https://orcid.org/0000-0003-1555-9985
Figures
Abstract
Hepatitis E virus genotype 1 (HEV-1) has long been considered human-specific, with no known natural animal hosts. Here, we demonstrate that three wild rodent species—Apodemus peninsulae, Clethrionomys rufocanus, and Lasiopodomys brandtii—are susceptible to HEV-1 infection. Among them, A. peninsulae infected with HEV-1 exhibited the highest susceptibility, characterized by robust fecal viral shedding, systemic viral replication, seroconversion, and mild liver pathology mimicking human acute HEV-1 infection. Intrahepatic transcriptomic analysis of infected animals revealed activation of inflammatory pathways, including upregulation of IL-1β and IL-18. Re-inoculation experiments confirmed infection-induced protective immunity, and ribavirin treatment effectively suppressed viral replication. HEV-1 infection can be established by oral gavage inoculation, close contact and vertical transmission. These results provide solid evidence that wild rodents can serve as potential hosts for HEV-1, highlighting the potential role of wild rodents in HEV-1 ecology and cross-species transmission.
Citation: Zhang H, Wu Y, Wang H, Liu T, Liu X, Chen J, et al. (2026) Experimental hepatitis E virus genotype 1 infection in three types of wild rodents. PLoS Pathog 22(3): e1014050. https://doi.org/10.1371/journal.ppat.1014050
Editor: Alexander E. Gorbalenya, Leiden University Medical Center: Leids Universitair Medisch Centrum, NETHERLANDS, KINGDOM OF THE
Received: October 1, 2025; Accepted: March 2, 2026; Published: March 18, 2026
Copyright: © 2026 Zhang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting information files.
Funding: This work was supported by grants from the National Key R&D Program of China (Grant Number: 2022YFF0710503) to H.Z; National Natural Science Foundation of China (Grant/Award Number: 82522053) to L.W; National Key R&D Program of China (Grant Number: 2023YFF0724603) to Y.W; Hepatitis E prevention and treatment research fund (Grant Number: CLH2023-F-HEV-18) to X.Y; National Clinical Research Center for Obstetrics and Gynecology, Peking University Third Hospital (Grant/Award Number: BYSYSZKF2023006) to L.W; The Youth Innovation Program of the Chinese Academy of Agricultural Sciences (Grant Number: Y2026QC35) to X.L. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
According to World Health Organization, hepatitis E virus (HEV) caused an estimated 19.47 million cases of acute hepatitis E (AHE) globally in 2021; HEV was responsible for 5.4% of global disability-adjusted life years (DALYs) related to acute hepatitis [1]. Of the eight HEV genotypes (genus Paslahepevirus, HEV-1 to HEV-8), humans are considered as the natural hosts of HEV-1 and HEV-2, whereas the other genotypes have a broad range of animal reservoirs [1,2]. HEV-1 is the main cause of acute icteric hepatitis in developing countries and cuases 20% of mortality in infected pregnant women [3]. While HEV-3 and HEV-4 are zoonotic and account for most sporadic and chronic hepatitis E cases in developed countries [4].
It is known that HEV-1 is confined to humans, but this notion is challenged by our recent report that Mongolian gerbil, a small rodent can be experimentally infected with HEV-1 [5]. Notably, only five nonsynonymous mutations in the viral genome were detected after serial passage in the aged male gerbils, which may result in the increased infection efficiency. An in silico study also suggested that human-associated HEV likely had an origin of rodents [6]. Rodents, the most speciose mammals, often live in close proximity to humans, sharing overlapping habitats, including water sources. This close contact enables wild rodents to transmit major zoonotic pathogens to humans, such as rat HEV (genus Rocahepevirus), which is increasingly detected in humans, causing acute and chronic hepatitis E [7,8]. Although human-associated HEV is rarely reported in wild rodents. A study from the early 1990s documented a hepatitis E outbreak in humans in Kyrgyz Republic, where HEV (probably HEV-1) was detected in rodent blood sera using immuno-electron microscopy [9]. Despite limited data and no subsequent independent confirmation, this report suggests that wild rodents may play an underrecognized role in the HEV-1 transmission between humans and animals. Given the recent evidence indicating a broader host tropism for HEV-1 than previously assumed, further investigation into additional wild rodent species is warranted.
In this study, we domesticated three wild rodent species-Apodemus peninsulae (A. peninsulae), Clethrionomys rufocanus (C. rufocanus), and Lasiopodomys brandtii (L. brandtii), from the wild populations to laboratory breeding. We then investigated their susceptibility to HEV-1 infection and found that all three species are readily susceptible, with A. peninsulae exhibiting particularly robust infection characteristics. These findings provide direct evidence of HEV-1's potentially broader host tropism and advance our understanding of HEV virology.
Results
HEV-1 can infect wild rodents
Previous studies have reported that Mongolian gerbils are susceptible to HEV-1 [5,10]. To explore whether other wild rodent species are also susceptible, we investigated the susceptibility of A. peninsulae, C. rufocanus, and L. brandtii to a clinical isolate of HEV-1 (W2-1, genotype 1b; GenBank accession no. PP291577.1). The A. peninsulae and C. rufocanus were captured from forests in the Mudanjiang area and its surroundings, and were subsequently domesticated, bred, and raised by the Harbin Veterinary Research Institute. The L. brandtii was provided by the Institute of Zoology, Chinese Academy of Sciences. All animals were authenticated in our previous studies [11–13]. Male rodents aged 15–18 months were assigned into three groups (six animals per group: A. peninsulae, C. rufocanus, and L. brandtii) (Fig 1A). All animals were tested negative for HEV RNA in feces and anti-HEV antibodies in serum prior to inoculation. Each rodent was intraperitoneally inoculated with an HEV-1 fecal suspension containing 6.83 × 107 genome copies of HEV RNA. Concurrently, HEV-3 (OM780137.1) and HEV-4 (OM780138.1) were administered to the same three rodent species (six animals per group; Fig 1B). Following HEV-1 inoculation, fecal viral shedding was detected by 5 days post-inoculation (dpi) in all groups, peaking at 10 dpi: A. peninsulae (up to 6.26 × 10⁵ copies/g), C. rufocanus (up to 1.45 × 10⁵ copies/g), and L. brandtii (up to 1.83 × 10⁵ copies/g) (Fig 