Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

The importance of IFNα2A (Roferon-A) in HSV-1 latency and T cell exhaustion in ocularly infected mice

  • Shaohui Wang,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Center for Neurobiology & Vaccine Development, Ophthalmology Research, Department of Surgery, Cedars-Sinai Medical Center, Los Angeles, California, United States of America

    ⨯
  • Ujjaldeep Jaggi,

    Roles Data curation, Methodology, Writing – review & editing

    Affiliation Center for Neurobiology & Vaccine Development, Ophthalmology Research, Department of Surgery, Cedars-Sinai Medical Center, Los Angeles, California, United States of America

    ⨯
  • Makoto Katsumata,

    Roles Conceptualization, Data curation, Investigation, Methodology, Resources

    Affiliation Rodent genetics core facility, Department of Comparative Medicine, Cedars-Sinai Medical Center, Los Angeles, California, United States of America

    ⨯
  • Homayon Ghiasi

    Roles Conceptualization, Formal analysis, Funding acquisition, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    ghiasih@cshs.org

    Affiliation Center for Neurobiology & Vaccine Development, Ophthalmology Research, Department of Surgery, Cedars-Sinai Medical Center, Los Angeles, California, United States of America

    ⨯

Abstract

Published studies have generated compelling results indicating that type I IFN modulates function of HSV-1 latency-associated transcript (LAT). One member of type I IFN is IFNα2A also called Roferon-A). IFNα2A has been used in monotherapy or in combination therapy with other drugs to treat viral infections and different kinds of cancer in humans. The goal of this study was to determine whether the absence of IFNα2A affects primary and latent infections in ocularly infected mice. Therefore, we generated a mouse strain lacking IFNα2A expression (IFNα2A-/-). Ocular HSV-1 replication, IFN and immune cell expressions on days 3 and 5 post infection (PI), as well as eye disease, survival, latency-reactivation, and T cell exhaustion were evaluated in ocularly infected IFNα2A-/- and wild type (WT) control mice. Absence of IFNα2A did not affect other members of the IFNα family but it affected IFNβ and IFNγ expressions as well as some immune cells on day 5 PI compared to WT mice. Viral replication in the eye, eye disease, and survival amongst ocularly infected IFNα2A-/- mice were similar to that of WT infected mice. The absence of IFNα2A significantly reduced the levels of latency and T cell exhaustion but not time of reactivation compared with control mice. Our results suggest that blocking IFNα2A expression may be a useful tool in reducing latency and the subsequent side effects associated with higher levels of latency.

Author summary

Many viruses have evolved strategies to circumvent the IFN system, including (i) inhibition of IFN production; (ii) blocking of downstream signaling events that occur after cytokine-receptor binding; and (iii) inhibition of the functions of proteins, which are induced by IFN, including apoptotic proteins. The interferons (IFNs) are of considerable interest in the control of HSV-1 infection due to their rapid generation in response to viral infection and their antiviral activities. Type I interferons, which includes interferon alpha (IFNα), are a family of cytokines important for control of viral infections. There are at least 14 IFNα genes in mouse, amongst which includes the gene encoding IFNα2A that play an important role in human studies. The mechanisms by which HSV-1 interferes with type I IFN responses during primary infection, establishment of latency and reactivation are not fully understood. Thus, to evaluate the importance of IFNα2A on HSV-1 infectivity, we generated IFNα2A knockout mice. The absence of IFNα2A significantly reduced latency and T cell exhaustion, but not virus reactivation.

Citation: Wang S, Jaggi U, Katsumata M, Ghiasi H (2024) The importance of IFNα2A (Roferon-A) in HSV-1 latency and T cell exhaustion in ocularly infected mice. PLoS Pathog 20(10): e1012612. https://doi.org/10.1371/journal.ppat.1012612

Editor: Deepak Shukla, University of Illinois at Chicago, UNITED STATES OF AMERICA

Received: July 29, 2024; Accepted: September 23, 2024; Published: October 1, 2024

Copyright: © 2024 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the manuscript and its supporting information files.

Funding: This study was supported by Public Health Service NIH grants RO1 EY029160 and RO1 EY033574 to HG. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

In most pathogenic viral infections, the host responds immediately by producing type I interferons (IFNs) that limits viral replication, induces apoptosis/autophagy of infected cells, and contributes to mobilization of other immune responses [1,2]. Many viruses have evolved strategies to circumvent the IFN system [3], including (i) blocking of downstream signaling events that occur after cytokine-receptor binding; and (ii) inhibition of the functions of proteins, which are induced by IFNs, including apoptotic proteins [4]. IFNs are divided into three classes: type I, II and III [5]. Type I IFNs are powerful antiviral response factors capable of controlling viral infections and are essential for antiviral immunity in both mice and humans [6,7]. As IFN response also contributes to the development of the host immune response, defective IFN responses can result in skewed and suboptimal adaptive immune responses [8]. The type I IFN gene family in both human and mice are composed of at least 20 members: the IFNα subtypes, IFNβ, IFNω, IFNε, and IFNκ [9–13]. Type I IFNs are immunoregulatory cytokines that have antiviral and antitumor activities [14–16]. IFNα/β have been studied extensively in the context of viral infections and have three major functions [5,17–21]: (1) Induction of antimicrobial responses; (2) Modulation of innate immune responses; and (3) Activation of the adaptive components of host antiviral defense. In addition, IFNα/β signaling can activate cell death pathways [22,23]. In most tissues, death of virally infected cells is a desired mode of virus containment [24]; however, the vertebrate host cannot tolerate death of neurons [25]. There are at least 14 IFNα genes that encode over 30 proteins and a single IFNβ gene in humans and mice [9,10]. All type I IFNs initiate their biological effects by binding to the same receptor, a heterodimer composed of the transmembrane proteins IFNAR1 and IFNAR2 [26,27]. IFNAR1-/- mice (also known as IFNαβR-/- or CD118-/-) lack antiproliferative and antiviral responses associated with IFNα/β signaling and are highly susceptible to viral infections [28,29] (Preliminary studies). Although the IFNα subtypes and IFNβ uses the same IFNARs, they exhibit functional differences [30].

Previous studies [31–34] have generated compelling results indicating that the latency-associated transcript (LAT) of HSV-1 modulates the effects of type I IFN induction in the trigeminal ganglia (TG) of wild-type (WT) mice after ocular infection with LAT(+) virus as compared with LAT(-) virus, which suggests that LAT acts to suppress the production of IFNα. Additionally, we have shown that LAT downregulates JAK1 and JAK2 pathways as well as affecting expressions of ISG-15, ISG-54, ISG-56, IP-10, OAS-3, IRF-1, IRF-3, Mx-1, CIITA, and GBP-1 genes but not TLR genes in latently infected mouse TG [32]. LAT has anti-apoptotic activity [35–40]. Replacing LAT with two different anti-apoptosis genes restores the WT reactivation phenotype to a LAT-minus virus [41,42] indicating that LAT’s anti-apoptosis activity is important for LAT reactivation phenotype. Thus, LAT functions at multiple levels.

In our model of ocular HSV-1 infection, LAT had no effect on the levels of NF-κB expression in the TG of infected WT mice [32]. One member of IFNα family is IFNα2 and it has three isoforms of IFNα2A, IFNα2B, and IFNα2C [9]. IFNα2A also called Roferon-A is well characterized, broadly expressed with enhanced antiviral activities [9,43]. IFNα2A has been used in monotherapy or in combination therapy with other drugs to treat viral infections, including chronic hepatitis B and chronic hepatitis C, in addition to different kinds of cancer (including melanoma, renal cell carcinoma, leukemia, melanoma, AIDS-related Kaposi’s sarcoma), HIV, SIV, and LCMV [15,43–50]. However, the efficacy of IFNα2A therapy against viral infections and cancers was dependent on the time and dosage of treatment [51,52]. Overall, in both viral infection and cancer models, IFNα2A therapy showed greatest efficacy against early viral infections and cancer establishment [15].

The mechanisms by which HSV-1 interferes with type I IFN responses during primary infection, establishment of latency, and reactivation are not fully understood. Therefore, due to the prevalence of IFNα2A expression during viral infection and its use therapeutically for the treatment of malignancy and viral infections, we decided to characterize its functions during HSV-1 infection by constructing an IFNα2A knockout mice (IFNα2A-/-). In the present study, we investigated the impacts of the absence of IFNα2A expression on HSV-1 infectivity using IFNα2A-/- mice. We show that in the absence of IFNα2A expression: 1) Viral replication was similar in the eyes of infected IFNα2A-/- to WT control mice; 2) gB transcript in isolated TG of infected IFNα2A-/- mice on day 3 was similar to control mice, but was significantly reduced in TG of infected IFNα2A-/- mice on day 5 post infection; 3) On day 3 PI, except for IFNκ, no other significant differences were detected for IFNα1, IFNα6, IFNα11, IFNα13, and IFNα16 expressions in TG of IFNα2A-/- mice compared with control mice, while on day 5 PI, expressions of IFNα1, and IFNα11 in TG of IFNα2A-/- mice were significantly lower than in control mice; 4) absence of IFNα2A did not affect expressions of CD4, CD8α, F4/80, CD11b, CD11c, NK1.1, IRF9, Stat1, Stat2, IFNβ, or IFNγ in TG of infected mice on day 3 PI but its absence affected CD8α, F4/80, CD11c, NK1.1, IRF9, Stat1, Stat2, IFNβ, or IFNγ expressions on day 5 PI; 5) Levels of LAT RNA in TG of IFNα2A-/- mice was significantly less than in control mice, while its absence did not affect reactivation time or eye disease; and 6) CD8α T cell exhaustion in TG of latently infected IFNα2A-/- mice was significantly less than in control mice. The absence of IFNα2A in infected mouse correlated with lower latency and lower T cell exhaustion. Therefore, our results suggest that abolishing IFNα2A expression may present an effective way to reduce latency and pathology associated with higher LAT expression.

