Skip to main content
Advertisement
  • Loading metrics

Phosphorylated vimentin-triggered fibronectin matrix disaggregation enhances the dissemination of Treponema pallidum subsp. pallidum across the microvascular endothelial barrier

  • Xi Luo ,

    Contributed equally to this work with: Xi Luo, Litian Zhang, Xiaoyuan Xie

    Roles Conceptualization, Data curation, Investigation, Project administration, Resources, Writing – original draft, Writing – review & editing

    Affiliation Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China

  • Litian Zhang ,

    Contributed equally to this work with: Xi Luo, Litian Zhang, Xiaoyuan Xie

    Roles Conceptualization, Data curation, Investigation, Project administration, Resources, Writing – original draft, Writing – review & editing

    Affiliations Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China, The First School of Clinical Medicine, Southern Medical University, Guangzhou, People’s Republic of China

  • Xiaoyuan Xie ,

    Contributed equally to this work with: Xi Luo, Litian Zhang, Xiaoyuan Xie

    Roles Data curation, Investigation, Resources, Writing – review & editing

    Affiliations Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China, The First School of Clinical Medicine, Southern Medical University, Guangzhou, People’s Republic of China

  • Liyan Yuan,

    Roles Investigation, Writing – review & editing

    Affiliation Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China

  • Yanqiang Shi,

    Roles Investigation, Writing – review & editing

    Affiliation Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China

  • Yinbo Jiang ,

    Roles Conceptualization, Resources, Supervision, Writing – review & editing

    yinbo_j@126.com (YJ); kewujianstauch@163.com (WK); yangbin1@smu.edu.cn (BY)

    Affiliation Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China

  • Wujian Ke ,

    Roles Conceptualization, Supervision, Writing – review & editing

    yinbo_j@126.com (YJ); kewujianstauch@163.com (WK); yangbin1@smu.edu.cn (BY)

    Affiliation Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China

  • Bin Yang

    Roles Supervision, Writing – review & editing

    yinbo_j@126.com (YJ); kewujianstauch@163.com (WK); yangbin1@smu.edu.cn (BY)

    Affiliations Dermatology Hospital, Southern Medical University, Guangzhou, People’s Republic of China, The First School of Clinical Medicine, Southern Medical University, Guangzhou, People’s Republic of China

Abstract

Fibronectin (FN) is an essential component of the extracellular matrix (ECM) that protects the integrity of the microvascular endothelial barrier (MEB). However, Treponema pallidum subsp. pallidum (Tp) breaches this barrier through elusive mechanisms and rapidly disseminates throughout the host. We aimed to understand the impact of Tp on the surrounding FN matrix of MEB and the underlying mechanisms of this effect. In this study, immunofluorescence assays (IF) were conducted to assess the integrity of the FN matrix surrounding human microvascular endothelial cell-1 (HMEC-1) with/without Tp co-culture, revealing that only live Tp exhibited the capability to mediate FN matrix disaggregation in HMEC-1. Western blotting and IF were employed to determine the protein levels associated with the FN matrix during Tp infection, which showed the unaltered protein levels of total FN and its receptor integrin α5β1, along with reduced insoluble FN and increased soluble FN. Simultaneously, the integrin α5β1-binding protein–intracellular vimentin maintained a stable total protein level while exhibiting an increase in the soluble form, specifically mediated by the phosphorylation of its 39th residue (pSer39-vimentin). Besides, this process of vimentin phosphorylation, which could be hindered by a serine-to-alanine mutation or inhibition of phosphorylated-AKT1 (pAKT1), promoted intracellular vimentin rearrangement and FN matrix disaggregation. Moreover, within the introduction of additional cellular FN rather than other Tp-adhered ECM protein, in vitro endothelial barrier traversal experiment and in vivo syphilitic infectivity test demonstrated that viable Tp was effectively prevented from penetrating the in vitro MEB or disseminating in Tp-challenged rabbits. This investigation revealed the active pAKT1/pSer39-vimentin signal triggered by live Tp to expedite the disaggregation of the FN matrix and highlighted the importance of FN matrix stability in syphilis, thereby providing a novel perspective on ECM disruption mechanisms that facilitate Tp dissemination across the MEB.