1C). All A. peninsulae continued shedding virus at 35dpi, whereas some C. rufocanus and L. brandtii ceased shedding. No viral shedding was observed in any group inoculated with HEV-3 or HEV-4 throughout the 35-day period (Fig 1D and 1E). Indeed, the detection of viral RNA confirmed that both HEV-3 and HEV-4 strains were infectious and capable of infecting the susceptible gerbil model (S1A and S1B Fig). At 7 dpi, HEV-1 RNA was detected in the liver tissues: A. peninsulae (4.94 × 104 to 2.85 × 105copies/g), C. rufocanus (3.88 × 103 to 1.36 × 104copies/g), and L. brandtii (0 to 1.25 × 104 copies/g) (Fig 1F). HEV RNA was also presented in spleen, kidney, and intestinal tissues (S2A Fig). At 35 dpi, liver HEV RNA levels remained detectable: A. peninsulae (~1.5 × 10⁵ copies/g), C. rufocanus (~ 4.5 × 10⁴ copies/g), and L. brandtii (~ 2.3 × 10⁴ copies/g) (Fig 1F), with continued detection in other organs (S2B Fig). Simultaneously, immunohistochemical detection confirmed the presence of hepatitis E virus ORF2 antigen in the liver cells of all three wild rodents (S2C-S2E Fig). In order to determine the complete detoxification cycle, we conducted an additional series of experiments. Our results showed that detoxification was completed by day 42 after vaccination in all three types of wild rodents (S2F Fig). In contrast, no HEV RNA was detected in the liver (Fig 1G), spleen, kidney, or intestine of rodent inoculated with HEV-3 or HEV-4 at 7 or 35 dpi (S3A Fig). Serological analysis revealed that no HEV-specific antibodies was detected at 7 dpi, but antibodies were present at 35 dpi in all three species following HEV-1 inoculation (S4A-S4C Fig). No antibodies were detected in any group inoculated with HEV-3 or HEV-4 during the whole observation period (S4D Fig). To further validate HEV-1 infectivity in wild rodents, we inoculated six A. peninsulae (15–18 months old) with cell-derived strain of HEV-1 (Sar55, 1.0 × 107 copies per animal, intraperitoneally inoculated). Fecal shedding was detected by 10 dpi, peaking at 5.89 × 10⁵ copies/g at 18 dpi, and persisted throughout the observation period (Fig 1H). At 14 and 35 dpi, HEV RNA was detected in the liver, spleen, kidney, and intestine of three animals (S5A Fig). Seroconversion to anti-HEV was absent at 14 dpi, but observed in one of three animals at 35 dpi (S5B Fig). Furthermore, these wild rodents were inoculated with rabbit-HEV. No HEV RNA was detected in their fecal samples over a 42-day monitoring period, demonstrating that these animals are not susceptible to infection by rabbit-HEV (S5C Fig). And no HEV RNA was detected in fecal samples of A. peninsulae over the 42-day monitoring period, demonstrating that A. peninsulae is not susceptible to infection by Kernow C-1 P6 (S5D Fig). These findings demonstrated that A. peninsulae, C. rufocanus, and L. brandtii are susceptible to HEV-1 but not to HEV-3 or HEV-4, highlighting a broader host tropism for HEV-1.
(A) Representative photos of three wild rodent species: A. peninsulae, C. rufocanus, and L. brandtii. (B) Experimental design for HEV-1, HEV-3, and HEV-4 intraperitoneal inoculation in the three rodent species, including the number of animals per group and sample collection time points (feces, serum, and tissues). (C–E) Quantification of HEV RNA in fecal samples following inoculation with HEV-1 (C), HEV-3 (D), or HEV-4 (E) at indicated time points. (F) HEV RNA levels in liver tissues of the three rodent species at 7 and 35 dpi with HEV-1. (G) HEV RNA levels in liver tissues at 7 and 35 dpi after inoculation with HEV-3 or HEV-4. (H) Quantification of fecal HEV RNA in A. peninsulae inoculated with cell-derived HEV-1 (Sar55 strain). Viral RNA copy numbers were determined using RT-qPCR. LOQ: limit of quantification. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
Serial passage of HEV-1 in A. peninsulae
To confirm the susceptibility of wild rodents to HEV-1, A. peninsulae, the most susceptible species among three tested, was subjected to four rounds of serial passages (Fig 2A). Fecal samples with the highest viral RNA load from the initial passage (P0) were used to prepare viral suspensions, inoculated intraperitoneally into five naïve, aged 15–18 months A. peninsulae (P1 generation). Fecal samples were collected at defined intervals to monitor viral shedding until fecal HEV RNA was undetectable. In P1, peak fecal viral load occurred at 14 dpi, becoming undetectable by 49 dpi (Fig 2B). All animals seroconverted to anti-HEV antibodies by 49 dpi, (S6A Fig), indicating successful infection in all five animals. This process was repeated for subsequent passages. In the P2, peak fecal viral loads were observed at 10 and 14 dpi (Fig 2C), with seroconversion to anti-HEV by 42 dpi (S6B Fig). In P3, peak fecal viral loads occurred at 10 and 14 dpi (Fig 2D), with seroconversion in all animals by 49 dpi (S6C Fig). In P4, peak fecal viral shedding was observed only at 10 dpi (Fig 2E), with all animals testing positive for anti-HEV antibodies by 42 dpi (Fig 2F). HEV RNA was detected in the liver, spleen, kidneys, and intestines of P4 animals at 14 dpi (Fig 2G). To further characterize the viral particles in circulation, hepatic portal blood collected from P4 A. peninsulae at 14 dpi was analyzed via rate-zonal centrifugation. HEV RNA was detected in fractions 8–14, peaking in fraction 12, indicates that viremia occurred after infection.
(A) Schematic diagram of HEV-1 serial passage in A. peninsulae. (B–E) Quantification of fecal HEV RNA by RT-qPCR during passages P1 to P4 in A. peninsulae. (F) Seroconversion to anti-HEV antibodies in P4 animals at baseline and 42 dpi, determined by ELISA (Wantai, Beijing, China). An S/CO ratio >1 was considered positive. (G) Quantification of HEV RNA in liver, spleen, kidney, and intestine at 14 dpi in P4 animals. (H) Layered quantification of HEV RNA in hepatic portal blood of P4 animals after density gradient centrifugation at 14 dpi. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
Genome sequences of the original inoculum (W2-1-M, GenBank accession no. PP291577.1) and P4-adapted strain were compared. Both were 7,212 nucleotides long with 99.9% nucleotide identity. Four nucleotide substitutions were identified in P4, including three nonsynonymous mutations: Histidine (H) at position 458 of ORF1 was replaced by arginine (R), and alanine (A) at position 462 was substituted with threonine (T); In ORF2, valine (V) at position 600 was replaced by isoleucine (I). No amino acid mutations were detected in ORF3 (S6D Fig).
