Figures
Abstract
Jumonji domain-containing 1A (JMJD1A, also known as KDM3A) is a histone demethylase that specifically demethylates H3K9me1/2 to enhance gene expression. The roles of JMJD1A in many physiological and pathological processes have been revealed. However, it is unclear whether JMJD1A is involved in host defense against enteric pathogen infection. In this study, we found that enteric infection with C. rodentium induced JMJD1A expression in colonic epithelial cells at the transcriptional level partly mediated by IRF1. After C. rodentium infection, JMJD1A-/- mice exhibited increased mortality, colonic injury, and C. rodentium load and systemic spread, suggesting that JMJD1A protects host against C. rodentium infection by enhancing C. rodentium clearance. JMJD1A-/- mice exhibited an impaired colonic recruitment of macrophages and CD4+ T cells as well as a reduced production of C. rodentium-specific IgG, leading to impaired clearance of C. rodentium. Reduced induction of a chemoattractant CCL8 in the colon of JMJD1A-/- mouse was responsible for reduced recruitment of macrophages and CD4+ T cells to the colon after C. rodentium infection. Mechanistically, JMJD1A cooperated with STAT1 and demethylated H3K9me2 on IRF1 promoter to promote the expression of IRF1, which can enhance CCL8 expression. Furthermore, JMJD1A cooperated with IRF1 and demethylated H3K9me2 on CCL8 promoter to induce CCL8 expression. Collectively, our study suggests that JMJD1A contributes to host defense against enteric bacteria, at least in part, by promoting CCL8 expression to enhance the recruitment of macrophages and CD4+ T cells.
Author summary
Bacterial enteritis is one of the most profound global public health challenges and serves as a significant contributor to child mortality in developing countries. And a mouse model infected with C. rodentium is wildly used to mimic bacterial enteritis in clinical settings. Therefore, an in-depth study of host-pathogen interactions and host defense mechanisms during bacterial enteritis pathogenesis will facilitate the development of preventive and therapeutic strategies against this disease. Here, we found that JMJD1A-/- mice exhibited increased C. rodentium load, mortality, colonic injury, and systemic spread compared to wild-type mice, suggesting the protective role of JMJD1A in host defense against enteric bacteria. Furthermore, IRF1 expression was dramatically increased in the colons, colonic epithelial cells, and CT26 cells, which was required for CCL8 induction for recruitment of macrophages and T cells after C. rodentium infection. Mechanistically, JMJD1A can cooperate with IRF1 to enhance the CCL8 promoter activity, and JMJD1A also cooperated with STAT1 to promote the expression of IRF1. In summary, JMJD1A played protective role to be cooperating with IRF1 and demethylated H3K9me2 on CCL8 promoter to induce CCL8 expression, which increased recruitment of macrophages and CD4+ T cells to the colon after C. rodentium infection. These results can provide new strategy for prevention and therapy of bacterial enteritis.
Citation: Lin G, Yang L, Jiang S, Zhang Y, Luo P, Li W, et al. (2026) Histone demethylase JMJD1A protects mice from enteric bacterial infection by upregulating CCL8 expression to recruit macrophages and CD4+ T cells. PLoS Pathog 22(3): e1014009. https://doi.org/10.1371/journal.ppat.1014009
Editor: George Deepe jr, University of Cincinnati College of Medicine, UNITED STATES OF AMERICA
Received: August 18, 2025; Accepted: February 18, 2026; Published: March 4, 2026
Copyright: © 2026 Lin et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The sequencing raw data in the present study have been deposited in the National Center for Biotechnology Information (NCBI) database, and the project numbers are PRJNA1093258 and PRJNA1094454.
Funding: This work was supported by the National Natural Science Foundation of China (Grant No. 81901597 to W.C., Grant No. 81970485 and 82173086 to C.Y.), the Science and Technology Planning Projects of Xiamen (Grant No. 3502Z20224021 to W.L.), the Natural Science Foundation of Fujian Province (Grant No. 2021J05289 to W.C., Grant No. 2025J01763 to Y.Z.), and the Fujian Provincial Health Technology Project (Grant No. 2024GGA017 to Y.Z.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: I have read the journal’s policy and the authors of this manuscript have the following competing interests: JX is a shareholder of Coactigon, Inc in Houston, TX. Other authors declare no conflicts.
Introduction
Citrobacter rodentium (CR), a natural murine-specific enteric pathogen, is widely used as a model to study the human attaching and effacing pathogens enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC), which can cause infant diarrhea and mortality [1]. The locus of enterocyte effacement (LEE) pathogenicity island, including a filamentous type III secretion system (T3SS), plays a determinable role in the C. rodentium infection strategy [2]. Infection of C57BL/6 mice with C. rodentium manifests as a mild and self-limiting disease, encompassing four main phases [2]: upon infection by oral gavage, some C. rodentium can colonize the caecal lymphoid patch during the establishment phase (from 1 to 3 days post-infection) [3]; C. rodentium starts to scattered colonize the apex of the colonic crypt at 4 days post-infection, followed by proliferation on the colonic mucosa during the expansion phase (from 4 to 8 days post-infection) [4]; C. rodentium is shedding plateau at 108-109 colony forming units (CFU)/g feces during the steady-state phase (from 8 to 12 days post-infection) [5]; shedding C. rodentium starts to be rapidly cleared at the clearance phase (> 12 days post-infection) and cannot be detected in the feces at 18–21 days post-infection [3]. Infected mice exhibit colonic crypt hyperplasia and a drastic inflammatory response. Both the innate immune response and adaptive immune response play critical roles in host defense against C. rodentium. Upon colonization of C. rodentium at the establishment phase, epithelial cells are capable of producing anti-microbial peptides, reactive oxygen species, and serum amyloid to clear the C. rodentium [6–7]. Subsequently, the innate immune responses, mediated by phagocytes including macrophages, inflammatory monocytes, and neutrophils, contribute to host defense against C. rodentium during the expansion phase, and these phagocytes are required for the clearance of C. rodentium [8–10]. The adaptive immune response involves immune cells such as CD4+ T cells and B cells, which produce C. rodentium-specific antibodies during the steady-state phase, playing a crucial role in the host defense against C. rodentium [11]. CD4+ T cell-dependent immunoglobulin G (IgG), rather than IgA and IgM, is required for the clearance of C. rodentium [12–13].
Histone demethylase Jumonji domain-containing 1A (JMJD1A, also known as KDM3A) belongs to a member of the Jumonji C-domain-containing histone demethylase family that can promote target gene expression by removing H3K9me2 and H3K9me1 [14–15]. JMJD1A protein comprises a JmjC domain for catalytic histone demethylase at the C-terminus, LXXLL motifs for interacting with nuclear receptors, and a non-catalytic zinc finger domain for determining substrate specificity [16–17]. The roles of JMJD1A in several physiological and pathological processes, including spermatogenesis [15], sex determination [18], energy metabolism [19], tumorigenesis [20–21], stem cell self-renewal [22], and cardiovascular disease [23–24], have been elucidated; however, its role in C. rodentium-induced colitis remains unclear.
In this study, we revealed the role of JMJD1A in C. rodentium-induced colitis by comparing JMJD1A-/- mice with wild-type (WT) mice after C. rodentium infection. We found that JMJD1A expression in the colon was upregulated in response to C. rodentium infection partly mediated by IRF1; up-regulated JMJD1A promoted mouse survival and limited C. rodentium load and systemic spread; JMJD1A protected mice against C. rodentium infection, at least in part by increasing the recruitment of macrophages and CD4+ T cells to the colon by promoting CCL8 expression.
Results
JMJD1A expression is upregulated in the colon and colonic epithelial cells in response to C. rodentium infection
To investigate the patterns of JMJD1A expression in the colons of WT mice after C. rodentium infection, we collected the colons of WT mice on day 7 after enteric infection with C. rodentium and then performed western blot assays and quantitative RT-PCR assays. As shown in Fig 1A and 1B, the protein and mRNA levels of JMJD1A were significantly increased in the colons of mice on day 7 after C. rodentium infection. JMJD1A immunohistochemistry (IHC) staining showed that JMJD1A expression was mainly detected in the colonic epithelial cells on day 7 after C. rodentium infection, suggesting that C. rodentium infection can induce JMJD1A expression in the colonic epithelial cells (Fig 1C). Consistently, western blot and quantitative RT-PCR analysis showed that the protein and mRNA expression of JMJD1A was significantly upregulated in the colonic epithelial cells of mice on days 7 and 10 after C. rodentium infection (Fig 1D and 1E). Furthermore, heat-killed C. rodentium (HKCR) induced JMJD1A protein and mRNA expression in CT26 cells (Fig 1F and 1G). To determine the mechanism of JMJD1A upregulation in the colonic epithelial cells, we analyzed the binding sites of the transcription factors on the JMJD1A promoter as well as the RNA-sequencing data of the colons of mice on day 7 after C. rodentium infection to predict potential transcription factors regulating JMJD1A expression. To determine which transcription factor can regulate the expression of JMJD1A, we screened the sequence of mouse JMJD1A promoter in Jaspar databases to search for the potential transcription factor binding sites. 114 potential transcription factors were obtained. Then, we searched the expression model of these 114 potential transcription factors in RNA-sequencing data of the colons of mice on days 7 and 0. Hence, we found some significantly upregulated transcription factors such as Rel and IRF1, and other significantly downregulated transcription factors such as Jun and Fosl2 in the colons of mice on day 7 after C. rodentium infection (Fig 1H). Nineteen transcription factors that showed significant changes between the day 7 and day 0 was provided in supplementary information and listed in excel (S1 Data, Excel file). Consistently, mRNA and western blot analysis showed that the expression of IRF1 was significantly increased in the colons after C. rodentium infection (Fig 1I). Knockdown of IRF1 in CT26 cells reduced the protein and mRNA levels of JMJD1A after C. rodentium infection (Fig 1J), suggesting that IRF1 can regulate JMJD1A expression. An IRF1 binding site was found between -1391 bp and -992 bp on the JMJD1A promoter, implicating that IRF1 may regulate JMJD1A expression at the transcriptional level. To test it, we performed JMJD1A promoter-reporter (p (-1984/-88)) assays and found that IRF1 could increase JMJD1A promoter reporter activity in a dose dependent manner (Fig 1K and 1L). However, IRF1 could not increase the reporter activity of a truncated JMJD1A promoter-reporter (p (-992/-88)) with IRF1 binding site absence (Fig 1L). These results supported the notion that IRF1 regulates JMJD1A expression at the transcriptional level. In addition, we found c-Rel binding site (TAGAATTTCC, -557 ~ -566) on the JMJD1A promoter, implicating that c-Rel may bind to this site to induce the expression of JMJD1A. However, the results of JMJD1A promoter-reporter (p (-1984/-88)) assays showed that c-Rel could not enhance JMJD1A promoter activity in CT26 cells (S1 Fig), excluding the c-Rel-mediated regulation of JMJD1A. To determine whether IRF1 could be recruited to the IRF1 binding site on the JMJD1A promoter after HKCR treatment, ChIP assays were performed and the results showed that IRF1 could be recruited to the IRF1 binding site on the JMJD1A promoter (Fig 1M). Taken together, these results demonstrated that JMJD1A expression was significantly increased in the colon, at least in part mediated by IRF1 after C. rodentium infection, implicating that JMJD1A may play a role in host defense against C. rodentium infection.
(A) The protein level of JMJD1A was significantly increased in the colons of mice on day 7. The protein level was measured in the colons of mice on day 7 and day 0 after C. rodentium infection. Densitometric analysis of JMJD1A were performed. (B) The mRNA level of JMJD1A was significantly increased in the colons of mice. The mRNA level was measured in the colons of mice on day 7 and day 0 after C. rodentium infection. (C) Anti-JMJD1A immunohistochemistry staining showed that JMJD1A expression was mainly detected in the colons of WT and JMJD1A-/- mice on day 7 after C. rodentium infection. Anti-JMJD1A immunohistochemistry staining in the colons of mice on day 7 and day 0. Scale bars represent 50 μm. The black arrow represents JMJD1A-positive cells. (D) The protein level of JMJD1A was significantly upregulated in the colonic epithelial cells of WT mice on days 7 and 10 compared with day 0 after C. rodentium infection. (E) The mRNA level of JMJD1A was significantly upregulated in the colonic epithelial cells of WT mice on days 7 and 10 after C. rodentium infection. (F) The mRNA level of JMJD1A was significantly upregulated in CT26 cells treated with HKCR (MOI = 200) for 30 min and 60 min. (G) The protein level of JMJD1A was significantly upregulated in CT26 cells treated with HKCR (MOI = 200) for 30 min and 60 min. Densitometric analysis of JMJD1A were performed. (H) Prediction of JMJD1A promoter-binding transcription factors by JASPAR and heatmap of DEG in the colons of WT mice infected with C. rodentium for 7 days relative to control group (for 0 day) from the RNA-seq database. (I) The levels of mRNA and protein of IRF1 were significantly increased in the colons of mice after C. rodentium infection. (J) Knockdown of IRF1 in CT26 cells reduced the mRNA and protein levels of JMJD1A after C. rodentium infection. n = 4. Densitometric analysis of JMJD1A were performed. (K) IRF1 could increase JMJD1A promoter reporter activity in a dose dependent manner in CT26 cells. CT26 cells were co-transfected with Renilla plasmids, murine JMJD1A promoter, and IRF1 expression plasmids using Lipofectamine 2000. The luciferase and Renilla values were measured at 24 h after co-transfection. (L) IRF1 could not increase the reporter activity of a truncated JMJD1A promoter-reporter (p (-992/-88)) with IRF1 binding site absence. (M) IRF1 could be recruited to the IRF1 binding site on the JMJD1A promoter. Data are mean ± SEM. Results are representative of three independent experiments. P values were assessed with the two-tailed Student’s t-test, or one-way ANOVA test. *P < 0.05; **P < 0.01; ***P < 0.001.