Author summary

Treponema pallidum subsp. pallidum (Tp), dominating the global concerned disease—syphilis, can mediate various pathogenic processes through its dissemination, during which the vascular endothelial barrier plays a vital role in the pathogen-host interaction. Tp alters the characteristics of the barrier components, including vascular endothelial cell and the surrounding extracelluar matrix (ECM), while the initial step of Tp dissemination involves breaching the ECM and moving toward the surface within unknown mechanisms. Here, we demostrated that live Tp triggered the pAKT1/pSer39-vimentin signals in microvascular endothelial cells, which promoted the redistribution of vimentin around the perinucleus. And pSer39-vimentin facilitated the detachment of intergrein α5β1 from fibronectin (FN), which is an essential component of ECM for Tp adhesion. Furthermore, we discovered that pAKT1 inhibition or addition of cellular FN could delay the FN matrix disaggregation, ultimately preventing live Tp from traversing the microvascular endothelial barrier. These results provide insights into ECM disruption employed by Tp and identify potential therapeutic targets against syphilis.

Introduction

Syphilis is a sexually transmitted disease, with Treponema pallidum subsp. pallidum (Tp) infection as the causative factor [1]. As the disease progresses or without proper treatment, patients may develop skin lesions and organ-specific damage [24], indicating that Tp can traverse various microvascular endothelial barriers (MEB) to reach different organs. Previous studies have revealed that Tp can enter the bloodstream of rabbits or penetrate the in vitro human umbilical vein endothelial cell barrier in a matter of hours [5,6]. Currently, two predominant pathways are proposed for microorganisms breaching the MEB: intracellular transendothelial migration, as seen with Streptococcus pneumoniae [7], and the paracellular pathway, exemplified by Neisseria meningitidis disrupting cell junctions [8]. Subsequently, Tp was observed within cell junctions and across a monolayer endothelial barrier without compromising its structural integrity [9], and can disrupt VE-Cadherin connections and initiate lipid raft-mediated endocytosis [6]. Nonetheless, a comprehensive understanding of Tp dissemination remains elusive.

At the beginning of Tp crossing the MEB, spirochetes must initially navigate through the extracellular matrix (ECM) to anchor themselves to the endothelial cell surface. ECM is a complex network of proteins and polysaccharides, including fibronectin (FN), collagens, laminin, and hyaluronic acid, structurally and functionally supporting the local environment surrounding cells. Together with the dense microvascular endothelial cells, the ECM forms an MEB against pathogen dissemination. Recently, few studies have investigated the ECM disruption by Tp, such as the fact that Tp can secret hyaluronidase and promoted the release of matrix metalloproteinases [1012], while in vivo experiments that can confirm these findings are lacking. Cellular fibronectin (cFN) is an important glycoprotein in ECM typically secreted by cells (such as vascular endothelial cells and fibroblasts) that forms an insoluble polymer matrix within the MEB to maintain its stability and integrity [13], whereas the soluble plasma FN (pFN) is primarily secreted by the liver into the bloodstream, where it circulates throughout the body rather than forms a matrix [14]. There are distinct compositional differences between cFN and pFN; cFN includes additional domains (EDA and EDB) compared to pFN, which can self-assemble into fibrillar matrix together with other ECM proteins, forming insoluble FN and insoluble matrix. Upon matrix disaggregation, cFN can become soluble FN. In contrast, pFN circulating in the blood does not form matrix and remains soluble. These differences are crucial, as cFN provides a structural barrier that Tp must overcome, whereas pFN could interact with Tp in the bloodstream without forming such barriers. Notably, Tp exhibits the adhesion ability to various vital ECM components [1517], suggesting a specific interaction that facilitates its pathogenic process. It is well-documented that Tp binds to fibronectin, aiding its colonization and dissemination. Previous studies identified Tp0155 and Tp0483 as FN adhesins contributing to further invasion [18], and an antibody targeting the FN-binding protein Tp0751 has shown potential in reducing Tp dissemination in rabbits [19]. However, the detailed mechanisms by which Tp interacts with FN and how this interaction influences ECM disruption and MEB penetration are still not fully understood.

As a common cytoskeletal protein that belongs to the intermediate filament family, vimentin plays a fundamental role in maintaining cell integrity and pathogeneis [20,21]. For example, Escherichia coli K1 can induce the disassembly of vimentin polymers distributed in the cytoplasm into monomers that translocate to the cell membrane, where they interact with membrane-associated vimentin to mediate adhesion and invasive behaviors [22]. Specifically, viementin regulates the configuration of integrin α5β1 on the cellular membrane through the phosphorylation of its 39th residue of serine (Ser39), which in turn stabilizes the cFN matrix [23]. Because that phosphorylation at Ser39 has been implicated in altering vimentin function and its interaction with other extracellular proteins, we also focused on its potential upstream kinases. The serine/threonine kinase AKT (also known as protein kinase B subgrouped in the AGC kinase family) is a crucial regulator of various cellular processes, including metabolism, cell survival, angiogenesis, and response to various stimuli. AKT1 has been shown to phosphorylate vimentin at Ser39, thereby influencing the intergirn-FN dynamics [23,24].