Host responses in A. peninsulae following HEV-1 infection
Ten A. peninsulae were intraperitoneally inoculated with HEV-1 strain (6.5 × 10⁷ copies/g), with random sex distribution, alongside uninfected controls. Fecal viral shedding peaked at 10 dpi (8.23 × 10⁴ to 1.22 × 10⁶ copies/g) and ceased by 56 dpi (Fig 3A and 3B). At 10dpi, five animals (three females and two males) were randomly euthanized, and liver, spleen, kidney, and intestinal tissues were collected from both infected and uninfected animals. Liver tissues showed the highest HEV RNA levels detected by RT-qPCR (8.24 × 10⁴ to 1.18 × 10⁶ copies/g) (Fig 3C). Weekly serological analysis showed that anti-HEV antibodies appeared at 28 dpi (Fig 3D). Liver histopathology at 14 dpi showed lymphocytic infiltration in the infected animals, while no obvious lesions were observed in the control group (Fig 3E). The samples were scored according to Ishak score and no significantly difference in the HEV-infected group than in the control group (S7A Fig). Immunohistochemistry of HEV ORF2 antigen confirmed the presence of HEV ORF2 antigen in hepatocytes (Fig 3G). No HEV ORF2 antigen was detected in the hepatocytes of the MOCK group (Fig 3G). We used an ELISA kit to detect antigens in serum samples collected on days 7, 14, 21, and 28 post-inoculation. All serum samples tested negative (S7B Fig). Additionally, liver tissue from an A. peninsulae specimen euthanized on day 10 post-infection was also tested and yielded a positive result for antigen presence (S7C Fig). Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels remained comparable between infected and control animals throughout the 56-day observation period, with no significant differences (S7D and S7E Fig). Fecal supernatants collected at 10 dpi (following 4-hour ultracentrifugation), then immunoelectron microscopy using ORF2-specific antibodies confirmed the specific binding of antibodies to HEV-1 particles (S7F and S7G Fig). Additionally, liver transcriptomics at 14 dpi identified 452 differentially expressed genes (DEGs) with 248 upregulated, including interleukin-1 beta (IL1B) and interleukin-18 (IL18) (Figs 3H and S8A). Gene Ontology (GO) enrichment analysis revealed that upregulated DEGs were predominantly associated with complement activation and innate immune responses (Fig 3I). Transcription factor enrichment analysis indicated activation of immune-related factors, including interferon regulatory factor 8 (IRF8) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) (S8B Fig).
(A) Schematic diagram of the experimental design. (B) Fecal HEV RNA levels following HEV-1 inoculation. (C) HEV RNA levels in liver, spleen, kidney, and intestine at 10 dpi. (D) Serum conversion of anti-HEV antibodies on the 10th dpi after infection. (E) Weekly seroconversion to anti-HEV antibodies in infected animals. (F) Representative H&E-stained liver sections at 10 dpi in HEV-infected (n = 3) and mock-infected (n = 3) animals. Inflammatory cell infiltration is visible in liver tissues from infected animals. Scale bars are shown. (G) Immunohistochemistry for HEV ORF2 in liver tissues from infected and control animals. Arrows indicate positive staining. (H) Volcano plot showing DEGs between HEV-infected (n = 3) and mock-infected (n = 3) liver tissues at 10 dpi. Thresholds: adjusted P < 0.05 and log2FC > 1. (I) GO enrichment analysis of upregulated DEGs. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
Re-inoculation and antiviral treatment influence HEV-1 infection in A. peninsulae
To investigate whether A. peninsulae can be re-infected with HEV-1 post-viral clearance, five animals from the P1 generation were re-inoculated intraperitoneally with HEV-1 (Fig 4A). Controls showed fecal HEV RNA peaking at 10 dpi (5.35 × 10⁵ copies/g), but re-inoculated animals had no detectable HEV RNA over 56 days (Fig 4B), indicating antibody-mediated protection. We further assessed the antiviral efficacy of ribavirin when administered after the onset of fecal viral shedding (Fig 4C). Beginning at 6 dpi, infected A. peninsulae received oral ribavirin at a dosage of 1 mg/day (approximately 50 mg/kg/day). In untreated controls, viral shedding began at 5 dpi, and HEV RNA remained detectable in feces through 28 day, with a viral load of 2.02 × 10⁴ copies/g. In contrast, ribavirin treatment significantly reduced fecal HEV RNA levels at 10 and 14 dpi, and viral shedding ceased by 14 dpi (Fig 4D). The prophylactic efficacy of ribavirin in A. peninsulae was also evaluated. Over a four-week period, fecal HEV RNA levels were compared between ribavirin-treated and untreated groups (S9A Fig). In untreated controls, all A. peninsulae exhibited fecal viral shedding starting from 6 dpi. However, no fecal HEV RNA was detected in the ribavirin-treated group, which received 0.5 mg/day of ribavirin (approximately 25 mg/kg/day), indicating that oral ribavirin has strong prophylactic effects against HEV-1 infection (S9B Fig).
(A) Schematic of reinoculation experiment following fecal viral clearance in P1 animals. (B) Fecal HEV RNA levels in reinoculated and positive control groups. (C) Schematic of ribavirin treatment experiment post-inoculation. (D) Fecal HEV RNA levels in ribavirin-treated and untreated groups during infection. *P < 0.05, ****P < 0.0001. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
Transmission routes of HEV-1 in A. peninsulae
To investigate the transmission routes of HEV-1 in A. peninsulae, six animals were orally inoculated with HEV-1 (approximately 7 × 10⁷ copies) via gavage for six consecutive days. Fecal shedding was monitored after inoculation (Fig 5A). Transient fecal HEV RNA appeared at 3 dpi, with one animal shedding at 14 dpi; no shedding occurred from 17 to 42 dpi (Fig 5B). At 10 dpi, three mice were euthanized for tissue collection. RT-qPCR revealed HEV RNA was detected in the liver (8.67 × 10³ copies/g), spleen (5.42 × 10³ copies/g), kidney (3.83 × 10³ copies/g), and intestine (4.45 × 10³ copies/g) (Fig 5C). Weekly serological analysis showed no detectable HEV-specific antibodies during the four-week observation period (S10A Fig). These results suggest that HEV-1 can establish infection in A. peninsulae via the oral gavage route, albeit with limited efficiency. To exclude the possibility that the detected viral RNA originated from non-infectious viral particles, we designed specific primers targeting the negative strand of HEV-1. PCR amplification of liver tissue collected 10 days post-oral inoculation successfully detected the HEV-1 negative strand, thus demonstrating that the virus detected was replication-competent rather than non-infectious excreted RNA (S10B Fig). To further confirm fecal–oral transmission, two A. peninsulae were intraperitoneally inoculated with HEV-1 (6.5 × 10⁷ copies) and co-housed with four naïve animals (Sentinel group) beginning at 10 dpi (Fig 5D). The groups were co-housed for 49 days, with separation occurring one day before fecal collection. In the sentinel group, HEV RNA was first detected in two animals on day 4 post-co-housing. By day 7, three animals were tested positive, and by day 14, only one remained positive, with detectable shedding lasting until day 25. One mouse remained negative throughout the entire period (Fig 5E). No detectable HEV-specific antibodies were observed in the Sentinel group during the 49-day co-housing period (Fig 5F). These findings indicate limited fecal–oral transmission of HEV-1 under experimental conditions. In a preliminary study to assess vertical transmission, three female A. peninsulae were co-housed with males for mating. On day 7 post-mating, pregnant females were intraperitoneally inoculated with HEV-1 (approximately 6.5 × 10⁷ copies) (Fig 5G). Fecal shedding of HEV-1 RNA was observed on day 7 post-inoculation (Fig 5H). A total of 11 neonate were born naturally at day 21 post-mating. HEV RNA was detected in the liver tissues of four neonate, confirming that vertical transmission of HEV-1 from dam to neonate can occur (Fig 5I). Furthermore, we inoculated three pregnant mice with HEV-1 using the same method. One week before delivery, we tested 20 placentas from these three pregnant mice for HEV RNA. The results showed that among the five placentas from one of the pregnant mice, three tested positive for HEV RNA, while all others were negative (S11A Fig). Immunohistochemical analysis of fetal livers from placenta-positive cases revealed varying degrees of HEV antigen staining in the HEV group, while none was observed in the Mock group (S11B Fig). This further confirms that vertical transmission of HEV-1 from dam to neonate can occur.