Results

Generation of IFNα2A mice

Type I IFNs are divided into IFNα and IFNβ subtypes [14–16]. There is a single gene associated with IFNβ expression and IFNβ-/- mice have been developed and studied extensively [53,54]. In contrast to IFNβ, there are at least 14 mouse IFNα genes (i.e., IFNα1, IFNα2, IFNα4, IFNα5, IFNα6, IFNα7, IFNα9, IFNα11, IFNα12, IFNα13, IFNα14, IFNα15, IFNα16, and IFNαB) [9,10]. Among the 14 known IFNα genes (Fig 1A), IFNα2A, also called IFNα2 or Roferon-A, is well characterized and has been used in the treatment of viral infections and different kinds of cancers [15,43–50]. However, there are no IFNα2A knockout mice available and given its extensive use in human studies, we generated IFNα2A knockout mouse lines with disabled IFNα2A allele with various degrees of indels using the CRISPR/Cas9 genome editing technology [55]. We utilized the CRISPR algorithm to design the guide RNA sequence [56] of UCAUCACUAUCAGCA UCACGAGG (20 bases plus PAM). We performed pronuclear microinjection of the CRISPR RNP in combination with a synthesized tracrRNA (Dharmacon U-002005-5) and wild type Cas9 protein (ESPCAS9 PRO-50UG, Millipore Sigma) at the concentration of 60 ng/μl crRNA/tracrRNA (approx. 1:1 molar ratio) mix and 50 ng/μl Cas9 protein. We observed different degrees of insertion or large deletions in 4 founders and chose one of the founders (founder #3) carrying a 5 bp insertion followed by 165 bp deletion that creates a missense mutation after 7th amino acid and premature termination after 34th amino acid (Fig 1B). Deletion was confirmed with sequencing. Mice having this deletion were back crossed and the absence of deletion was confirmed by PCR (Fig 1C). We used qRT-PCR to compare IFNα2A RNA expression in IFNα2A-/- and control mice. RNA levels in isolated TG from IFNα2A-/- mice were not detectable (Fig 1D). Thus, IFNα2A-/- mice lacked expression of IFNα2A. This strain of knockout mouse grew and bred normally, and no anatomical dysfunction was detected in these mice.

thumbnail
Download:
Fig 1. Generation of IFNα2A knockout mice.

A) Phylogenetic tree of mouse interferons. Sequences of mouse interferons were aligned, and the phylogenetic tree was drawn by Clustal Omega, as described. As shown in Fig 1, there is a huge similarity between interferon alpha subtypes versus other interferons, the other type I interferon IFNβ, IFNε, and IFNκ are distant from alpha subtypes on the evolutionary tree: B) A schematic view of establishing IFNα2A deletion mice. The guide RNA sequence is CCUCGUGAUGCUGAUAGUGAUGA. The CLISPR resulted in a 165 bp deletion after 7th codon followed by 5 bp “TCTAG’ insertion, created a missense mutation and prematurely terminated at 34th amino acid; C) Representative genotyping of IFNα2A-/- mice. As shown, the WT allele size is about 341 bp and the IFNα2A deletion allele size is 181 bp; and D) Absence of IFNα2A expression in TG of IFNα2A-/- mice. TG from WT mice and IFNα2A knockout mice were harvested, expression of IFNα2A was measured by RT-qPCR as indicated. Each point represents mean ± SEM from 10 TG/group. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g001

Viral replication in the eyes of ocularly infected IFNα2A-/- mice was not affected by the absence of IFNα2A expression

To determine if the absence of IFNα2A expression alters viral replication in the eyes of infected mice, IFNα2A-/- and control mice were ocularly infected with HSV-1 strain McKrae. Tear films were collected from 20 eyes of WT and 34 eyes of IFNα2A-/- mice in two separate experiments on days 1–5 PI and the presence of infectious virus was determined by standard plaque assays (Fig 2A). Virus titers in the eyes of the two infected mice groups were similar on days 1 to 5 PI (Fig 2A, p>0.05 at all-time points). Thus, the absence of IFNα2A in IFNα2A-/- mice was not associated with reduced viral replication in the eyes of infected mice.

thumbnail
Download:
Fig 2. Virus titers and gB expression in the eyes and TG of infected mice.

(A) Virus titers in the eyes of IFNα2A-/- mice. IFNα2A-/- and control mice were ocularly infected with 2 X 105 PFU/eye of HSV-1 strain McKrae. Tear films were collected on days 1 to 5, and virus titers were determined by standard plaque assays. Each point represents the mean titer of 20 eyes for WT and 34 eyes for IFNα2A-/- mice from two separate experiments; and (B) HSV-1 gB expression in TG of infected mice. IFNα2A-/- and control mice were ocularly infected with 2 X 105 PFU/eye of HSV-1 strain McKrae. TG were harvested on days 3 and 5 PI. Total RNA was extracted and gB copy number was measured by RT-qPCR and normalized with GAPDH. Each point represents the mean ± SEM gB copy numbers of 12 TG for day 3 and 10 TG for day 5 for each group from two separate experiments. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g002

Fig 2A showed that the absence of IFNα2A did not affect viral replication in the eyes of infected mice. We next asked whether the lack of IFNα2A affected expression levels of HSV-1 gB transcript in TG of infected mice on days 3 and 5 PI. IFNα2A-/- and control mice were infected as above with HSV-1 McKrae. On days 3 and 5 PI, TG from infected mice were collected and total RNA was isolated from each TG. RNA isolated from each TG was analyzed by TaqMan RT-PCR to determine copy numbers for gB mRNA. GAPDH mRNA in each sample was used as an internal control. The results showed lower levels of each transcript in TG of infected IFNα2A-/- mice than in control mice on both days 3 and 5 PI. While the differences were not statistically significant on day 3 PI, they were significant on day 5 post infection (Fig 2B; p>0.05 for day 3 and p<0.05 on day 5 PI). Collectively, these results indicate that, while the differences between infected WT and IFNα2A mice were not statistically significant for virus replication and gB copy numbers during primary infection, yet a trend for decreased replication that fits with decreased copies of gB transcript in the corneas and TG of IFNα2A infected mice compared with WT control mice were detected.

Expressions of various cellular transcripts in TG of IFNα2A-/- mice during primary ocular infection

Fig 2 above showed that the absence of IFNα2A did not affect viral replication in the eyes of infected mice but reduced the gB expression in TG of infected mice on day 5 PI. We next asked whether the lack of IFNα2A altered some of the other members of the IFNα family. IFNα2A-/- and control mice were infected as above. On days 3 and 5 PI, TG from infected mice were collected and RNA was isolated and expressions of IFNα1, IFNκ, IFNα6, IFNα11, IFNα13, IFNα14, and IFNα16 mRNAs were determined by TaqMan RT-PCR. Results are presented as “fold” increase over baseline mRNA levels in TG of uninfected IFNα2A-/- and WT mice for each group. GAPDH mRNA in each sample was used as an internal control. The results showed no significant differences in the levels of each transcript in TG of infected IFNα2A-/- mice than in control mice except for IFNκ on day 3 PI (Fig 3A). In contrast to day 3 PI, levels of IFNκ expression on day 5 PI were not significantly different, while levels of IFNα1 and IFNα11 transcripts were significantly lower in IFNα2A-/- mice than in control mice (Fig 3B). Collectively, these results indicate that except for a few IFNα genes, the absence of IFNα2A in TG of infected mice did not alter expressions of many members of the IFNα family compared with WT infected mice.

thumbnail
Download:
Fig 3. Absence of IFNα2A and its effects on expressions of IFNα family members during primary infection.