JMJD1A-/- mice exhibit increased mortality, worsened colonic histopathology, and enhanced proinflammatory cytokine production after C. rodentium infection
To determine the role of JMJD1A in host defense against C. rodentium infection, we infected WT and JMJD1A-/- mice with C. rodentium orally and monitored the body weight change and the survival of mice. C. rodentium infection led to more body weight loss in JMJD1A-/- mice compared with WT mice at day 10 post-infection (Fig 2A). Strikingly, all JMJD1A-/- mice succumbed to C. rodentium infection whereas all WT mice survived (Fig 2B). Increased mortality of JMJD1A-/- mice infected with C. rodentium may be associated with more severe colonic injury and colonic inflammation. Indeed, a shorter colon length, which is one of the inflammatory features, was observed in infected JMJD1A-/- mice compared with WT mice on day 12 after C. rodentium infection (Fig 2C). C. rodentium infection-induced colonic injury and colonic inflammation are characterized by epithelial integrity impairment, inflammatory cell infiltration, and submucosal oedema [25]. Therefore, we performed H&E staining to assess C. rodentium-induced colonic injury. H&E staining showed that worsened histopathology was observed in the colons of JMJD1A-/- mice (Fig 2D). To determine whether the colonic inflammation is aggravated in JMJD1A-/- mice during C. rodentium infection, we measured the levels of proinflammatory cytokines in the colon culture supernatant of WT mice and JMJD1A-/- mice by ELISA. Although the concentrations of TNFα and IL-1β were comparable in the colons of WT mice and JMJD1A-/- mice, the concentration of IL-6 in the colons of JMJD1A-/- mice was lower compared with WT mice on day 7 after infection (Fig 2E). The concentrations of TNFα, IL-1β, and IL-6 in the colons of JMJD1A-/- mice were significantly higher compared with WT mice on day 12 after infection (Fig 2E). Collectively, these results suggest that JMJD1A can protect mice from C. rodentium-induced colonic injury and colonic inflammation.
(A) Body weight loss was greater in JMJD1A-/- mice (n = 11) compared with WT mice (n = 12) on day 14 after C. rodentium infection. (B) Survival kinetics of C. rodentium-infected mice revealed significantly higher mortality in JMJD1A-/- mice (n = 8) compared to WT (n = 8). (C) Colon length of JMJD1A-/- mice was shorter than WT mice on day 12 after C. rodentium infection. n = 4-8. (D) H&E staining of colon sections exhibited more severe histopathological damage in JMJD1A-/- mice compared with WT mice on days 7 and 12 after C. rodentium infection. n = 4-10. Representative pictures of H&E staining of the colon sections (Left panel); Quantification of histopathology scores (Right panel). Scale bars represent 100 μm. (E) The concentrations of TNFα, IL-1β, and IL-6 were significantly higher in the colons of JMJD1A-/- mice compared with WT mice on day 12 after C. rodentium infection as measured by ELISA. n = 6-10. The data were pooled from three independent experiments. Data are mean ± SEM. The survival curve was assessed with the log-rank test; the other data were assessed with the two-tailed Student’s t-test or nonparametric tests. *P < 0.05; **P < 0.01; ***P < 0.001.
JMJD1A-/- mice exhibit impaired clearance of C. rodentium
Increased mortality and worsened colonic histopathology of JMJD1A-/- mice infected with C. rodentium may be caused by impaired clearance of C. rodentium. As shown in Fig 3A-3C, JMJD1A-/- mice exhibited more C. rodentium load compared with WT mice in the feces, colons, and caecum with feces on days 7 and 12 after C. rodentium infection. Furthermore, JMJD1A-/- mice exhibited more severe systemic spreading of C. rodentium to spleens, livers, and lungs compared with WT mice on days 7 and 12 after C. rodentium infection (Fig 3D-3F). Immunohistochemical staining of C. rodentium in the colons of WT mice and JMJD1A-/- mice showed that JMJD1A-/- mice had more invaded crypts and C. rodentium loads compared with WT mice on days 7 and 12 after C. rodentium infection (Fig 3G). Taken together, these results suggest that JMJD1A protects mouse from C. rodentium infection by enhancing clearance of C. rodentium and limiting the systemic spreading of C. rodentium.
(A-F) JMJD1A-/- mice exhibited more C. rodentium load compared with WT mice in feces (A), colons (B), caecum + feces (C), spleen (D), liver (E), and lung (F) after oral administration of C. rodentium for 7 days and 12 days. (G) Anti-C. rodentium immunohistochemistry staining showed that the colon sections of JMJD1A-/- mice had more invaded crypts and C. rodentium loads compared with WT mice on days 7 and 12 after C. rodentium infection. n = 4-7. The black arrow indicates the crypt tissue invaded by C. rodentium with brown signals. Representative pictures of anti-C. rodentium immunohistochemistry staining of the colon sections (Left panel); Quantification of crypt invasion by C. rodentium in JMJD1A-/- mice and WT mice (Right panel). Scale bars represent 100 μm. (H) The protein levels of JMJD1A in the colons and colonic epithelial cells of WT mice infected with AAV9-shJMJD1A were significantly decreased compared with AAV9-shCtrl for 4 weeks. Densitometric analysis of JMJD1A were performed. (I) H&E staining of colon sections from WT mice infected with AAV9-shJMJD1A showed a severe colonic histopathology than in AAV9-shCtrl group after C. rodentium infection. Representative pictures of H&E staining of the colon sections (Left panel); Quantification of histopathology scores (Right panel). Scale bars represent 100 μm. n = 6. (J) Mice infected with AAV9-shJMJD1A exhibited more C. rodentium load compared with mice infected with AAV9-shCtrl in the colons on day 14 after C. rodentium infection. n = 11. (K) Anti-C. rodentium immunohistochemistry staining of the colon sections of WT mice infected with AAV9-shJMJD1A or AAV9-shCtrl after C. rodentium infection revealed that JMJD1A-knockdown mice had more invaded crypts and C. rodentium loads compared with control mice. Brown signals represent C. rodentium. Representative pictures of anti-C. rodentium immunohistochemistry staining of the colon sections (Left panel); Quantification of crypt invasion by C. rodentium in WT mice infected with AAV9-shJMJD1A or AAV9-shCtrl (Right panel). Scale bars represent 100 μm. n = 6. The data were pooled from three independent experiments. Data are mean ± SEM. P values were assessed with the two-tailed Student’s t-test or nonparametric tests. *P < 0.05; **P < 0.01; ***P < 0.001.
Previous study has demonstrated that adeno-associated virus (AAV) pseudotype 9 could be used for transduction of the epithelium in the colon, which is ideal for studying mucosal inflammation in the experimental colitis [26]. Since JMJD1A was mainly expressed in the colonic epithelial cell after C. rodentium infection (Fig 1C), we wondered whether JMJD1A in colonic epithelial cell is responsible for the clearance of C. rodentium. We knocked down JMJD1A in the colonic epithelial cells in vivo by infecting WT mice with AAV9 carrying JMJD1A short hairpin RNA (AAV9-shJMJD1A) or negative control short hairpin RNA (AAV9-shCtrl) via portal vein injection, and then orally administered C. rodentium to these mice four weeks later. To address the specificity of our AAV-mediated JMJD1A knockdown in vivo, we performed a series of cellular and molecular analyses. First, immunohistochemical staining confirmed that AAV9-shJMJD1A treatment significantly reduced JMJD1A protein levels within the colonic epithelial compartment, while expression in the lamina propria stromal cells remained comparable to the control group (S2 Fig). To further validate this specificity and examine potential off-target effects on some crucial immune cells, we isolated colonic epithelial cells, macrophages (isolated using anti-mouse CD11b MicroBeads), and CD4+ T cells (anti-mouse CD4 MicroBeads) from the colons of the infected mice treated with AAV9-shCtrl and AAV9-shJMJD1A. Consistent with the IHC results, qPCR results revealed a significant reduction of JMJD1A mRNA exclusively in the epithelial cells of AAV9-shJMJD1A-treated mice. In contrast, JMJD1A expression in sorted macrophages and CD4+ T cells, as well as in the unlabeled cells, was not significantly changed (S3A Fig). We further assessed the cytokines produced by CD4+ T cells isolated from AAV9-shCtrl mice and AAV9-shJMJD1A mice on day 14 after infection. qPCR analysis in these sorted CD+ T cells showed comparable levels of IFNγ, IL-10, and IL-17A between AAV9-shCtrl group and AAV9-shJMJD1A group (S3B Fig). As shown in Fig 3H, western blot results showed that JMJD1A expression was significantly decreased in the colons and colonic epithelial cells of mice infected with AAV9-shJMJD1A. C. rodentium infection led to more body weight loss in AAV9-shJMJD1A mice compared with AAV9-shCtrl mice at day 14 post-infection (S4A Fig). However, all AAV9-shCtrl and AAV9-shJMJD1A mice survived after C. rodentium infection (S4B Fig), which differed from the lethal phenotype observed in JMJD1A-/- mice (Fig 2B). The different causes for this result might be that AAV9-shJMJD1A could not fully get rid of JMJD1A in IECs of AAV9-shJMJD1A mice, or the AAV9-shJMJD1A mice mainly affected IECs, while JMJD1A-/- mice had a much broader range of affected cells. H&E staining showed a severe colonic histopathology in AAV9-shJMJD1A group compared with AAV9-shCtrl group after C. rodentium infection (Fig 3I). Furthermore, mice infected with AAV9-shJMJD1A exhibited more C. rodentium load compared with mice infected with AAV9-shCtrl in the colons on day 14 after C. rodentium infection (Fig 3J). Consistent with these results, immunohistochemical staining of C. rodentium in the colons of mice infected with AAV9-shJMJD1A or AAV9-shCtrl showed that JMJD1A-knockdown mice had more invaded crypts and C. rodentium loads compared with control mice on day 14 after C. rodentium infection (Fig 3K). These results suggest that JMJD1A expressed in the colonic epithelial cell promotes the clearance of C. rodentium.
The expression of antimicrobial peptide (AMPs) in the colons of WT and JMJD1A-/- mice is comparable with or without C. rodentium infection
One of the important functions of colonic epithelial cell is to produce AMPs to control bacterial infection. Since JMJD1A expressed in the colonic epithelial cell promoted the clearance of C. rodentium, we wondered whether JMJD1A regulates the expression of colonic AMPs to clear C. rodentium. However, there was no difference observed in the mRNA levels of AMPs in the colons between WT and JMJD1A-/- mice with or without C. rodentium infection (S5 Fig), suggesting that JMJD1A-mediated protection against C. rodentium is not through regulation of AMPs.
JMJD1A-/- mice exhibit impaired recruitment of macrophages and CD4+ T cells and reduced production of C. rodentium-specific antibodies after C. rodentium infection
The other important function of colonic epithelial cells is to produce chemoattractants to recruit immune cells. Many immune cell types, including macrophages, CD4+ T cells, and neutrophils, play critical roles in C. rodentium clearance [11,27,28]. We therefore performed F4/80 IHC staining for macrophages, CD4 IHC staining for CD4+ T cells, and MPO IHC staining for neutrophils in the colons of WT mice and JMJD1A-/- mice after C. rodentium infection. Without C. rodentium infection, the number of macrophages and CD4+ T cells was comparable in the colons of WT mice and JMJD1A-/- mice (Fig 4A and 4B). However, on days 7 and 12 after C. rodentium infection, more macrophages and CD4+ T cells were observed in the colons of WT mice compared with JMJD1A-/- mice (Fig 4A and 4B). The number of neutrophils was comparable in the colons of WT and JMJD1A-/- mice after C. rodentium infection (S6 Fig). Additionally, the numbers of CD20-positive cells were significantly decreased in the colons of JMJD1A-/-mice compared to WT mice after C. rodentium infection on day 12 (S7 Fig). Previous studies have shown that CD4+ T cell-dependent IgG response is required for the clearance of C. rodentium [11], but IgA and IgM are dispensable [13]. Especially, luminal IgG is essential for eradicating C. rodentium and promoting the host survival [10]. Therefore, we assessed C. rodentium-specific IgG and IgA in the luminal content of WT mice and JMJD1A-/- mice after C. rodentium infection. As shown in Fig 4C, the titers of IgG and IgA in the luminal contents of JMJD1A-/- mice were reduced compared to WT mice on day 12 after C. rodentium infection. These results demonstrated that the recruitment of macrophages and CD4+ T cells, as well as CD4+ T cell-dependent antibody responses were impaired in the colons of JMJD1A-/- mice after C. rodentium infection, leading to impaired clearance of C. rodentium. Similar to JMJD1A-/- mice, less macrophages and CD4+ T cells were recruited into the colons of the AAV9-shJMJD1A-infected mice compared with the AAV9-shCtrl-infected mice after C. rodentium infection (Fig 4D and 4E), and the C. rodentium-specific IgG and IgA in the luminal content of mice infected with AAV-shJMJD1A were less than those of mice infected with AAV-shCtrl on day 14 after C. rodentium infection (Fig 4F). Taken together, these results suggest that JMJD1A in the colonic epithelial cell plays a critical role in host defense against C. rodentium infection by promoting the recruitment of macrophages and CD4+ T cells to clear C. rodentium.
(A) Anti-F4/80 immunohistochemistry staining showed that more macrophages were observed in the colons of WT mice compared with JMJD1A-/- mice on days 7 and 12 after C. rodentium infection. n = 3-5. Representative pictures of anti-F4/80 immunohistochemistry staining of the colon sections (Left panel); Quantification of F4/80+ cells (Right panel). Arrows represent F4/80-positive cells. Scale bars represent 100 μm. (B) Anti-CD4 immunohistochemistry staining showed that more CD4+ T cells were detected in the colons of WT mice compared with JMJD1A-/- mice on days 7 and 12 after C. rodentium infection. n = 3-5. Representative pictures of anti-CD4 immunohistochemistry staining of the colon sections (Left panel); Quantification of CD4+ T cells (Right panel). Arrows represent CD4-positive cells. Scale bars represent 50 μm. (C) The contents of IgG and IgA in the luminal contents of JMJD1A-/- mice were reduced compared to WT mice on day 12 after C. rodentium infection. n = 3-8. (D) Anti-F4/80 immunohistochemistry staining showed that less macrophages were recruited into the colons of the AAV9-shJMJD1A-infected mice compared with the AAV9-shCtrl-infected mice after C. rodentium infection. Representative pictures of anti-F4/80 immunohistochemistry staining of the colon sections (Left panel); Quantification of F4/80+ cells (Right panel). Arrows represent positive cells. Scale bars represent 100 μm. n = 3-5. (E) Anti-CD4 immunohistochemistry staining showed that less CD4+ T cells were recruited into the colons of the AAV9-shJMJD1A-infected mice compared with the AAV9-shCtrl-infected mice after C. rodentium infection. Representative pictures of anti-CD4 immunohistochemistry staining of the colon sections (Left panel); Quantification of CD4+ T cells (Right panel). Scale bars represent 50 μm. n = 3-5. (F) Production of total IgG and IgA against C. rodentium were decreased in the luminal content of AAV9-shJMJD1A infected mice compared with AAV9- shCtrl infected mice on day 14. n = 6-8. Data are mean ± SEM. The data were pooled from three independent experiments. P values were assessed with the two-tailed Student’s t-test or nonparametric tests, or two-way ANOVA test. *P < 0.05; **P < 0.01; ***P < 0.001.