(A) Schematic of oral inoculation experiment. (B) Fecal HEV RNA levels following oral HEV-1 administration. (C) HEV RNA levels in liver, spleen, kidney, and intestine at 10 dpi. (D) Schematic of co-housing natural transmission experiment. (E) Fecal HEV RNA levels in Donor and Sentinel groups during co-housing. (F) Seroconversion in Donor and Sentinel animals during co-housing. (G) Schematic of vertical transmission experiment during pregnancy. (H) Fecal HEV RNA levels in pregnant A. peninsulae after inoculation. (I) Detection of HEV RNA in the liver tissues of neonates born to HEV-infected dams. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
Discussion
It was long assumed that HEV-1 infection is limited to humans, with no natural animal host identified to date [14,15]. However, recent evidence demonstrates the Mongolian gerbil, a small rodent species, can be experimentally infected with HEV-1 [5,16]. It appears that only five genetic adaptations may be required for robust HEV-1 infection in Mongolian gerbils. Supporting this, a computational study proposed that rodents may be the ancestral hosts of human HEV [6]. These findings indicate that HEV-1 may have a broader host range, warranting further exploration of its infectivity in other wild rodent species. Furthermore, we didn’t find studies that surveyed HEV-1 in the three rodent species we used. No related metagenomic datasets as well. Surveillance in rodents should be enhanced and not be limited to R. ratti.
A. peninsulae, C. rufocanus, and L. brandtii are the three wild rodents we used for HEV-1 infection. L. brandtii and Mongolian gerbil are representative wild rodent species inhabiting the grasslands of Inner Mongolia. L. brandtii has been reported as a suitable infection model for important zoonotic viruses, including influenza virus and SARS-CoV. A. peninsulae and C. rufocanus are dominant wild rodent species in northern China, particularly in the forested areas of Heilongjiang Province [17]. Both A. peninsulae and C. rufocanus have been reported to be susceptible to hantaviruses—an important group of zoonotic pathogens—suggesting their potential role in zoonotic disease transmission [18,19]. We constructed a phylogenetic tree of common rodents (scale bar = 10), which clearly revealed the evolutionary relationships among the three wild rodent species. The results showed that C. rufocanus and L. brandtii are phylogenetically closer to other cricetid groups, while demonstrating clear phylogenetic divergence from the murid clade containing A. peninsulae (S12 Fig). Currently published epidemiological studies of HEV-1 on rodents have not yet covered these three rodent species. We fully acknowledge the critical importance of this research direction and will prioritize the design of relevant investigations in our follow-up work. Furthermore, future surveillance should be enhanced on these rodent species.
In this study, we provide evidence that A. peninsulae, C. rufocanus, and L. brandtii are all susceptible to HEV-1 infection. Following HEV-1 inoculation, all three species exhibited detectable fecal HEV RNA shedding and HEV RNA in multiple tissues, including the liver, spleen, kidney, and intestine. Among them, A. peninsulae was more susceptible to HEV-1 when compared to the other two rodent species. We conducted serial in vivo passages using fecal suspensions made from HEV-1-infected A. peninsulae. However, no obvious improvement of minimal genetics changes were observed during passage in A. peninsulae, suggesting natural susceptibility. However, variability among individuals was observed, possibly due to host heterogeneity. To further confirm A. peninsulae’s susceptibility, we used another HEV-1 strain, Sar55 (subtype 1a), and found that A. peninsulae was also susceptible to this strain. In contrast, inoculation with HEV-3 and HEV-4 resulted in no detectable HEV RNA in feces or tissues, indicating genotype-specific susceptibility in these wild rodents.
HEV-1 infection in A. peninsulae recapitulated key features of acute HEV-1 infection in human, including robust fecal viral shedding, seroconversion to anti-HEV antibodies, mild hepatic histopathological changes, and spontaneous viral clearance. Quantitative RT-PCR analysis showed that the liver had the highest HEV RNA levels among all tested tissues. To explore virus-host interactions, we employed high-throughput RNA sequencing to examine the hepatic transcriptional changes during the acute phase (14 dpi). Transcriptomic analysis revealed significant upregulation of multiple inflammatory mediators, including IL1β and IL18, in the livers of HEV-1-infected A. peninsulae. In HEV infection, IL-1β and IL-18 are key pro-inflammatory cytokines mediated by the NOD-like receptor family, pyrin domain containing 3 (NLRP3) inflammasome, playing crucial roles in regulating the host immune response. Studies have reported that during HEV infection, IL-1β serves as a key inflammatory factor and a hallmark of NLRP3 inflammasome activation [20–22].
To further confirm that successful HEV-1 infection has been established in A. peninsulae, we conducted a reinfection experiment in animals that recovered from prior HEV-1 infection. Upon re-challenge, no viral shedding was detected in feces, suggesting that prior infection-induced immunity prevented reinfection. The broad-spectrum drug ribavirin is used for the treatment of HEV [23–25]. Oral ribavirin, recommended for the treatment of chronic hepatitis E, significantly inhibited HEV-1 replication when administered before or after infection in A. peninsulae. These findings confirm that HEV-1 can effectively replicate in A. peninsulae, establishing it as a valuable model for studying HEV-1 infection.