IFNα2A-/- and WT mice were infected ocularly with 2x105 PFU/eye of McKrae virus. On days 3 and 5 PI, TG from infected mice were isolated and qRT-PCR was performed using specific TaqMan primers. TG from uninfected mice was used for normalization and GAPDH was used as the endogenous control. Results are shown as mean ± SEM from two separate experiments using 12 TG for day 3 and 10 TG for day 5 for each group. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g003

The above results suggest that the absence of IFNα2A does not significantly affect the expressions of several members of the IFNα family. Therefore, we next asked whether the absence of IFNα2A in IFNα2A-/- mice affects the expressions of CD4, CD8α, F4/80, CD11b, CD11c, NK1.1, IRF9, Stat1, and Stat2 transcripts in TG of infected mice on days 3 and 5 PI. RNA isolated from IFNα2A-/- and control mice (see Fig 3) was used to measure CD4, CD8α, F4/80, CD11b, CD11c, NK1.1, IRF9, Stat1, and Stat2 transcript levels in TG of infected mice by qRT-PCR. Results are presented as “fold” increase over baseline mRNA levels in TG of naive mice for each group. GAPDH mRNA in each sample was used as an internal control. On day 3 PI, CD4, CD8α, F4/80, CD11b, CD11c, NK1.1, IRF9, Stat1, and Stat2 transcripts were similar in mice with and without IFNα2A expression (Fig 4A, p>0.05). On day 5 PI, CD8α (Fig 4B; p = 0.01), F4/80 (Fig 4B; p = 0.03), CD11c (Fig 4B; p = 0.01), NK1.1 (Fig 4B; p = 0.02), IRF9 (Fig 4B; p = 0.03), Stat1 (Fig 4B; p = 0.004), and Stat2 (Fig 4B; p = 0.006) transcript levels were significantly reduced in TG of IFNα2A-/- mice compared with control mice. However, the levels of CD4 and CD11b transcripts were not significantly different in IFNα2A-/- mice compared with control mice (Fig 4B). These results suggest that absence of IFNα2A significantly reduced all tested immune related genes except CD4 and CD11b by day 5 PI.

thumbnail
Download:
Fig 4. Immune cell profiling in the absence of IFNα2A during primary infection.

RNA isolated on days 3 and 5 PI from IFNα2A-/- and WT infected mice were used to measure the expression levels of CD4, CD8α, F4/80, CD11b, CD11c, Nk1.1, IRF9, Stat1 and Stat2. qRT-PCR were done as above and GAPDH was used as an endogenous control. TG from IFNα2A-/- and WT uninfected mice were used for normalization. Each point represents the mean ± SEM fold change of expressions of 12 TG for day 3 and 10 TG for day 5 for each group from two separate experiments. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g004

Our results described in Fig 4 suggested that, in the absence of IFNα2A by day 5 PI, expressions of the tested immune response genes were significantly reduced in TG of infected mice. Thus, we next asked whether the absence of IFNα2A in IFNα2A-/- mice affects expression levels of IFNβ and IFNγ transcripts in TG of infected mice on days 3 and 5 PI. IFNβ is a member of type I IFN family [54], while IFNγ is type II IFN consists of a single gene [17]. It has been suggested that IFNβ and IFNγ play opposing roles in the regulation of inflammatory responses: IFNγ promotes inflammatory responses, whereas IFNβ has anti-inflammatory properties [57–59]. RNA isolated from IFNα2A-/- and control mice (see Fig 3, above) was used to measure IFNβ and IFNγ transcripts levels in TG of infected mice by qRT-PCR. Results are presented as “fold” increase over baseline mRNA levels in TG of naive mice for each group. GAPDH mRNA in each sample was used as an internal control. On day 3 PI, IFNβ and IFNγ expression levels were similar in mice with and without IFNα2A expression (Fig 5A, p>0.05). In contrast to day 3, expression levels of IFNβ (Fig 5B; p = 0.004) and IFNγ (Fig 5B; p = 0.01) transcripts were significantly reduced in TG of IFNα2A-/- mice compared with control mice on day 5 PI. These results suggest that the absence of IFNα2A significantly reduced IFNβ and IFNγ expressions by day 5 PI.

thumbnail
Download:
Fig 5. Effects of the absence of IFNα2A on IFNβ and IFNγ expression during primary infection.

RNA isolated on days 3 and 5 PI from IFNα2A-/- and WT infected mice were used to measure the expression levels of IFNβ and IFNγ. qRT-PCR were done as above and GAPDH was used as the endogenous control. TG from uninfected mice was used for normalization. Each point represents the mean ± SEM fold change of gene expression two separate experiments using 12 TG for day 3 and 10 TG for day 5 for each group. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g005

Latency is reduced in the TG of latently infected mice lacking IFNα2A expression

The above results suggests that levels of immune cells were significantly reduced in IFNα2A-/- mice compared with control mice (Figs 4 and 5). To determine whether the absence of IFNα2A affects latency, IFNα2A-/- mice and control mice were infected ocularly as above and TG from infected mice were isolated on day 28 PI and total TG RNA was isolated from latently infected TG. Isolated TG RNA was used to quantify LAT RNA copy numbers and cellular GAPDH RNA was used as an internal control. The amount of LAT RNA during latency in TG from IFNα2A-/- mice was significantly reduced compared with WT mice (Fig 6A; p = 0.012). These results suggest that, in the absence of IFNα2A, latency in TG of HSV-1 infected mice was significantly reduced.

thumbnail
Download:
Fig 6. Role of IFNα2A in HSV-1 latency, reactivation, and corneal scarring.

A) Levels of latency in TG of latently infected mice. IFNα2A-/- and control mice were ocularly infected with 2 X 105 PFU/eye of HSV-1 strain McKrae. TG were harvested on day 28 PI and total TG RNA was isolated as described in Materials and Methods. LAT RNA copy numbers were measured by qRT-PCR using a standard curve generated with pGem5317. GAPDH expression was used to normalize relative levels of LAT RNA expression. Each bar represents the mean ± SEM from 20 mice from three independent experiment; B) Virus reactivation in infected mice. IFNα2A-/- and control mice were ocularly infected with 2 X 105 PFU/eye of HSV-1 strain McKrae as above. TG from infected mice were harvested on day 28 PI and the explant reactivation assay was performed. Data points indicate the day of virus reactivation. Each point is the mean ± SEM from 18 TG for WT control mice and 13 TG for IFNα2A-/- mice; and C) corneal scarring in infected mice. Severity of corneal scarring on mice used to measure latency-reactivation was determined on day 28 PI. Each point represents the mean ± SEM from 46 eyes for control mice and 38 eyes for IFNα2A-/- mice. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g006

Time of explant reactivation is not affected in latently infected mice lacking IFNα2A expression

The qRT-PCR analyses described in Fig 6A suggests that the absence of IFNα2A reduces LAT expression in TG of latently infected mice. Thus, we asked whether reduced LAT levels correlated with reduced reactivation of latent virus. To test this, IFNα2A-/- or control mice were ocularly infected with 2 X 105 PFU/eye of HSV-1 strain McKrae. On day 28 PI, individual TG from infected mice was harvested and the kinetics of virus reactivation was measured in explanted TG. Average reactivation time for IFNα2A-/- mice was 3.56 ± 0.23 days; control mice reactivated similarly, with an average of 3.54 ± 0.12 days (Fig 6B, p>0.05). Together, these results suggest that absence of IFNα2A does not affect time to reactivation compared with control mice despite reduced levels of latency in IFNα2A-/- mice. Thus, in the absence of IFNα2A time to reactivation is not correlated with the levels of latency.

Absence of IFNα2A does not affect levels of corneal scarring or mice survival

A total of 47 IFNα2A-/- mice and 44 control mice (from 4 separate experiments) were ocularly infected with 2x105 PFU/eye of HSV-1 strain McKrae as above. Survival of infected mice was recorded at day 28 PI. Forty-two of 47 (89%) of mice in the IFNα2A-/- group and 40 of 44 (91%) in the control group survived ocular infection. No significant differences in survival rate were detected between the IFNα2A-/- infected mice and control mice (p>0.05, Mann Whitney test) (not shown). Eyes of the surviving mice were examined for corneal scarring (CS) at day 28 PI. Although the IFNα2A-/- infected mice had lower levels of CS compared with control mice, these differences were not statistically significant (Fig 6C; p = 0.19). Thus, the absence of IFNα2A did not exacerbate CS or result in increased mortality of infected mice.

Absence of IFNα2A in IFNα2A-/- mice significantly reduced CD8α T cell exhaustion markers during latency

The above results suggested that the absence of IFNα2A reduces LAT expression in TG of latently infected mice compared with WT control mice (Fig 6B). Previously, we have shown that reduced latency in TG of latently infected mice correlated with lower levels of CD8α and PD-1 expressions [60–62]. Thus, to investigate the effects of reduced LAT expression in TG of latently infected IFNα2A-/- mice on T cell exhaustion, IFNα2A-/- and WT control mice were infected as above with HSV-1 strain McKrae. The relative levels of CD8 and PD-1 were determined by RT-PCR of total TG extracts (Fig 7). Results are presented as “fold” increase (or decrease) compared to the baseline mRNA levels in TG from uninfected naive mice for each group. GAPDH mRNA in each sample was used as an internal control. Expression levels of CD8α transcript in TG of IFNα2A-/- mice was significantly lower than in control mice (Fig 7A, p = 0.03). PD-1 transcript level was also significantly lower in TG of latently infected IFNα2A-/- mice compared with control mice (Fig 7B, p = 0.04). These results suggest that absence of IFNα2A does affect expression levels of CD8α and PD-1 in TG of latently infected mice and this strongly correlates with lower levels of latency as we reported previously [60–62].

thumbnail
Download:
Fig 7. T cell exhaustion in the absence of IFNα2A in TG of latently infected mice.

