Viral inhibition of the anaphase promoting complex enhances replication by elevating nucleotide pools

Owen J. Chen; Cynthia Y. Feng; Paola Blanchette; Reese Jalal Ladak; Maximilian A. Crosby; Mariana de Sá Tavares Russo; Yilin Wang; Cristina Fernandez; Yingke Liang; David M. Sharon; Mohamed Moustafa-Kamal; Isabelle Gamache; Nahum Sonenberg; Daina Avizonis; Jose G. Teodoro

doi:10.1371/journal.ppat.1013930

Abstract

The anaphase promoting complex/cyclosome (APC/C) is a large, ubiquitin ligase and a central regulator of cell cycle progression. By targeting key substrates for degradation during mitosis and G1 phase, the APC/C coordinates metabolic fluctuations that occur during the cell cycle. A diverse range of viruses have convergently evolved mechanisms to bind and inhibit the APC/C; however, a molecular understanding for these interactions has never been demonstrated. Here, we use chicken anemia virus (CAV), a small single-stranded DNA virus encoding only three proteins, to demonstrate the importance of viral APC/C inhibition during replication. We show that the Vp3 protein of CAV inhibits the APC/C, causing a dramatic mitotic arrest during infection. The mutant virus lacking Vp3 is defective for replication and can be rescued by APC/C inhibition. Metabolomic profiling during CAV infection revealed that Vp3 expression mediates a broad increase in nucleotide pools. Moreover, viral inhibition of the APC/C resulted in stabilization of enzymes required for nucleotide biosynthesis. These findings suggest that the APC/C is a general target of many viruses to elevate nucleotide levels and facilitate viral genome replication.

Author summary

Viruses dramatically reshape the cells they infect in order to replicate. To do this efficiently, many viruses disrupt the host’s normal control systems, particularly those that regulate cell growth and division. One such system is the anaphase promoting complex/cyclosome (APC/C), a key cellular machine that controls when specific proteins are broken down during the cell cycle. Surprisingly, a wide range of viruses—including adenovirus, HIV, human papillomavirus, herpesvirus, and others—have been shown to interfere with the APC/C. Until now, however, it was unclear why so many unrelated viruses target this same pathway. In our study, we used chicken anemia virus (CAV), one of the smallest known animal viruses, as a simple model to uncover the underlying mechanism. CAV produces just three proteins, one of which—called Vp3—strongly inhibits the APC/C. We found that this inhibition increases the availability of nucleotides, the basic building blocks needed to copy viral DNA. By disrupting normal cell cycle control, the virus effectively redirects cellular resources toward its own replication. These findings reveal APC/C inhibition as a common and powerful strategy used by diverse viruses, offering new insight into how viruses exploit host cells and highlighting potential targets for future antiviral therapies.

Citation: Chen OJ, Feng CY, Blanchette P, Ladak RJ, Crosby MA, de Sá Tavares Russo M, et al. (2026) Viral inhibition of the anaphase promoting complex enhances replication by elevating nucleotide pools. PLoS Pathog 22(8): e1013930. https://doi.org/10.1371/journal.ppat.1013930

Editor: Cary A. Moody, University of North Carolina at Chapel Hill, UNITED STATES OF AMERICA

Received: January 27, 2026; Accepted: July 21, 2026; Published: August 12, 2026

Copyright: © 2026 Chen et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its Supporting Information files.

Funding: O.J. Chen is a recipient of the Doctoral Training Scholarship from the Fonds de recherche du Québec - Santé (FRQ-S), and the Canada Graduate Scholarship - Doctoral (CGS-D) from the Canadian Institutes of Health Research (CIHR). C.Y. Feng is a recipient of the Canada Graduate Scholarship - Master’s (CGS-M). This work is funded by a Project Grant from the CIHR to J.G. Teodoro, and a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada (NSERC) to J.G. Teodoro. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Viruses induce enormous changes in their host cells during the course of infection to facilitate replication. For example, viruses are well known to dysregulate cell cycle dynamics [1]. A diverse range of viruses have been demonstrated to associate with and inhibit a key cell cycle regulator known as the anaphase promoting complex/cyclosome (APC/C). Papillomavirus [2], adenovirus [3], herpesvirus [4], poxvirus [5], retrovirus [6] and anellovirus [7] have all been shown to encode proteins that bind and inactivate the APC/C. The APC/C is a large 1.5 MDa complex composed of at least fifteen subunits and is required for cell division in all eukaryotes [8]. The APC/C functions as an E3 ubiquitin ligase that targets specific substrates for degradation via the 26S proteasome at transition points in the cell cycle [8]. The APC/C must be bound to a co-activator to have ubiquitylation activity and has different substrate specificities depending upon which co-activator is bound [8]. During anaphase, the APC/C is bound to the co-activator CDC20, which is responsible for coordination of mitotic events by targeting substrates such as the mitotic cyclins and securin [8]. A second APC/C complex bound to the co-activator CDH1 exists in G1. APC/C^CDH1 has a unique set of substrates that control S phase entry and DNA replication [9–12]. The first characterized substrates of the APC/C were the mitotic A- and B-type cyclins [13]. For cell division to occur successfully, a series of events must be perfectly coordinated including DNA synthesis, spindle formation, and nuclear division.

We previously demonstrated that the Vp3 protein encoded by chicken anemia virus (CAV) binds to the APC/C and promotes the disassembly of the complex [7]. CAV is a small, single-stranded DNA virus in the Anelloviridae family and is among the smallest viruses that infect animals [14]. The CAV genome is 2.3 kilobases and encodes only three open reading frames (VP1, 2 and 3, see Fig 1A) [15,16]. Vp3, also referred to as apoptin, is a small 13.6 kDa protein that mediates the pathology of the virus in chickens [17]. CAV has a natural tropism for rapidly dividing cells and Vp3 has attracted considerable interest because it induces cell death preferentially in tumour cells [18–22]. Vp3 induces mitotic arrest in a manner that is dependent on binding the APC/C [7,23], but the importance of this function for viral replication has never been addressed.

Download:

Fig 1. Viral protein expression in CAV-infected MSB-1 cells induces mitotic arrest and result in a cytopathic effect.

(A) Schematic of the overlapping reading frames (ORFs) in the CAV genome coding for the three viral proteins of the virus. (B) Immunoblots showing the expression of Vp2 and Vp3 at 4-hour timepoints during CAV infection for 48 hours. Total lane protein is used as a loading control. (C) Flow cytometry analysis of mock- vs. CAV-infected cells stained with propidium iodide for DNA content at 24 hours post-infection (hpi). (D) Cell viability curves of mock- (black square) vs. CAV- (red circle) infected cells over the course of 48 hours. Cell viability was measured via trypan blue staining of infected cells every 4 hours. This figure is representative of three independent experiments.

https://doi.org/10.1371/journal.ppat.1013930.g001

Results

CAV infection results in mitotic arrest and a subsequent cytopathic effect

To determine how CAV affects cell cycle dynamics during a normal infection, we used an established infection model of CAV [17]. Chicken MDCC MSB-1 cells were infected with CAV and monitored for viral gene expression, cell cycle state and induction of cell death (Fig 1). Fig 1B shows that the CAV Vp3 protein is expressed starting approximately 16 hours post-infection (hpi). Flow cytometry at 24 hpi shows that infection results in a near complete mitotic arrest consistent with inhibition of the APC/C (Fig 1C). Starting at approximately 24 hpi, infected cells undergo a rapid cytopathic effect with all cells dead by 48 hpi, as shown by Trypan Blue staining in Fig 1D. Zombie Red staining (S1 Fig), a more sensitive fluorescence-based survival assay, demonstrated cell viability results similar to those in Fig 1D.

Vp3 is important for the replication and cytopathogenicity of CAV

To further understand the role of viral APC/C binding proteins during replication, we derived a mutant CAV that is defective for expression of VP3 (CAV Vp3-). As shown in the schematic in Fig 1A, the VP3 open reading frame (orf) is completely contained in an alternative reading frame within the VP2 replicase gene. Therefore, we derived CAV Vp3- such that the VP3 initiation codon is mutated, while maintaining the VP2 orf (Fig 2A). Fig 2B shows that viral replication of the CAV Vp3- mutant occurs at approximately one third of the wild-type CAV (CAV WT). Co-transfection of exogenous VP3 with the CAV Vp3- replicative form (RF) partially rescued the replication deficiency of the mutant virus (Fig 2C). Loss of VP3 expression was confirmed by immunoblot (Fig 2D).