JMJD1A-/- mice exhibit reduced CCL8 induction, which is responsible for reduced recruitment of macrophages and CD4+ T cells to the colons after C. rodentium infection
Since chemokines play important roles in the recruitment of many immune cell types, including macrophages and CD4+ T cells, we hypothesized that the difference in the recruitment of macrophages and CD4+ T cells in the colons of infected WT and JMJD1A-/- mice may be due to the difference in the expression of chemoattractants. Therefore, we detected the expression of chemoattractants in the colons of WT mice and JMJD1A-/- mice by RNA-sequencing on day 7 after C. rodentium infection. RNA-sequencing analysis showed that the macrophage chemoattractants CCL3 and CCL4, the neutrophil chemoattractants CXCL5, and the macrophage and CD4+ T cell chemoattractants CXCL9 and CCL8 were significantly decreased in the colons of JMJD1A-/- mice on day 7 after C. rodentium infection (Fig 5A). However, the quantitative RT-PCR results showed that only CCL8 was significantly reduced in the colons of JMJD1A-/- mice after C. rodentium infection (Fig 5B). The expression pattern of colonic CCL8 protein was in accord with the expression pattern of CCL8 mRNA (Fig 5C). Furthermore, the expression of CCL8 in the colonic epithelial cells of JMJD1A-/- mice was markedly decreased compared to WT mice on day 7 after C. rodentium infection (Fig 5D). These results suggest that reduced induction of CCL8 may lead to reduced recruitment of macrophages and CD4+ T cells in the colons of JMJD1A-/- mice.
(A) RNA-sequencing was performed in the colons of JMJD1A-/- and WT mice infected with C. rodentium for 0 and 7 days. Selected genes involved in chemokines and proinflammatory cytokines have shown as a heat map from the RNA-seq database: differentially expressed genes (DEGs) were highlighted with “*”; for visualization, value of the Log2(FPKM+0.1) are represented as row Z-scores. Red indicated high expression, and the blue indicated low expression relative to the gene mean. Each sample is pooled from 3 mice. (B) CCL8 was significantly reduced in the colons of JMJD1A-/- mice compared with WT mice on days 7 and 12 after C. rodentium infection. n = 3-7. (C) The concentration of CCL8 was decreased in the colon cultured supernatants of JMJD1A-/- mice compared with WT mice as measured by ELISA on days 7 and 12 after C. rodentium infection. n = 3-5. (D) The expression of CCL8 in the colonic epithelial cells was reduced in the JMJD1A-/- mice compared to WT mice on day 7 after C. rodentium infection. n = 3. (E) The concentration of CCL8 in the colon cultured supernatants was increased in AAV9-mCCL8 infected mice compared to AAV9-flag infected mice. n = 3. (F) H&E staining of colon sections showed that AAV9-mCCL8 infected mice suffered from less severe pathology compared to AAV9-flag infected mice after C. rodentium infection for 14 days. Representative pictures of H&E staining of the colon sections (Left panel); Quantification of histopathology scores (Right panel). Scale bars represent 100 μm. n = 3-5. (G) C. rodentium loads in the colons of AAV9-mCCL8 infected mice (n = 10) was significantly lower than in those AAV9-flag (n = 8) after oral administration of C. rodentium for 14 days. (H) Anti-C. rodentium immunohistochemistry staining showed that CCL8-overexpressed mice had less invaded crypts and C. rodentium loads compared with control mice on day 14 after C. rodentium infection. Brown signals represent C. rodentium. Representative pictures of anti-C. rodentium immunohistochemistry staining of the colon sections (Upper panel); Quantification of crypt invasion by C. rodentium in WT mice infected with AAV9-mCCL8 or AAV9-flag (Lower panel). Scale bars represent 100 μm. n = 5. (I) Anti-F4/80 immunohistochemistry staining revealed more macrophages infiltration in the colons of AAV9-mCCL8 infected mice compared to AAV9-flag group with C. rodentium infection for 14 days. Representative pictures of anti-F4/80 immunohistochemistry staining of the colon sections (Left panel); Quantification of F4/80+ cells (right panel). Scale bars represent 100 μm. n = 3-5. (J) Anti-CD4 immunohistochemistry staining showed the enhanced CD4+ T cells accumulation in the colons of WT mice infected with AAV9-mCCL8 compared to AAV9-flag group with C. rodentium infection for 14 days. Representative pictures of anti-CD4 immunohistochemistry staining of the colon sections (Left panel); Quantification of CD4+ T cells (Right panel). Scale bars represent 50 μm. n = 3-5. (K) Production of IgG and IgA against C. rodentium were increased in the luminal content of AAV-mCCL8-infected mice compared to AAV-Flag-infected mice on day 14 after C. rodentium infection. Data are mean ± SEM. The data were pooled from three independent experiments. P values were assessed with the two-tailed Student’s t-test or nonparametric tests, or two-way ANOVA test. *P < 0.05; **P < 0.01.
Additionally, we also attempt to explore other pathways that may operate downstream of JMJD1A. As shown in Fig 5A, JMJD1A-/- mice exhibited lower colonic IFNγ mRNA levels. We quantified IFNγ protein levels by ELISA (S8C Fig) and assessed STAT1 phosphorylation by western blot in colonic tissues from WT and JMJD1A-/- mice uninfected and infected with C. rodentium for 7 days. Correspondingly, the protein levels of STAT1 phosphorylation in colons of JMJD1A-/- mice were lower than that of the WT mice (S8B Fig). These results suggest that IFNγ-STAT1-IRF1 axis could be a second crucial arm of the JMJD1A-mediated host defense against enteric infection.
To verify the role of CCL8 in host defense against C. rodentium in vivo, WT mice were infected with AAV9-mCCL8 or control AAV9 (AAV9-flag) via portal vein injection before C. rodentium infection, and then C. rodentium was orally administered to these mice infected with AAV9-mCCL8 or AAV9-flag four weeks later. As shown in Figs 5E and S9, mouse CCL8 expression was significantly increased in the colons of mice infected with AAV9-mCCL8. H&E staining exhibited an alleviative colonic histopathology in the AAV9-mCCL8 group compared with the AAV9-flag group after C. rodentium infection (Fig 5F). Furthermore, the number of C. rodentium in the colons of mice infected with AAV9-mCCL8 was less than those of mice infected with AAV9-flag on day 14 after C. rodentium infection (Fig 5G). Consistent with these results, immunohistochemical staining of C. rodentium in the colons of mice infected with AAV9-mCCL8 or AAV9-flag showed that CCL8-overexpressing mice had fewer invaded crypts and C. rodentium loads compared with control mice on day 14 after C. rodentium infection (Fig 5H). Additionally, more macrophages and CD4+ T cells were recruited to the colons of the AAV9-mCCL8 group compared with the AAV9-flag group after C. rodentium infection (Fig 5I and 5J). The C. rodentium-specific IgG and IgA in the luminal content of mice infected with AAV9-mCCL8 were more than those of mice infected with AAV-flag on day 14 after C. rodentium infection (Fig 5K). Taken together, these results suggest that CCL8 in the colonic epithelial cell is responsible for the host defense against C. rodentium infection by recruiting CD4+ T cells and macrophages to the colons.
CCL8 restore rescues JMJD1A-knockdown-caused susceptibility to C. rodentium infection
To determine whether CCL8 is a key downstream effector mediating JMJD1A’s protective role, we performed a functional rescue experiment by restoring CCL8 expression in JMJD1A-knockdown (AAV9-shJMJD1A) mice via co-infection of AAV9-mCCL8. The protein level of JMJD1A was significantly decreased in the colonic epithelial cells of both AAV9-shJMJD1A-flag mice and AAV9-shJMJD1A-mCCL8 mice on day 14 after C. rodentium infection (S10A Fig), indicating that co-infection of AAV9-mCCL8 did not affect the knockdown efficiency of JMJD1A by AAV9-shJMJD1A. Then, we examined the efficacy and specificity of CCL8 overexpression after co-infection of AAV9-mCCL8. JMJD1A knockdown in AAV9-shJMJD1A-flag mice markedly reduced CCL8 mRNA expression in the colonic epithelial cells on day 14 after infection, which was rescued by co-infection of AAV9-mCCL8 (S10B Fig), but CCL8 mRNA expression was comparable in the macrophages, CD4+ T cells, and unlabeled cells from the colons of AAV9-shJMJD1A-CCL8 mice and AAV9-shJMJD1A-flag mice on day 14 after infection (S10C Fig), indicating that CCL8 expression was specifically rescued in the epithelial compartment of the rescue group. Consistently, the protein level of CCL8 was significantly decreased in the colon cultured supernatants of JMJD1A-knockdown mice on day 14 after C. rodentium infection, but rescued by co-infection of AAV9-mCCL8 (S10D Fig).
Critically, CCL8 rescue by co-infection of AAV9-mCCL8 markedly reversed the susceptibility to C. rodentium infection caused by JMJD1A knockdown. Compared to AAV9-shJMJD1A-flag mice, AAV9-shJMJD1A-CCL8 mice exhibited a marked decrease in colonic C. rodentium burden (S11A Fig), significantly attenuated pathology (S11B Fig), and diminished bacterial crypt invasion (S11C Fig). Additionally, compared to AAV9-shJMJD1A-flag mice, IHC analysis showed increased infiltration of macrophages (S11D Fig) and CD4+ T cells (S11E Fig) in the colons of AAV9-shJMJD1A-CCL8 mice on day 14 after C. rodentium infection. Compared to AAV9-shJMJD1A-flag mice, AAV9-shJMJD1A-CCL8 displayed restored levels of C. rodentium-specific fecal IgG and IgA on day 14 after C. rodentium infection (S11F Fig). These results demonstrate that CCL8 restore is sufficient to rescue the host defense defect caused by JMJD1A knockdown.
JMJD1A cooperates with STAT1 to promote IRF1 expression which further enhances CCL8 expression
As C. rodentium-induced CCL8 expression was reduced in colonic epithelial cells of JMJD1A-/- mice, we hypothesized that CCL8 may be regulated by JMJD1A directly in colonic epithelial cells after C. rodentium infection. To test it, we transfected JMJD1A-specific small interfering RNA to knock down JMJD1A in CT26 cells and then assessed the effects of JMJD1A knockdown on CCL8 expression after HKCR treatment. As shown in Fig 6A, HKCR treatment increased CCL8 expression in control CT26 cells, whereas the induction of CCL8 expression was markedly impaired in JMJD1A-knockdown CT26 cells, supporting the hypothesis that JMJD1A promotes CCL8 expression in the colonic epithelial cells.
(A) The mRNA level of CCL8 was decreased in JMJD1A knock-down CT26 cells with heat-killed C. rodentium treatment. (B) The mRNA level of CCL8 was decreased in the IRF1 knock-down CT26 cells with heat-killed C. rodentium treatment. (C) The mRNA level of IRF1 was decreased in the JMJD1A knock-down CT26 cells with C. rodentium treatment. (D) The protein levels of JMJD1A and IRF1 were decreased in JMJD1A knock-down CT26 cells by western blot with heat-killed C. rodentium (MOI = 200) treatment. (E) The protein level of JMJD1A and IRF1 were decreased in colons of WT and JMJD1A-/- mice by western blot after C. rodentium infection. (F) KEGG pathway analysis showed that Jak-STAT signaling pathway was enriched. (G) The protein levels of p-STAT1 and STAT1 were increased in the colons of mice after C. rodentium infection. (H) JMJD1A could cooperate with STAT1 to enhance IRF1 promoter activity in CT26 cells. CT26 cells were co-transfected with Renilla plasmids, murine IRF1 promoter, JMJD1A expression plasmids and STAT1 expression plasmids using Lipofectamine 2000. The luciferase and Renilla values were measured at 24 h after co-transfection. n = 3. (I) The endogenous JMJD1A and STAT1 in CT26 cells could be detected by co-immunoprecipitation using STAT1 and JMJD1A antibodies, respectively. (J) STAT1 bound to the IRF1 promoter without HKCR treatment, and the binding was increased after HKCR treatment. The affinity of STAT1 on the IRF1 promoter in CT26 cells via ChIP assay using STAT1 antibodies or IgG antibodies. (K) JMJD1A bound to the IRF1 promoter without HKCR treatment, and the binding was increased after HKCR treatment. The affinity of JMJD1A on the IRF1 promoter in CT26 cells was measured via ChIP assay using JMJD1A antibodies or IgG antibodies. (L) The binding of H3K9me2 was decreased after HKCR treatment. The affinity of H3K9me2 on the IRF1 promoter in CT26 cells was measured via ChIP assay using H3K9me2 antibodies or IgG antibodies. Data are mean ± SEM. Results are representative of three independent experiments. P values were assessed with the two-tailed Student’s t-test or nonparametric tests, or one-way ANOVA test. *P < 0.05; **P < 0.01.
To determine which transcription factor can regulate the expression of CCL8, we screened the sequence of mouse CCL8 promoter in Jaspar databases to search for the potential transcription factor binding sites. We found IRF1 binding site (AGAAAAAGGAA, -519 ~ -509) on the CCL8 promoter, implicating that IRF1 may bind to this site to induce the expression of CCL8. Indeed, knockdown of IRF1 significantly reduced CCL8 expression (Fig 6B). To determine whether JMJD1A knockdown reduces CCL8 expression by decreasing IRF1 expression, we examined the effect of JMJD1A knockdown on IRF1 expression. As shown in Fig 6C and 6D, knockdown of JMJD1A markedly decreased HKCR-induced IRF1 mRNA and protein expression in CT26 cells. Consistently, western blotting results showed that IRF1 expression was significantly reduced in the colons (Fig 6E) and the colonic epithelial cells (S8A Fig) of JMJD1A-/- mice compared with WT mice on day 7 after C. rodentium infection.
Since KEGG analysis showed that C. rodentium infection was associated with the activation Jak-STAT signaling pathway (Fig 6F), the protein levels of p-STAT1 and STAT1 were increased in colons and colonic epithelial cells after C. rodentium infection (Figs 6G and S8A), and it has been reported that the transcription factor STAT1 can regulate IRF1 expression at the transcriptional level [29], we wondered whether JMJD1A could cooperate with STAT1 to induce IRF1 expression. We therefore performed IRF1 promoter reporter assays to test this hypothesis. The results of IRF1 promoter reporter assays showed that JMJD1A could cooperate with STAT1 to enhance IRF1 promoter activity in CT26 cells (Fig 6H). Furthermore, to determine whether JMJD1A could interact with STAT1, we treated CT26 cells with HKCR and then performed Co-IP assays. As shown in Fig 6I, JMJD1A antibodies could immunoprecipitate STAT1 and STAT1 antibodies could immunoprecipitate JMJD1A, suggesting that JMJD1A can interact with STAT1. ChIP assays also revealed that JMJD1A and STAT1 bound to the IRF1 promoter without HKCR treatment, and the binding was increased after HKCR treatment (Fig 6J and 6K),whereas the levels of H3K9me2 were reduced (Fig 6L). These results suggest that JMJD1A cooperates with STAT1 to promote IRF1 expression, which further enhances CCL8 expression.