Isolated RNA from total TG (see Fig 6B) was used to measure expressions of CD8a (panel A) and PD-1 (panel B) transcripts by qRT-PCR. CD8α and PD-1 expression in TG of uninfected naive mice was used as a baseline to estimate relative expression of each transcript in TG of infected mice. GAPDH expression was used to normalize relative expressions of each transcript. Each bar represents mean ± SEM from 22 TG for control mice and 35 TG for IFNα2A-/- mice from two independent experiments. Differences were detected using t-test.

https://doi.org/10.1371/journal.ppat.1012612.g007

Discussion

In most pathogenic viral infections, the host responds immediately by producing type I interferons (IFNs) that limits viral replication, induces apoptosis/autophagy of infected cells, and contributes to mobilization of other immune responses [1]. Many viruses have evolved strategies to circumvent the IFN system [3], including (i) inhibition of IFN production; (ii) blocking of downstream signaling events that occur after cytokine-receptor binding; and (iii) inhibition of the functions of proteins, which are induced by IFN, including apoptotic proteins [4]. IFNα/β acts in both autocrine and paracrine manner [63,64] and affects expressions of over 1,000 genes [65,66]. The mechanisms by which HSV-1 interferes with type I IFN responses during primary infection and in the establishment of latency and reactivation are not fully understood. Our published studies [31,32] and our analyses of ocular HSV-1 infection and recurrences have generated compelling results indicating that HSV-1 modulates the effects of type I IFN. Amongst the 14 IFNα genes, IFNα2A is well characterized and broadly expressed, and has been used in human studies [15,43–50]. In contrast to IFNα2A, the other 13 members of IFNα are not well characterized, are more tissue restricted, and are not represented in all mammalian species [54]. Since human studies have shown the importance of IFNα2A in virus and cancer therapy and there is no knockout of IFNα2A available to evaluate the role of IFNα2A in HSV-1 infectivity, we deleted this gene to generate IFNα2A knockout mice. The IFNα2A-/- mice generated in this study allowed us to evaluate the role of IFNα2A during primary and latent HSV-1 infection. As expected, IFNα2A expression was not detectable in TG of IFNα2A-/- mice compared with control mice and deletion of IFNα2A had no obvious side effects in mice.

IFNα/β is essential in the control of HSV-1 infection in the eyes of ocularly infected mice [67,68] and ectopic expressions of IFNα or IFNβ markedly suppresses HSV-1 replication, its spread and is associated with a reduction in lytic gene expression in infected mice [69,70]. Mice deficient in IFN responses exhibits lethal susceptibility to murine cytomegalovirus (MCMV) infection [71]. It is also reported that mutations within STAT1 which is an essential downstream factor in IFNα/β and IFNγ signaling pathways leads to lethal outcomes from infection with HSV-1, HCMV, and Epstein-Barr virus [72–75]. We also observed lower levels of IRF9, Stat1, and Stat2, which indicated a less robust interferon response via Jak/Stat signal pathways in the knockout mice. Recombinant IFNα has also been used to treat HCMV-induced retinitis after HIV infection [76]. Our current study focused on determining the roles of the absence of IFNα2A on HSV-1 infection. We found that the absence of IFNα2A did not affect virus replication in the eyes of infected IFNα2A-/- mice compared with control mice, but it does reduce the HSV-1 gB expression in TG of infected mice on day 5 PI. We also looked at expressions of the remaining 13 members of IFNα and detected IFNα1, IFNκ, IFNα6, IFNα11, IFNα13, IFNα14, and IFNα16 mRNAs in TG of both IFNα2A-/- and control mice, while levels of IFNα4, IFNα5, IFNα7, IFNα9, IFNα12, IFNα15, and IFNαB in TG were not detectable. Additionally, on day 3 PI, amongst the 6 detectable members of IFNαs in TG of IFNα2A-/- mice compared with control mice, only IFNκ levels were upregulated in IFNα2A-/- mice compared with control mice, however by day 5 PI, the differences were not significant. In contrast, levels of IFNα1 and IFNα11 were significantly reduced in IFNα2A-/- mice compared with control mice at day 5 PI. IFNα11 is a part of the same cluster as IFNα2A and the absence of IFNα2A may affect expression of IFNα11 (Fig 1A). T cells, macrophages, DCs, NK cells play a major role in protection against HSV-1 infection [77–80]. During acute infection, innate lymphocytes such as neutrophils, NK cells, and macrophages are recruited to the site of infection to control the virus [81]. In this study, on day 3 PI, we did not detect any differences in the levels of immune infiltrates in TG of infected mice, while by day 5 PI, IFNα2A-/- mice had significantly lower levels of CD8α, F4/80, CD11b, CD11c, NK1.1 compared with control mice. In conjunction with these reduced expressions of immune responsive genes, HSV-1 gB transcripts were also lower in the knockout mice, indicating reduced viral replication in TG on day 5 PI. Absence of differences in immune cells between IFNα2A-/- mice and control mice on day 3 PI is possibly due to lower viral load in TG on day 3 versus day 5 PI. This lower viral load on day 3 versus day 5 PI correlated with significantly lower expression levels of CD8α, F4/80, CD11b, CD11c, NK1.1, IRF9, Stat1, and Stat2 transcripts. Similarly, levels of IFNβ and IFNγ in TG of infected IFNα2A-/- and control mice were similar on day 3 PI, while the expression levels for both IFNβ and IFNγ were significantly lower in the IFNα2A-/- group on day 5 PI. Thus, absence of IFNα2A significantly reduced levels of IFNβ and IFNγ expressions in TG of infected mice but the absence of IFNα2A expression did not affect viral replication in the eyes of infected mice. The absence of IFNα2A in infected mice did not affect their susceptibility to ocular infection with the virulent HSV-1 strain McKrae. Furthermore, after infection of mice lacking IFNα2A, the levels of eye disease were similar to that in control mice. Overall, lower expressions of CD8α, F4/80, CD11b, CD11c, NK1.1 IRF9, Stat1, Stat2, IFNβ, and IFNγ in TG did not affect virus replication in the eye, eye disease, or survival in IFNα2A-/- infected mice. IFNAR1-/- mice are highly susceptible to HSV-1 infection [82–85]. In contrast to the highly susceptible IFNAR1-/- mice, IFNα2A-/- mice are less susceptible to HSV-1 infection, which could be due to functional redundancy of IFNα subtypes.

HSV-1 LAT is the only viral product that is expressed abundantly in TG of infected mice, rabbits, and humans [60,86–89]. In this study we showed significantly less LAT expression in TG of IFNα2A-/- mice than in control mice. LAT interferes with host IFNα/β expressions in the TG of infected mice and this interference is independent of other HSV-1 genes that inhibits IFNα/β signaling [90–95]. LAT is important for the high WT rate of in vivo spontaneous [96], and induced [86] reactivation from latency. LAT also has anti-apoptotic activity [35–40] and is associated with T cell exhaustion in TG of latently infected mice [60]. It was previously shown that LAT delays expressions of several IFNα subtypes as well as IFNβ in vitro and in vivo [34]. In addition to LAT, ICP0 and ICP27 also inhibits the type I IFN pathway during the acute phase of infection [97–99]. Our results suggest that IFNα2A could utilize a reverse mechanism on LAT expression to reduce levels of latency and T cell exhaustion during latency in mice. Similar to HSV-1 LAT, viruses have developed strategies to suppress IFNα/β such as vaccinia virus E3L and influenza virus NS1 that inhibits IFNα/β production [100–102].

Previously, we and others have shown that higher LAT expression is correlated with higher reactivation in infected mice [60,62]. HSV-1 LAT plays a major role in enhancing the reactivation phenotype in TG of infected mice and rabbits [86,96,103]. LAT deletion mutant viruses have a reduced reactivation phenotype in both mice and rabbits [86,96,103]. In this study, the absence of IFNα2A expression in TG of IFNα2A-/- mice did not alter time of reactivation compared with control mice. However, levels of reactivation in this study were similar between latently infected IFNα2A-/- and control mice despite significantly higher levels of LAT expression in the TG of control mice. Thus, reduced expression of IFNα2A transcript did not correlate with changes in time to reactivation. Consistent with reduced levels of LAT in TG of IFNα2A-/- mice compared with control mice, we also found lower levels of CD8α and PD-1 expressions in TG of mice lacking IFNα2A. We previously showed that lower levels of latency strongly correlate with lower levels of CD8α and PD-1 expressions and, thereby, reduced T cell exhaustion [60]. Although despite the presence of other known IFNα genes, in this study we have shown that the absence of IFNα2A was not compensated by the other 13 IFNα subtypes with regards to HSV-1 latency and T cell exhaustion.

In conclusion, in this study, due to the importance of IFNα2A in both viral infections and cancer therapy, we report the novel construction of a knockout mouse lacking IFNα2A (Roferon-A) gene. The absence of IFNα2A affected levels of viral transcripts which leads to less cell recruitment and hence less inflammation during primary infection as well as reduced levels of latency and T cell exhaustion, but not time to reactivation. Our results also suggest that few but not all functions of IFNα2A could be compensated by the remaining members of the IFNα family and highlight the redundancy of the IFNα subtypes. Thus, blocking IFNα2A expression may be a useful tool to reduce latency and subsequently managing infection.

Material and methods

Ethics statement

All animal procedures were performed in strict accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and the NIH guide for Care and Use of Laboratory Animals (ISBN 0-309-05377-3). The animal research protocol was approved by the Institutional Animal Care and Use Committee of Cedars-Sinai Medical Center (Protocol # 8837).