Download:

Fig 2. Vp3 is important for the replicative efficiency and cytopathogenicity of CAV.

(A) Schematic of the mutagenesis strategy to generate the CAV Vp3- mutant construct. A T > C point mutation was made to abolish the start codon in the VP3 reading frame. This also results in a silent mutation in the alternate reading frame for VP2 and thus has no effect on the expression of VP2. (B) Viral growth curves for CAV WT (red circle) and CAV Vp3- (blue triangle) infected MSB-1 cells. Infected cells were taken every 4 hours for 48 hours and viral genomes were measured by qPCR at each timepoint. N = 3. (C) Quantification of viral genomes in MSB-1 cells transfected with CAV WT, CAV Vp3- or CAV Vp3- DNA with the p3XFLAG-VP3 expression vector. Transfected cells were taken every 24 hours for 72 hours and viral genomes were measured by qPCR at each timepoint. N = 3; *, P < 0.05 for all samples. (D) Immunoblots showing the temporal differences in Vp2 expression in the CAV WT vs. CAV Vp3- infections of MSB-1 cells. The Vp2 blot is shown at two different exposures (exp). Hpi, hours post-infection. Total lane protein is used as the loading control. (E) Flow cytometry analysis of mock, CAV WT, and CAV Vp3- infected cells stained with propidium iodide for DNA content at 24 hours post-infection (hpi). (F) Cell viability curves of mock (black square), CAV WT (red circle) and CAV Vp3- (blue triangle) infected cells over the course of 48 hours. Cell viability was measured via Trypan Blue staining of infected cells every 4 hours. N = 3. (G) Quantification of viral genomes by qPCR at the 72-hour timepoint of mock, CAV WT and CAV Vp3- infections in MSB-1 cells, as well as CAV Vp3- infected cells treated with TAME, relative to the CAV WT infection. N = 3; *, P < 0.05.

https://doi.org/10.1371/journal.ppat.1013930.g002

Interestingly, viral gene expression appeared to be delayed and much lower in the CAV Vp3- mutant with expression of the Vp2 replicase protein only becoming apparent 72 hpi compared to 48 hpi in the CAV WT (Fig 2D). Moreover, the pronounced induction of mitotic arrest observed with the WT virus was absent in the CAV Vp3-, suggesting that the Vp3 protein is required for the cell cycle arrest (Fig 2E). Similarly, the cytopathic effect of the virus was also lost in the CAV Vp3- mutant (Fig 2F). Since the Vp3 protein binds and inactivates the APC/C complex [7], we then examined whether inhibition of the APC/C could rescue the defect in replication of CAV Vp3-. In Fig 2G, we show that treatment with 10 µM of the APC/C inhibitor tosyl-L-Arginine Methyl Ester (TAME) can greatly rescue the replication defect caused by loss of Vp3. Previous studies have shown that the IC₅₀ for proTAME in many cell types fall within the ~ 4–15 µM range, placing 10 µM squarely within the standard effective window for APC/C inhibition [24]. At this concentration, the primary observed effect is a reversible mitotic arrest due to APC/C inhibition, rather than nonspecific toxicity. These data suggest that by interacting and inhibiting the APC/C, the Vp3 protein induces a cell state that is more amenable to viral replication.

Vp3 induces a metabolic environment that is favourable for nucleotide biosynthesis

We hypothesized that the Vp3 protein may enhance replication by inducing a more favourable metabolic state for viral replication. To test this hypothesis, metabolic profiling was performed on MSB-1 cells that were mock, CAV or CAV Vp3- infected. Metabolites of infected cells were extracted and quantified using liquid chromatography coupled to mass spectroscopy (LC-MS). Over 150 different metabolites were detected and quantitated (S1 and S2 Tables). S2 Fig shows a principal component analysis (PCA) plot of the metabolic changes observed in each of the replicate mock, CAV and CAV Vp3- samples. The PCA plot shows that there are major differences in metabolic profiles following infection with CAV. Mock infection and infection with the CAV Vp3- mutant clustered closer together, whereas the samples from WT-infected cells clustered tightly within a discrete outlying area of the plot. In Fig 3A, pathway analysis was performed by using the MetaboAnalyst software to identify the most affected metabolic pathways during CAV infection. Intriguingly, pyrimidine and purine metabolism were two of the most significantly impacted pathways following infection (Fig 3A and S3 Table). The heat map in Fig 3B shows that a wide range of intermediate metabolites in pyrimidine and purine metabolism were elevated in CAV-infected cells but not in the CAV Vp3- infection. These data demonstrate a shift in host cell nucleic acid metabolism during CAV infection to facilitate viral genome replication.

Download:

Fig 3. Vp3 induces a metabolic state that is more conducive to nucleotide metabolism.

(A) Pathways analysis from comparing metabolites of MSB-1 cells infected with CAV WT relative to that of CAV Vp3- at 24 hours. The metabolites of the infected cellular extracts were analyzed by LC-MS. Raw metabolite data were analyzed and presented using the MetaboAnalyst web-based software. Pathway importance is a combination of pathway impact score (the higher score, the higher the biological impact of the pathway – x axis) and significance (the higher the -log₁₀(P) value, the more statistically significant those changes are for the pathway – y axis). The colour of each circle is based on the enrichment P value (white-red gradient, where redness indicates more enrichment), while the size of each plot represents the impact value. N = 4. (B) Heatmap visualizing the changes in all nucleotides and derivatives detected by LC-MS in the CAV WT and CAV Vp3- infections from (A), as well as mock infection. Values are colour-coded on a blue-red gradient and are centred around 0, at which no relative change in levels is detected.

https://doi.org/10.1371/journal.ppat.1013930.g003

APC/C inhibition by Vp3 elevates the expression of APC/C substrates involved in nucleotide biogenesis

The APC/C regulates mitotic progression by targeting substrates for degradation in the form of APC/C^CDC20. Inhibition of the APC/C by Vp3, as demonstrated in the aforementioned experiments, explains the resulting mitotic arrest and cytopathogenicity from CAV infection. However, in addition to its mitotic functions, the APC/C complexed with CDH1 controls S-phase entry by targeting a variety of substrates including nucleotide biosynthetic enzymes. At the G1-S boundary, APC/C^CDH1 is inactivated allowing the stabilization of enzymes including ribonucleotide reductase regulatory subunit M2 (RRM2) [25], thymidine kinase 1 (TK1) [26], and thymidylate kinase (TMPK) [27]. We therefore hypothesized that viral targeting of the APC/C may be a mechanism to stabilize enzymes required for nucleotide biosynthesis. To test this possibility, we examined the expression of RRM2 in MSB-1 cells infected with CAV. Fig 4A shows that at 24 hpi expression, the protein levels of RRM2 are elevated compared to the mock infection or the CAV Vp3- infection. A time course of infection showed that RRM2 levels become elevated as Vp3 expression becomes detectable at approximately 12 hpi (Fig 4B). Fig 4C shows that the concentrations of deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP) and deoxythymidine triphosphate (dTTP) were all significantly elevated following CAV infection but were not affected in the CAV Vp3- infections. A similar trend was also observed for the other deoxynucleotide triphosphates (dNTPs). Despite the elevation in dNTPs, no significant changes were observed in the levels of the nitrogenous bases suggesting that these effects are due to enhanced salvage pathways rather than de novo biosynthesis (S3 Fig). Since we previously observed that the Vp3 protein can inhibit the APC/C when expressed alone [7], we determined if it can also stimulate nucleotide biosynthesis outside the context of a CAV infection. Fig 4D shows that when Vp3 was expressed in H1299 cells, there was an increase in the steady state levels of RRM2 and TK1. Importantly, the levels of the mRNAs encoding these enzymes were not affected in infected cells, suggesting that the elevated expression was due to increased protein stability (S4 Fig). Furthermore, we show that expression of Vp3 alone was able to significantly elevate production of dTMP, dTDP and dTTP (Fig 4E), indicating that the protein is both necessary and sufficient to elevate nucleotide levels. The overexpression of Vp3 alone in H1299 cells, however, did not alter the overall metabolic profile of cells (S5 Fig and S4 & S5 Tables). Finally, to truely demonstrate that RRM2 is indeed an APC/C substrate targeted by CAV during infection, we show that 0.1-0.2 mM hydroxyurea (HU), a well-characterized inhibitor of RRM2, was able to reverse the rescued replication defect of CAV Vp3- by TAME (Fig 4F and 4G). Higher doses of HU (2 mM) can inhibit the cell cycle in S-phase but only one tenth of this concentration was sufficient to suppress CAV replication. Taken together, these data show that viral targeting of the APC/C is a mechanism to elevate cellular biosynthesis of nucleotides and maximize viral replication.