JMJD1A cooperates with IRF1 to promote CCL8 expression
In addition to enhancing IRF1 expression to promote CCL8 expression, we wondered whether JMJD1A could cooperate with IRF1 to promote CCL8 expression. We therefore performed CCL8 promoter reporter assays. As shown in Fig 7A, JMJD1A could cooperate with IRF1 to enhance CCL8 promoter activity, whereas the JMJD1A (H1120Y) mutant, which loses the histone demethylation function, failed to cooperate with IRF1 to enhance CCL8 promoter activity. These results suggest that JMJD1A can cooperate with IRF1 to promote CCL8 expression and the demethylation activity of JMJD1A is required for promoting CCL8 expression.
(A) JMJD1A could cooperate with IRF1 to enhance CCL8 promoter activity. CT26 cells were co-transfected with Renilla plasmids, murine CCL8 promoter reporter, JMJD1A expression plasmids or JMJD1A mutant expression plasmids, and IRF1 expression plasmids using Lipofectamine 2000. The luciferase and Renilla values were measured at 24 h after co-transfection. n = 3. (B) JMJD1A antibodies could immunoprecipitate IRF1 and IRF1 antibodies could immunoprecipitate JMJD1A. HEK293 cells were co-transfected with Flag-JMJD1A expression plasmids and Myc-IRF1 expression plasmids using Lipofectamine 2000. Co-IP analysis of the interaction of JMJD1A and IRF1 with indicated tag antibodies. n = 3. (C) JMJD1A antibodies could immunoprecipitate IRF1 and IRF1 antibodies could immunoprecipitate JMJD1A in CT26 cells. CT26 cells were treated with HKCR (MOI = 200), and cell lysis was collected. Co-IP analysis of the interaction of JMJD1A and IRF1 with indicated antibodies. n = 3. (D) JMJD1A and IRF1 bound to the CCL8 promoter without HKCR treatment, and the binding was enhanced after HKCR treatment, but the level of H3K9me2 was reduced. CT26 cells were treated with or without HKCR (MOI = 200), and ChIP assays were performed. The affinity of IRF1 on the CCL8 promoter in CT26 cells was measured by ChIP assay using IRF1 antibodies or IgG antibodies. The affinity of JMJD1A on the CCL8 promoter in CT26 cells was measured by using JMJD1A antibodies or IgG antibodies. The affinity of H3K9Me2 on the CCL8 promoter in CT26 cells was measured by using H3K9me2 antibodies or IgG antibodies. (E-H) HKCR treatment caused an increase in the chemoattraction of Raw264.7 and CTLL-2 cells, while knockdown of JMJD1A or IRF1 in CT26 cells decreased the chemoattraction of Raw264.7 and CTLL-2 cells. Graph showing number migrating toward in a chemotaxis assay. The data were normalized by the cell number of negative control (siNC) group. n = 4. (I) Schematic model for the mechanism by which JMJD1A protect mice from C.rodentium infection by upregulating CCL8 to recruit macrophages and CD4+ T cells. The image was created by “ScienceSlides 2005” plugin and Microsoft PowerPoint software. Data shown in graphs are Mean ± SEM or SD. The data were pooled from three independent experiments. P values were assessed with the two-tailed Student’s t-test or nonparametric tests, or one-way ANOVA test. *P < 0.05; **P < 0.01; ***P < 0.001.
To determine whether JMJD1A could interact with IRF1, we transfected 293T cells with JMJD1A and IRF1 expression plasmids for 24 h and then performed Co-IP assays. As shown in Fig 7B, JMJD1A antibodies could immunoprecipitate IRF1 and IRF1 antibodies could immunoprecipitate JMJD1A. In addition, the interaction of endogenous JMJD1A and IRF1 in CT26 cells could be detected by co-immunoprecipitation using JMJD1A antibodies and IRF1 antibodies, respectively (Fig 7C). Because JMJD1A can cooperate with IRF1 to enhance the CCL8 promoter activity, we determined whether JMJD1A could bind to the IRF1 binding site on the CCL8 promoter. CT26 cells were treated with HKCR and then the ChIP assays were performed. The results showed that JMJD1A and IRF1 bound to the CCL8 promoter without HKCR treatment, and the binding was enhanced after HKCR treatment (Fig 7D, left and middle panels). Furthermore, H3K9me2 could be detected at the IRF1 binding site on the CCL8 promoter without HKCR treatment, but the level was reduced after HKCR treatment (Fig 7D, right panel). Taken together, these results suggest that JMJD1A can be recruited to IRF1 binding site on the CCL8 promoter to demethylate H3K9me2 for enhancement of CCL8 expression.
To verify that JMJD1A and IRF1-induced CCL8 could chemoattract macrophages and T cells, chemotaxis assays in a transwell system were performed utilizing mouse macrophage cell line RAW264.7 and T cell line CTLL-2, respectively. As shown in Fig 7E-7H, HKCR treatment caused an increase in the chemoattraction of Raw264.7 and CTLL-2 cells, while knockdown of JMJD1A or IRF1 in CT26 cells decreased the chemoattraction of Raw264.7 and CTLL-2 cells after HKCR treatment. Furthermore, CCL8 overexpression in JMJD1A-knockdown or IRF1-knockdown CT26 cells could partly rescue the chemoattraction of Raw264.7 and CTLL-2 cells.
JMJD1A impacts on the health status of gut microbiota
Because the gut microbiota plays an important role in regulating intestinal inflammation and enteropathogens colonization, we assessed the fecal microbiota composition from naïve WT and JMJD1A-/- mice by 16S rRNA amplicon sequencing. The principal co-ordinated analysis (PCoA) of beta diversity based on a Bray-Curtis comparison showed that the fecal samples from naïve WT and JMJD1A-/- mice were separated (S12A Fig). Beta diversity of the fecal microbiomes from the WT mice was significant difference compared with JMJD1A-/- mice at genus level (S12B Fig). Gut Microbiome Health index (GMHI) showed that the health conditions of gut microbiota from WT mice were better than that of gut microbiota from JMJD1A-/- mice (S12C Fig). Furthermore, microbial dysbiosis index (MDI) showed that the microbial dysbiosis of JMJD1A-/- mice was more severe than that of WT mice (S12D Fig). Linear discriminant analysis effect size (LEfSe) analysis and linear discriminant analysis (LDA) scores revealed that there was significantly different Oscillospirales Order between WT and JMJD1A-/- mice, which belongs to Firmicutes phylum (S12E and S12F Fig). There were significantly different bacterial species, including norank_f_Eubacterium_coprostanoligenes_group and Colidextribacter, identified by intergroup significance analysis at genus level between WT and JMJD1A-/- mice (S12G and S12H Fig). These results suggest that JMJD1A promotes the growth of some gut microbiota and impacts on the health status of gut microbiota.
In summary, our study demonstrates that JMJD1A plays an essential role in protecting colon from C. rodentium infection. Mechanistically, JMJD1A cooperates with STAT1 to enhance IRF1 expression, and then cooperates with IRF1 to promote CCL8 expression, thereby enhancing the recruitment of macrophages and CD4+ T cells to the colons. Recruited macrophages kill C. rodentium through phagocytosis and induction of inflammatory response, and recruited CD4+ T cells activate B cells to produce antibodies against C. rodentium, both actions limit C. rodentium infection (Fig 7I).
Discussion
It has been shown that JMJD1A plays important roles in the physiological and pathological processes, including spermatogenesis, sex determination, metabolism, and tumorigenesis [15,18,19]. In this study, we revealed the role of JMJD1A in C. rodentium infection. We found that JMJD1A was mainly moderately expressed in colonic epithelial cells, and significantly up-regulated in response to C. rodentium infection, suggesting that JMJD1A may be involved in host defense against C. rodentium infection. Moreover, the mouse model of C. rodentium infection showed that JMJD1A promoted the clearance of C. rodentium, limited the systemic spreading of C. rodentium, and promoted mouse survival, suggesting that JMJD1A plays an important protective role against C. rodentium infection.
Both colonic immune cells and epithelial cells play important roles in the control of C. rodentium infection. Neutrophils play a critical role in bacterial clearance during the early stage of C. rodentium infection [30–31]. Macrophages can engulf C. rodentium and induce specific immunity to kill C. rodentium [27]. CD4+-dependent IgG responses and intestinal luminal pathogen-specific IgG antibodies are essential for the eradication of C. rodentium [10,11,13]. Colonic epithelial cells can produce mucin (for example, muc2), cathelicidin, and antimicrobial peptides (for example, REG3β, REG3γ, and β-defensins) to directly control C. rodentium infection [32–34], as well as chemoattrants to recruit neutrophils, macrophages, and T cells to indirectly control C. rodentium infection [35–36]. In our study, there was no difference observed in the mRNA expression of AMPs in the colons between WT mice and JMJD1A-/- mice, suggesting that JMJD1A-mediated protection against C. rodentium is not due to the up-regulation of AMPs. JMJD1A-/- mice exhibited reduced recruitment of macrophages and CD4+ T cells to colons and reduced expression CCL8 in colonic epithelial cells, suggesting that JMJD1A facilitates the recruitment of immune cells, including macrophages and CD4+ T cells through enhancing the expression of CCL8 to control C. rodentium infection. These results revealed a critical interaction between intestinal epithelial cells (IEC) and immune cells, orchestrated by JMJD1A, in host defense against C. rodentium.
Previous study has demonstrated that adeno-associated virus (AAV) pseudotype 9 could be used for transduction of the epithelium in the colon, which is ideal for studying mucosal inflammation in the experimental colitis [26]. In accordance with this, our analysis of magnetically isolated cell populations demonstrates that AAV-shJMJD1A administration causes a significant decrease in JMJD1A expression predominantly within the colonic epithelial cells, with no marked decrease in the bulk populations of colonic macrophages and CD4+ T cells, although we cannot exclude the possibility of effects on rare immune subsets or minor changes below the detection limit of our assay. These results strongly support the conclusion that the observed protective phenotypes are largely attributable to epithelial-intrinsic JMJD1A function. Of course, using mice with conditional knockout of JMJD1A in the intestinal epithelial cells will provide ultimate validation in the future studies.
Macrophages play a crucial role in the initial phase of the innate immune response by killing phagocytosed bacteria, which is essential for controlling bacterial infections [37]. Intestinal macrophages, derived primarily from circulating monocytes, are vital for intestinal immunity [38]. The intestinal inflammatory macrophages are crucial for host defense against C. rodentium infection [8]. Additionally, the studies from immune cell-deficient mice have shown that CD4+ T cells, B cells, and IgG are necessary for eradicating C. rodentium infection [11,13,39]. Luminal IgG facilitates the clearance of C. rodentium, while IgA is dispensable for the eradication of C. rodentium [10], although IgA can inhibit the spread of pathogenic bacteria [40–41]. Moreover, IgG enhances the engulfment and killing of IgG-bound C. rodentium by phagocytes through opsonization [10,42]. These studies suggest that CD4+ T cell-dependent luminal IgG, which can promote the phagocytes to engulf and kill IgG-bound C. rodentium, are essential for clearing C. rodentium. In this study, we found that JMJD1A-/- mice exhibited less macrophages and CD4+ T cells in the colons compared with WT mice after C. rdentium infection. Additionally, the titers of IgG and IgA in the luminal contents of JMJD1A-/- mice were significantly lower compared to WT mice on day 12 after C. rodentium infection. These results suggest that the impaired clearance of C. rodentium in JMJD1A-/- mice may be attributed, at least in part, to reduced macrophage recruitment and impaired luminal IgG and IgA response.
Because T-B cell interaction plays important roles in affinity maturation [43] and germinal centers (GC) formation [44], decreased CD4+ T cells could explain the impaired response of antibody. In addition, the numbers of CD20-positive cells were significantly decreased in the colons of JMJD1A-/-mice compared to WT mice after C. rodentium infection on day 12 (S7 Fig), suggesting that JMJD1A deficiency also affects the number of B cells. However, we could not rule out the possible direct role of JMJD1A in B cells; it’s necessary to conduct relevant assay to clearly elucidate this phenomenon. The relative contributions of CD4+ T cells assistance and B cell functions will be able to be separated through the “adoptive cell transfer therapy” assay. This addition will provide a more nuanced interpretation of our results and identifying a key direction for future research. Elucidating this mechanism will be a critical focus of our future investigations.
Chemokine C-C motif ligand 8 (CCL8), also known as monocyte chemotactic protein 2 (MCP-2), belongs to the CC chemokine subfamily. It can interact with many receptors, such as CCR1, CCR2B, CCR5 and CCR8 in mouse and human cells [45–47]. It is involved in the immune response by attracting immune cells, such as CD4+ T cells [48], γ/δ T cells [49], macrophages [50], and dendritic cells [51]. CCL8-deficient mice were more susceptible to Listeria monocytogenes infection [49], indicating that CCL8 is involved in host defense against bacterial infection. In this study, we showed that CCL8 overexpression in the colon promoted the clearance of C. rodentium on day 14 after infection. Moreover, CCL8 overexpression increased the recruitment of CD4+ T cells and macrophages into the colon on day 14 after C. rodentium infection. CCL8 rescue experiments demonstrated that JMJD1A protected against enteric infection, at least in part, through CCL8. These results suggest that CCL8 is important for eradicating C. rodentium, at least in part, through recruiting CD4+ T cells and macrophages.
Our results revealed a strong correlation between JMJD1A and CCL8, which recruits macrophages and CD4+ T cells, and enhances host defense against infection. CCL8 rescue by co-infection of AAV9-mCCL8 in JMJD1A-knockdown mice further confirmed the important role of CCL8 in host defense against infection. However, a critical question remains regarding the sufficiency of these increasing immune cells to confer protection. We have not proved this question by performing adoptive transfer of macrophages and CD4+ T cells. This addition will provide a more nuanced interpretation of our results and identifying a key direction for future research. Elucidating this mechanism will be a critical focus of our future investigations.
Our results indicated that CCL8 is an important and sufficient mediator of JMJD1A-mediated protection. Additionally, JMJD1A-/- mice exhibited a severe impairment of the IFNγ-STAT1-IRF1 axis compared to WT mice, revealing that IFNγ-STAT1-IRF1 axis could be a second crucial arm of the JMJD1A-mediated host defense against enteric infection. Therefore, the protective role of JMJD1A is manifested in that CCL8 plays a key role in immune recruitment and cooperates with other effectors such as IFNγ to mount full host defense against enteric infection.
