, Glebov A, Hussain A, Kulkarni S, Mochalkin I, Geary TG, et al. Identification of annotated bioactive molecules that impair motility of the blood fluke Schistosoma mansoni. Int J Parasitol Drugs Drug Resist. 2020;13:73–88. pmid:32531750
- 25. Pereira PHS, Garcia CRS. Evidence of G-protein-coupled receptors (GPCR) in the parasitic protozoa Plasmodium falciparum-sensing the host environment and coupling within its molecular signaling toolkit. Int J Mol Sci. 2021;22(22):12381.
- 26. Camicia F, Vaca HR, Park S-K, Bivona AE, Naidich A, Preza M, et al. Characterization of a new type of neuronal 5-HT G- protein coupled receptor in the cestode nervous system. PLoS One. 2021;16(11):e0259104. pmid:34762657
- 27. McVeigh P, McCammick E, McCusker P, Wells D, Hodgkinson J, Paterson S, et al. Profiling G protein-coupled receptors of Fasciola hepatica identifies orphan rhodopsins unique to phylum Platyhelminthes. Int J Parasitol Drugs Drug Resist. 2018;8(1):87–103. pmid:29474932
- 28. Bakx JC, Seidell JC, Deurenberg P, van den Hoogen HJ. Development of hypertension in obese subjects seen in general practice. Fam Pract. 1987;4(1):11–8. pmid:3569720
- 29. Wang J, Yu Y, Shen H, Qing T, Zheng Y, Li Q, et al. Dynamic transcriptomes identify biogenic amines and insect-like hormonal regulation for mediating reproduction in Schistosoma japonicum. Nat Commun. 2017;8:14693. pmid:28287085
- 30. MacDonald K, Kimber MJ, Day TA, Ribeiro P. A constitutively active G protein-coupled acetylcholine receptor regulates motility of larval Schistosoma mansoni. Mol Biochem Parasitol. 2015;202(1):29–37. pmid:26365538
- 31. Patocka N, Sharma N, Rashid M, Ribeiro P. Serotonin signaling in Schistosoma mansoni: a serotonin-activated G protein-coupled receptor controls parasite movement. PLoS Pathog. 2014;10(1):e1003878. pmid:24453972
- 32. Li X, Weth O, Haimann M, Möscheid MF, Huber TS, Grevelding CG. Rhodopsin orphan GPCR20 interacts with neuropeptides and directs growth, sexual differentiation, and egg production in female Schistosoma mansoni. Microbiol Spectr. 2024;12(1):e0219323. pmid:38047698
- 33. World Health Organization. Fact sheets, schistosomiasis. 2021. https://www.who.int/news-room/fact-sheets/detail/schistosomiasis
- 34. McManus DP, Dunne WD, Sacko M. Schistosomiasis. Nat Rev Dis Primers. 2018;4(13).
- 35. Olveda DU, Olveda RM, McManus DP, Cai P, Chau TNP, Lam AK, et al. The chronic enteropathogenic disease schistosomiasis. Int J Infect Dis. 2014;28:193–203. pmid:25250908
- 36.
Basch PF. Schistosomes: Development, reproduction, and host relations. New York: Oxford University Press; 1991.
- 37. Kunz W. Schistosome male-female interaction: induction of germ-cell differentiation. Trends Parasitol. 2001;17(5):227–31. pmid:11323306
- 38. Grevelding CG. Schistosoma. Curr Biol. 2004;14(14):R545.
- 39. Popiel I, Basch PF. Reproductive development of female Schistosoma mansoni (Digenea: Schistosomatidae) following bisexual pairing of worms and worm segments. J Exp Zool. 1984;232(1):141–50. pmid:6502090
- 40. Den Hollander JE, Erasmus DA. Schistosoma mansoni: male stimulation and DNA synthesis by the female. Parasitology. 1985;91 (Pt 3):449–57. pmid:4080418
- 41. Loverde PT, Chen L. Schistosome female reproductive development. Parasitol Today. 1991;7(11):303–8. pmid:15463396
- 42. Lu Z, Sessler F, Holroyd N, Hahnel S, Quack T, Berriman M. Schistosome sex matters: a deep view into gonad-specific and pairing-dependent transcriptomes reveals a complex gender interplay. Sci Rep. 2016;6:31150.