Download:

Fig 4. Vp3 is necessary and sufficient to increase nucleotide synthesis by elevating levels of APC/C substrates that are involved in nucleotide biosynthesis.

(A) Immunoblots comparing the expression of RRM2 and TK1, both substrates of the APC/C, in lysates of MSB-1 cells at 24 hours post-infection with mock, CAV WT or CAV Vp3-. Total lane protein is used as the loading control. (B) Immunoblots tracking the temporal changes in RRM2 expression in MSB-1 cells during the initial hours of CAV WT infection. Timepoints were taken every 4 hours for the first 20 hours of CAV infection. The Vp3 blot is shown at two different exposures (exp). Total lane protein is used as the loading control. (C) Normalized levels of dTTP, its precursors and the other dNTPs compared across the different infection conditions from (A). N = 4. (D) Immunoblots showing the expression of APC/C substrates involved in nucleotide biosynthesis in H1299 cells overexpressing the Vp3 protein via the FLAG-tagged Vp3 adenovirus (Ad-Vp3). The Ad-lacZ virus was used in the control infections. Infected cells were harvested at the 24- and 48-hour timepoints post-infection. Cyclin B1 is used as a mitotic marker. Total lane protein is used as the loading control. (E) Normalized levels of dTTP and its precursors compared across the different infection conditions from (D). N = 4. (F) Viral growth curves for mock, CAV WT and CAV Vp3- infected MSB-1 cells, along with different combinations of treatment with TAME and/or hydroxyurea (HU). Infected cells were taken every 24 hours for 72 hours and viral genomes were measured by qPCR at each timepoint. N = 3. (G) Quantification of viral genomes by qPCR at the 72-hour timepoint of mock, CAV WT and CAV Vp3- infections in MSB-1 cells, along with different combinations of treatment with TAME and/or hydroxyurea (HU). N = 3. *, P < 0.05; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

https://doi.org/10.1371/journal.ppat.1013930.g004

Discussion

DNA viruses are known to profoundly alter host metabolic pathways to enhance ribonucleotide production during replication (reviewed in [28]). For example, small DNA tumour viruses encode oncogenes that sequester the retinoblastoma (Rb) tumour suppressor, thereby activating the E2F transcription factor. E2F is a key regulator of S-phase entry and drives the expression of genes involved in DNA synthesis, including RRM2 and TK1. In contrast, larger DNA viruses, such as poxviruses and herpesviruses, often encode viral homologs of RRM2 and TK1, enabling them to directly augment nucleotide biosynthesis [28].

In the current study, we used CAV to study the impact of viral APC/C inhibition on viral replication. Our findings demonstrate the importance of viral inhibition of the APC/C in upregulating nucleotide biosynthesis to facilitate viral replication. This mechanistic finding can be extended to a diverse range of viruses to explain why they have convergently evolved to inhibit the APC/C. CAV is one of the smallest viruses that causes pathology in animals with a genome of only 2.3 kilobases [15]. Despite encoding only three polypeptides, the virus has maintained the inhibitory interaction with the APC/C, underscoring the importance of targeting this complex. The CAV Vp3 protein induces the disassembly of the APC/C by binding the large scaffold subunit of the APC/C called APC1 [7]. Similar changes are observed during infections with human cytomegalovirus (HCMV), a betaherpesvirus [4,29–31], and HIV, whose VPR protein also binds APC1 and stimulates its degradation [6]. Besides binding to the APC1 scaffold protein, other viral APC/C inhibitory mechanisms have been reported. The adenovirus E4orf4 protein was shown to recruit the PP2A phosphatase to the APC/C resulting in the dephosphorylation and inactivation of the complex [3] and the human papillomavirus (HPV) E2 protein was shown to bind and sequester both the CDH1 and CDC20 co-activators of the APC/C [2]. Perhaps the most dramatic example of viral APC/C inhibition is observed in some types of poxviruses. Orf virus (ORFV) is a poxvirus that encodes a viral homolog of the catalytic APC11 subunit of the APC/C termed the poxvirus APC/cyclosome regulator (PACR) [5]. The PACR protein is catalytically inert and displaces the endogenous APC11 resulting in an inactive APC/C [32]. In all these studies, viruses appear to inactivate both the APC/C^CDH1 and the APC/C^CDC20 complexes. These two complexes have very different effects on cell cycle progression. APC/C^CDH1 has an inhibitory effect on the cell cycle progression by elevating levels of CDK inhibitors such as p21, p57 and p27 [33,34]. APC/C^CDH1 inhibition and transition to S phase in CAV-infected cells would be needed for the elevation of nucleotide pools to facilitate viral genome replication. In contrast, APC/C^CDC20 is absolutely required for mitotic progression and as observed in CAV-infected cells, inhibition of both complexes would be predicted to result in mitotic arrest.

Despite the numerous studies showing viral inhibition with the APC/C, a molecular understanding of the role of these interactions during infection has never been shown. Although APC/C inhibition may enhance viral replication through more than one mechanism, the metabolomics data presented in this study suggest that upregulation of nucleotide biosynthesis is a key benefit of virally-induced APC/C inhibition. Other evidence also points to the importance of APC/C inhibition to elevate nucleotide pools. For example, poxviruses either encode a copy of PACR or a viral thymidine kinase but never both, suggesting that these two proteins have redundant functions in stimulating nucleotide production [5,35]. Similarly, although most herpesviruses encode a copy of thymidine kinase, HCMV, which is known to inhibit the APC/C with its pUL97 and pUL21 proteins during infection, does not [4,29–31]. The work presented here defines a previously unappreciated importance for APC/C inhibition that is broadly applicable to a wide range of viruses.

Methods and methods

Cell lines and maintenance of cell culture

Marek’s Disease chicken cell (MDCC) MSB-1 cells (CLS Cell Lines Service), a chicken lymphoblastoid cell line immortalized by Marek’s Disease Virus (MDV), were cultured in RPMI-1640 (Wisent Bioproducts) supplemented with 10% fetal bovine serum (Sigma, Canadian origin) and 50 μg/mL gentamycin (Wisent Bioproducts). Cells were kept at 41°C under 5% CO₂ atmosphere. MSB-1 cells were split every 2 days and maintained at a density of 0.3–1.5 × 10⁶ cells/mL. H1299 cells (ATCC) were cultured using DMEM (Wisent Bioproducts) with 10% FBS and were split every 2–3 days. H1299 cells were maintained at 37°C under 5% CO₂ atmosphere.

Plasmids

The full-length Cux-1 strain CAV genome (Genbank accession number NC_001427, from Dr. Mathieu Noteborn) was ligated into the pIC20H expression plasmid and was amplified in DH5α Escherichia coli. The CAV VP3- mutant construct was made by introducing a single point mutation in the ATG start codon of the VP3 ORF via site-directed mutagenesis (see Fig 2a): here, the T > C nucleotide change results in a missense mutation (Met to Thr) that eliminates the start codon of the VP3 ORF, while the coding sequence for VP2 remains intact as it is a silent mutation (Asn to Asn) in the overlapping VP2 ORF. VP3 cDNA was cloned into the p3XFLAG-myc-CMV-26 expression vector (Sigma).