Therefore, in this study, we proposed that vimentin may play an vital role in disrupting cFN-integrin binding after Tp infection, facilitating the dissemination of Tp across the MEB. Eventually, we confirmed that phosphorylated Ser39 of vimentin triggered fibronectin matrix disaggregation and the related mechanisms and domestrated that the stability of the FN matrix alleviated the dissemination of Tp across the MEB.

Methods and materials

Ethics statement

All procedures mentioned above were approved by the Medical Ethics Committee of Dermatology Hospital of Southern Medical University and the Animal Ethics Committee of South China Agricultural University (2021c036).

Cell culture

Wild-type and stable-transfected HMEC-1 (human dermal microvascular endothelial cell-1) were cultivated in completed endothelial cell medium (1001; ScienCell, USA) in a humidified atmosphere at 37°C and 5% CO2, while HEK-293T cells for lentivirus packaging in DMEM medium (C11995500BT; Gibco, USA) with 10% (v/v) fetal bovine serum (FBS) (F8318; Sigma-Aldrich, USA).

Lentivirus packaging

HEK-293T cells in the logarithmic growth phase were seeded in 10 cm culture dishes at a density of 70%. When the cell density approached 90%, cells were subjected to serum starvation by culturing for 2 hours in DMEM medium without FBS. Liposome mixtures were prepared according to the manufacturer’s instructions of Lipofectamine 3000 Transfection Kit (L3000015; Invitrogen, USA): Tube A contained 500.0 μL Opti-MEM medium (31985070; Gibco, USA) and 20.0 μL Lipo3000; and Tube B contained 500.0 μL Opti-MEM medium, 4.0 μg pLV3-CMV-vimentin (human)-3×flag-puro plasmid (OE-S39-Vim) or 4.0 μg pLV3-CMV-vimentin (human)-S39A-3×flag-puro plasmid (OE-S39A-Vim), 3.0 μg psPAX2 plasmid, 1.0 μg pDM2.G plasmid, and 16.0 μL P3000. Subsequently, cells were replaced with 6.0 mL of fresh DMEM medium with 10% (v/v) FBS, and the liposome mixture was added dropwise to the medium. After 6 hours, the entire culture medium was discarded and replaced with 8.0 mL of DMEM medium with 10% (v/v) FBS for cultivation.

After 48 hours post-transfection, the entire medium was collected and filtered through 0.45 μm syringe driven-filters (FPE404030; JET BIOFIL, China). The filtrate was mixed with 5× virus precipitation buffer (NaCl 8.766 g; PEG8000 50.0 g; ultrapure water 200.0 mL) at a ratio of 4:1 and incubated overnight at 4°C. Then, the mixture was centrifuged at 4,000 ×g for 20 minutes at 4°C. The supernatant was discarded, and the lentivirus precipitate was dissolved by 200.0 μL of pre-cooled PBS, which was divided into aliquots of 50.0 μL per tube and stored at -80°C for future use.

Establishment of stable-transfected HMEC-1 cell lines

HMEC-1 cells in the logarithmic growth phase were seeded in 6-well culture plates at a density of 50%. A 50.0 μL lentivirus suspension (OE-S39-Vim or OE-S39A-Vim) and 1.0 μL polybrene (40804ES76; Yeasen, China) were added into 2.0 mL culture medium per well, followed by the incubation for 24 hours. Subsequently, the transfected cells were cultured with the medium containing 1.0 μg/mL puromycin (60209ES10; Yeasen, China) for 5-day selection, while with the maintenance medium containing 0.25 μg/mL puromycin to ensure the overexpression efficiency of the stable-transfected HMEC-1 cell lines.

Preparation and enumeration of Tp Nichols strain

The Tp Nichols strain was provided by Prof. Tiebing Zeng from University of South China. This strain was propagated with the rabbit infectivity test and resuspended to obtain live Tp suspension referred to the previous studies [25,26]. To obtain an inactivated Tp suspension, 1% (v/v) penicillin-streptomycin was added for a 30-minute incubation. The number of Tp organisms was determined using the dark field microscopy (DFM) enumeration method [25,27]:

A ten-microliter (10.0 μL) of Tp suspension was placed on a slide and covered with a 22.0 × 22.0 mm coverslip, providing an area of 4.84 cm2 (22.0 mm × 22.0 mm = 484 mm2 = 4.84 cm2) and a thickness of 0.0207 mm (10.0 μL = 0.01 cm3, 0.01 cm3/4.84 cm2 = 0.00207 cm = 0.0207 mm).