- 43. Grevelding CG, Sommer G, Kunz W. Female-specific gene expression in Schistosoma mansoni is regulated by pairing. Parasitology. 1997;115 (Pt 6):635–40. pmid:9488875
- 44. Moescheid MF, Lu Z, Soria CD, Quack T, Puckelwaldt O, Holroyd N, et al. The retinoic acid family-like nuclear receptor SmRAR identified by single-cell transcriptomics of ovarian cells controls oocyte differentiation in Schistosoma mansoni. Nucleic Acids Res. 2025;53(4):gkae1228. pmid:39676663
- 45. Armstrong JC. Mating Behavior And Development Of Schistosomes In The Mouse. J Parasitol. 1965;51:605–16. pmid:14339375
- 46. Michaels RM. Mating of Schistosoma mansoni in vitro. Exp Parasitol. 1969;25(1):58–71. pmid:5362600
- 47. Ruppel A, Cioli D. A comparative analysis of various developmental stages of Schistosoma mansoni with respect to their protein composition. Parasitology. 1977;75(3):339–43. pmid:604820
- 48. Shaw JR, Marshall I, Erasmus DA. Schistosoma mansoni: in vitro stimulation of vitelline cell development by extracts of male worms. Exp Parasitol. 1977;42(1):14–20. pmid:862702
- 49. Atkinson KH, Atkinson BG. Biochemical basis for the continuous copulation of female Schistosoma mansoni. Nature. 1980;283(5746):478–9. pmid:7352026
- 50. Popiel I, Basch PF. Putative polypeptide transfer from male to female Schistosoma mansoni. Mol Biochem Parasitol. 1984;11:179–88. pmid:6749178
- 51. Basch PF, Nicolas C. Schistosoma mansoni: pairing of male worms with artificial surrogate females. Exp Parasitol. 1989;68(2):202–7. pmid:2924879
- 52. Chen R, Wang J, Gradinaru I, Vu HS, Geboers S, Naidoo J. A male-derived nonribosomal peptide pheromone controls female schistosome development. Cell. 2022;185(9):1506–20.e17.
- 53. Hahnel S, Wheeler N, Lu Z, Wangwiwatsin A, McVeigh P, Maule A, et al. Tissue-specific transcriptome analyses provide new insights into GPCR signalling in adult Schistosoma mansoni. PLoS Pathog. 2018;14(1):e1006718. pmid:29346437
- 54. Lu Z, Spänig S, Weth O, Grevelding CG. Males, the Wrongly Neglected Partners of the Biologically Unprecedented Male-Female Interaction of Schistosomes. Front Genet. 2019;10:796. pmid:31552097
- 55. Howe KL, Bolt BJ, Shafie M, Kersey P, Berriman M. WormBase ParaSite - a comprehensive resource for helminth genomics. Mol Biochem Parasitol. 2017;215:2–10.
- 56. Wendt G, Zhao L, Chen R, Liu C, O’Donoghue AJ, Caffrey CR, et al. A single-cell RNA-seq atlas of Schistosoma mansoni identifies a key regulator of blood feeding. Science. 2020;369(6511):1644–9.
- 57. Weth O, Haeberlein S, Haimann M, Zhang Y, Grevelding CG. Towards deorphanizing G protein-coupled receptors of Schistosoma mansoni using the MALAR yeast two-hybrid system. Parasitology. 2020;147(8):865–72. pmid:31840628
- 58. Beckmann S, Buro C, Dissous C, Hirzmann J, Grevelding CG. The Syk kinase SmTK4 of Schistosoma mansoni is involved in the regulation of spermatogenesis and oogenesis. PLoS Pathog. 2010;6(2):e1000769. pmid:20169182
- 59. Beckmann S, Long T, Scheld C, Geyer R, Caffrey CR, Grevelding CG. Serum albumin and α-1 acid glycoprotein impede the killing of Schistosoma mansoni by the tyrosine kinase inhibitor Imatinib. Int J Parasitol Drugs Drug Resist. 2014;4(3):287–95. pmid:25516839
- 60. Li X, Weth O, Haeberlein S, Grevelding CG. Molecular characterization of Smtdc-1 and Smddc-1 discloses roles as male-competence factors for the sexual maturation of Schistosoma mansoni females. Front Cell Infect Microbiol. 2023;13:1173557. pmid:37305409
- 61. Collins JNR, Collins JJ 3rd. Methods for Studying the Germline of the Human Parasite Schistosoma mansoni. Methods Mol Biol. 2017;1463:35–47. pmid:27734345
- 62. Tran MH, Freitas TC, Cooper L, Gaze S, Gatton ML, Jones MK, et al. Suppression of mRNAs encoding tegument tetraspanins from Schistosoma mansoni results in impaired tegument turnover. PLoS Pathog. 2010;6(4):e1000840. pmid:20419145
- 63. Moescheid MF, Puckelwaldt O, Beutler M, Haeberlein S, Grevelding CG. Defining an optimal control for RNAi experiments with adult Schistosoma mansoni. Sci Rep. 2023;13(1):9766. pmid:37328492
- 64. Lück S, Kreszies T, Strickert M, Schweizer P, Kuhlmann M, Douchkov D. siRNA-Finder (si-Fi) Software for RNAi-Target Design and Off-Target Prediction. Front Plant Sci. 2019;10:1023.