Replicative form (RF) viral DNA preparation, transfection, and virus production

To obtain the replicative form (RF) of CAV for virus production, the purified pIC20H CAV WT or VP3- plasmid was linearized by EcoRI and BglI. The linearized CAV genome was purified by agarose gel and re-circularized with T4 DNA ligase (NEB) at a low concentration (1 ng/mL) to maximize intramolecular ligation. The circular, RF CAV was then recovered using a silica spin column, following the PCR clean-up instructions from the GenepHlow Gel/PCR Kit (Geneaid). Circular RF CAV was confirmed by agarose gel before transfection.

For virus production, 400–900 ng of circular RF CAV WT or CAV VP3- were electroporated into 2 × 10⁶ MSB-1 cells (seeded at a density of 3 × 10⁵ cells/mL the day before) using the AMAXA Nucleofector II device (custom T-001 setting) and Reagent Kit T (Lonza). Following electroporation, cells were resuspended in growth media at 3 × 10⁵ cells/mL to recover for 1 hour at 41°C and washed with phosphate buffered saline (PBS) to remove residual RF CAV. Cells were grown for 3 days post-transfection, and 140 μL of the cell suspension was taken every 24 hours (or otherwise specified) for viral genome quantification. After 72 hours, cells were lysed by three freeze-thaw cycles and the liberated virus in the media was filtered through a 0.45-μm membrane (Corning) to collect the cell-free viral supernatant. A final 140-μL sample was taken for viral genome quantification. Viral supernatants were stored at –80°C until use for infection.

Viral genome quantification

Viral DNA was extracted from the 140-μL samples of virus-containing MSB-1 cells and filtered cell-free viral supernatants using the QIAamp Viral RNA Mini Kit (QIAGEN) according to the manufacturer’s instructions. Extracted DNA was digested with DpnI remove traces of bacterial RF CAV from the initial electroporation step. Viral genomes were quantified by qPCR based on a standard curve generated by known dilutions of pIC20H-CAV DNA, using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and the CFX Connect Real-Time PCR System (Bio-Rad). Primers for qPCR targeted the VP1 gene (common to both the CAV WT and CAV Vp3-) in such a way that the resulting amplicon spanned a DpnI restriction site. The primer sequences used are as follows: forward – ATGACCCTGCAAGACATGGG; reverse – CTTTTTGCCACCGGTTCTGG. Following viral genome quantification, the concentrations of both CAV WT and Vp3- supernatants were equalized by the addition of fresh media.

CAV infection of MSB-1 cells

MDCC MSB-1 cells were seeded at 3 × 10⁵ cells/mL one day prior to infection. Five-mL aliquots of virus-laden media of at least 5 × 10⁸ viral genomes/mL were thawed and used to resuspend 10 million MSB-1 cells for each infection. Cells were incubated with WT or Vp3- virus (or media for mock infection) for 1 hour at 41°C. The viral suspension was then removed, and the infected cells were washed with PBS. Finally, the infected cells were resuspended at 3 × 10⁵ cells/mL with regular growth media. Cell suspension aliquots of 140 μL of each infection were taken at specific timepoints post-infection where needed and viral genomes were quantified as described above.

Cell counts and viability

At specific timepoints post-infection, cells of each infection were counted using a hemocytometer and percent cell viability was determined by Trypan Blue staining (1:10, dye: cells) under light microscopy. For the Zombie Red viability experiment, at the specific time point, 1 million cells were washed and incubated 30 minutes in a 1/1000 dilution of Zombie Red (BioLegend), washed and fixed with methanol and stored at -20C. Prior to analysis by flow cytometry, cells were washed and resuspended in PBS + 2% FBS. Cells were analyzed using the LSRFortessa (BD Biosciences) and the data were analyzed with the FlowJo software.

Cell cycle analysis (flow cytometry)

Cells of each infection were collected and fixed with ice-cold ethanol. Cells were stained with propidium iodide (PI, from Sigma) solution (100 ug/mL PI, 0.2 mg/mL RNase A, 0.6% Nonident P-40 in PBS). Cellular DNA was analyzed using the LSRFortessa (BD Biosciences). Data were analyzed with Flowing Software 2.5.1.

Western blotting

Infected MSB-1 cells taken at different timepoints post-infection were lysed in 1 × Laemmli buffer (diluted in ddH₂O from a 4 × stock: 200 mM Tris-HCl pH 6.8, 4% SDS, 40% glycerol, 4% β-mercaptoethanol, 0.012% bromophenol blue, and 50 mM DTT). Cell pellets were sonicated, and DNA was further sheared using a 23-gauge needle (BD PrecisionGlide) and a 1-cc syringe (BD). Twenty micrograms of total protein were separated by SDS-PAGE and probed with antibodies against Vp2 (custom made), Vp3 (Dr. Mahvash Tavassoli Lab), RRM2 (Invitrogen), TK1 (Santa Cruz), Cyclin B1 (Santa Cruz), FLAG (Sigma), and TMPK (Dr. Zee-Fan Chang Lab). Total lane protein was used as the loading control. Polyacrylamide gels with 0.5% (by volume) of 2,2,2-trichloroethanol (TCE, from Sigma) were used to resolve total protein, after which the gel was activated using the ChemiDoc XRS+ stain-free enabled UV transilluminator (Bio-Rad) with Image Lab 6.0.1 (Bio-Rad) to visualize total lane protein. Total protein transferred onto PVDF membranes was also visualized with the ChemiDoc XRS + UV transilluminator.

Vp3- rescue experiments

For the Vp3 rescue experiment, 1 μg of the p3XFLAG-myc-CMV-26 plasmid expressing exogenous VP3 was co-transfected with the circular RF CAV VP3- genome as described above. For the TAME rescue experiment, CAV Vp3- virus was used to infected MSB-1 cells as described above. Immediately following infection, pro-N-4-tosyl-L-arginine methyl ester (proTAME) (Boston Biochem) in DMSO or DMSO only (vehicle) was added to culture media to a final concentration of 10 μM. In the case of the hydroxyurea experiment, upon addition of the proTAME, cells were split in three flasks and HU was added to reach a concentration of 0 mM (media only), 0.1 mM or 0.2 mM. For all rescue experiments, aliquots of cell suspensions were taken for quantification as described above.

Cell extraction for metabolite analysis

All LC-MS grade solvents and salts were purchased from Fisher (Ottawa, Ontario Canada: water, acetonitrile (ACN), Methanol (MeOH), formic acid, ammonium acetate and ammonium formate. The authentic metabolite standards and N-ethylmaleimide were purchase from Sigma-Aldrich Co. (Oakville, Ontario, Canada).

Cells were washed with ice-cold 150 mM ammonium formate solution pH of 7.4 containing 1 mg/mL N-ethylmaleimide to protect free thiols [36]. Cells were then scraped and extracted with 600 μL of 31.6% MeOH/36.3% ACN in H₂O (v/v also containing 1 mg/mL N-ethylmaleimide). Cells were lysed and homogenized by bead-beating for 30 seconds at 50 Hz using 4 ceramic beads (2 mm) per sample (TissueLyser II – Qiagen). Cellular extracts were partitioned into aqueous and organic layers following dimethyl chloride treatment and centrifugation. The aqueous supernatants were dried by vacuum centrifugation with sample temperature maintained at −4°C (Labconco, Kansas City MO, USA). Dried extracts were subsequently re-suspended in 50 μL of chilled H₂O and clarified by centrifugation at 1°C. Sample injection volumes for analyses were 5 μL per injection.

LC-MS

For targeted metabolite analysis, samples were injected onto an Agilent 6470 Triple Quadrupole (QQQ)–LC–MS/MS (Agilent Technologies). Chromatographic separation of metabolites was achieved by using a 1290 Infinity ultra-performance quaternary pump liquid chromatography system (Agilent Technologies). The mass spectrometer was equipped with a Jet Stream electrospray ionization source, and samples were analyzed in negative mode. The source-gas temperature and flow were set at 150 °C and 13 L min⁻¹, respectively, the nebulizer pressure was set at 45 psi, and capillary voltage was set at 2,000 V. Multiple reaction monitoring parameters (qualifier/quantifier ions and retention times) were either obtained or optimized using authentic metabolite standards.