CCL8 expression can be regulated by some transcription factors including C/EBPβ [52], GAS-like elements [53], B lymphocyte-induced maturation protein 1 (BLIMP1) [49] and ZEB1 [54]. In this study, our results showed that JMJD1A could interact with IRF1 and both IRF1 and JMJD1A could be recruited to the IRF1 binding site on the CCL8 promoter. The changes in histone methylation can influence the binding of IRF1 and its cofactors on the promoter to modulate IRF1 target genes transcription [55]. JMJD1A can demethylate H3K9me2 and H3K9me1. Our results showed that JMJD1A can cooperate with IRF1 to enhance CCL8 promoter activity, while the JMJD1A (H1120Y) mutant failed to cooperate with IRF1 to enhance CCL8 promoter activity. Furthermore, the levels of H3K9me2 on CCL8 promoter were reduced after HKCR treatment. These results suggest that JMJD1A promotes CCL8 transcription by catalyzing the demethylation of H3K9me2 on CCL8 promoter.
The transcription factor IRF1 is expressed in cells at low basal levels, whereas it can be strongly induced in response to a variety of stimuli [55]. Previous study has demonstrated that IRF1 expression was upregulated in the human gut, correlating with chronic intestinal inflammation [56]. Additionally, IRF1-deficient mice exhibited significantly increased severity and lethality of chemically induced colitis compared with WT mice [57]. Moreover, IRF1-deficient mice exhibited higher C. rodentium load in the colons and feces, as well as increased systemic spread after C. rodentium infection compared with WT mice [58]. These results suggest that IRF1 plays a crucial protective role in both chemical-induced colitis and C. rodentium-induced colitis. Intriguingly, there are comparable bacterial load between mice with conditional IRF1 deficiency in the intestinal epithelial cells and control mice [58], implicating that IRF1 in the intestinal epithelial cells may be less important during C. rodentium infection. Our study demonstrated that JMJD1A could enhance IRF1 signaling by inducing IRF1 expression and coactivating its transcriptional activity, highlighting the important role of JMJD1A in IRF1-mediated control of C. rodentium infection. Interestingly, IRF1 can be recruited to the IRF1 binding site on the JMJD1A promoter to enhance JMJD1A expression after HKCR treatment, forming a positive regulatory loop to amplify IRF1 signaling.
In our study, we found that IRF1 expression was dramatically increased in the colons, colonic epithelial cells, and CT26 cells, and was required for CCL8 induction for chemoattracting macrophages and T cells in vitro (Fig 7E-7H) after C. rodentium treatment, suggesting that IRF1 expression in the colonic epithelial cells plays an important role in controlling C. rodentium infection. JMJD1A deficiency reduced the expression of IRF1 in the colonic epithelial cells, and the phenotypes of JMJD1A-KO and JMJD1A-knockdown mice were similar to the severe disease of global IRF1-KO mice after C. rodentium infection, but contradicted the comparable mild disease of mice with conditional epithelial knockout of IRF1 [58]. The discrepancy may be explained that IRF1 in cells other than colonic epithelial cells also plays essential roles in controlling C. rodentium infection and constitutive IRF1 deficiency in colonic epithelial cells may activate compensatory mechanisms that bypass the requirement of IRF1 to control C. rodentium infection. The compensatory mechanisms may be related to the downregulation of cytokines signaling 1 (SOCS1) and overactivation of STAT1 in IRF1-deficient colonic epithelial cells. SOCS1 has been related to IBD pathogenesis and mainly inhibits JAK2/STAT1 axis [59–60]. IRF1 can directly activate the transcription of SOCS1 by binding to the IRF binding element (IRF-E) in the SOCS1 promoter region to inhibit STAT1 activation [61]. Therefore, constitutive IRF1 deficiency in colonic epithelial cells may cause reduced SOCS1 expression, leading to overactivation of STAT1, which STAT can bind to the STAT binding site of the CCL8 to enhance the expression of CCL8 [62]. Since JMJD1A is a coactivator of STAT1 (Fig 6H), JMJD1A deficiency may impair STAT1-induced CCL8 expression. All this information helps to explain IRF1-KO, JMJD1A-KO, and AAV-shJMJD1A mice develop severe disease upon C. rodentium infection while conditional epithelial-specific IRF1 KO mice display no phenotype.
Our results showed that heat-killed C. rodentium induces the expression of JMJD1A, IRF1, and CCL8 in CT26 cells, suggesting that the activation of JMJD1A-CCL8 axis is independent of the bacterium’s A/E lesion formation and heat-stable pathogen-associated molecular patterns (PAMPs) from bacteria (including LPS, flagellin, and bacterial DNA) can play a key role in triggering the epigenetic and immune responses of host cells. Pattern recognition receptors (PRRs) expressed on epithelial cells can activate MAPK pathway and canonical NF-κB pathway, as well as IRFs [63–64]. Our results demonstrated that JMJD1A can serve as a potentially critical component in this signaling cascade. We hypothesize that PRR signaling increases JMJD1A expression at the transcriptional level, which then serves as an epigenetic amplifier to promote the expression of IRF1 and CCL8. This could enhance and maintain the epithelial alarm response in the absence of live infection.
The gut microbiota plays a crucial role in maintaining the intestinal health and contributing to disease regulation. Previous study has shown a significant reduction in the genera Eubacterium_coprostanoligenes_group in UC patients compared with normal control [65], suggesting its role in maintaining the intestine balance. Moreover, Eubacterium_coprostanoligenes_group has been demonstrated to decrease in DSS-induced colitis [66], and Eubacterium_coprostanoligenes has been found to alleviate DSS-induced colitis, implying that its role in modifying intestinal inflammation. Additionally, short chain fatty acid-producing bacteria Colidextribacter, which belongs to Firmicutes phylum, has also been demonstrated to decrease in DSS-induced colitis [67–68], indicating its role in modulating intestinal inflammation. Furthermore, the gut microbiota is required for the clearance of C. rodentium [69].
Since the results from 16S rRNA sequencing of WT and JMJD1A-/- mice were derived from the fecal samples of C.rodentium on day 0, and the gut microbiota alterations were observed prior the C. rodentium infection (S12 Fig). The gut microbiota confers colonization resistance against pathogens through multiple mechanisms, including occupation of ecological niches, nutrient competition and creation of an unfavorable environment. The dysbiosis of gut microbiota directly impairs this resistance, thereby facilitating pathogen colonization and proliferation [70]. Indeed, study in germ-free mice have shown that microbial compositional differences alone can affect susceptibility to enteric infection and immune responses [71]. Moreover, in a humanized mouse model of C. rodentium-induced colitis, robust differences were observed in different microbiome samples from 30 donors of three countries [72]. These results suggest that microbiome is a cause of infection susceptibility.
Although the AAV is known for relatively low immunogenicity, systemic administration can still induce transient innate immunity, including the production of pro-inflammatory cytokines and type Ⅰ interferons [73]. Such immune activation and the transduction of epithelial cells or gut resident immune cells could potentially alter the composition and function of the gut microbiota in the gut model. Moreover, the intestinal flora disorder can markedly influence susceptibility to infection and inflammatory outcomes [74]. We mitigated these concerns and strengthen our conclusions by setting appropriate controls and designing a four-week recovery period between AAV administration and infection. However, we cannot rule out the possibility that AAV-mediated modulation itself causes the immune perturbations and gut microbiota alteration in a JMJD1A-independent manner. It will be essential to rule out the possibility by employing epithelial-specific conditional knockout mice in the future studies.
Besides JMJD1A, other histone-modifying enzymes, such as LSD1, JMJD2D, EZH2, and HDAC3 have played crucial roles in intestinal immunity and pathogen defense. Incorporating these studies into a more in-depth discussion will help better position the core function of JMJD1A we have identified. The understanding of our work in this field and related research of these critical enzymes was showing as follows: LSD1 (a H3K4/K9 demethylase) and JMJD2D (a H3K9me2/3 demethylase) have been shown to promote the expression of anti-microbial peptides in the gut by demethylating the repressive histone marks at target genes [75–76]. Similar to these enzymes, JMJD1A demethylates the repressive H3K9me2 mark, implying that these demethylases have a common theme wherein demethylating the repressive histone marks promotes innate and adaptive immune target genes expression. In contrast, the enhancer of zeste homolog2 (EZH2), which catalyzes H3K27me3, serves as an epigenetic brake to inhibit inflammation by suppressing immune responses [77]. Therefore, the functions of EZH2 and JMJD1A represent the two opposing sides of “brake” and “throttle” in epigenetic regulation, highlighting a balance between activating and repressive epigenetic mechanisms in maintaining intestinal homeostasis. Similar, histone deacetylase 3(HDAC3) can regulate gene expression by deacetylating histones and transcription factors in response to environmental signals. HDAC3 plays an important protective role in antibacterial immunity through activating local resident intraepithelial CD8+ T cells [78]. HDAC3 and JMJD1A both exert their effects by removing inhibitory modifications. However, the modifications types of them are different. What distinguishes our study is that we identify a specific and non-redundant pathway. We link JMJD1A to the direct transcriptional control of CCL8 in epithelial cells, which are not previously recognized as a central effector in this epigenetic axis. Furthermore, our data demonstrated that JMJD1A-CCL8 signaling is protective against C. rodentium-induced colitis. Therefore, our results provide new evidence for the specific function of the demethylase family in host defense.
In our study, we found that JMJD1A plays a critical protective role in the host defense against enteric bacterial infection through enhancing CCL8 expression. This may have significant implications for understanding, preventing, and treating human enteric infection, particularly those caused by EPEC and EHEC, since C. rodentium shares a common pathogenic mechanism with those pathogens, which is characterized by forming A/E lesions and manipulating host cell signaling [2]. Our results highlight the therapeutic potential of targeting the JMJD1A-CCL8 pathway. Therefore, moderate pharmacological activation of JMJD1A or using recombinant CCL8 may be a novel and potential preventive and therapeutic strategy against a major class of diarrheal pathogens. Additionally, as JMJD1A has pleiotropic roles in many pathological processes, we also need to evaluate the risk of human enteric infection during the treatment of other diseases such as cancer.
Materials and methods
Ethics statement
All experimental procedures were carried out in line with animal protocols, which are approved by the Laboratory Animal Center of Xiamen University. The animal experimental design was approved by the Ethics Committee of Xiamen University (approval number: XMULAC20190099).
Mice
JMJD1A-/- mice were generated on a C57BL/6 background as previously described [79]. WT mice from the same litter served as a control group. Ten-week-old female mice were employed in all experiments.
C. rodentium infection
After fasting for 8 h, WT and JMJD1A-/- mice were infected with C. rodentium strain ATCC51459 (1.0 × 109 CFU mouse-1 in 0.2 mL PBS) by oral gavage. For quantification of C. rodentium, feces and tissues samples were collected and weighed. Then, the samples were homogenized in a Tissuelyser-24 at 30 Hz for 6 min. Homogenates were serially diluted with PBS, and seeded onto MacConkey agar plates. C. rodentium colonies were counted after incubating overnight at 37 °C.
Cell culture
The human embryonic kidney 293 cell line (HEK293T) and the murine cell lines CT26 were all purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and the cell lines were stored in the lab of Professor Yu. HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), and the CT26 cells were cultured in RPMI-1640, which were supplemented with streptomycin (100 mg mL-1), penicillin (100 IU) and fetal bovine serum (FBS, 10%). The cells were all cultured in a humidified incubator containing 5% CO2 at 37 ℃.
RNA interference
JMJD1A siRNA [22] and nonspecific siRNA were purchased from Genepharma. CT26 cells were transfected with JMJD1A siRNA (20 nM) or negative siRNA using Lipofectamine 2000 (ThermoFisher Scientific, Waltham, US) according to the manufacturer’s instructions.
Histological analysis, immunofluorescence and immunohistochemistry
10% neutral Formalin-fixed distal colons were embedded in paraffin and 5 μm sections were cut. The sections were then stained with hematoxylin and eosin (H&E) by standard techniques or prepared for immunohistochemistry. For H&E staining, histological scoring was determined as described previously [80]. For immunohistochemistry, the method was described in our previous study [76]. The antibodies were incubated as follows: rabbit anti-C. rodentium antibody, rabbit anti-JMJD1A (NB100–77282, Novus), rabbit anti-CD4 antibody (Cat#ab183685, Abcam), and rabbit anti-F4/80 antibody (Cat#70076, CST) for overnight at 4 ℃.
For immunofluorescence staining (IF), the antibodies Rabbit anti-Mouse-CCL8 antibody (Cat#AF790, R&D Systems) was incubated for overnight at 4 ℃. The Fluorescent Secondary Antibody (Cat#A23330, Abbkine) for immunofluorescence was incubated for 30 min. Slides were mounted with the Antifade Mounting Medium with DAPI (Cat# H-1200, Vector Laboratories, USA).
Isolation of colonic epithelial cells
The colons were longitudinally opened and cleaned with cold PBS containing penicillin and streptomycin. The colons were cut into about 2 mm pieces and subsequently transferred them into chelating buffer for 30 min at 4 ℃ [81]. And then the colon segments were vigorously shaken for 1 min to dissociate the epithelial cells. The colon segments were removed by a 100 μm cell-strainer and the colon epithelial cells were collected by centrifuging at 400 × g for 10 min at 4 ℃.
Isolation of lamina propria cells
The methods of lamina propria cells isolated from the colonic lamina propria were described in our previous study [80]. Colonic macrophages and CD4+ T cells were purified by positive selection with a magnetic cell separation system by using anti-mouse CD11b Microbeads (Cat#130-049-601, Miltenyi Biotec) and anti-mouse CD4+ microbeads (Cat#K1302-10, RWD life science Co.).
Colon culture and cytokine analysis by ELISA
For colon culture and cytokine analysis, the methods were described in our previous study [76].
Measurement of C. rodentium-reactive immunoglobulins
The feces were immersed with 1 mL cold PBS containing protease inhibitor cocktail (Roche) and homogenized in a Tissuelyser-24 for a total of 6 min at 30 Hz. The homogenate was centrifuged and the supernatants were collected. The 96-well ELISA plates were coated with heat-killed C. rodentium for overnight at 4 ℃. After washing 3 times with 1 × PBST, blocking solution (1% BSA in 1 × PBST) was added to the plate and incubated for 1 h at room temperature. After washing 3 times with 1 × PBST, the diluted feces supernatants (1:1000) were then added to the coated plate for 2 h at room temperature. After washing 5 times with 1 × PBST, HRP-conjugated polyclonal goat anti-mouse IgG, IgA, or IgM antibodies (Southern Biotechnology Associates, Birminghan, AL) were added to the plate and incubated for 1 h at room temperature. After washing 5 times with 1 × PBST, 100 μL TMB solution was added to the plate and incubated for 15 min at room temperature. And then 2 N sulfuric acid was added to the plate to stop reaction, and OD450 was detected.
Western blot
The proteins from colons, isolated epithelial cells and CT26 cells were extracted in RIPA buffer containing Protease Inhibitor (MedChemExpress, US). Then, the western blot was performed according to previous study [76]. The antibodies were incubated as follows: anti-JMJD1A (Cat#12835–1-AP, Proteintech), anti-STAT1 (Cat#14994, CST), anti-phosphorylation STAT1 (Cat#9167, CST), anti-IRF-1 (Cat#8478S, CST), and anti-β-actin (Cat #A5441, Sigma-Aldrich). Partly protein band intensities were quantified using ImageJ software (National Institutes of Health). The signal intensity of interest protein was normalized to that of its corresponding loading control (β-actin).