Cells and virus

The rabbit skin (RS) cell line was cultured in minimal essential medium plus 5% fetal bovine serum and maintained as described previously [104]. Triple-plaque-purified HSV-1 strain McKrae was grown in RS cell monolayers as described previously [96]. HSV strain McKrae is a virulent strain of virus that infects mice efficiently without corneal scarification.

Generation of IFNα2A knockout mice

IFNα2A-/- mice on a C57BL/6 background were generated in-house using CRISPR technology. The gRNA sequence used was UCAUCACUAUCAGCA UCACGAGG and was synthesized by Dharmacon, Inc. (Lafayette, CO). Briefly, a CRISPR mixture containing gRNA and 20 ng/μl eSPCas9 protein (Cat # ESPCAS9PRO-50UG) (Millipore-Sigma, Burlington, MA, USA) in injection buffer (0.1 mM EDTA, 10 mM Tris-HCl, 100 mM NaCl) was introduced into WT C57BL/6J fertilized eggs via pronuclear microinjection following standard methods. Guide RNA efficacy and the status of non-homologous end joining (NHEJ) were validated by PCR genotyping of blastocysts in the initial phase and subsequently on tissue samples isolated from transgenic founders and progeny. Deletion mutations were identified by genotyping and sequencing, and founder 3 (male) was chosen to generate the knockout line. The knockout mice were backcrossed to WT C57BL/6 mice for 2 generations before generating the homozygous mice. WT C57BL/6 mice were used as controls and were purchased from The Jackson Laboratory (Bar Harbor, ME) and bred in-house at Cedars-Sinai Medical Center.

IFNα2A-/- mice genotyping

The following primers were used to screen IFNα2A-/- mice: IFNa2A-F: TCAACCTCTGCAAGACCCAC and IFNa2A-R2: GAGTCTAGGAGGGTTGTATTCC. The resulted PCR product is 181 bp for deletion mutant allele and 341 bp for wild type allele.

Ocular infection

WT control and IFNα2A-/- mice (7 to 8 weeks old of both sexes) were ocularly infected in both eyes with 2 X 105 pfu/eye of HSV strain McKrae in MEM medium as an eye drop without corneal scarification as we described previously [61].

Viral titers from tears of infected mice

Tear films were collected from 10 WT (5 males and 5 females) and 17 IFNa2A (10 males and 7 females) infected mice eyes on days 1–5 post infection (PI) using a Dacron-tipped swab. Each swab was placed in 1 ml of tissue culture medium and squeezed. The amount of virus was determined using a standard plaque assay on RS cells as described [105]. Virus replication in the eyes of infected male and female mice for each group were the same.

Monitoring corneal scarring

The severity of CS lesions in mouse corneas was examined by slit-lamp biomicroscopy. Scoring scale was: 0, normal cornea; 1, mild haze; 2, moderate opacity; 3, severe corneal opacity but iris visible; 4, opaque and corneal ulcer; 5, corneal rupture and necrotizing keratitis as we described [106].

In vitro explant reactivation assay

TG from infected mice were harvested 28 days PI, cultured in 1.5 ml tissue culture medium, and the reactivation assay was performed as we described previously [107]. Briefly, a 100-μl aliquot was collected from each culture daily and used to infect RS cell monolayers, which were monitored daily for 5 days for the appearance of cytopathic effect (CPE) to determine the time that reactivated virus first appeared from each TG. Media from the explanted TG cultures were plated daily and the time at which reactivated virus first appeared in explanted TG cultures was determined.

Gene expressions during primary infection

TG from individual mice were isolated on days 3 and 5 PI. Collected tissues were immersed in TRIzol reagent and stored at −80°C until processing. TG from each animal were processed for RNA extraction as described previously [107]. Isolated total RNA was reverse transcribed using high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s recommendations. Expression levels of gene transcripts were evaluated using custom-made TaqMan primer sets as follows: for gB, 5′-AACGCGA CGCACATCAAG-3′ (forward), 5′-CTGGTACGCGATCAGAAAGC-3′ (reverse), and probe 5’ FAM-CAG CCGCAGTACTACC-3′ (where FAM is 6-carboxyfluorescein); CD8α (Mm01182107_g1); IFNγ (Mm01168134_m1); IFNα1 (Mm03030145_gH); IFNκ (Mm02529417_s1); IFNα4 (Mm00833969_s1); IFNα6 (Mm01703458_s1); IFNα11 (Mm04207507_gH); IFNα12 (Mm00616656_s1); IFNα13 (Mm01731013_s1); IFNα14 (Mm01703465_s1); IFNα16 (Mm01703434_s1); Stat1 (Mm01257286_m1); Stat2 (Mm00490880_m1); CD11c (Mm00498701_m1); IRF9 (Mm00492679_m1); CD11b (Mm00434455_m1); NK1.1 (Mm07307455_s1); F4/80 (Mm00802529_m1); CD4 (Mm00442754_m1); and IFNβ (Mm00439552_s1). GAPDH (m999999.15_G1) was used as an internal control.

The estimated relative copy number of gB expression was calculated using standard curves generated from plasmid pAc-gB1 [108]. Briefly, plasmid DNA template was serially diluted 10-fold so that 1 μl contained from 103 to 108 copies of the desired gene and then was subjected to TaqMan PCR with the same set of primers as the test samples. The copy number for each reaction product was determined by comparing the normalized threshold cycle (CT) of each sample to the threshold cycle of the standard curve. To analyze fold change of expression, the 2−ΔΔCT method was used to calculate gene expression fold change compared to expression in uninfected controls in each group. Statistical difference was calculated by ΔCT value.

Determining the levels of latency in TG of latently infected mice

TG from individual mice were collected on day 28 PI, immersed in RNA stabilization reagent (RNA Later, Thermo Fisher Scientific, Waltham, MA, USA), and stored at −80°C until processing. Total RNA was extracted as we described previously. LAT RNA levels from latent TG were determined using custom-made LAT primers and probe as follows: forward primer, 5′-GGGTGGGCTCGTGTTACAG-3′; reverse primer, 5′-GGACGGGTAAGTAA CAGAGTCTCTA-3′; and probe, 5′-FAM-ACACCAGCCCGTTC TTT-3′ (amplicon length = 81 bp). GAPDH was used as an internal control. LAT RNA copy number was calculated using a standard curve generated using pGem5317 containing the LAT region as we described previously [61].

Statistical analysis

Student’s t-test was performed using the computer program Instat (GraphPad, San Diego, CA). Results were considered statistically significant at a “P” value of <0.05. All experiments were repeated at least two times to ensure accuracy. For RT-PCR analysis, the statistical significance was calculated based on ΔΔCT and P<0.05 considered as significant. Error bar for each figure was automatically calculated by PRISM software, which is based on individual value of fold change, 2^(- ΔΔCT).

Supporting information

S1 Data. Original data that underlies this paper (Figs 2–7).

https://doi.org/10.1371/journal.ppat.1012612.s001

(PDF)