- 65. Neves RH, de Lamare Biolchini C, Machado-Silva JR, Carvalho JJ, Branquinho TB, Lenzi HL, et al. A new description of the reproductive system of Schistosoma mansoni (Trematoda: Schistosomatidae) analyzed by confocal laser scanning microscopy. Parasitol Res. 2005;95(1):43–9. pmid:15565465
- 66. Beckmann S, Quack T, Burmeister C, Buro C, Long T, Dissous C, et al. Schistosoma mansoni: signal transduction processes during the development of the reproductive organs. Parasitology. 2010;137(3):497–520. pmid:20163751
- 67. Wang B, Collins JJ 3rd, Newmark PA. Functional genomic characterization of neoblast-like stem cells in larval Schistosoma mansoni. Elife. 2013;2:e00768.
- 68. Haeberlein S, Angrisano A, Quack T, Lu Z, Kellershohn J, Blohm A, et al. Identification of a new panel of reference genes to study pairing-dependent gene expression in Schistosoma mansoni. Int J Parasitol. 2019;49(8):615–24. pmid:31136746
- 69. Larsson M, Norrander J, Gräslund S, Brundell E, Linck R, Ståhl S, et al. The spatial and temporal expression of Tekt1, a mouse tektin C homologue, during spermatogenesis suggest that it is involved in the development of the sperm tail basal body and axoneme. Eur J Cell Biol. 2000;79(10):718–25. pmid:11089920
- 70. Nishie T, Ohta Y, Shirai E, Higaki S, Shimozawa N, Narita K, et al. Identification of TEKTIN1-expressing multiciliated cells during spontaneous differentiation of non-human primate embryonic stem cells. Genes Cells. 2023;28(7):516–25. pmid:37186436
- 71. Yamaguchi A, Kaneko T, Inai T, Iida H. Molecular cloning and subcellular localization of Tektin2-binding protein 1 (Ccdc 172) in rat spermatozoa. J Histochem Cytochem. 2014;62(4):286–97. pmid:24394471
- 72. Fitzpatrick JM, Hirai Y, Hirai H, Hoffmann KF. Schistosome egg production is dependent upon the activities of two developmentally regulated tyrosinases. FASEB J. 2007;21(3):823–35. pmid:17167065
- 73. Chen LL, Rekosh DM, LoVerde PT. Schistosoma mansoni p48 eggshell protein gene: characterization, developmentally regulated expression and comparison to the p14 eggshell protein gene. Mol Biochem Parasitol. 1992;52(1):39–52. pmid:1625706
- 74. Collins JJ 3rd, Wang B, Lambrus BG, Tharp ME, Iyer H, Newmark PA. Adult somatic stem cells in the human parasite Schistosoma mansoni. Nature. 2013;494(7438):476–9. pmid:23426263
- 75. Platt TR, Brooks DR. Evolution of the schistosomes (Digenea: Schistosomatoidea): the origin of dioecy and colonization of the venous system. J Parasitol. 1997;83(6):1035–44. pmid:9406775
- 76. Brant SV, Loker ES. Can specialized pathogens colonize distantly related hosts? Schistosome evolution as a case study. PLoS Pathog. 2005;1(3):167–9. pmid:16322771
- 77. Grevelding CG, Langner S, Dissous C. Kinases: Molecular Stage Directors for Schistosome Development and Differentiation. Trends Parasitol. 2018;34(3):246–60. pmid:29276074
- 78. Lu C, Wu W, Niles EG, LoVerde PT. Identification and characterization of a novel fushi tarazu factor 1 (FTZ-F1) nuclear receptor in Schistosoma mansoni. Mol Biochem Parasitol. 2006;150(1):25–36. pmid:16870276
- 79. Shakir EMN, Rinaldi G, Kirk RS, Walker AJ. Schistosoma mansoni excretory-secretory products induce protein kinase signalling, hyperkinesia, and stem cell proliferation in the opposite sex. Commun Biol. 2023;6(1):985. pmid:37752334
- 80. Kapp K, Knobloch J, Schüssler P, Sroka S, Lammers R, Kunz W, et al. The Schistosoma mansoni Src kinase TK3 is expressed in the gonads and likely involved in cytoskeletal organization. Mol Biochem Parasitol. 2004;138(2):171–82. pmid:15555729
- 81. Beckmann S, Hahnel S, Cailliau K, Vanderstraete M, Browaeys E, Dissous C. Characterization of the Src/Abl hybrid kinase SmTK6 of Schistosoma mansoni. J Biol Chem. 2011;286(49):42325–36.