Chromatographic separation of the isomers and other metabolites was achieved by using a Zorbax Extend C18 column 1.8 μm, 2.1 × 150mm² with guard column 1.8 μm, 2.1 × 5mm² (Agilent Technologies). The chromatographic gradient started at 100% mobile phase A (97% water, 3% methanol, 10 mM tributylamine, 15 mM acetic acid, 5 µM medronic acid) for 2.5 min, followed with a 5-min gradient to 20% mobile phase C (methanol, 10 mM tributylamine, 15 mM acetic acid, 5 µM medronic acid), a 5.5-min gradient to 45% C and a 7-min gradient to 99% C at a flow rate of 0.25 mL min⁻¹. This was followed by a 4-min hold time at 100% mobile phase C. The column was restored by washing with 99% mobile phase D (90% ACN) for 3 min at 0.25 mL min⁻¹, followed by an increase of the flow rate to 0.8 mL min⁻¹ over 0.5 min and a 3.85-min hold, after which the flow rate was decreased to 0.6 mL min⁻¹ over 0.15 min. The column was then re-equilibrated at 100% A over 0.75 min, during which the flow rate was decreased to 0.4 mL min⁻¹, and held for 7.65 min. One minute before the next injection, the flow was brought back to forward flow at 0.25 mL min⁻¹. For all LC–MS analyses, 5 μL of sample was injected. The column temperature was maintained at 35°C. Relative concentrations were determined from external calibration curves. Data were analyzed by using MassHunter Quantitative Data Analysis B.10.00 (Agilent Technologies). Data presented are peak area normalized by cell counts at the time of the cell extractions.

Analysis of metabolites

Data were analyzed and presented using the web-based platform MetaboAnalyst [37]. The one-factor Statistical Analysis module was used to generate the PCA plot of all infections. Data were normalized with log-transformation and auto-scaling before analysis. To compare the individual metabolites from the different infections, a one-way ANOVA with post-hoc Tukey’s HSD multiple comparisons tests were performed with a P value cutoff of 0.05. Next, the Pathways Analysis module was used to determine the significantly impacted molecular pathways in the CAV WT infections relative to the CAV Vp3- infections. Data were normalized with log-transformation and auto-scaling before analysis. The following pathway analysis parameters were selected: Scatter plot (Visualization method), Global Test (Enrichment method), Relative-betweeness Centrality (Topology measure). The G. gallus (KEGG) pathway library provided by the platform was selected as the Reference metabolome. To generate the heatmap comparing nucleotide changes, the one-factor Statistical Analysis module was used to analyze only nucleotides and their derivatives across all infection conditions. Data were normalized with log-transformation and auto-scaling before analysis. The following parameters were used to display the normalized data: Autoscale features (Standardization), Euclidean (Distance measure), Ward (Clustering method).

Overexpression of VP3 in H1299 cells

To express Vp3 in mammalian cells, the FLAG-tagged Vp3 adenovirus (Ad-Vp3) was used as described previously [7]. The Ad-lacZ virus was used as the control. Both Ad-Vp3 and Ad-lacZ viruses were generated and titered as described previously [7]. H1299 cells were seeded at around 60% confluency and were infected at an MOI of 35. Cells were harvested at the relevant timepoints and were processed for Western blot and metabolite analyses as described above.

Gene expression analysis by RT-qPCR

Total RNA was extracted from MSB-1 cells using the RNeasy Mini Kit (Qiagen). Nine hundred nanograms of total RNA were reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed using the SsoAdvanced SYBR Green Supermix (Bio-Rad) with the CFX Real-Time system (Bio-Rad). All reactions were performed in duplicate (technical). ACTB and GAPDH were used as reference genes for relative gene expression analysis via the 2^−ΔΔCT method. All primers were validated before assaying relative gene expression. qPCR primer sequences are listed as follows:

RRM2: GCATTTGCAGCAGTGGAAGG & TCACAGTGCAAACCCTCATC
TK1: GAGGGGCAGTTTTTCCCAG & GAGGATGCTCCCAAAAGCC
DTYMK (TMPK): GCTGGGAGCACGTAACATTG & ACTTGTGAAGGCCACTCCAG
ANAPC1: CACCCAGAGAACCTTTGCC & GCAGAGCCAAACACACAGAC
ANAPC4: GCTTCTGGGTGATGTAAGGC & CAAGAACCTGCCACCTCAG
GAPDH: CCCTGAGCTGAATGGGAAGC & TCAGCAGCAGCCTTCACTAC
ACTB: CGTTACTCCCACAGCCAGC & GGGCGACCCACGATAGATG

Statistical analysis

Statistical analysis was performed with the GraphPad Prism (Version 10) software (GraphPad) or on the web-based MetaboAnalyst platform [37]. For comparisons of more than two groups, an ordinary one-way ANOVA was performed followed by post hoc pairwise comparisons (Dunnett or Tukey multiple comparisons test). A P value <0.05 is considered statistically significant. For histograms and curves, data are expressed as mean ± SEM. For box & whisker plots, all data points are shown with the median, maximum and minimum. Biological replicates were used to generate the plots in the figures. A biological replicate for a given condition is defined by an independent sample measured in an experiment or a sample measured in an independently repeated experiment.

Supporting information

S1 Table. Raw data of metabolites of mock, CAV WT and CAV Vp3- infections in MSB-1 cells detected by LC-MS.

https://doi.org/10.1371/journal.ppat.1013930.s001

(CSV)

S2 Table. Normalized metabolite data of mock, CAV WT and CAV Vp3- infections.

https://doi.org/10.1371/journal.ppat.1013930.s002

(CSV)

S3 Table. Significance and impact scores for the pathways analysis of metabolites from MSB-1 cells infected with CAV WT vs. CAV Vp3.

https://doi.org/10.1371/journal.ppat.1013930.s003

(CSV)

S4 Table. Raw data of metabolites of H1299 cells overexpressing Ad-Vp3 and Ad-lacZ adenoviral constructs detected by LC-MS.

https://doi.org/10.1371/journal.ppat.1013930.s004

(CSV)

S5 Table. Normalized metabolite data of H1299 cells overexpressing Ad-Vp3 and Ad-lacZ adenoviral constructs.

https://doi.org/10.1371/journal.ppat.1013930.s005

(CSV)

S1 Fig. Cell viability of mock, CAV WT and CAV Vp3- infected MSB-1 cells quantified by the Zombie Red survival assay.

https://doi.org/10.1371/journal.ppat.1013930.s006

(DOCX)

S2 Fig. Principal component analysis (PCA) plot of the metabolic profiles of mock, CAV WT and CAV Vp3- infected MSB-1 cells at 24 hours post-infection.

https://doi.org/10.1371/journal.ppat.1013930.s007

(DOCX)

S3 Fig. Normalized levels of nitrogenous bases compared across mock, CAV WT and CAV Vp3- infections.

https://doi.org/10.1371/journal.ppat.1013930.s008

(DOCX)

S4 Fig. mRNA transcript levels of different enzymes involved in nucleotide synthesis during CAV infection.

https://doi.org/10.1371/journal.ppat.1013930.s009

(DOCX)

S5 Fig. Heatmap visualizing the changes of the top 50 metabolites detected by LC-MS in H1299 cells infected with the Ad-lacZ and Ad-Vp3 adenoviral constructs, as well as mock infection.

https://doi.org/10.1371/journal.ppat.1013930.s010

(DOCX)

S1 File. Raw Gel: Uncropped images of all immunoblots used in the figures of this article.

https://doi.org/10.1371/journal.ppat.1013930.s011

(PDF)

Acknowledgments

We thank the support of the Metabolomics Innovation Resource Core at the Goodman Cancer Institute for the assistance in experimental design and data collection. We also acknowledge the support from the McGill Flow Cytometry Innovation Platform. The Vp3 and TMPK antibodies were gifts from Dr. Mahvash Tavassoli and Dr. Zee-Fan Chang, respectively.