References

  1. 1. Jaitin DA, Schreiber G. Upregulation of a small subset of genes drives type I interferon-induced antiviral memory. J Interferon Cytokine Res. 2007;27(8):653–64. pmid:17784817.
  2. 2. Ivashkiv LB, Donlin LT. Regulation of type I interferon responses. Nat Rev Immunol. 2014;14(1):36–49. pmid:24362405; PubMed Central PMCID: PMC4084561.
  3. 3. Navratil V, de Chassey B, Meyniel L, Pradezynski F, Andre P, Rabourdin-Combe C, et al. System-level comparison of protein-protein interactions between viruses and the human type I interferon system network. J Proteome Res. 2010;9(7):3527–36. pmid:20459142.
  4. 4. Lin RJ, Liao CL, Lin E, Lin YL. Blocking of the alpha interferon-induced Jak-Stat signaling pathway by Japanese encephalitis virus infection. J Virol. 2004;78(17):9285–94. pmid:15308723; PubMed Central PMCID: PMC506928.
  5. 5. Stark GR, Kerr IM, Williams BR, Silverman RH, Schreiber RD. How cells respond to interferons. Annu Rev Biochem. 1998;67:227–64. pmid:9759489
  6. 6. Theofilopoulos AN, Baccala R, Beutler B, Kono DH. Type I interferons (alpha/beta) in immunity and autoimmunity. Annu Rev Immunol. 2005;23:307–36. pmid:15771573.
  7. 7. McNab F, Mayer-Barber K, Sher A, Wack A, O’Garra A. Type I interferons in infectious disease. Nat Rev Immunol. 2015;15(2):87–103. pmid:25614319.
  8. 8. Dowling JW, Forero A. Beyond Good and Evil: Molecular Mechanisms of Type I and III IFN Functions. J Immunol. 2022;208(2):247–56. pmid:35017214.
  9. 9. Pestka S, Krause CD, Walter MR. Interferons, interferon-like cytokines, and their receptors. Immunol Rev. 2004;202:8–32. pmid:15546383.
  10. 10. Pestka S. The human interferon alpha species and receptors. Biopolymers. 2000;55(4):254–87. pmid:11169919.
  11. 11. Hardy MP, Owczarek CM, Trajanovska S, Liu X, Kola I, Hertzog PJ. The soluble murine type I interferon receptor Ifnar-2 is present in serum, is independently regulated, and has both agonistic and antagonistic properties. Blood. 2001;97(2):473–82. pmid:11154225.
  12. 12. Hardy MP, Sanij EP, Hertzog PJ, Owczarek CM. Characterization and transcriptional analysis of the mouse Chromosome 16 cytokine receptor gene cluster. Mamm Genome. 2003;14(2):105–18. pmid:12584606.
  13. 13. de Weerd NA, Samarajiwa SA, Hertzog PJ. Type I interferon receptors: biochemistry and biological functions. J Biol Chem. 2007;282(28):20053–7. pmid:17502368.
  14. 14. Chen K, Liu J, Cao X. Regulation of type I interferon signaling in immunity and inflammation: A comprehensive review. J Autoimmun. 2017;83:1–11. Epub 20170319. pmid:28330758.
  15. 15. Snell LM, McGaha TL, Brooks DG. Type I Interferon in Chronic Virus Infection and Cancer. Trends Immunol. 2017;38(8):542–57. Epub 20170531. pmid:28579323; PubMed Central PMCID: PMC8059441.
  16. 16. Forero A, Ozarkar S, Li H, Lee CH, Hemann EA, Nadjsombati MS, et al. Differential Activation of the Transcription Factor IRF1 Underlies the Distinct Immune Responses Elicited by Type I and Type III Interferons. Immunity. 2019;51(3):451–64 e6. Epub 20190827. pmid:31471108; PubMed Central PMCID: PMC7447158.
  17. 17. Stetson DB, Medzhitov R. Type I interferons in host defense. Immunity. 2006;25(3):373–81. pmid:16979569.
  18. 18. Mossman KL, Ashkar AA. Herpesviruses and the innate immune response. Viral Immunol. 2005;18(2):267–81. pmid:16035939.
  19. 19. Marrack P, Kappler J, Mitchell T. Type I interferons keep activated T cells alive. J Exp Med. 1999;189(3):521–30. pmid:9927514; PubMed Central PMCID: PMC2192920.
  20. 20. Fuertes MB, Kacha AK, Kline J, Woo SR, Kranz DM, Murphy KM, et al. Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8{alpha}+ dendritic cells. J Exp Med. 2011;208(10):2005–16. pmid:21930765; PubMed Central PMCID: PMC3182064.
  21. 21. Kolumam GA, Thomas S, Thompson LJ, Sprent J, Murali-Krishna K. Type I interferons act directly on CD8 T cells to allow clonal expansion and memory formation in response to viral infection. J Exp Med. 2005;202(5):637–50. pmid:16129706; PubMed Central PMCID: PMC2212878.
  22. 22. Stolzer I, Ruder B, Neurath MF, Gunther C. Interferons at the crossroad of cell death pathways during gastrointestinal inflammation and infection. Int J Med Microbiol. 2021;311(3):151491. Epub 20210225. pmid:33662871.
  23. 23. Apelbaum A, Yarden G, Warszawski S, Harari D, Schreiber G. Type I interferons induce apoptosis by balancing cFLIP and caspase-8 independent of death ligands. Mol Cell Biol. 2013;33(4):800–14. Epub 20121210. pmid:23230268; PubMed Central PMCID: PMC3571350.
  24. 24. Barber GN. Host defense, viruses and apoptosis. Cell Death Differ. 2001;8(2):113–26. pmid:11313713.
  25. 25. Levine B. Apoptosis in viral infections of neurons: a protective or pathologic host response? Curr Top Microbiol Immunol. 2002;265:95–118. pmid:12014197.
  26. 26. Brierley MM, Fish EN. Review: IFN-alpha/beta receptor interactions to biologic outcomes: understanding the circuitry. J Interferon Cytokine Res. 2002;22(8):835–45. pmid:12396722.
  27. 27. Thomas C, Moraga I, Levin D, Krutzik PO, Podoplelova Y, Trejo A, et al. Structural linkage between ligand discrimination and receptor activation by type I interferons. Cell. 2011;146(4):621–32. pmid:21854986; PubMed Central PMCID: PMC3166218.
  28. 28. Hwang SY, Hertzog PJ, Holland KA, Sumarsono SH, Tymms MJ, Hamilton JA, et al. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc Natl Acad Sci U S A. 1995;92(24):11284–8. pmid:7479980; PubMed Central PMCID: PMC40616.
  29. 29. Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM, et al. Functional role of type I and type II interferons in antiviral defense. Science. 1994;264(5167):1918–21. pmid:8009221
  30. 30. Platanias LC, Uddin S, Colamonici OR. Tyrosine phosphorylation of the alpha and beta subunits of the type I interferon receptor. Interferon-beta selectively induces tyrosine phosphorylation of an alpha subunit-associated protein. J Biol Chem. 1994;269(27):17761–4. pmid:8027027.
  31. 31. Allen SJ, Rhode-Kurnow A, Mott KR, Jiang X, Carpenter D, Rodriguez-Barbosa JI, et al. Interactions between herpesvirus entry mediator (TNFRSF14) and latency-associated transcript during herpes simplex virus 1 latency. J Virol. 2014;88(4):1961–71. Epub 2013/12/07. pmid:24307582; PubMed Central PMCID: PMC3911542.
  32. 32. Tormanen K, Allen S, Mott KR, Ghiasi H. The Latency-Associated Transcript Inhibits Apoptosis via Downregulation of Components of the Type I Interferon Pathway during Latent Herpes Simplex Virus 1 Ocular Infection. J Virol. 2019;93(10)e00103–19. Epub 20190501. pmid:30814286; PubMed Central PMCID: PMC6498055.
  33. 33. Wang S, Ljubimov AV, Jin L, Pfeffer K, Kronenberg M, Ghiasi H. Herpes Simplex Virus 1 Latency and the Kinetics of Reactivation Are Regulated by a Complex Network of Interactions between the Herpesvirus Entry Mediator, Its Ligands (gD, BTLA, LIGHT, and CD160), and the Latency-Associated Transcript. J Virol. 2018;92(24)e01451–18. Epub 20181127. pmid:30282707; PubMed Central PMCID: PMC6258941.
  34. 34. Peng W, Henderson G, Inman M, BenMohamed L, Perng GC, Wechsler SL, et al. The locus encompassing the latency-associated transcript of herpes simplex virus type 1 interferes with and delays interferon expression in productively infected neuroblastoma cells and trigeminal Ganglia of acutely infected mice. J Virol. 2005;79(10):6162–71. pmid:15858001; PubMed Central PMCID: PMC1091686.
  35. 35. Perng GC, Jones C, Ciacci-Zanella J, Stone M, Henderson G, Yukht A, et al. Virus-induced neuronal apoptosis blocked by the herpes simplex virus latency-associated transcript. Science. 2000;287(5457):1500–3. pmid:10688801
  36. 36. Carpenter D, Hsiang C, Brown DJ, Jin L, Osorio N, BenMohamed L, et al. Stable cell lines expressing high levels of the herpes simplex virus type 1 LAT are refractory to caspase 3 activation and DNA laddering following cold shock induced apoptosis. Virology. 2007;369(1):12–8. Epub 2007 Aug 28. pmid:17727910.
  37. 37. Jin L, Peng W, Perng GC, Brick DJ, Nesburn AB, Jones C, et al. Identification of herpes simplex virus type 1 latency-associated transcript sequences that both inhibit apoptosis and enhance the spontaneous reactivation phenotype. J Virol. 2003;77(11):6556–61. pmid:12743314.