Co-IP assays
HEK-293T and CT26 cells were lysed in cell lysis buffer containing protease inhibitor cocktail (Roch) and whole cell lysates were collected in a new 1.5 mL tube. The supernatants were immunoprecipitated with 3 μg of the following antibodies or control immunoglobulin G (IgG) with rotation overnight at 4 °C: anti-JMJD1A (Cat#12835–1-AP, Proteintech), anti-STAT1 (Cat#14994, CST), anti-IRF-1 (Cat#8478S, CST) and Myc-Tag antibody (Cat#AE010, Abcolonal). And then the supernatants were incubated with protein A/G magnetic beads (Cat#HY-K0202, MCE) and rotated for 2 h at 4 °C. After washing three times with lysis buffer, the immunoprecipitants were eluted and boiled for 5 min with 1 × loading buffer. For exogenous Co-IP, the supernatants were incubated with 20 μL anti-flag magnetic beads (Cat#B26102, Biomake). The immunoprecipitants were then performed to western blot.
Gene expression analysis
Total RNA from colons and CT26 cells was extracted using TRIzol (ThermoFisher Scientific, US). Real-time RT-PCR was performed according to our previous study [76]. The primers were as follows: mJMJD1A forward: 5’-TCCCCAGGCAGCCAATT
CTCCA-3’, mJMJD1A reverse: 5’-TGGCTGTGGAGCAGACTCCAGT-3’; mCCL3 forward: 5’- TTCTCTGTACCATGACACTCTGC-3’, mCCL3 reverse: 5’- CGTGGAATCTTCCGGCT
GTAG-3’; mCCL4 forward: 5’- TTCCTGCTGTTTCTCTTACACCT-3’, mCCL4 reverse:
5’-CTGTCTGCCTCTTTTGGTCAG-3’; mCxcl5 forward: 5’-GGTCCACAGTGCCCTACG
-3’, mCxcl5 reverse: 5’-GCGAGTGCATTCCGCTTA-3’; mCxcl9 forward: 5’-AATGC
ACGATGCTCCTGCA-3’, mCxcl9 reverse: 5’-AGGTCTTTGAGGGATTTGTAGTGG-3’;
mCCL8 forward: 5’- CCAGATAAGGCTCCAGTCACC-3’, mCCL8 reverse: 5’- AGAGAGACATACCCTGCTTGGTC-3’; mIL-10 forward: 5’-GGTTGCCAAGCCTTATCG
GA-3’, mIL-10 reverse: 5’-ACCTGCTCCACTGCCTTGCT-3’; mIL-17A forward: 5’-GCTCCAGAAGGCCCTCAGA-3’, and mIL-17A reverse: 5’-CTTTCCCTCCGCATTGA
CA-3’; mIFNγ forward: 5’-TCAAGTGGCATAGATGTGGAAGAA-3’, and mIFNγ reverse: 5’-TGGCTCTGCAGGATTTTCATG-3’; GAPDH forward: 5’-AACTTTGGCATTGTGGAAG
G-3’, GAPDH reverse:5’-GGATGCAGGGATGATGTTCT-3’; L32 forward: 5’-AAGCGAA
ACTGGCGGAAAC-3’, L32 reverse: 5’- TAACCGATGTTGGGCATCAG-3’.
AAV9 packaging
The shuttle plasmids were cotransfected into HEK-293T cells with AAV9-cap plasmids and pHelper. The AAV viral particles were isolated and purified according to a previously reported protocol [82]. For AAV9-mediated CCL8 overexpression and JMJD1A knockdown, 5 × 1010 viral genomes were injected into female 8-week-old WT mice via portal vein injection before C. rodentium infection. Four weeks after operation, these mice were infected with C. rodentium by oral gavage. JMJD1A knockdown plasmid was constructed with the primers: shJMJD1A forward, 5’-GATCCGAGTATGTGTAGATTGCTATTCAAGAGATAGCAATCT
ACACATACTCTTTTTA-3’, shJMJD1A reverse, 5’-AGCTTAAAAAGAGTATGTGTAGATT
GCTATCTCTTGAATAGCAATCTACACATACTCG-3’, and then inserted into the pAAV-ZsGreen1-shRNA vector at the BamHI and HindIII sites to construct the JMJD1A knockdown plasmid. Mouse CCL8 cDNA was amplified by PCR from colonic epithelial cells with the following primers: forward, 5’-CGCGGATCCAAT
GAAGATCTACGCAGTGCT-3’, and reverse, 5’- CGACGCGTTCAAGGCTGCAGAATTTG
AG-3’ and then inserted into the pAAV-MCS vector at the BamHI and HindIII sites to produce the mouse CCL8 expression plasmid.
16S rRNA sequencing
The fecal samples from naïve WT and JMJD1A-/- mice were collected, frozen, and sent to Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The Genomic DNA extraction, PCR amplification and Illumina sequencing were performed with extracted samples by Majorbio. Principal coordinate analysis (PCoA) was used to determine the similarity among the microbiota communities in different fecal samples through Vegan v2.5-3 package. To identify the bacteria taxa, which was significantly abundant among different samples, the linear discriminant analysis (LDA) effect size (LEfSe) [83] (http://huttenhower.sph.harvard.edu/LEfSe) was administered (LDA score > 2 and P < 0.05). The raw sequencing reads were deposited into the NCBI Sequence Read Archive (SRA) database (BioProject ID: PRJNA1093258).
RNA-sequencing analysis
RNA-sequencing experiment was performed referring to our previous study [84]. In short, total RNA samples were extracted from the colon tissues of mice, which included WT and JMJD1A KO (JMJD1A-/-) mice, using TRIzol reagent (Invitrogen). Then, the RNA-sequencing analysis was performed with extracted RNA samples at GENEWIZ Company. Three representative mice were pooled in a sample. Significantly differential genes were selected, and the thresholds were defined as Fold change>1.5 and P < 0.05. The raw sequencing reads were deposited into the NCBI SRA database (BioProject ID: PRJNA1094454).
Construction of plasmids and luciferase reporter assays
The mouse JMJD1A promoter fragments were amplified by PCR using mouse genomic DNA as a template with the following primers: forward, JMJD1A (-1984 bp) 5’-TCCCCCGGGACAAGATGCCAATGTAGCTTTCC-3’, JMJD1A (-1716 bp) 5’-TCC
CCCGGGTCCTTCATTCCATTTCCCACCT-3’, JMJD1A (-1391 bp) 5’-TCCCCCGGGCCT
CTGGTCCAAACCATAAAACC-3’, JMJD1A (-992 bp) 5’-T CCCCCGGGGTCTTCGCTCGA
CAGCCTAC-3’; reverse, JMJD1A (-88 bp) 5’-GGAAGATCTTTGCCTAAGTGTTCGTCC
CC-3’. The fragments were ligated into the SmaI and BglII sites of the PGL3-basic to yield the JMJD1A promoter plasmids. The mouse CCL8 promoter fragment was amplified by PCR using mouse genomic DNA as a template with the following primers: forward, 5’-GGGGTACCGGTGGATGTCTAAAAGTG-3’, and reverse, 5’-TCCC
CCGGGTTTGGAGTGAAGGCT-3’. The fragment was ligated into the KpnI and SmaI sites of the PGL3-basic to yield the JMJD1A promoter plasmids. The mouse STAT1 promoter fragments were also amplified by PCR using mouse genomic DNA as a template with the following primers: forward, STAT1, 5’- TCTATCGATAGGTACAC
TTGGACACTTCAAAAATATGAA-3’, and reverse STAT1,5’-CTTAGATCGCAGATCGT
CCCAAGTGGGTCTGAGGGGCG-3’. CT26 cells were seeded in a 24-well plate and transfected with Renilla plasmisds and indicated plasmids using Lipofectamine 2000 (ThermoFisher Scientific, Waltham, US) according to the manufacturer’s instructions. The luciferase and Renilla values were measured at 24 h after transfection by a Dual luciferase reporter assay kit (Promega, Madison, US) according to the manufacturer’s instructions. The Renilla served as an internal control.
Chromatin immunoprecipitation (ChIP) assay
ChIP assays were performed based on the protocol described by Abcam (Cambridge, MA). The sheared chromatin was immunoprecipitated with anti-JMJD1A (Cat#12835–1-AP, Proteintech), anti-IRF-1 (Cat#8478S, CST), anti-STAT1 (Cat#14994, CST), anti-H3K9me2 (Cat#ab1220, Abcam) or nonspecific IgG (Santa Cruz, Dallas, US) antibodies. ChIP DNA fragments were analyzed by qRT-PCR with specific primers for the JMJD1A or CCL8 promoter. The following primers were used: JMJD1A promoter IRF1 binding site, forward, 5’-CTCTGGTC CAAACCATAAAACCA-3’, and reverse, 5’-TGAGAAAGTAGATGGAGTTG
ATGA-3’; IRF1 promoter STAT1 binding site, forward, 5’-AGGTACCCATCACTAACA
AGGC-3’, and reverse, 5’- CCTACTGAAAGCAACCAGAGACTA-3’; CCL8 promoter IRF1 binding site, forward, 5’-TCACTTACGACGACAGTTGGG-3’, and reverse, 5’- TCAAATGCCTAAGACAGTTTTCAA-3’.
Transwell migration assays
4 × 105 RAW264.7 cells in 100 μL of DMEM or 2 × 105 CTLL-2 cells in 100 μL of RIMP-1640 supplemented with penicillin (100 IU) and streptomycin (100 mg mL-1) were placed in upper chamber of transwell containing permeable polyester membrane (8 μm pores) pretreated with calcein-AM (Yeasen, Shanghai, China). In the lower chamber, 500 μL of RPMI-1640 medium without FBS containing different treatments (siNC, siIRF1, siIRF1 plus PLV-mCCL8, siJMJD1A, siJMJD1A plus PLV-mCCL8 and PLV-mCCL8), CT26 cells were placed and incubated at 37 ℃ for 4h. The number of cells transmigrated into the bottom chamber was counted using the Fluorescence Microscope (Nikon TE2000) for each treatment condition.
Statistical analysis
Bioinformatic analysis of the gut microbiota was carried out using the online platform of Majorbio Cloud platform (www.majorbio.com). Data analysis was performed by using GraphPad Prism 8.0 software. Data shown in graphs are Mean ± SEM or SD. Statistical analyses were calculated with GraphPad Prism 8.0. P < 0.05 was considered statistically significant. P values were assessed with the two-tailed Student’s t-test or nonparametric tests, one-way ANOVA or two-way ANOVA test. The survival curve was assessed with the log-rank test.
Supporting information
S1 Fig. The c-Rel could not enhance JMJD1A promoter activity in CT26 cells.
Related to Fig 1. The relative luciferase activity of murine JMJD1A promoter transfected with c-REL expression plasmids.
https://doi.org/10.1371/journal.ppat.1014009.s001
(TIF)
S2 Fig. JMJD1A immunohistochemical staining in the colons of control group and JMJD1A knockdown group uninfected and infected with C. rodentium.
(A) Representative pictures of JMJD1A expression in the colonic epithelial cells after C. rodentium infection on day 0 and 14. (B) Quantification of JMJD1A+ epithelial cells from (A). (C) Representative pictures of JMJD1A expression in the lamina propria after C. rodentium infection on day 0 and 14. (D) Quantification of JMJD1A+ stromal cells in the lamina propria from (C). The black arrows indicate JMJD1A+ cells. Data are mean ± SEM. Scale bars represent 50 μm. n = 3. P values were assessed with the two-tailed Student’s t-test. *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s002
(TIF)
S3 Fig. Validation of JMJD1A knockdown specificity and its impact on cytokines produced by CD4 + T cell.
(A) Cell-type-specific efficiency of AAV9-shJMJD1A -mediated knockdown. The colonic epithelial cells, macrophages (isolated using anti-mouse CD11b MicroBeads), and CD4+ T cells (isolated using anti-mouse CD4 MicroBeads) were purified from the colons of mice treated with AAV9-shCtrl and AAV9-shJMJD1A on day 14 after infection. JMJD1A mRNA level were detected by qPCR assays. The unlabeled cells represent the effluent after magnetic beads sorting. n = 3. (B) The expression of IFNγ, IL-10 and IL-17A was analyzed by qPCR in the CD4+ T cells isolated from AAV9-shCtrl and AAV9-shJMJD1A-treated mice on day 14 after infection. P values were assessed with the two-tailed Student’s t-test. *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s003
(TIF)
S4 Fig. JMJD1A knockdown exacerbates body weight loss after C. rodentium infection.
(A) The body weight change in mice treated with AAV9-shCtrl and AAV9-shJMJD1A was monitored on day 14 after C. rodentium infection. JMJD1A knockdown mice exhibited significantly greater body weight loss on day 14 after C. rodentium infection. (B) Survival curves of mice treated with AAV9-shCtrl and AAV9-shJMJD1A over the 14-day infection period. All mice in both groups survived at the experimental endpoint. n = 6. P values were assessed with the two-tailed Student’s t-test. *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s004
(TIF)
S5 Fig. There is no difference observed in the mRNA levels of AMPs.
Related to Fig 3. The AMPs contained such as MUC2, MUC5AC, RELM-β, Reg3β, Reg3γ, Defensin β1, Defensin β3 and Defensin β4 in the colons between WT and JMJD1A-/- mice infected with or without C. rodentium. Data are mean ± SEM. Results are representative of the three independent experiments. n = 4–7. P values were assessed with the two-way ANOVA statistical test.
https://doi.org/10.1371/journal.ppat.1014009.s005
(TIF)
S6 Fig. The number of neutrophils is comparable in the colons of WT mice and JMJD1A-/- mice after C. rodentium infection.
Related to Fig 4. (A) Representative pictures of MPO IHC staining of the colon sections. (B) Quantification of MPO+ cells. Data are mean ± SEM. Scale bars represent 200 μm. n = 5–8. P values were assessed with the two-way ANOVA statistical test.
https://doi.org/10.1371/journal.ppat.1014009.s006
(TIF)
S7 Fig. The numbers of CD20-positive cells are significantly decreased in the colons of JMJD1A-/-mice compared to WT mice after C. rodentium infection on day 12.
(A) Representative pictures of CD20+ IHC staining of the colon sections after C. rodentium infection on day 0 and 12. (B) Quantification of CD20+ cells. Data are mean ± SEM. Scale bars represent 200 μm. n = 4. P values were assessed with the two-way ANOVA statistical test. *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s007
(TIF)
S8 Fig. The protein levels of JMJD1A, IRF1, p-STAT1 and IFNγ are decreased in the colonic epithelial cells or colons from JMJD1A-/- mice compared to WT mice infected with C. rodentium on day 7.