References

1. Mo M, Shahar S, Fleming SB, Mercer AA. How viruses affect the cell cycle through manipulation of the APC/C. Trends Microbiol. 2012;20(9):440–8. pmid:22727131
- View Article
- PubMed/NCBI
- Google Scholar
2. Bellanger S, Blachon S, Mechali F, Bonne-Andrea C, Thierry F. High-risk but not low-risk HPV E2 proteins bind to the APC activators Cdh1 and Cdc20 and cause genomic instability. Cell Cycle. 2005;4(11):1608–15. pmid:16222116
- View Article
- PubMed/NCBI
- Google Scholar
3. Kornitzer D, Sharf R, Kleinberger T. Adenovirus E4orf4 protein induces PP2A-dependent growth arrest in Saccharomyces cerevisiae and interacts with the anaphase-promoting complex/cyclosome. J Cell Biol. 2001;154(2):331–44. pmid:11470822
- View Article
- PubMed/NCBI
- Google Scholar
4. Tran K, Mahr JA, Choi J, Teodoro JG, Green MR, Spector DH. Accumulation of substrates of the anaphase-promoting complex (APC) during human cytomegalovirus infection is associated with the phosphorylation of Cdh1 and the dissociation and relocalization of APC subunits. J Virol. 2008;82(1):529–37. pmid:17942546
- View Article
- PubMed/NCBI
- Google Scholar
5. Mo M, Fleming SB, Mercer AA. Cell cycle deregulation by a poxvirus partial mimic of anaphase-promoting complex subunit 11. Proc Natl Acad Sci U S A. 2009;106(46):19527–32. pmid:19887645
- View Article
- PubMed/NCBI
- Google Scholar
6. Barbosa JAF, Sparapani S, Boulais J, Lodge R, Cohen ÉA. Human Immunodeficiency Virus Type 1 Vpr Mediates Degradation of APC1, a Scaffolding Component of the Anaphase-Promoting Complex/Cyclosome. J Virol. 2021;95(15):e0097120. pmid:34011540
- View Article
- PubMed/NCBI
- Google Scholar
7. Teodoro JG, Heilman DW, Parker AE, Green MR. The viral protein Apoptin associates with the anaphase-promoting complex to induce G2/M arrest and apoptosis in the absence of p53. Genes Dev. 2004;18(16):1952–7. pmid:15314021
- View Article
- PubMed/NCBI
- Google Scholar
8. Peters J-M. The anaphase promoting complex/cyclosome: a machine designed to destroy. Nat Rev Mol Cell Biol. 2006;7(9):644–56. pmid:16896351
- View Article
- PubMed/NCBI
- Google Scholar
9. Kramer ER, Scheuringer N, Podtelejnikov AV, Mann M, Peters JM. Mitotic regulation of the APC activator proteins CDC20 and CDH1. Mol Biol Cell. 2000;11(5):1555–69. pmid:10793135
- View Article
- PubMed/NCBI
- Google Scholar
10. Sorensen CS, Lukas C, Kramer ER, Peters JM, Bartek J, Lukas J. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis. Mol Cell Biol. 2000;20(20):7613–23. pmid:11003657
- View Article
- PubMed/NCBI
- Google Scholar
11. Shreeram S, Sparks A, Lane DP, Blow JJ. Cell type-specific responses of human cells to inhibition of replication licensing. Oncogene. 2002;21(43):6624–32. pmid:12242660
- View Article
- PubMed/NCBI
- Google Scholar
12. Bashir T, Dorrello NV, Amador V, Guardavaccaro D, Pagano M. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature. 2004;428(6979):190–3. pmid:15014502
- View Article
- PubMed/NCBI
- Google Scholar
13. Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, et al. The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell. 1995;6(2):185–97. pmid:7787245
- View Article
- PubMed/NCBI
- Google Scholar
14. Feng C, Liang Y, Teodoro JG. The Role of Apoptin in Chicken Anemia Virus Replication. Pathogens. 2020;9(4):294. pmid:32316372
- View Article
- PubMed/NCBI
- Google Scholar
15. Noteborn MH, de Boer GF, van Roozelaar DJ, Karreman C, Kranenburg O, Vos JG, et al. Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. J Virol. 1991;65(6):3131–9. pmid:1851873
- View Article
- PubMed/NCBI
- Google Scholar
16. Phenix KV, Meehan BM, Todd D, McNulty MS. Transcriptional analysis and genome expression of chicken anaemia virus. J Gen Virol. 1994;75 (Pt 4):905–9. pmid:8151304
- View Article
- PubMed/NCBI
- Google Scholar
17. Noteborn MH, Todd D, Verschueren CA, de Gauw HW, Curran WL, Veldkamp S, et al. A single chicken anemia virus protein induces apoptosis. J Virol. 1994;68(1):346–51. pmid:8254747
- View Article
- PubMed/NCBI
- Google Scholar
18. Danen-Van Oorschot AA, Fischer DF, Grimbergen JM, Klein B, Zhuang S, Falkenburg JH, et al. Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells. Proc Natl Acad Sci U S A. 1997;94(11):5843–7. pmid:9159162
- View Article
- PubMed/NCBI
- Google Scholar
19. Zhuang SM, Shvarts A, van Ormondt H, Jochemsen AG, van der Eb AJ, Noteborn MH. Apoptin, a protein derived from chicken anemia virus, induces p53-independent apoptosis in human osteosarcoma cells. Cancer Res. 1995;55(3):486–9. pmid:7834613
- View Article
- PubMed/NCBI
- Google Scholar
20. Leliveld SR, Zhang Y-H, Rohn JL, Noteborn MHM, Abrahams JP. Apoptin induces tumor-specific apoptosis as a globular multimer. J Biol Chem. 2003;278(11):9042–51. pmid:12496278
- View Article
- PubMed/NCBI
- Google Scholar
21. Danen-Van Oorschot AAAM, Zhang Y-H, Leliveld SR, Rohn JL, Seelen MCMJ, Bolk MW, et al. Importance of nuclear localization of apoptin for tumor-specific induction of apoptosis. J Biol Chem. 2003;278(30):27729–36. pmid:12754198
- View Article
- PubMed/NCBI
- Google Scholar
22. Heilman DW, Teodoro JG, Green MR. Apoptin nucleocytoplasmic shuttling is required for cell type-specific localization, apoptosis, and recruitment of the anaphase-promoting complex/cyclosome to PML bodies. J Virol. 2006;80(15):7535–45. pmid:16840333
- View Article
- PubMed/NCBI
- Google Scholar
23. Lanz HL, Zimmerman RME, Brouwer J, Noteborn MHM, Backendorf C. Mitotic catastrophe triggered in human cancer cells by the viral protein apoptin. Cell Death Dis. 2013;4(2):e487. pmid:23392175
- View Article
- PubMed/NCBI
- Google Scholar
24. Zeng X, Sigoillot F, Gaur S, Choi S, Pfaff KL, Oh D-C, et al. Pharmacologic inhibition of the anaphase-promoting complex induces a spindle checkpoint-dependent mitotic arrest in the absence of spindle damage. Cancer Cell. 2010;18(4):382–95. pmid:20951947
- View Article
- PubMed/NCBI
- Google Scholar
25. Chabes AL, Pfleger CM, Kirschner MW, Thelander L. Mouse ribonucleotide reductase R2 protein: a new target for anaphase-promoting complex-Cdh1-mediated proteolysis. Proc Natl Acad Sci U S A. 2003;100(7):3925–9. pmid:12655059
- View Article
- PubMed/NCBI
- Google Scholar
26. Ke P-Y, Chang Z-F. Mitotic degradation of human thymidine kinase 1 is dependent on the anaphase-promoting complex/cyclosome-CDH1-mediated pathway. Mol Cell Biol. 2004;24(2):514–26. pmid:14701726
- View Article
- PubMed/NCBI
- Google Scholar
27. Ke P-Y, Kuo Y-Y, Hu C-M, Chang Z-F. Control of dTTP pool size by anaphase promoting complex/cyclosome is essential for the maintenance of genetic stability. Genes Dev. 2005;19(16):1920–33. pmid:16103219
- View Article
- PubMed/NCBI
- Google Scholar
28. Lo S-Y, Lai M-J, Yang C-H, Li H-C. Unveiling the Connection: Viral Infections and Genes in dNTP Metabolism. Viruses. 2024;16(9):1412. pmid:39339888
- View Article
- PubMed/NCBI
- Google Scholar
29. Clark AE, Spector DH. Studies on the Contribution of Human Cytomegalovirus UL21a and UL97 to Viral Growth and Inactivation of the Anaphase-Promoting Complex/Cyclosome (APC/C) E3 Ubiquitin Ligase Reveal a Unique Cellular Mechanism for Downmodulation of the APC/C Subunits APC1, APC4, and APC5. J Virol. 2015;89(13):6928–39. pmid:25903336
- View Article
- PubMed/NCBI
- Google Scholar
30. Tran K, Kamil JP, Coen DM, Spector DH. Inactivation and disassembly of the anaphase-promoting complex during human cytomegalovirus infection is associated with degradation of the APC5 and APC4 subunits and does not require UL97-mediated phosphorylation of Cdh1. J Virol. 2010;84(20):10832–43. pmid:20686030
- View Article
- PubMed/NCBI
- Google Scholar
31. Fehr AR, Gualberto NC, Savaryn JP, Terhune SS, Yu D. Proteasome-dependent disruption of the E3 ubiquitin ligase anaphase-promoting complex by HCMV protein pUL21a. PLoS Pathog. 2012;8(7):e1002789. pmid:22792066
- View Article
- PubMed/NCBI
- Google Scholar
32. Mo M, Fleming SB, Mercer AA. Orf virus cell cycle regulator, PACR, competes with subunit 11 of the anaphase promoting complex for incorporation into the complex. J Gen Virol. 2010;91(Pt 12):3010–5. pmid:20826619
- View Article
- PubMed/NCBI
- Google Scholar
33. Wei W, Ayad NG, Wan Y, Zhang G-J, Kirschner MW, Kaelin WG Jr. Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature. 2004;428(6979):194–8. pmid:15014503
- View Article
- PubMed/NCBI
- Google Scholar
34. Eguren M, Manchado E, Malumbres M. Non-mitotic functions of the Anaphase-Promoting Complex. Semin Cell Dev Biol. 2011;22(6):572–8. pmid:21439391
- View Article
- PubMed/NCBI
- Google Scholar
35. Smolders L, Teodoro JG. Targeting the anaphase promoting complex: common pathways for viral infection and cancer therapy. Expert Opin Ther Targets. 2011;15(6):767–80. pmid:21375465
- View Article
- PubMed/NCBI
- Google Scholar
36. Russo MST, Napylov A, Paquet A, Vuckovic D. Comparison of N-ethyl maleimide and N-(1-phenylethyl) maleimide for derivatization of biological thiols using liquid chromatography-mass spectrometry. Anal Bioanal Chem. 2020;412(7):1639–52. pmid:32016570
- View Article
- PubMed/NCBI
- Google Scholar
37. Xia J, Wishart DS. Web-based inference of biological patterns, functions and pathways from metabolomic data using MetaboAnalyst. Nat Protoc. 2011;6(6):743–60. pmid:21637195
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Mo M, Shahar S, Fleming SB, Mercer AA. How viruses affect the cell cycle through manipulation of the APC/C. Trends Microbiol. 2012;20(9):440–8. pmid:22727131
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Bellanger S, Blachon S, Mechali F, Bonne-Andrea C, Thierry F. High-risk but not low-risk HPV E2 proteins bind to the APC activators Cdh1 and Cdc20 and cause genomic instability. Cell Cycle. 2005;4(11):1608–15. pmid:16222116
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Kornitzer D, Sharf R, Kleinberger T. Adenovirus E4orf4 protein induces PP2A-dependent growth arrest in Saccharomyces cerevisiae and interacts with the anaphase-promoting complex/cyclosome. J Cell Biol. 2001;154(2):331–44. pmid:11470822
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Tran K, Mahr JA, Choi J, Teodoro JG, Green MR, Spector DH. Accumulation of substrates of the anaphase-promoting complex (APC) during human cytomegalovirus infection is associated with the phosphorylation of Cdh1 and the dissociation and relocalization of APC subunits. J Virol. 2008;82(1):529–37. pmid:17942546
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Mo M, Fleming SB, Mercer AA. Cell cycle deregulation by a poxvirus partial mimic of anaphase-promoting complex subunit 11. Proc Natl Acad Sci U S A. 2009;106(46):19527–32. pmid:19887645
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Barbosa JAF, Sparapani S, Boulais J, Lodge R, Cohen ÉA. Human Immunodeficiency Virus Type 1 Vpr Mediates Degradation of APC1, a Scaffolding Component of the Anaphase-Promoting Complex/Cyclosome. J Virol. 2021;95(15):e0097120. pmid:34011540
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Teodoro JG, Heilman DW, Parker AE, Green MR. The viral protein Apoptin associates with the anaphase-promoting complex to induce G2/M arrest and apoptosis in the absence of p53. Genes Dev. 2004;18(16):1952–7. pmid:15314021
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Peters J-M. The anaphase promoting complex/cyclosome: a machine designed to destroy. Nat Rev Mol Cell Biol. 2006;7(9):644–56. pmid:16896351
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref9] 9. Kramer ER, Scheuringer N, Podtelejnikov AV, Mann M, Peters JM. Mitotic regulation of the APC activator proteins CDC20 and CDH1. Mol Biol Cell. 2000;11(5):1555–69. pmid:10793135
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref10] 10. Sorensen CS, Lukas C, Kramer ER, Peters JM, Bartek J, Lukas J. Nonperiodic activity of the human anaphase-promoting complex-Cdh1 ubiquitin ligase results in continuous DNA synthesis uncoupled from mitosis. Mol Cell Biol. 2000;20(20):7613–23. pmid:11003657
View Article
PubMed/NCBI
Google Scholar