In humans, HEV is primarily transmitted via the fecal–oral route [26,27]. However, studies in animals, including non-human primates, pigs, rabbits, and gerbils, oral inoculation results in low infection efficiency with unknown mechanism [5]. A recent study established a robust HEV infection model in immunodeficient nude rats via oral administration [28]. In our study, oral gavage of A. peninsulae with HEV-1 resulted in detectable fecal viral shedding, although the viral load was lower compared to intraperitoneal inoculation, indicating that the oral gavage route is less efficient for HEV-1 infection in A. peninsulae. Furthermore, we also investigated whether HEV-1 could spread through close-contact transmission. By co-housing HEV-1-inoculated and uninfected A. peninsulae, we observed limited HEV-1 transmission through natural contact, indicating low efficiency. Vertical transmission is observed for HEV-1 during large outbreaks [29]. Our finding revealed a 36% vertical transmission rate in HEV-1-infected pregnant A. peninsulae, aligning with reported rates of 33% to 100%. These results demonstrated that HEV-1 can infect A. peninsulae via multiple transmission routes.
In summary, our study confirms that A. peninsulae, C. rufocanus, and L. brandtii are susceptible to HEV-1, with A. peninsulae exhibiting the highest susceptibility. We systematically demonstrated that A. peninsulae can sustain productive HEV-1 infection, fulfilling Koch’s postulates. While computational studies have suggested rodents as potential ancestral hosts of human HEV, direct evidence of wild rodent susceptibility to HEV-1 has been lacking. Our study establishes, for the first time, that wild rodents can be infected with HEV-1, significantly expanding the known host range of this virus. These findings provide a crucial foundation for investigating wild rodents as potential intermediate hosts in HEV-1 transmission dynamics.
Materials and methods
Ethics statement
Adult A. peninsulae [11], C. rufocanus [12], and L. brandtii [13] (15–18 months old) were randomly selected and bred at the Laboratory Animal Center of the Harbin Veterinary Research Institute. Mongolian gerbils (20–25 months old) were randomly selected and bred at the Laboratory Animal Center of the Harbin Veterinary Research Institute. Equal numbers of male and female rodents were included. In studies related to infection during pregnancy, observation of a white or milky “vaginal plug” at the vaginal opening and continuous weight gain in the days following mating can be used to assess successful mating in female mice. Serum and fecal samples were collected at predetermined time points and tested for HEV RNA and/or anti-HEV antibodies prior to enrollment to exclude current or prior HEV infection. All animals were housed individually in cages with free access to food and water. All experimental protocols were approved by the Animal Ethics Committee of the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (approval no. 230713–03-GR).
Virus inoculum
HEV-1, HEV-3, Rabbit HEV, and HEV-4 strains were isolated from fecal samples (GenBank accession numbers is pending). Kernow C-1 P6 and Sar55 were isolated from cell- derived. HEV-positive fecal specimens were diluted 1:10 (wt/vol) in sterile phosphate-buffered saline (PBS), centrifuged at 4,000 × g for 30 minutes at 4°C, and filtered sequentially through 0.45 μm and 0.22 μm membranes. The viral genome copy number of each inoculum was determined by quantitative real-time reverse transcription PCR (RT-qPCR). Negative control inocula were prepared from fecal samples of HEV-negative A. peninsulae, C. rufocanus, and L. brandtii.
Sample collection and processing
Fecal and serum samples were collected weekly and stored at −80°C. Feces were diluted to 10–20% (wt/vol) suspensions in PBS, then centrifuged at 5,000 × g for 20 minutes at 4°C, and the supernatants were collected for HEV RNA testing. Serum was analyzed for ALT, AST, anti-HEV antibodies, and HEV RNA. After euthanasia, placental tissues and fetal liver were collected from the pregnant A. peninsulae; liver tissue samples were collected from naturally delivered fetuses. For the other experimental mice, samples of hepatic portal venous blood along with tissues from the liver, spleen, kidneys, and intestine were collected (for detection of hepatitis E virus RNA).
Detection and quantification of anti-HEV, HEV Antigen and HEV RNA
Anti-HEV antibodies and HEV antigen was detected or quantified using commercial enzyme-linked immunosorbent assay (ELISA) kits (Wantai, Beijing, China) according to the manufacturer’s instructions. A signal-to-cutoff (S/CO) ratio >1.0 was considered positive. Total anti-HEV antibodies levels were quantified as previously described. Total RNA was extracted from 200 μL of serum, 200 μL of fecal suspension, or 100 mg of tissue using TRIzol reagent (Invitrogen, Burlington, ON, Canada) or EasyPure Viral RNA/DNA Kit (TransGen Biotech, Beijing, China). Reverse transcription was performed with the SuperScript IV kit (Invitrogen, Carlsbad, CA, USA), followed by nested PCR targeting the partial ORF2 region on an Applied Biosystems ProFlex PCR System. HEV viral loads were quantified using a one-step RT-qPCR kit (GoTaq Probe One-Step RT-qPCR System, Promega, WI, USA) as described previously [6].
Nested PCR assay
First Round: Use HEV-ORF3-R1 for reverse transcription at 55°C. Then, without opening the tube, add the outer forward primer HEV-ORF1-F1 and a high-fidelity master mix for long-range PCR (35 cycles, with 4–5 min extension at 72°C per cycle).Second Round: Perform nested PCR using a 10–100 × dilution of the first-round product as template, inner primers HEV-ORF1-F2 and HEV-ORF2-R2, and fresh high-fidelity mix (30–35 cycles, 3.5–4 min extension at 72°C per cycle). Finally, through gel electrophoresis, the band containing approximately 7.2 kilobases was extracted, purified and sequenced.
Serum ALT and AST measurement
Serum ALT and AST levels were determined using a Hematology Analyer for Animal Blood (ProCyte Dx) Hitachi 7180 automatic clinical analyzer with standard protocols. Baseline values were defined as pre-inoculation levels; elevations of twofold or greater were considered indicative of hepatic injury.
Histopathology and immunohistochemistry
Collected tissue samples were first fixed in 10% neutral buffered formalin for 72 hours, then rinsed, dehydrated through graded ethanol, cleared in xylene, and embedded in paraffin. Continuous 5-μm sections were cut, mounted, baked, and stored. For histological analysis, sections were dewaxed, rehydrated, and stained with hematoxylin and eosin (H&E) for morphological examination. For specific antigen detection, immunohistochemistry (IHC) was performed: after dewaxing and antigen retrieval, endogenous peroxidase was blocked, followed by overnight incubation at 4°C with a primary monoclonal antibody against Hepatitis E Virus ORF2 protein diluted 1:2000, (1E6, 1:2000, Millipore, Darmstadt, Germany). Subsequently, sections were incubated with an HRP-labeled secondary antibody, developed with DAB under microscopic monitoring, and counterstained with hematoxylin. All stained sections were evaluated independently by at least two pathologists in a double-blind manner using light microscopy. Representative fields were imaged magnification. [30].