  38. 38. Peng W, Jin L, Henderson G, Perng GC, Brick DJ, Nesburn AB, et al. Mapping herpes simplex virus type 1 latency-associated transcript sequences that protect from apoptosis mediated by a plasmid expressing caspase-8. J Neurovirol. 2004;10(4):260–5. pmid:15371157.
  39. 39. Inman M, Perng GC, Henderson G, Ghiasi H, Nesburn AB, Wechsler SL, et al. Region of herpes simplex virus type 1 latency-associated transcript sufficient for wild-type spontaneous reactivation promotes cell survival in tissue culture. J Virol. 2001;75(8):3636–46. pmid:11264353.
  40. 40. Branco FJ, Fraser NW. Herpes simplex virus type 1 latency-associated transcript expression protects trigeminal ganglion neurons from apoptosis. J Virol. 2005;79(14):9019–25. pmid:15994795.
  41. 41. Perng GC, Maguen B, Jin L, Mott KR, Osorio N, Slanina SM, et al. A gene capable of blocking apoptosis can substitute for the herpes simplex virus type 1 latency-associated transcript gene and restore wild-type reactivation levels. J Virol. 2002;76(3):1224–35. pmid:11773398.
  42. 42. Jin L, Perng GC, Carpenter D, Mott KR, Osorio N, Naito J, et al. Reactivation phenotype in rabbits of a herpes simplex virus type 1 mutant containing an unrelated antiapoptosis gene in place of latency-associated transcript. J Neurovirol. 2007;13(1):78–84. pmid:17454452.
  43. 43. Pestka S, Langer JA, Zoon KC, Samuel CE. Interferons and their actions. Annu Rev Biochem. 1987;56:727–77. pmid:2441659.
  44. 44. Monkarsh SP, Ma Y, Aglione A, Bailon P, Ciolek D, DeBarbieri B, et al. Positional isomers of monopegylated interferon alpha-2a: isolation, characterization, and biological activity. Anal Biochem. 1997;247(2):434–40. pmid:9177709.
  45. 45. Heim MH. 25 years of interferon-based treatment of chronic hepatitis C: an epoch coming to an end. Nat Rev Immunol. 2013;13(7):535–42. pmid:23743475.
  46. 46. Ramon J, Saez V, Baez R, Aldana R, Hardy E. PEGylated interferon-alpha2b: a branched 40K polyethylene glycol derivative. Pharm Res. 2005;22(8):1374–86. Epub 20050803. pmid:16078148.
  47. 47. Azzoni L, Foulkes AS, Papasavvas E, Mexas AM, Lynn KM, Mounzer K, et al. Pegylated Interferon alfa-2a monotherapy results in suppression of HIV type 1 replication and decreased cell-associated HIV DNA integration. J Infect Dis. 2013;207(2):213–22. Epub 20121026. pmid:23105144; PubMed Central PMCID: PMC3532820.
  48. 48. Wang Y, Swiecki M, Cella M, Alber G, Schreiber RD, Gilfillan S, et al. Timing and magnitude of type I interferon responses by distinct sensors impact CD8 T cell exhaustion and chronic viral infection. Cell Host Microbe. 2012;11(6):631–42. pmid:22704623; PubMed Central PMCID: PMC3572910.
  49. 49. Antonelli G, Scagnolari C, Moschella F, Proietti E. Twenty-five years of type I interferon-based treatment: a critical analysis of its therapeutic use. Cytokine Growth Factor Rev. 2015;26(2):121–31. Epub 20141230. pmid:25578520; PubMed Central PMCID: PMC7108252.
  50. 50. Sandler NG, Bosinger SE, Estes JD, Zhu RT, Tharp GK, Boritz E, et al. Type I interferon responses in rhesus macaques prevent SIV infection and slow disease progression. Nature. 2014;511(7511):601–5. Epub 20140709. pmid:25043006; PubMed Central PMCID: PMC4418221.
  51. 51. Bosinger SE, Utay NS. Type I interferon: understanding its role in HIV pathogenesis and therapy. Curr HIV/AIDS Rep. 2015;12(1):41–53. pmid:25662992.
  52. 52. Zitvogel L, Galluzzi L, Kepp O, Smyth MJ, Kroemer G. Type I interferons in anticancer immunity. Nat Rev Immunol. 2015;15(7):405–14. Epub 20150601. pmid:26027717.
  53. 53. Scheu S, Dresing P, Locksley RM. Visualization of IFNbeta production by plasmacytoid versus conventional dendritic cells under specific stimulation conditions in vivo. Proc Natl Acad Sci U S A. 2008;105(51):20416–21. Epub 20081216. pmid:19088190; PubMed Central PMCID: PMC2629269.
  54. 54. Decker T, Muller M, Stockinger S. The yin and yang of type I interferon activity in bacterial infection. Nat Rev Immunol. 2005;5(9):675–87. pmid:16110316.
  55. 55. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337(6096):816–21. Epub 20120628. pmid:22745249; PubMed Central PMCID: PMC6286148.
  56. 56. Haeussler M, Schonig K, Eckert H, Eschstruth A, Mianne J, Renaud JB, et al. Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 2016;17(1):148. Epub 20160705. pmid:27380939; PubMed Central PMCID: PMC4934014.
  57. 57. Zandian M, Mott KR, Allen SJ, Dumitrascu O, Kuo JZ, Ghiasi H. Use of cytokine immunotherapy to block CNS demyelination induced by a recombinant HSV-1 expressing murine interleukin-2. Gene Ther. 2011;18:734–42. Epub 2009/02/24. [pii] pmid:19234357.
  58. 58. Zandian M, Belisle R, Mott KR, Nusinowitz S, Hofman FM, Ghiasi H. Optic neuritis in different strains of mice by a recombinant HSV-1 expressing murine interleukin-2. Invest Ophthalmol Vis Sci. 2009;50(7):3275–82. Epub 2009 Feb 21. pmid:19234357.
  59. 59. Dumitrascu OM, Mott KR, Ghiasi H. A comparative study of experimental mouse models of central nervous system demyelination. Gene Ther. 2014;21:599–608. pmid:24718267.
  60. 60. Allen SJ, Hamrah P, Gate DM, Mott KR, Mantopoulos D, Zheng L, et al. The role of LAT in increased CD8+ T cell exhaustion in trigeminal ganglia of mice latently infected with herpes simplex virus type 1. J Virol. 2011;85:4184–97. Epub 2011/02/11. [pii]
  61. 61. Mott KR, Bresee CJ, Allen SJ, BenMohamed L, Wechsler SL, Ghiasi H. Level of herpes simplex virus type 1 latency correlates with severity of corneal scarring and exhaustion of CD8+ T cells in trigeminal ganglia of latently infected mice. J Virol. 2009;83(5):2246–54. Epub 008 Dec 17. pmid:19091870.
  62. 62. Matundan HH, Mott KR, Allen SJ, Wang S, Bresee CJ, Ghiasi YN, et al. Interrelationship of Primary Virus Replication, Level of Latency, and Time to Reactivation in the Trigeminal Ganglia of Latently Infected Mice. J Virol. 2016;90(20):9533–42. pmid:27512072.
  63. 63. Gonzalez-Navajas JM, Lee J, David M, Raz E. Immunomodulatory functions of type I interferons. Nat Rev Immunol. 2012;12(2):125–35. pmid:22222875; PubMed Central PMCID: PMC3727154.
  64. 64. Bowie AG, Unterholzner L. Viral evasion and subversion of pattern-recognition receptor signalling. Nat Rev Immunol. 2008;8(12):911–22. pmid:18989317.
  65. 65. Kalie E, Jaitin DA, Podoplelova Y, Piehler J, Schreiber G. The stability of the ternary interferon-receptor complex rather than the affinity to the individual subunits dictates differential biological activities. J Biol Chem. 2008;283(47):32925–36. pmid:18801736.
  66. 66. Der SD, Zhou A, Williams BR, Silverman RH. Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proc Natl Acad Sci U S A. 1998;95(26):15623–8. pmid:9861020; PubMed Central PMCID: PMC28094.
  67. 67. Hendricks RL, Weber PC, Taylor JL, Koumbis A, Tumpey TM, Glorioso JC. Endogenously produced interferon alpha protects mice from herpes simplex virus type 1 corneal disease. J Gen Virol. 1991;72(Pt 7):1601–10. pmid:1649898
  68. 68. Su YH, Oakes JE, Lausch RN. Ocular avirulence of a herpes simplex virus type 1 strain is associated with heightened sensitivity to alpha/beta interferon. J Virol. 1990;64(5):2187–92. pmid:2157880
  69. 69. Noisakran S, Campbell IL, Carr DJ. IFN-alpha1 plasmid construct affords protection against HSV-1 infection in transfected L929 fibroblasts. J Interferon Cytokine Res. 2000;20(1):107–15. pmid:10670657.
  70. 70. Noisakran S, Carr DJ. Plasmid DNA encoding IFN-alpha 1 antagonizes herpes simplex virus type 1 ocular infection through CD4+ and CD8+ T lymphocytes. J Immunol. 2000;164(12):6435–43. pmid:10843699.
  71. 71. Presti RM, Pollock JL, Dal Canto AJ, O’Guin AK, Virgin HWt. Interferon gamma regulates acute and latent murine cytomegalovirus infection and chronic disease of the great vessels. J Exp Med. 1998;188(3):577–88. pmid:9687534; PubMed Central PMCID: PMC2212470.
  72. 72. Dupuis S, Jouanguy E, Al-Hajjar S, Fieschi C, Al-Mohsen IZ, Al-Jumaah S, et al. Impaired response to interferon-alpha/beta and lethal viral disease in human STAT1 deficiency. Nat Genet. 2003;33(3):388–91. Epub 20030218. pmid:12590259.
  73. 73. Vairo D, Tassone L, Tabellini G, Tamassia N, Gasperini S, Bazzoni F, et al. Severe impairment of IFN-gamma and IFN-alpha responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 2011;118(7):1806–17. Epub 20110719. pmid:21772053.