[38] View Article

[39] PubMed/NCBI

[40] Google Scholar

[ref11] 11. Shreeram S, Sparks A, Lane DP, Blow JJ. Cell type-specific responses of human cells to inhibition of replication licensing. Oncogene. 2002;21(43):6624–32. pmid:12242660
View Article
PubMed/NCBI
Google Scholar

[42] View Article

[43] PubMed/NCBI

[44] Google Scholar

[ref12] 12. Bashir T, Dorrello NV, Amador V, Guardavaccaro D, Pagano M. Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature. 2004;428(6979):190–3. pmid:15014502
View Article
PubMed/NCBI
Google Scholar

[46] View Article

[47] PubMed/NCBI

[48] Google Scholar

[ref13] 13. Sudakin V, Ganoth D, Dahan A, Heller H, Hershko J, Luca FC, et al. The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell. 1995;6(2):185–97. pmid:7787245
View Article
PubMed/NCBI
Google Scholar

[50] View Article

[51] PubMed/NCBI

[52] Google Scholar

[ref14] 14. Feng C, Liang Y, Teodoro JG. The Role of Apoptin in Chicken Anemia Virus Replication. Pathogens. 2020;9(4):294. pmid:32316372
View Article
PubMed/NCBI
Google Scholar

[54] View Article

[55] PubMed/NCBI

[56] Google Scholar

[ref15] 15. Noteborn MH, de Boer GF, van Roozelaar DJ, Karreman C, Kranenburg O, Vos JG, et al. Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. J Virol. 1991;65(6):3131–9. pmid:1851873
View Article
PubMed/NCBI
Google Scholar

[58] View Article

[59] PubMed/NCBI

[60] Google Scholar

[ref16] 16. Phenix KV, Meehan BM, Todd D, McNulty MS. Transcriptional analysis and genome expression of chicken anaemia virus. J Gen Virol. 1994;75 (Pt 4):905–9. pmid:8151304
View Article
PubMed/NCBI
Google Scholar

[62] View Article

[63] PubMed/NCBI

[64] Google Scholar

[ref17] 17. Noteborn MH, Todd D, Verschueren CA, de Gauw HW, Curran WL, Veldkamp S, et al. A single chicken anemia virus protein induces apoptosis. J Virol. 1994;68(1):346–51. pmid:8254747
View Article
PubMed/NCBI
Google Scholar

[66] View Article

[67] PubMed/NCBI

[68] Google Scholar

[ref18] 18. Danen-Van Oorschot AA, Fischer DF, Grimbergen JM, Klein B, Zhuang S, Falkenburg JH, et al. Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells. Proc Natl Acad Sci U S A. 1997;94(11):5843–7. pmid:9159162
View Article
PubMed/NCBI
Google Scholar