Drug administration
Some HEV-infected A. peninsulae in the treatment group received ribavirin (Solarbio, Beijing, China) via oral gavage for 2 weeks. Ribavirin was dissolved in 1 mL of water and administered once daily. The preventive dose was 0.5 mg/day (25 mg/kg/day), and the therapeutic dose was 1 mg/day (50 mg/kg/day).
RNA sequencing (RNA-seq)
Total RNA was extracted from liver tissues using TRIzol Reagent (Magen) as the manufacturer’s protocol. RNA purity was assessed using a Nanodrop ND-2000 (Thermo Scientific, USA), and RNA integrity was measured using an Agilent Bioanalyzer 4150 (Agilent Technologies, CA, USA). Only qualified RNA samples were used for library construction. Libraries were prepared with the abclonal mRNA-seq Lib Prep Kit (Abclonal, China). mRNA was purified with oligo (dT) magnetic beads from 1 μg of total RNA, fragmented, and reverse-transcribed by using random hexamer primers and reverse transcriptase. Second-strand synthesis was performed, followed by adapter ligation and PCR amplification. Libraries were purified with AMPure XP beads and quality-checked using the Agilent Bioanalyzer 4150 system. Sequencing was conducted on an Illumina NovaSeq 6000 (or MGISEQ-T7) platform to generate 150 bp paired-end reads.
Negative-strand HEV RNA detection
Liver tissue samples from orally infected A. peninsulae with HEV were homogenized. Total RNA was extracted using the RNAsimple Total RNA Extraction Kit (TIANGEN, China) and reverse-transcribed into cDNA. Detection was performed using specifically designed primers (F: TCGTGCTACAATTCGCTACCG; R: TAACAAGACCAGAGGTGGCCTC) targeting the negative strand of the viral genome. PCR amplification was carried out using cDNA as the template in a 25 μL reaction system containing 12.5 μL of 2 × Taq PCR Master Mix (Vazyme, China), 1.0 μL each of forward and reverse primers (working concentration: 10 μM), 2 μL of cDNA template, and deionized water to adjust the volume to 25 μL. The amplification protocol consisted of an initial denaturation at 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 30 s, with a final extension at 72°C for 5 min. A 10 μL aliquot of the amplified product was analyzed by 1% agarose gel electrophoresis. Known HEV-infected liver tissue served as the positive control, and deionized water was used as the negative control.
RNA-seq data analysis
Raw reads in FASTQ format were preprocessed using internal Perl scripts to remove adapter sequences and low-quality reads (reads with >60% bases having quality score ≤25 or >5% undefined bases “N”). Clean reads were aligned to the reference genome using HISAT2. Read counts for each gene were obtained using FeatureCounts. Gene expression levels were quantified as fragments per kilobase of exon model per million reads mapped (FPKM). Differential expression analysis was performed using DESeq2, and genes with |log2FC| > 1 and P < 0.05 were considered differentially expressed. GO enrichment was performed using the STRING database and clusterProfiler R package. GO terms with P < 0.05 were considered significantly enriched.
Electron microscopy (EM)
Purified viral particles were applied to 400-mesh Formvar/carbon-coated copper grids and negatively stained with 2% phosphotungstic acid. Grids were then floated on 1% glutaraldehyde in 0.15 M sodium phosphate buffer (pH 7.4) for 1 minute, rinsed with deionized water, and stained with 3% ammonium molybdate (pH 7.0). After air-drying, the grids were examined under a Hitachi H-7650 transmission electron microscope at 80 kV.
Isopycnic gradient ultracentrifugation
Hepatic portal blood from HEV-1–infected A. peninsulae was centrifuged at 1,000 × g for 10 minutes at 4°C to remove debris, then at 10,000 × g for 30 minutes to clarify. The clarified supernatant was ultracentrifuged at 150,000 × g for 2 h at 4°C. The pellet was resuspended in PBS overnight. The suspension was layered on an 8–40% (w/v) iodixanol (OptiPrep, Sigma) step gradient and ultracentrifuged at 37,500 rpm for 18 h in a 55Ti rotor (Beckman Coulter Optima XPN-100, USA) at 4°C. A total of 24 fractions were collected, and density was measured with a refractometer.
Rate-zonal sucrose gradient centrifugation
Hepatic portal blood was applied to a 10–60% continuous sucrose gradient in Hank’s Balanced Salt Solution (Gibco 14025–092, USA) pre-equilibrated at 4°C. Samples were centrifuged at 42,000 rpm (167,000 × g) for 2 h at 4°C in a 55Ti rotor. HEV RNA in gradient fractions was quantified by RT-qPCR.
Phylogenetic tree construction and visualization
The phylogenetic tree was constructed based on the taxonomic hierarchy retrieved from the NCBI Taxonomy database. The process was performed using the “Taxonomy” module on the NCBI website. Target species were searched and added to the analysis list one by one via the “Common Tree” tool by entering their English or Latin scientific names. To preserve complete taxonomic information, the option “include unranked taxa” was selected. The resulting tree file was downloaded in “phylip tree” format. For visualization and refinement, the phylogenetic tree was subsequently imported into the Interactive Tree Of Life (iTOL) online platform.
Statistical analysis and graphing
Statistical analyses and graph generation were conducted using GraphPad Prism 9. The differences in fecal viral shedding between the daily remdesivir-treated group and the control group were assessed using an unpaired two-tailed Student’s t-test. Differences between two groups were assessed using unpaired two-tailed Student’s t-test. Statistical significance was denoted as follows: *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. Data are presented as mean ± SEM, and the number of animals (n) is indicated in each figure legend. All illustrations and graphical elements were created using BioRender.
Significance
It is well-recongnized that hepatitis E virus genotype 1 (HEV-1) infects humans only. This study, however, demonstrates that wild rodents—particularly the Apodemus peninsulae—can be infected with HEV-1, exhibiting viral shedding patterns and immune responses similar to those in human infections. The findings suggest that wild rodents may serve as potential natural reservoirs for HEV-1, providing new insights into cross-species viral transmission. The study also confirms HEV-1 can transmit via fecal-oral route and vertical transmission route in Apodemus peninsulae. These discoveries may reshape our understanding of HEV-1, indicating that wild rodents may play a potential role in outbreaks.
Supporting information
S1 Fig. HEV-3, and HEV-4 infection in Mongolian gerbils.
(A)HEV-3 virus shedding/feces of gerbil. (B) HEV-3 virus shedding/feces of gerbil.
https://doi.org/10.1371/journal.ppat.1014050.s001
(TIF)
S2 Fig. HEV-1infection in wild rodents.