Related to Fig 6. (A) The protein levels of JMJD1A, IRF1, p-STAT1 were detected by western blot in the colonic epithelial cells from JMJD1A-/- mice and WT mice uninfected and infected with C. rodentium on day 7. (B) The protein levels of p-STAT1 and STAT1 were detected by western blot in the colons from JMJD1A-/- mice and WT mice uninfected and infected with C. rodentium on day 7. (C) The protein level of IFNγ was detected by ELISA in the colon cultured supernatants of JMJD1A-/- mice and WT mice infected with C. rodentium on days 7 and 12. Data are mean ± SEM. P values were assessed with the two-way ANOVA statistical test. *P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s008
(TIF)
S9 Fig. Immunofluorescence staining (IF) of CCL8 in colons of mice is increased in AAV9-mCCL8 group compared to AAV-flag group.
Representative pictures of CCL8+ immunofluorescence staining of the colons after C. rodentium infection on day 0. Scale bar represents 100 μm.
https://doi.org/10.1371/journal.ppat.1014009.s009
(TIF)
S10 Fig. Co-infection of AAV9-mCCL8 rescues CCL8 expression in colonic epithelial cells of JMJD1A-knockdown mice.
(A) Co-infection of AAV9-mCCL8 did not affect the knockdown efficiency of JMJD1A by AAV9-shJMJD1A. The protein level of JMJD1A was detected by western blot in the colonic epithelial cells of mice treated with AAV9-shCtrl-flag, AAV9-shJMJD1A-flag, and AAV9-shJMJD1A-mCCL8 on day 14 after C. rodentium infection. (B) Co-infection of AAV9-mCCL8 rescued CCL8 mRNA expression in colonic epithelial cells of JMJD1A-knockdown mice. CCL8 mRNA levels in colonic epithelial cells isolated from the colons of mice treated with AAV9-shCtrl-flag, AAV9-shJMJD1A-flag, and AAV9-shJMJD1A-mCCL8 (n = 10) were measured by RT-qPCR. (C) Co-infection of AAV9-mCCL8 did not affect CCL8 mRNA expression in colonic macrophages, CD4+ T cells, and unlabeled effluent cells of JMJD1A-knockdown mice. Macrophages (isolated using anti-mouse CD11b MicroBeads) and CD4+ T cells (isolated using anti-mouse CD4 MicroBeads) were isolated from the colons of mice treated with AAV9-shCtrl-flag, AAV9-shJMJD1A-flag, and AAV9-shJMJD1A-mCCL8. The unlabeled cells were the effluent obtained after MicroBeads sorting. (D) Co-infection of AAV9-mCCL8 rescued CCL8 protein expression in colonic epithelial cells of JMJD1A-knockdown mice. The concentration of CCL8 was measured by ELISA in the colon cultured supernatants of mice treated with AAV9-shCtrl-flag, AAV9-shJMJD1A-flag and AAV9-shJMJD1A-mCCL8 on day 14 after C. rodentium infection. The data were pooled from three independent experiments. Data shown in graphs are Mean ± SEM. P values were assessed with the one-way ANOVA. *P < 0.05; **P < 0.01.
https://doi.org/10.1371/journal.ppat.1014009.s010
(TIF)
S11 Fig. Co-infection of AAV9-mCCL8 rescues the defects of host defense against C. rodentium infection in JMJD1A-knockdown mice.
(A) Co-infection of AAV9-mCCL8 reduced the colonic C. rodentium load in JMJD1A-knockdown mice. Colonic C. rodentium load in mice treated with AAV9-shCtrl-flag, AAV9-shJMJD1A-flag, and AAV9-shJMJD1A-mCCL8 (n = 10) on day 14 after C. rodentium infection. (B) Representative pictures of H&E-stained colon sections (Left panel) and quantification of histopathology scores (Right panel) on day 14 after C. rodentium infection. JMJD1A knockdown exacerbated pathology, which was ameliorated by CCL8 overexpression. Scale bars represent 100 μm. n = 10. (C) Representative pictures of anti-C. rodentium immunohistochemistry staining of the colon sections (Left panel) and quantification of crypt invasion by C. rodentium (Right panel). JMJD1A knockdown increased bacterial crypt invasion, which was reduced by CCL8 overexpression. Brown signals represent C. rodentium. Scale bars represent 100 μm. n = 9. (D) Representative pictures of anti-F4/80 immunohistochemistry staining of the colon sections (Left panel) and quantification of F4/80+ cells (Right panel). JMJD1A knockdown reduced macrophages infiltration, which was rescued by CCL8 overexpression. Scale bars represent 100 μm. n = 7. (E) Representative pictures of anti-CD4 immunohistochemistry staining of the colon sections (Left panel) and quantification of CD4+ T cells (Right panel). Arrows represent positive cells. JMJD1A knockdown reduced CD4+ T cells infiltration, which was restored by CCL8 overexpression. Scale bars represent 100 μm. n = 7. (F) C. rodentium-specific IgG and IgA levels in colonic luminal contents on day 14 after C. rodentium infection. JMJD1A knockdown reduces IgG and IgA levels, which was increased by CCL8 overexpression. n = 9. The data were pooled from three independent experiments. Data shown in graphs are Mean ± SEM. Arrows represent positive cells. n = 9. P values were assessed with the one-way ANOVA statistical test. *P < 0.05; **P < 0.01; ***P < 0.001.
https://doi.org/10.1371/journal.ppat.1014009.s011
(TIF)
S12 Fig. Effects of JMJD1A on the health status of gut microbiota.
16S rRNA amplicon sequencing was performed on DNA extracted from colonic feces of naïve WT and JMJD1A-/- mice. (A) 3D-PCoA analysis of all samples by bray_curtis distance. (B) Beta diversity difference analysis. (C) GMHI index. (D) MDI index. (E) Taxonomc cladogram generated from LEfSe analysis of 16SrDNA gene sequences. Each circle’s size is proportional to the taxon’s abundance. (F) LDA score representing the taxonomic data with significant difference between WT and JMJD1A-/- mice. Only LDA scores>3 are shown. Red indicates enriched taxa in the WT mice. (G) The bar plot on genus level with significant difference between WT and JMJD1A-/- mice by Wilcoxon rank-sum test. (H) Proportion of the genus norank_f_Eubacterium_coprostanoligenes_group, Colidextribacter and norank_f_Erysipelotrichaceae with significant difference between WT and JMJD1A-/- mice.
https://doi.org/10.1371/journal.ppat.1014009.s012
(TIF)
S1 Data. Nineteen transcription factors exhibited significant changes from day 0 to day 7 post C. rodentium infection.
Related to Fig 1. Based on RNA-seq analysis of the colon, nineteen transcription factors exhibited significant changes from day 0 to day 7 post C. rodentium infection. Significantly differential genes were selected based on thresholds of |Fold change| > 1.5 and P < 0.05.
https://doi.org/10.1371/journal.ppat.1014009.s013
(XLSX)
References
- 1. Caballero-Flores G, Pickard JM, Núñez G. Regulation of Citrobacter rodentium colonization: virulence, immune response and microbiota interactions. Curr Opin Microbiol. 2021;63:142–9. pmid:34352594
- 2. Mullineaux-Sanders C, Sanchez-Garrido J, Hopkins EGD, Shenoy AR, Barry R, Frankel G. Citrobacter rodentium-host-microbiota interactions: immunity, bioenergetics and metabolism. Nat Rev Microbiol. 2019;17(11):701–15. pmid:31541196
- 3. Crepin VF, Collins JW, Habibzay M, Frankel G. Citrobacter rodentium mouse model of bacterial infection. Nat Protoc. 2016;11(10):1851–76. pmid:27606775
- 4. Hopkins EGD, Roumeliotis TI, Mullineaux-Sanders C, Choudhary JS, Frankel G. Intestinal epithelial cells and the microbiome undergo swift reprogramming at the inception of colonic citrobacter rodentium infection. mBio. 2019;10(2):e00062-19. pmid:30940698
- 5. Wiles S, Clare S, Harker J, Huett A, Young D, Dougan G, et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 2004;6(10):963–72. pmid:15339271
- 6. Atarashi K, Tanoue T, Ando M, Kamada N, Nagano Y, Narushima S, et al. Th17 cell induction by adhesion of microbes to intestinal epithelial cells. Cell. 2015;163(2):367–80. pmid:26411289
- 7. Silberger DJ, Zindl CL, Weaver CT. Citrobacter rodentium: a model enteropathogen for understanding the interplay of innate and adaptive components of type 3 immunity. Mucosal Immunol. 2017;10(5):1108–17. pmid:28612839
- 8. Seo S-U, Kuffa P, Kitamoto S, Nagao-Kitamoto H, Rousseau J, Kim Y-G, et al. Intestinal macrophages arising from CCR2(+) monocytes control pathogen infection by activating innate lymphoid cells. Nat Commun. 2015;6:8010. pmid:26269452
- 9. Kim Y-G, Kamada N, Shaw MH, Warner N, Chen GY, Franchi L, et al. The Nod2 sensor promotes intestinal pathogen eradication via the chemokine CCL2-dependent recruitment of inflammatory monocytes. Immunity. 2011;34(5):769–80. pmid:21565531
- 10. Kamada N, Sakamoto K, Seo S-U, Zeng MY, Kim Y-G, Cascalho M, et al. Humoral immunity in the gut selectively targets phenotypically virulent attaching-and-effacing bacteria for intraluminal elimination. Cell Host Microbe. 2015;17(5):617–27. pmid:25936799
- 11. Simmons CP, Clare S, Ghaem-Maghami M, Uren TK, Rankin J, Huett A, et al. Central role for B lymphocytes and CD4+ T cells in immunity to infection by the attaching and effacing pathogen Citrobacter rodentium. Infect Immun. 2003;71(9):5077–86. pmid:12933850
- 12. Bry L, Brigl M, Brenner MB. CD4+-T-cell effector functions and costimulatory requirements essential for surviving mucosal infection with Citrobacter rodentium. Infect Immun. 2006;74(1):673–81. pmid:16369024
- 13. Maaser C, Housley MP, Iimura M, Smith JR, Vallance BA, Finlay BB, et al. Clearance of Citrobacter rodentium requires B cells but not secretory immunoglobulin A (IgA) or IgM antibodies. Infect Immun. 2004;72(6):3315–24. pmid:15155635
- 14. Yamane K, Toumazou C, Tsukada Y, Erdjument-Bromage H, Tempst P, Wong J, et al. JHDM2A, a JmjC-containing H3K9 demethylase, facilitates transcription activation by androgen receptor. Cell. 2006;125(3):483–95. pmid:16603237
- 15. Okada Y, Scott G, Ray MK, Mishina Y, Zhang Y. Histone demethylase JHDM2A is critical for Tnp1 and Prm1 transcription and spermatogenesis. Nature. 2007;450(7166):119–23. pmid:17943087
- 16. Klose RJ, Kallin EM, Zhang Y. JmjC-domain-containing proteins and histone demethylation. Nat Rev Genet. 2006;7(9):715–27. pmid:16983801
- 17. Yoo J, Jeon YH, Cho HY, Lee SW, Kim GW, Lee DH, et al. Advances in histone demethylase KDM3A as a cancer therapeutic target. Cancers (Basel). 2020;12(5):1098. pmid:32354028
- 18. Kuroki S, Matoba S, Akiyoshi M, Matsumura Y, Miyachi H, Mise N, et al. Epigenetic regulation of mouse sex determination by the histone demethylase Jmjd1a. Science. 2013;341(6150):1106–9. pmid:24009392
- 19. Tateishi K, Okada Y, Kallin EM, Zhang Y. Role of Jhdm2a in regulating metabolic gene expression and obesity resistance. Nature. 2009;458(7239):757–61. pmid:19194461
- 20. Wan W, Peng K, Li M, Qin L, Tong Z, Yan J, et al. Histone demethylase JMJD1A promotes urinary bladder cancer progression by enhancing glycolysis through coactivation of hypoxia inducible factor 1α. Oncogene. 2017;36(27):3868–77. pmid:28263974
- 21. Wang H-Y, Long Q-Y, Tang S-B, Xiao Q, Gao C, Zhao Q-Y, et al. Histone demethylase KDM3A is required for enhancer activation of hippo target genes in colorectal cancer. Nucleic Acids Res. 2019;47(5):2349–64. pmid:30649550
- 22. Loh Y-H, Zhang W, Chen X, George J, Ng H-H. Jmjd1a and Jmjd2c histone H3 Lys 9 demethylases regulate self-renewal in embryonic stem cells. Genes Dev. 2007;21(20):2545–57. pmid:17938240
- 23. Liu L, Zhao Q, Kong M, Mao L, Yang Y, Xu Y. Myocardin-related transcription factor A regulates integrin beta 2 transcription to promote macrophage infiltration and cardiac hypertrophy in mice. Cardiovasc Res. 2022;118(3):844–58. pmid:33752236
- 24. Guo X, Zhang B-F, Zhang J, Liu G, Hu Q, Chen J. The histone demthylase KDM3A protects the myocardium from ischemia/reperfusion injury via promotion of ETS1 expression. Commun Biol. 2022;5(1):270. pmid:35338235
- 25. Saha P, Yeoh BS, Xiao X, Golonka RM, Singh V, Wang Y, et al. PAD4-dependent NETs generation are indispensable for intestinal clearance of Citrobacter rodentium. Mucosal Immunol. 2019;12(3):761–71. pmid:30710097
- 26. Polyak S, Mach A, Porvasnik S, Dixon L, Conlon T, Erger KE, et al. Identification of adeno-associated viral vectors suitable for intestinal gene delivery and modulation of experimental colitis. Am J Physiol Gastrointest Liver Physiol. 2012;302(3):G296-308. pmid:22114116
- 27. Schreiber HA, Loschko J, Karssemeijer RA, Escolano A, Meredith MM, Mucida D, et al. Intestinal monocytes and macrophages are required for T cell polarization in response to Citrobacter rodentium. J Exp Med. 2013;210(10):2025–39. pmid:24043764
- 28. Wang Y, Koroleva EP, Kruglov AA, Kuprash DV, Nedospasov SA, Fu Y-X, et al. Lymphotoxin beta receptor signaling in intestinal epithelial cells orchestrates innate immune responses against mucosal bacterial infection. Immunity. 2010;32(3):403–13. pmid:20226692