[70] View Article

[71] PubMed/NCBI

[72] Google Scholar

[ref19] 19. Zhuang SM, Shvarts A, van Ormondt H, Jochemsen AG, van der Eb AJ, Noteborn MH. Apoptin, a protein derived from chicken anemia virus, induces p53-independent apoptosis in human osteosarcoma cells. Cancer Res. 1995;55(3):486–9. pmid:7834613
View Article
PubMed/NCBI
Google Scholar

[74] View Article

[75] PubMed/NCBI

[76] Google Scholar

[ref20] 20. Leliveld SR, Zhang Y-H, Rohn JL, Noteborn MHM, Abrahams JP. Apoptin induces tumor-specific apoptosis as a globular multimer. J Biol Chem. 2003;278(11):9042–51. pmid:12496278
View Article
PubMed/NCBI
Google Scholar

[78] View Article

[79] PubMed/NCBI

[80] Google Scholar

[ref21] 21. Danen-Van Oorschot AAAM, Zhang Y-H, Leliveld SR, Rohn JL, Seelen MCMJ, Bolk MW, et al. Importance of nuclear localization of apoptin for tumor-specific induction of apoptosis. J Biol Chem. 2003;278(30):27729–36. pmid:12754198
View Article
PubMed/NCBI
Google Scholar

[82] View Article

[83] PubMed/NCBI

[84] Google Scholar

[ref22] 22. Heilman DW, Teodoro JG, Green MR. Apoptin nucleocytoplasmic shuttling is required for cell type-specific localization, apoptosis, and recruitment of the anaphase-promoting complex/cyclosome to PML bodies. J Virol. 2006;80(15):7535–45. pmid:16840333
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref23] 23. Lanz HL, Zimmerman RME, Brouwer J, Noteborn MHM, Backendorf C. Mitotic catastrophe triggered in human cancer cells by the viral protein apoptin. Cell Death Dis. 2013;4(2):e487. pmid:23392175
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref24] 24. Zeng X, Sigoillot F, Gaur S, Choi S, Pfaff KL, Oh D-C, et al. Pharmacologic inhibition of the anaphase-promoting complex induces a spindle checkpoint-dependent mitotic arrest in the absence of spindle damage. Cancer Cell. 2010;18(4):382–95. pmid:20951947
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref25] 25. Chabes AL, Pfleger CM, Kirschner MW, Thelander L. Mouse ribonucleotide reductase R2 protein: a new target for anaphase-promoting complex-Cdh1-mediated proteolysis. Proc Natl Acad Sci U S A. 2003;100(7):3925–9. pmid:12655059
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref26] 26. Ke P-Y, Chang Z-F. Mitotic degradation of human thymidine kinase 1 is dependent on the anaphase-promoting complex/cyclosome-CDH1-mediated pathway. Mol Cell Biol. 2004;24(2):514–26. pmid:14701726
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref27] 27. Ke P-Y, Kuo Y-Y, Hu C-M, Chang Z-F. Control of dTTP pool size by anaphase promoting complex/cyclosome is essential for the maintenance of genetic stability. Genes Dev. 2005;19(16):1920–33. pmid:16103219
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref28] 28. Lo S-Y, Lai M-J, Yang C-H, Li H-C. Unveiling the Connection: Viral Infections and Genes in dNTP Metabolism. Viruses. 2024;16(9):1412. pmid:39339888
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref29] 29. Clark AE, Spector DH. Studies on the Contribution of Human Cytomegalovirus UL21a and UL97 to Viral Growth and Inactivation of the Anaphase-Promoting Complex/Cyclosome (APC/C) E3 Ubiquitin Ligase Reveal a Unique Cellular Mechanism for Downmodulation of the APC/C Subunits APC1, APC4, and APC5. J Virol. 2015;89(13):6928–39. pmid:25903336
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref30] 30. Tran K, Kamil JP, Coen DM, Spector DH. Inactivation and disassembly of the anaphase-promoting complex during human cytomegalovirus infection is associated with degradation of the APC5 and APC4 subunits and does not require UL97-mediated phosphorylation of Cdh1. J Virol. 2010;84(20):10832–43. pmid:20686030
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref31] 31. Fehr AR, Gualberto NC, Savaryn JP, Terhune SS, Yu D. Proteasome-dependent disruption of the E3 ubiquitin ligase anaphase-promoting complex by HCMV protein pUL21a. PLoS Pathog. 2012;8(7):e1002789. pmid:22792066
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref32] 32. Mo M, Fleming SB, Mercer AA. Orf virus cell cycle regulator, PACR, competes with subunit 11 of the anaphase promoting complex for incorporation into the complex. J Gen Virol. 2010;91(Pt 12):3010–5. pmid:20826619
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref33] 33. Wei W, Ayad NG, Wan Y, Zhang G-J, Kirschner MW, Kaelin WG Jr. Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature. 2004;428(6979):194–8. pmid:15014503
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref34] 34. Eguren M, Manchado E, Malumbres M. Non-mitotic functions of the Anaphase-Promoting Complex. Semin Cell Dev Biol. 2011;22(6):572–8. pmid:21439391
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref35] 35. Smolders L, Teodoro JG. Targeting the anaphase promoting complex: common pathways for viral infection and cancer therapy. Expert Opin Ther Targets. 2011;15(6):767–80. pmid:21375465
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref36] 36. Russo MST, Napylov A, Paquet A, Vuckovic D. Comparison of N-ethyl maleimide and N-(1-phenylethyl) maleimide for derivatization of biological thiols using liquid chromatography-mass spectrometry. Anal Bioanal Chem. 2020;412(7):1639–52. pmid:32016570
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref37] 37. Xia J, Wishart DS. Web-based inference of biological patterns, functions and pathways from metabolomic data using MetaboAnalyst. Nat Protoc. 2011;6(6):743–60. pmid:21637195
View Article
PubMed/NCBI
Google Scholar

[146] View Article

[147] PubMed/NCBI

[148] Google Scholar

Figures

Abstract

Author summary

Introduction

Results

CAV infection results in mitotic arrest and a subsequent cytopathic effect

Vp3 is important for the replication and cytopathogenicity of CAV

Vp3 induces a metabolic environment that is favourable for nucleotide biosynthesis

APC/C inhibition by Vp3 elevates the expression of APC/C substrates involved in nucleotide biogenesis

Discussion

Methods and methods

Cell lines and maintenance of cell culture

Plasmids

Replicative form (RF) viral DNA preparation, transfection, and virus production

Viral genome quantification

CAV infection of MSB-1 cells

Cell counts and viability

Cell cycle analysis (flow cytometry)

Western blotting

Vp3- rescue experiments

Cell extraction for metabolite analysis

LC-MS

Analysis of metabolites

Overexpression of VP3 in H1299 cells

Gene expression analysis by RT-qPCR

Statistical analysis

Supporting information

S1 Table. Raw data of metabolites of mock, CAV WT and CAV Vp3- infections in MSB-1 cells detected by LC-MS.

S2 Table. Normalized metabolite data of mock, CAV WT and CAV Vp3- infections.

S3 Table. Significance and impact scores for the pathways analysis of metabolites from MSB-1 cells infected with CAV WT vs. CAV Vp3.

S4 Table. Raw data of metabolites of H1299 cells overexpressing Ad-Vp3 and Ad-lacZ adenoviral constructs detected by LC-MS.

S5 Table. Normalized metabolite data of H1299 cells overexpressing Ad-Vp3 and Ad-lacZ adenoviral constructs.

S1 Fig. Cell viability of mock, CAV WT and CAV Vp3- infected MSB-1 cells quantified by the Zombie Red survival assay.

S2 Fig. Principal component analysis (PCA) plot of the metabolic profiles of mock, CAV WT and CAV Vp3- infected MSB-1 cells at 24 hours post-infection.

S3 Fig. Normalized levels of nitrogenous bases compared across mock, CAV WT and CAV Vp3- infections.

S4 Fig. mRNA transcript levels of different enzymes involved in nucleotide synthesis during CAV infection.

S5 Fig. Heatmap visualizing the changes of the top 50 metabolites detected by LC-MS in H1299 cells infected with the Ad-lacZ and Ad-Vp3 adenoviral constructs, as well as mock infection.

S1 File. Raw Gel: Uncropped images of all immunoblots used in the figures of this article.

Acknowledgments

References