(A-B) HEV RNA levels in spleen, kidney, and intestine at 7 dpi (A) and 35 dpi (B) after HEV-1 inoculation. (C-E) Immunohistochemistry for HEV ORF2 in liver tissues from infected and control animals. A. peninsulae (C), C. rufocanus (D), and L. brandtii (E). Arrows indicate positive staining. (F) HEV-1 virus shedding/feces of A. peninsulae, C. rufocanus, and L. brandtii. The red dots represent A. peninsulae, the green dots represent C. rufocanus, and the yellow dots represent L. brandtii.
https://doi.org/10.1371/journal.ppat.1014050.s002
(TIF)
S3 Fig. The results of HEV RNA load in different tissues after HEV-3 or HEV-4 infections at different time points.
(A) HEV RNA levels in spleen, kidney, and intestine at 7 and 35 dpi after HEV-3 or HEV-4 inoculation.
https://doi.org/10.1371/journal.ppat.1014050.s003
(TIF)
S4 Fig. Analysis of serotype transformation in three wild rodents after HEV-1 infection.
(A–C) Seroconversion to anti-HEV antibodies at 7 and 35 dpi in A. peninsulae (A), C. rufocanus (B), and L. brandtii (C) following HEV-1 inoculation. (D) Anti-HEV antibody testing in all groups inoculated with HEV-3 or HEV-4 at 7 and 35 dpi.
https://doi.org/10.1371/journal.ppat.1014050.s004
(TIF)
S5 Fig. Analysis of the serotype transformation of wild rodents after infection with other genotypes of HEV.
(A) HEV RNA levels in tissues at 14 and 35 dpi following inoculation with HEV-Sar55 in A. peninsulae. (B) Seroconversion to anti-HEV antibodies at 14 and 35 dpi in A. peninsulae inoculated with HEV-Sar55. (C) Rabbit-HEV shedding/feces of A. peninsulae, C. rufocanus, and L. brandtii. (D) HEV-P6 shedding/feces of A. peninsulae.
https://doi.org/10.1371/journal.ppat.1014050.s005
(TIF)
S6 Fig. Serial Passage of HEV-1 in A. peninsulae.
(A–C) Seroconversion to anti-HEV antibodies at baseline and 49 dpi (P1 and P3) or 42 dpi (P2) during fecal viral clearance. (D) Schematic of mutations identified in the HEV-1 genome recovered from P4 feces. Nonsynonymous mutations are marked with red arrows. Abbreviations: Hel, helicase; HVR, hypervariable region; Met, methyltransferase; PCP, papain-like cysteine protease; RdRp, RNA-dependent RNA polymerase.
https://doi.org/10.1371/journal.ppat.1014050.s006
(TIF)
S7 Fig. Host Responses in A. peninsulae Following HEV-1 Infection.
(A) The histopathological scoring results of HE staining in the HEV group and the mock group. (B) Antigen detection results in the blood of A. peninsulae after infection with HEV-1. (C) Antigen detection results in the liver of A. peninsulae after infection with HEV-1. (D–E) Serum ALT (D) and AST (E) levels at indicated time points. Each symbol represents one animal. Data are shown as mean ± SEM. *P < 0.05, **P < 0.01 compared to mock-infected controls. (F–G) Immunoelectron microscopy showing ORF2 antibody binding to HEV particles (overview and magnified view).
https://doi.org/10.1371/journal.ppat.1014050.s007
(TIF)
S8 Fig. Liver transcriptomic analysis.
(A) Heatmap of 452 DEGs identified at 10 dpi. Colors represent fold change in gene expression relative to controls. (B) Predicted transcription factor enrichment analysis.
https://doi.org/10.1371/journal.ppat.1014050.s008
(TIF)
S9 Fig. Antiviral Treatment Influence HEV-1 Infection in A. peninsulae.
(A) Schematic of ribavirin prophylaxis experiment. (B) Fecal HEV RNA levels in ribavirin-pretreated and control groups following HEV-1 infection. Created in BioRender. He, Z. (2026) https://BioRender.com/wt0uu75.
https://doi.org/10.1371/journal.ppat.1014050.s009
(TIF)
S10 Fig. Serological conversion results after oral infection of HEV-1 in A. peninsulae.
(A) Seroconversion to anti-HEV antibodies during the oral inoculation experiment. (B) Negative-strand HEV-1 nucleic acid was detected in the liver tissues of A. peninsulae following oral infection.
https://doi.org/10.1371/journal.ppat.1014050.s010
(TIF)
S11 Fig. Detection of HEV RNA and Viral Antigen in Fetal Liver in a Vertical Transmission Model.
(A) The detection results of HEV RNA in the fetal liver. (B) Immunohistochemistry for HEV ORF2 in fetal liver tissues from infected and control animals. Arrows indicate positive staining.
https://doi.org/10.1371/journal.ppat.1014050.s011
(TIF)
S12 Fig. Phylogenetic Relationships Among 13 Wild Rodent Species.
A phylogenetic tree constructed using genome sequences shows the evolutionary relationships among 13 wild rodent species.
https://doi.org/10.1371/journal.ppat.1014050.s012
(TIF)
Acknowledgments
We thank Prof. Shuguang Duo and Yixi Wang from the Institute of Zoology, Beijing, Chinese Academy of Sciences, for providing the L. brandtii. We thank Prof. Yu Ding from Jilin University for providing the A. peninsulae. We also thank Prof. Zizheng-Zheng from Xiamen University for providing HEV serological testing kits.