  74. 74. Chapgier A, Wynn RF, Jouanguy E, Filipe-Santos O, Zhang S, Feinberg J, et al. Human complete Stat-1 deficiency is associated with defective type I and II IFN responses in vitro but immunity to some low virulence viruses in vivo. J Immunol. 2006;176(8):5078–83. pmid:16585605.
  75. 75. Jaggi U, Matundan HH, Yu J, Hirose S, Mueller M, Wormley FL Jr, et al. Essential role of M1 macrophages in blocking cytokine storm and pathology associated with murine HSV-1 infection. PLoS Pathog. 2021;17(10):e1009999. Epub 20211015. pmid:34653236; PubMed Central PMCID: PMC8550391.
  76. 76. Wen Y, Liu P. Interferon successfully inhibited refractory cytomegalovirus infection and resulted in CD4+ T-cells increase in a patient with AIDS. HIV Clin Trials. 2011;12(2):118–20. pmid:21498155.
  77. 77. Lee DH, Ghiasi H. Roles of M1 and M2 Macrophages in Herpes Simplex Virus 1 Infectivity. J Virol. 2017;91(15):pii: e00578–17. pmid:28490589; PubMed Central PMCID: PMC5512262.
  78. 78. Matundan H, Ghiasi H. Herpes Simplex Virus 1 ICP22 Suppresses CD80 Expression by Murine Dendritic Cells. J Virol. 2019;93(3). Epub 20190117. pmid:30404803; PubMed Central PMCID: PMC6340034.
  79. 79. Ghiasi H, Cai S, Perng GC, Nesburn AB, Wechsler SL. The role of natural killer cells in protection of mice against death and corneal scarring following ocular HSV-1 infection. Antiviral Res. 2000;45(1):33–45. pmid:10774588
  80. 80. Ghiasi H, Cai S, Perng GC, Nesburn AB, Wechsler SL. Both CD4+ and CD8+ T cells are involved in protection against HSV-1 induced corneal scarring. Br J Ophthalmol. 2000;84(4):408–12. pmid:10729300
  81. 81. Lee DH, Jaggi U, Ghiasi H. CCR2+ migratory macrophages with M1 status are the early-responders in the cornea of HSV-1 infected mice. PLoS One. 2019;14(4):e0215727. Epub 20190418. pmid:30998796; PubMed Central PMCID: PMC6472814.
  82. 82. Conrady CD, Halford WP, Carr DJ. Loss of the type I interferon pathway increases vulnerability of mice to genital herpes simplex virus 2 infection. J Virol. 2011;85(4):1625–33. pmid:21147921; PubMed Central PMCID: PMC3028887.
  83. 83. Conrady CD, Thapa M, Wuest T, Carr DJ. Loss of mandibular lymph node integrity is associated with an increase in sensitivity to HSV-1 infection in CD118-deficient mice. J Immunol. 2009;182(6):3678–87. pmid:19265146; PubMed Central PMCID: PMC2652688.
  84. 84. Leib DA, Harrison TE, Laslo KM, Machalek MA, Moorman NJ, Virgin HW. Interferons regulate the phenotype of wild-type and mutant herpes simplex viruses in vivo. J Exp Med. 1999;189(4):663–72. Epub 1999/02/17. pmid:9989981.
  85. 85. Luker GD, Prior JL, Song J, Pica CM, Leib DA. Bioluminescence imaging reveals systemic dissemination of herpes simplex virus type 1 in the absence of interferon receptors. J Virol. 2003;77(20):11082–93. pmid:14512556; PubMed Central PMCID: PMC224994.
  86. 86. Hill JM, Sedarati F, Javier RT, Wagner EK, Stevens JG. Herpes simplex virus latent phase transcription facilitates in vivo reactivation. Virology. 1990;174(1):117–25. pmid:2152989
  87. 87. Rock DL, Nesburn AB, Ghiasi H, Ong J, Lewis TL, Lokensgard JR, et al. Detection of latency-related viral RNAs in trigeminal ganglia of rabbits latently infected with herpes simplex virus type 1. J Virol. 1987;61(12):3820–6. pmid:2824816
  88. 88. Wechsler SL, Nesburn AB, Watson R, Slanina S, Ghiasi H. Fine mapping of the major latency-related RNA of herpes simplex virus type 1 in humans. J Gen Virol. 1988;69(Pt 12):3101–6. pmid:2848928
  89. 89. Wechsler SL, Nesburn AB, Watson R, Slanina SM, Ghiasi H. Fine mapping of the latency-related gene of herpes simplex virus type 1: alternative splicing produces distinct latency-related RNAs containing open reading frames. J Virol. 1988;62(11):4051–8. pmid:2845123
  90. 90. Johnson KE, Song B, Knipe DM. Role for herpes simplex virus 1 ICP27 in the inhibition of type I interferon signaling. Virology. 2008;374(2):487–94. pmid:18279905; PubMed Central PMCID: PMC2638114.
  91. 91. Mossman KL, Saffran HA, Smiley JR. Herpes simplex virus ICP0 mutants are hypersensitive to interferon. J Virol. 2000;74(4):2052–6. pmid:10644380; PubMed Central PMCID: PMC111685.
  92. 92. Kew C, Lui PY, Chan CP, Liu X, Au SW, Mohr I, et al. Suppression of PACT-induced type I interferon production by herpes simplex virus 1 Us11 protein. J Virol. 2013;87(24):13141–9. pmid:24067967; PubMed Central PMCID: PMC3838286.
  93. 93. Cotter CR, Nguyen ML, Yount JS, Lopez CB, Blaho JA, Moran TM. The virion host shut-off (vhs) protein blocks a TLR-independent pathway of herpes simplex virus type 1 recognition in human and mouse dendritic cells. PLoS One. 2010;5(2):e8684. pmid:20174621; PubMed Central PMCID: PMC2823768.
  94. 94. Wang S, Wang K, Lin R, Zheng C. Herpes simplex virus 1 serine/threonine kinase US3 hyperphosphorylates IRF3 and inhibits beta interferon production. J Virol. 2013;87(23):12814–27. pmid:24049179; PubMed Central PMCID: PMC3838156.
  95. 95. Paladino P, Mossman KL. Mechanisms employed by herpes simplex virus 1 to inhibit the interferon response. J Interferon Cytokine Res. 2009;29(9):599–607. pmid:19694546.
  96. 96. Perng GC, Dunkel EC, Geary PA, Slanina SM, Ghiasi H, Kaiwar R, et al. The latency-associated transcript gene of herpes simplex virus type 1 (HSV-1) is required for efficient in vivo spontaneous reactivation of HSV-1 from latency. J Virol. 1994;68(12):8045–55. pmid:7966594
  97. 97. Mossman KL, Macgregor PF, Rozmus JJ, Goryachev AB, Edwards AM, Smiley JR. Herpes simplex virus triggers and then disarms a host antiviral response. J Virol. 2001;75(2):750–8. pmid:11134288; PubMed Central PMCID: PMC113971.
  98. 98. Eidson KM, Hobbs WE, Manning BJ, Carlson P, DeLuca NA. Expression of herpes simplex virus ICP0 inhibits the induction of interferon-stimulated genes by viral infection. J Virol. 2002;76(5):2180–91. pmid:11836395; PubMed Central PMCID: PMC153810.
  99. 99. Christensen MH, Jensen SB, Miettinen JJ, Luecke S, Prabakaran T, Reinert LS, et al. HSV-1 ICP27 targets the TBK1-activated STING signalsome to inhibit virus-induced type I IFN expression. EMBO J. 2016;35(13):1385–99. Epub 20160527. pmid:27234299; PubMed Central PMCID: PMC4931188.
  100. 100. Xiang Y, Condit RC, Vijaysri S, Jacobs B, Williams BR, Silverman RH. Blockade of interferon induction and action by the E3L double-stranded RNA binding proteins of vaccinia virus. J Virol. 2002;76(10):5251–9. pmid:11967338; PubMed Central PMCID: PMC136119.
  101. 101. Garcia-Sastre A. Inhibition of interferon-mediated antiviral responses by influenza A viruses and other negative-strand RNA viruses. Virology. 2001;279(2):375–84. pmid:11162793.
  102. 102. Kim YG, Muralinath M, Brandt T, Pearcy M, Hauns K, Lowenhaupt K, et al. A role for Z-DNA binding in vaccinia virus pathogenesis. Proc Natl Acad Sci U S A. 2003;100(12):6974–9. pmid:12777633; PubMed Central PMCID: PMC165815.
  103. 103. Sawtell NM, Thompson RL. Herpes simplex virus type 1 latency-associated transcription unit promotes anatomical site-dependent establishment and reactivation from latency. J Virol. 1992;66(4):2157–69. pmid:1312626
  104. 104. Ghiasi H, Kaiwar R, Nesburn AB, Slanina S, Wechsler SL. Expression of seven herpes simplex virus type 1 glycoproteins (gB, gC, gD, gE, gG, gH, and gI): comparative protection against lethal challenge in mice. J Virol. 1994;68(4):2118–26. pmid:8138996
  105. 105. Matundan HH, Jaggi U, Wang S, Ghiasi H. Loss of ICP22 in HSV-1 Elicits Immune Infiltration and Maintains Stromal Keratitis Despite Reduced Primary and Latent Virus Infectivity. Invest Ophthalmol Vis Sci. 2019;60(10):3398–406. pmid:31387116; PubMed Central PMCID: PMC6685448.
  106. 106. Ghiasi H, Bahri S, Nesburn AB, Wechsler SL. Protection against herpes simplex virus-induced eye disease after vaccination with seven individually expressed herpes simplex virus 1 glycoproteins. Invest Ophthalmol Vis Sci. 1995;36(7):1352–60. pmid:7775113
  107. 107. Mott KR, Perng GC, Osorio Y, Kousoulas KG, Ghiasi H. A Recombinant Herpes Simplex Virus Type 1 Expressing Two Additional Copies of gK Is More Pathogenic than Wild-Type Virus in Two Different Strains of Mice. J Virol. 2007;81(23):12962–72. Epub 2007 Sep 26. pmid:17898051.
  108. 108. Ghiasi H, Kaiwar R, Nesburn AB, Wechsler SL. Expression of herpes simplex virus type 1 glycoprotein B in insect cells. Initial analysis of its biochemical and immunological properties. Virus Res. 1992;22(1):25–39. pmid:1311136