- 82. Beckmann S, Grevelding CG. Imatinib has a fatal impact on morphology, pairing stability and survival of adult Schistosoma mansoni in vitro. Int J Parasitol. 2010;40(5):521–6. pmid:20149792
- 83. Ding H, Liu F, Zhu L, Wu F, Liu Q, He S, et al. Tyrosine kinase 4 is involved in the reproduction of the platyhelminth parasite Schistosoma japonicum. Parasit Vectors. 2017;10(1):498. pmid:29047397
- 84. Xia Y, He S, Sun Z, Wang X, Shao W, Ren C, et al. Role of the Pumilio gene in the reproductive system of Schistosoma japonicum. Parasitol Res. 2020;119(2):501–11. pmid:31897787
- 85. Liu Q, Zhu L, Liu F, Hua M, Ding H, He S, et al. Function of Nanos1 gene in the development of reproductive organs of Schistosoma japonicum. Parasitol Res. 2017;116(5):1505–13. pmid:28352943
- 86. Leutner S, Oliveira KC, Rotter B, Beckmann S, Buro C, Hahnel S, et al. Combinatory microarray and SuperSAGE analyses identify pairing-dependently transcribed genes in Schistosoma mansoni males, including follistatin. PLoS Negl Trop Dis. 2013;7(11):e2532. pmid:24244773
- 87. Saberi A, Jamal A, Beets I, Schoofs L, Newmark PA. GPCRs Direct Germline Development and Somatic Gonad Function in Planarians. PLoS Biol. 2016;14(5):e1002457. pmid:27163480
- 88. Collins JJ 3rd, Hou X, Romanova EV, Lambrus BG, Miller CM, Saberi A, et al. Correction: Genome-Wide Analyses Reveal a Role for Peptide Hormones in Planarian Germline Development. PLoS Biol. 2015;13(8):e1002234. pmid:26275013
- 89. Tayler TD, Pacheco DA, Hergarden AC, Murthy M, Anderson DJ. A neuropeptide circuit that coordinates sperm transfer and copulation duration in Drosophila. Proc Natl Acad Sci U S A. 2012;109(50):20697–702. pmid:23197833
- 90. Kim WJ, Jan LY, Jan YN. A PDF/NPF neuropeptide signaling circuitry of male Drosophila melanogaster controls rival-induced prolonged mating. Neuron. 2013;80(5):1190–205. pmid:24314729
- 91. Hussain A, Üçpunar HK, Zhang M, Loschek LF, Grunwald Kadow IC. Neuropeptides Modulate Female Chemosensory Processing upon Mating in Drosophila. PLoS Biol. 2016;14(5):e1002455. pmid:27145127
- 92. Zamanian M, Kimber MJ, McVeigh P, Carlson SA, Maule AG, Day TA. The repertoire of G protein-coupled receptors in the human parasite Schistosoma mansoni and the model organism Schmidtea mediterranea. BMC Genomics. 2011;12:596. pmid:22145649
- 93. Nguyen DQ, Can TBN, Vu CD, Tran TAT, Nguyen NL, Nguyen TKL, et al. Identification of a novel BAAT frameshift mutation in a female child diagnosed with skeletal dysplasia: A case report. Med. 2024;103(36):e39509.
- 94. Middelkoop TC, Korswagen HC. Development and migration of the C. elegans Q neuroblasts and their descendants. WormBook. 2014;:1–23.
- 95. Hatten ME. New directions in neuronal migration. Science. 2002;297(5587):1660–3.