References
- 1. Lagare A, Abdoulkader IK, Fall G, Ousmane H, Hounkanrin W, Aoula B, et al. Molecular epidemiology of Hepatitis E virus among humans in the Niger Republic, 2017-2023. J Clin Virol. 2025;176:105761. pmid:39824034
- 2. Purdy MA, Drexler JF, Meng X-J, Norder H, Okamoto H, Van der Poel WHM, et al. ICTV Virus Taxonomy Profile: Hepeviridae 2022. J Gen Virol. 2022;103(9):001778. pmid:36170152
- 3. Terrault NA, Levy MT, Cheung KW, Jourdain G. Viral hepatitis and pregnancy. Nat Rev Gastroenterol Hepatol. 2021;18(2):117–30. pmid:33046891
- 4. Devarbhavi H, Asrani SK, Arab JP, Nartey YA, Pose E, Kamath PS. Global burden of liver disease: 2023 update. J Hepatol. 2023;79(2):516–37. pmid:36990226
- 5. Liu T, He Q, Yang X, Li Y, Yuan D, Lu Q, et al. An Immunocompetent Mongolian Gerbil Model for Hepatitis E Virus Genotype 1 Infection. Gastroenterology. 2024;167(4):750-763.e10. pmid:38582270
- 6. Jo WK, Anzolini Cassiano MH, de Oliveira-Filho EF, Brünink S, Yansanjav A, Yihune M, et al. Ancient evolutionary origins of hepatitis E virus in rodents. Proc Natl Acad Sci U S A. 2024;121(51):e2413665121. pmid:39652753
- 7. Porea D, Raileanu C, Crivei LA, Gotu V, Savuta G, Pavio N. First Detection of Hepatitis E Virus (Rocahepevirus ratti Genotype C1) in Synanthropic Norway Rats (Rattus norvegicus) in Romania. Viruses. 2023;15(6):1337. pmid:37376636
- 8. Li L-L, Ma X-H, Nan X-W, Wang J-L, Zhao J, Sun X-M, et al. Diversity of Hepatitis E Viruses in Rats in Yunnan Province and the Inner Mongolia Autonomous Region of China. Viruses. 2025;17(4):490. pmid:40284933
- 9. Karetnyĭ IV, Dzhumalieva DI, Usmanov RK, Titova IP, Litvak II, Balaian MS. The possible involvement of rodents in the spread of viral hepatitis E. Zh Mikrobiol Epidemiol Immunobiol. 1993;(4):52–6. pmid:8067115
- 10. Bai H, Ami Y, Suzaki Y, Doan YH, Muramatsu M, Li T-C. Open Reading Frame 4 Is Not Essential in the Replication and Infection of Genotype 1 Hepatitis E Virus. Viruses. 2023;15(3):784. pmid:36992492
- 11. Zhang Q, Jin Z, Hu J, Zhang X, He J, Feng Y, et al. Assessment of genetic diversity in Korean field mouse (Apodemus peninsulae): A study based on microsatellite molecular markers. Mol Biol Rep. 2025;52(1):234. pmid:39954141
- 12. Lu T, Zhu M, Yi C, Si C, Yang C, Chen H. Complete mitochondrial genome of the gray red-backed vole (Myodes rufocanus) and a complete estimate of the phylogenetic relationships in Cricetidae. Mitochondrial DNA A DNA Mapp Seq Anal. 2017;28(1):62–4. pmid:26709866
- 13. Zhong Z, Li G, Sanders D, Wang D, Holt RD, Zhang Z. A rodent herbivore reduces its predation risk through ecosystem engineering. Curr Biol. 2022;32(8):1869-1874.e4. pmid:35278348
- 14.
Kinast V, Klohn M, Nocke MK, Todt D, & Steinmann E. Hepatitis E virus species barriers: seeking viral and host determinants. Curr Opin Virol 2022;56:101274.
- 15. Sayed IM, Verhoye L, Cocquerel L, Abravanel F, Foquet L, Montpellier C, et al. Study of hepatitis E virus infection of genotype 1 and 3 in mice with humanised liver. Gut. 2017;66(5):920–9. pmid:27006186
- 16. Tian D, Li W, Heffron CL, Mahsoub HM, Wang B, LeRoith T, et al. Antiviral resistance and barrier integrity at the maternal-fetal interface restrict hepatitis E virus from crossing the placental barrier. Proc Natl Acad Sci U S A. 2025;122(18):e2501128122. pmid:40310464
- 17. Lu T, Zhu M, Yi C, Si C, Yang C, Chen H. Complete mitochondrial genome of the gray red-backed vole (Myodes rufocanus) and a complete estimate of the phylogenetic relationships in Cricetidae. Mitochondrial DNA A DNA Mapp Seq Anal. 2017;28(1):62–4. pmid:26709866
- 18. Jiang J-F, Zhang W-Y, Yao K, Wu X-M, Zuo S-Q, Zhan L, et al. A new Hantaan-like virus in rodents (Apodemus peninsulae) from Northeastern China. Virus Res. 2007;130(1–2):292–5. pmid:17624464
- 19. Lokugamage N, Kariwa H, Lokugamage K, Iwasa MA, Hagiya T, Yoshii K, et al. Epizootiological and epidemiological study of hantavirus infection in Japan. Microbiol Immunol. 2004;48(11):843–51. pmid:15557742
- 20. Li Y, Zhang R, Wang Y, Li P, Li Y, Janssen HLA, et al. Hepatitis E virus infection remodels the mature tRNAome in macrophages to orchestrate NLRP3 inflammasome response. Proc Natl Acad Sci U S A. 2023;120(25):e2304445120. pmid:37307479
- 21. Thakur V, Ratho RK, Singh MP, Chawla Y, Taneja S. NLRP3 Inflammasome Activation is a Prognostic Marker of Recovery in HEV-Infected Patients. Curr Microbiol. 2022;79(2):44. pmid:34982235
- 22. Li Y, Yu P, Kessler AL, Shu J, Liu X, Liang Z, et al. Hepatitis E virus infection activates NOD-like receptor family pyrin domain-containing 3 inflammasome antagonizing interferon response but therapeutically targetable. Hepatology. 2022;75(1):196–212. pmid:34392558
- 23. Gallacher J, Taha Y, da Silva Filipe A, Ijaz S, McPherson S. Ledipasvir/sofosbuvir and ribavirin for the treatment of ribavirin-refractory persistent hepatitis E virus infection. IDCases. 2023;32:e01741. pmid:36942308
- 24. Wang B, Mahsoub HM, Li W, Heffron CL, Tian D, Hassebroek AM, et al. Ribavirin Treatment Failure-Associated Mutation, Y1320H, in the RNA-Dependent RNA Polymerase of Genotype 3 Hepatitis E Virus (HEV) Enhances Virus Replication in a Rabbit HEV Infection Model. mBio. 2023;14(2):e0337222. pmid:36809085
- 25. Gu T, Zheng C-Y, Deng Y-Q, Yang X-F, Bao W-M, Tang Y-M. Systematic Evaluation of Guidelines for the Diagnosis and Treatment of Hepatitis E Virus Infection. J Clin Transl Hepatol. 2024;12(8):739–49. pmid:39130619
- 26. Iqbal H, Mehmood BF, Sohal A, Roytman M. Hepatitis E infection: A review. World J Virol. 2023;12(5):262–71. pmid:38187497
- 27. Geng Y, Shi T, Wang Y. Transmission of Hepatitis E Virus. Adv Exp Med Biol. 2023;1417:73–92. pmid:37223860
- 28. Zhang X, Cremers N, Hendrickx S, Debing Y, Roskams T, Coelmont L, et al. Establishment of a robust rat hepatitis E virus fecal-oral infection model and validation for antiviral studies. Antiviral Res. 2023;216:105670. pmid:37451630
- 29. Sridhar S, Chew NF-S, Situ J, Wu S, Chui ES-H, Lam AH-Y, et al. Risk of Hepatitis E among Persons Who Inject Drugs in Hong Kong: A Qualitative and Quantitative Serological Analysis. Microorganisms. 2020;8(5):675. pmid:32384808
- 30. Allweiss L, Gass S, Giersch K, Groth A, Kah J, Volz T, et al. Human liver chimeric mice as a new model of chronic hepatitis E virus infection and preclinical drug evaluation. J Hepatol. 2016;64(5):1033–40. pmid:26805671