- 29. Xu L, Zhou X, Wang W, Wang Y, Yin Y, Laan LJW van der, et al. IFN regulatory factor 1 restricts hepatitis E virus replication by activating STAT1 to induce antiviral IFN-stimulated genes. FASEB J. 2016;30(10):3352–67. pmid:27328944
- 30. Lebeis SL, Bommarius B, Parkos CA, Sherman MA, Kalman D. TLR signaling mediated by MyD88 is required for a protective innate immune response by neutrophils to Citrobacter rodentium. J Immunol. 2007;179(1):566–77. pmid:17579078
- 31. Zhou Z, Yang W, Yu T, Yu Y, Zhao X, Yu Y, et al. GPR120 promotes neutrophil control of intestinal bacterial infection. Gut Microbes. 2023;15(1):2190311. pmid:36927391
- 32. Iimura M, Gallo RL, Hase K, Miyamoto Y, Eckmann L, Kagnoff MF. Cathelicidin mediates innate intestinal defense against colonization with epithelial adherent bacterial pathogens. J Immunol. 2005;174(8):4901–7. pmid:15814717
- 33. Bergstrom KSB, Kissoon-Singh V, Gibson DL, Ma C, Montero M, Sham HP, et al. Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa. PLoS Pathog. 2010;6(5):e1000902. pmid:20485566
- 34. Zheng Y, Valdez PA, Danilenko DM, Hu Y, Sa SM, Gong Q, et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nat Med. 2008;14(3):282–9. pmid:18264109
- 35. Collins JW, Keeney KM, Crepin VF, Rathinam VAK, Fitzgerald KA, Finlay BB, et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 2014;12(9):612–23. pmid:25088150
- 36. Bergstrom KSB, Morampudi V, Chan JM, Bhinder G, Lau J, Yang H, et al. Goblet cell derived RELM-β recruits CD4+ T cells during infectious colitis to promote protective intestinal epithelial cell proliferation. PLoS Pathog. 2015;11(8):e1005108. pmid:26285214
- 37. Pauwels A-M, Trost M, Beyaert R, Hoffmann E. Patterns, Receptors, and Signals: Regulation of Phagosome Maturation. Trends Immunol. 2017;38(6):407–22. pmid:28416446
- 38. Bain CC, Bravo-Blas A, Scott CL, Perdiguero EG, Geissmann F, Henri S, et al. Constant replenishment from circulating monocytes maintains the macrophage pool in the intestine of adult mice. Nat Immunol. 2014;15(10):929–37. pmid:25151491
- 39. Bry L, Brenner MB. Critical role of T cell-dependent serum antibody, but not the gut-associated lymphoid tissue, for surviving acute mucosal infection with Citrobacter rodentium, an attaching and effacing pathogen. J Immunol. 2004;172(1):433–41. pmid:14688352
- 40. Matsunaga Y, Clark T, Wanek AG, Bitoun JP, Gong Q, Good M, et al. Intestinal IL-17R signaling controls secretory IgA and oxidase balance in citrobacter rodentium infection. J Immunol. 2021;206(4):766–75. pmid:33431657
- 41. Jamwal DR, Laubitz D, Harrison CA, Figliuolo da Paz V, Cox CM, Wong R, et al. Intestinal epithelial expression of MHCII determines severity of chemical, T-cell-induced, and infectious colitis in mice. Gastroenterology. 2020;159(4):1342-1356.e6. pmid:32589883
- 42. Van Oss CJ, Gillman CF. Phagocytosis as a surface phenomenon. II. Contact angles and phagocytosis of encapsulated bacteria before and after opsonization by specific antiserum and complement. J Reticuloendothel Soc. 1972;12(5):497–502. pmid:4120360
- 43. Verstegen NJM, Ubels V, Westerhoff HV, van Ham SM, Barberis M. System-level scenarios for the elucidation of T cell-mediated germinal center B Cell differentiation. Front Immunol. 2021;12:734282. pmid:34616402
- 44. Unger P-PA, Verstegen NJM, Marsman C, Jorritsma T, Rispens T, Ten Brinke A, et al. Minimalistic in vitro culture to drive human naive B cell differentiation into antibody-secreting cells. Cells. 2021;10(5):1183. pmid:34066151
- 45. Gong X, Gong W, Kuhns DB, Ben-Baruch A, Howard OM, Wang JM. Monocyte chemotactic protein-2 (MCP-2) uses CCR1 and CCR2B as its functional receptors. J Biol Chem. 1997;272(18):11682–5. pmid:9115216
- 46. Gong W, Howard OM, Turpin JA, Grimm MC, Ueda H, Gray PW, et al. Monocyte chemotactic protein-2 activates CCR5 and blocks CD4/CCR5-mediated HIV-1 entry/replication. J Biol Chem. 1998;273(8):4289–92. pmid:9468473
- 47. Islam SA, Chang DS, Colvin RA, Byrne MH, McCully ML, Moser B, et al. Mouse CCL8, a CCR8 agonist, promotes atopic dermatitis by recruiting IL-5+ T(H)2 cells. Nat Immunol. 2011;12(2):167–77. pmid:21217759
- 48. Mason GM, Poole E, Sissons JGP, Wills MR, Sinclair JH. Human cytomegalovirus latency alters the cellular secretome, inducing cluster of differentiation (CD)4+ T-cell migration and suppression of effector function. Proc Natl Acad Sci U S A. 2012;109(36):14538–43. pmid:22826250
- 49. Severa M, Islam SA, Waggoner SN, Jiang Z, Kim ND, Ryan G, et al. The transcriptional repressor BLIMP1 curbs host defenses by suppressing expression of the chemokine CCL8. J Immunol. 2014;192(5):2291–304. pmid:24477914
- 50. Farmaki E, Kaza V, Chatzistamou I, Kiaris H. CCL8 promotes postpartum breast cancer by recruiting M2 macrophages. iScience. 2020;23(6):101217. pmid:32535027
- 51. Nguyen Hoang AT, Liu H, Juaréz J, Aziz N, Kaye PM, Svensson M. Stromal cell-derived CXCL12 and CCL8 cooperate to support increased development of regulatory dendritic cells following Leishmania infection. J Immunol. 2010;185(4):2360–71. pmid:20624948
- 52. Mirghomizadeh F, Bullwinkel J, Orinska Z, Janssen O, Petersen A, Singh PB, et al. Transcriptional regulation of mouse mast cell protease-2 by interleukin-15. J Biol Chem. 2009;284(47):32635–41. pmid:19801677
- 53. Van Coillie E, Van Aelst I, Fiten P, Billiau A, Van Damme J, Opdenakker G. Transcriptional control of the human MCP-2 gene promoter by IFN-gamma and IL-1beta in connective tissue cells. J Leukoc Biol. 1999;66(3):502–11. pmid:10496322
- 54. Chen X-J, Deng Y-R, Wang Z-C, Wei W-F, Zhou C-F, Zhang Y-M, et al. Hypoxia-induced ZEB1 promotes cervical cancer progression via CCL8-dependent tumour-associated macrophage recruitment. Cell Death Dis. 2019;10(7):508. pmid:31263103
- 55. Feng H, Zhang Y-B, Gui J-F, Lemon SM, Yamane D. Interferon regulatory factor 1 (IRF1) and anti-pathogen innate immune responses. PLoS Pathog. 2021;17(1):e1009220. pmid:33476326
- 56. Tang R, Yang G, Zhang S, Wu C, Chen M. Opposite effects of interferon regulatory factor 1 and osteopontin on the apoptosis of epithelial cells induced by TNF-α in inflammatory bowel disease. Inflamm Bowel Dis. 2014;20(11):1950–61. pmid:25208103
- 57. Siegmund B, Sennello JA, Lehr HA, Senaldi G, Dinarello CA, Fantuzzi G. Frontline: interferon regulatory factor-1 as a protective gene in intestinal inflammation: role of TCR gamma delta T cells and interleukin-18-binding protein. Eur J Immunol. 2004;34(9):2356–64. pmid:15307168
- 58. Schmalzl A, Leupold T, Kreiss L, Waldner M, Schürmann S, Neurath MF, et al. Interferon regulatory factor 1 (IRF-1) promotes intestinal group 3 innate lymphoid responses during Citrobacter rodentium infection. Nat Commun. 2022;13(1):5730. pmid:36175404
- 59. Horino J, Fujimoto M, Terabe F, Serada S, Takahashi T, Soma Y, et al. Suppressor of cytokine signaling-1 ameliorates dextran sulfate sodium-induced colitis in mice. Int Immunol. 2008;20(6):753–62. pmid:18381351
- 60. Madonna S, Scarponi C, Doti N, Carbone T, Cavani A, Scognamiglio PL, et al. Therapeutical potential of a peptide mimicking the SOCS1 kinase inhibitory region in skin immune responses. Eur J Immunol. 2013;43(7):1883–95. pmid:23592500
- 61. House IG, Derrick EB, Sek K, Chen AXY, Li J, Lai J, et al. CRISPR-Cas9 screening identifies an IRF1-SOCS1-mediated negative feedback loop that limits CXCL9 expression and antitumor immunity. Cell Rep. 2023;42(8):113014. pmid:37605534
- 62. Jin R, Zhou M, Lin F, Xu W, Xu A. Pathogenic Th2 cytokine profile skewing by IFN-γ-responding vitiligo fibroblasts via CCL2/CCL8. Cells. 2023;12(2):217. pmid:36672151
- 63. Wells JM, Rossi O, Meijerink M, van Baarlen P. Epithelial crosstalk at the microbiota-mucosal interface. Proc Natl Acad Sci U S A. 2011;108 Suppl 1(Suppl 1):4607–14. pmid:20826446
- 64. Brennan K, Lyons C, Fernandes P, Doyle S, Houston A, Brint E. Engagement of Fas differentially regulates the production of LPS-induced proinflammatory cytokines and type I interferons. FEBS J. 2019;286(3):523–35. pmid:30536547
- 65. Dai L, Tang Y, Zhou W, Dang Y, Sun Q, Tang Z, et al. Gut microbiota and related metabolites were disturbed in ulcerative colitis and partly restored after mesalamine treatment. Front Pharmacol. 2021;11:620724. pmid:33628183
- 66. Guo W, Mao B, Cui S, Tang X, Zhang Q, Zhao J, et al. Protective effects of a novel probiotic bifidobacterium pseudolongum on the intestinal barrier of colitis mice via modulating the Pparγ/STAT3 pathway and intestinal microbiota. Foods. 2022;11(11):1551. pmid:35681301
- 67. Gao Q, Tian W, Yang H, Hu H, Zheng J, Yao X, et al. Shen-Ling-Bai-Zhu-San alleviates the imbalance of intestinal homeostasis in dextran sodium sulfate-induced colitis mice by regulating gut microbiota and inhibiting the NLRP3 inflammasome activation. J Ethnopharmacol. 2024;319(Pt 1):117136. pmid:37704122
- 68. Liu X, Zhang Y, Li W, Zhang B, Yin J, Liuqi S, et al. Fucoidan ameliorated dextran sulfate sodium-induced ulcerative colitis by modulating gut microbiota and bile acid metabolism. J Agric Food Chem. 2022;70(47):14864–76. pmid:36378195
- 69. Kamada N, Kim Y-G, Sham HP, Vallance BA, Puente JL, Martens EC, et al. Regulated virulence controls the ability of a pathogen to compete with the gut microbiota. Science. 2012;336(6086):1325–9. pmid:22582016
- 70. Marchesi JR, Adams DH, Fava F, Hermes GDA, Hirschfield GM, Hold G, et al. The gut microbiota and host health: a new clinical frontier. Gut. 2016;65(2):330–9. pmid:26338727
- 71. Porras AM, Brito IL. The internationalization of human microbiome research. Curr Opin Microbiol. 2019;50:50–5. pmid:31683111
- 72. Porras AM, Shi Q, Zhou H, Callahan R, Montenegro-Bethancourt G, Solomons N, et al. Geographic differences in gut microbiota composition impact susceptibility to enteric infection. Cell Rep. 2021;36(4):109457. pmid:34320343
- 73. Bucher K, Rodríguez-Bocanegra E, Dauletbekov D, Fischer MD. Immune responses to retinal gene therapy using adeno-associated viral vectors - implications for treatment success and safety. Prog Retin Eye Res. 2021;83:100915. pmid:33069860
- 74. Shi N, Li N, Duan X, Niu H. Interaction between the gut microbiome and mucosal immune system. Mil Med Res. 2017;4:14. pmid:28465831
- 75. Parmar N, Burrows K, Vornewald PM, Lindholm HT, Zwiggelaar RT, Díez-Sánchez A, et al. Intestinal-epithelial LSD1 controls goblet cell maturation and effector responses required for gut immunity to bacterial and helminth infection. PLoS Pathog. 2021;17(3):e1009476. pmid:33788902
- 76. Zhang Y, Li B, Hong Y, Luo P, Hong Z, Xia X, et al. Histone demethylase JMJD2D protects against enteric bacterial infection via up-regulating colonic IL-17F to induce β-defensin expression. PLoS Pathog. 2024;20(6):e1012316. pmid:38905308
- 77. Liu Y, Peng J, Sun T, Li N, Zhang L, Ren J, et al. Epithelial EZH2 serves as an epigenetic determinant in experimental colitis by inhibiting TNFα-mediated inflammation and apoptosis. Proc Natl Acad Sci U S A. 2017;114(19):E3796–805. pmid:28439030
- 78. Navabi N, Whitt J, Wu S-E, Woo V, Moncivaiz J, Jordan MB, et al. Epithelial histone deacetylase 3 instructs intestinal immunity by coordinating local lymphocyte activation. Cell Rep. 2017;19(6):1165–75. pmid:28494866
- 79. Liu Z, Zhou S, Liao L, Chen X, Meistrich M, Xu J. Jmjd1a demethylase-regulated histone modification is essential for cAMP-response element modulator-regulated gene expression and spermatogenesis. J Biol Chem. 2010;285(4):2758–70. pmid:19910458
- 80. Chen W, Lu X, Chen Y, Li M, Mo P, Tong Z, et al. Steroid receptor coactivator 3 contributes to host defense against enteric bacteria by recruiting neutrophils via upregulation of CXCL2 expression. J Immunol. 2017;198(4):1606–15. pmid:28053238
- 81. Kang YJ, Otsuka M, van den Berg A, Hong L, Huang Z, Wu X, et al. Epithelial p38alpha controls immune cell recruitment in the colonic mucosa. PLoS Pathog. 2010;6(6):e1000934. pmid:20532209
- 82. Wang L, Luo J-Y, Li B, Tian XY, Chen L-J, Huang Y, et al. Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nature. 2016;540(7634):579–82. pmid:27926730
- 83. Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, et al. Metagenomic biomarker discovery and explanation. Genome Biol. 2011;12(6):R60. pmid:21702898
- 84. Chen W, Zheng W, Liu S, Su Q, Ding K, Zhang Z, et al. SRC-3 deficiency prevents atherosclerosis development by decreasing endothelial ICAM-1 expression to attenuate macrophage recruitment. Int J Biol Sci. 2022;18(15):5978–93. pmid:36263184