- 96. Hoffmann KF. An historical and genomic view of schistosome conjugal biology with emphasis on sex-specific gene expression. Parasitology. 2004;128 Suppl 1:S11–22. pmid:16454894
- 97. Shakir EMN, Rinaldi G, Kirk RS, Walker AJ. Schistosoma mansoni excretory-secretory products induce protein kinase signalling, hyperkinesia, and stem cell proliferation in the opposite sex. Commun Biol. 2023;6(1):985. pmid:37752334
- 98. Koonin EV. Evolution of RNA- and DNA-guided antivirus defense systems in prokaryotes and eukaryotes: common ancestry vs convergence. Biol Direct. 2017;12(1):5. pmid:28187792
- 99. Suzuki K, Kelleher AD. Transcriptional regulation by promoter targeted RNAs. Curr Top Med Chem. 2009;9(12):1079–87. pmid:19860708
- 100. Cernilogar FM, Onorati MC, Kothe GO, Burroughs AM, Parsi KM, Breiling A, et al. Chromatin-associated RNA interference components contribute to transcriptional regulation in Drosophila. Nature. 2011;480(7377):391–5. pmid:22056986
- 101. Portnoy V, Huang V, Place RF, Li L-C. Small RNA and transcriptional upregulation. Wiley Interdiscip Rev RNA. 2011;2(5):748–60. pmid:21823233
- 102. Koziol U, Koziol M, Preza M, Costábile A, Brehm K, Castillo E. De novo discovery of neuropeptides in the genomes of parasitic flatworms using a novel comparative approach. Int J Parasitol. 2016;46(11):709–21. pmid:27388856
- 103. Fetterer RH, Pax RA, Bennett JL. Praziquantel, potassium and 2,4-dinitrophenol: analysis of their action on the musculature of Schistosoma mansoni. Eur J Pharmacol. 1980;64(1):31–8.
- 104. Caldwell N, Afshar R, Baragaña B, Bustinduy AL, Caffrey CR, Collins JJ, et al. Perspective on schistosomiasis drug discovery: highlights from a schistosomiasis drug discovery workshop at Wellcome Collection, London, September 2022. ACS Infect Dis. 2023;9(5):1046–55.
- 105. Dettman CD, Higgins-Opitz SB, Saikoolal A. The infectivity of Schistosoma mansoni in mice, following dipping with an acaricide. Lab Anim. 1990;24(2):156–8. pmid:2114504
- 106. Dettman CD, Higgins-Opitz SB, Saikoolal A. Enhanced efficacy of the paddling method for schistosome infection of rodents by a four-step pre-soaking procedure. Parasitol Res. 1989;76(2):183–4. pmid:2515540
- 107. Li J, Gao J, Han L, Zhang Y, Guan W, Zhou L, et al. Development of a membrane-anchored ligand and receptor yeast two-hybrid system for ligand-receptor interaction identification. Sci Rep. 2016;6:35631.
- 108. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45. pmid:11328886
- 109. Inouye S, Sahara-Miura Y, Sato J, Suzuki T. Codon optimization of genes for efficient protein expression in mammalian cells by selection of only preferred human codons. Protein Expr Purif. 2015;109:47–54. pmid:25665506
- 110. Jang M, Pete ES, Bruheim P. The impact of serum-free culture on HEK293 cells: From the establishment of suspension and adherent serum-free adaptation cultures to the investigation of growth and metabolic profiles. Front Bioeng Biotechnol. 2022;10:964397. pmid:36147538
- 111. Yang J, Yan Y, Xiang X, Xu Y, Zhou N, Wang T. Detection of ligand-activated G protein-coupled receptor internalization by confocal microscopy. J Vis Exp. 2017;122:55514.
- 112. Rinne A, Mobarec JC, Mahaut-Smith M, Kolb P, Bünemann M. The mode of agonist binding to a G protein-coupled receptor switches the effect that voltage changes have on signaling. Sci Signal. 2015;8(401):ra110.
- 113. Kirchhofer SB, Jelinek V, Klingelhöfer K, Krett AL, Buenemann M. Dissecting GPCR selectivity: A complex interplay of various intracellular motifs determines G-protein binding and activation. bioRXiv. 2025.
- 114. Kobayashi H, Picard L-P, Schönegge A-M, Bouvier M. Bioluminescence resonance energy transfer-based imaging of protein-protein interactions in living cells. Nat Protoc. 2019;14(4):1084–107. pmid:30911173
- 115. Li X, Zhang H, Hu W, Wu K, Li S, Jin S, et al. Structural basis of peptide recognition and modulation for neuropeptide FF receptors. Cell Rep. 2025;44(9):116160. pmid:40839429