Spiral-shaped Tp organisms were counted in twenty to fifty of microscopic fields (40×) when each field contained more than 10 organisms; otherwise, at least one hundred fields were counted (recorded as X1, X2, …, Xn, where n represented the number of fields).

In each field, the radius (r) of the DFM (Olympus, JAPAN; BX43) under the 40× microscope is 0.205 mm, resulting in a field area of 0.134 mm2 (πr2), and a volume of 2.73 × 10−6 cm3 (0.134 mm2 × 0.0207 mm = 2.73 × 10−3 mm3 = 2.73 × 10−6 cm3).

Therefore, the concentration (organisms/mL) was calculated using the formula: (X1 + X2 + … + Xn)/(2.73 × 10−6 × n).

Detection of viability and motility of Tp

HMEC-1 cells (1 × 106/mL, 200.0 μL per well) were added to a 24-well plate (containing a cell slide in each well) and incubated for 24 hours. Following this, live Tp was co-cultured with the cells for 6 and 8 hours. After the established time, the cell slides were removed and examined under the DFM to observe the viability and motility of Tp. Videos and photographs were recorded to document the observations.

In vitro infection with Tp

HMEC-1 cells were seeded in 6-well plates (1 × 106 cells per well/per coverslip) overnight and treated with TpCM-2 [28] (the control group), live Tp suspension (the Ltp group), or inactivated Tp suspension (the Dtp group), as well as pretreated with Capivasertib (1.0 μM for 1 hour) (pAKT1 inhibitor; HY-15431; MedChem Express, USA), cFN protein (2.5 μg for 1 hour) (F0556; Sigma-Aldrich, USA), pFN (2.5 μg for 1 hour) (F2006; Sigma-Aldrich, USA), or laminin (2.5 μg for 1 hour) (F4544; Sigma-Aldrich, USA).

Detection of adhesion ability of Tp to ECM proteins

cFN, pFN, and laminin (1.25 μg of each protein per 100.0 μL PBS per well) were added to a 96-well plate and incubated at 37°C for 2 hours. After incubation, the supernatant was discarded, and the plate was air-dried in a safety cabinet. Subsequently, 50.0 μL of live Tp suspension (containing 1 × 104 organisms) was added to each well and incubated at 37°C for 6 hours. The supernatant from each well was then collected, and the wells were washed five times with 100.0 μL PBS. All the PBS and supernatant from each well were combined and centrifuged and centrifuged at 16,000 ×g for 8 minutes. The precipitates containing nonadherent Tp were resuspended with PBS and enumerated using DFM.

Immunofluorescence assay (IF)

HMEC-1 cells (1 × 106/mL, 200.0 μL per well) plated on the Chamber Slides (177380; Thermo Fisher, USA) were fixed with 4% paraformaldehyde (P0099; Beyotime, China) for 15 minutes at room temperature (RT), permeabilized with 0.5% (v/v) Triton X-100 (ST1722; Beyotime, China) for 15 minutes at RT, and blocked in 2% (w/v) bovine serum albumin (BSA; 36101ES76l; Yeasen, China) for 1 hour. Then, cells were incubated with primary antibodies overnight at 4°C and subsequently with fluorescence-conjugated secondary antibodies for 1 hour at RT. The nuclei were counterstained with 300.0 nM DAPI (C1002; Beyotime, China) for 2 minutes. Fluorescent-stained images were taken using a confocal microscope (Nikon, Japan).

Primary antibodies included: Anti-Fibronectin antibody (1:50; ab281574; Abcam, USA); Anti-Treponema pallidum antibody (1:3000; ab20923; Abcam, USA); Anti-Vimentin antibody (1:100; ab92547; Abcam, USA); Anti-F-actin antibody (1:200; ab130935; Abcam, USA). Secondary antibodies included: Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) (1:500; ab150077; Abcam, USA); Goat Anti-Rabbit IgG H&L (Alexa Fluor 594) (1:500; ab150080; Abcam, USA); Goat Anti-Mouse IgG H&L (Alexa Fluor 488) (1:500; ab150113; Abcam, USA); Goat Anti-Mouse IgG H&L (Alexa Fluor 594) (1:500; ab150116; Abcam, USA).

Western Blotting (WB)

Total proteins extraction was performed referred to the previous study [29], and the concentration of total proteins was examined by the BCA Protein Assay Kit (P0011; Beyotime, China) according to the manufacturer’s instructions. And the extraction of insoluble and soluble FN/vimentin was performed by the DOC solubility assay [30,31]: Cells were lysed in the DOC lysis buffer (2% DOC [S579505; Aladdin, China]; 20.0 mM Tris-HCl, pH 8.8; 2.0 mM N-ethylmaleimide; 2.0 mM iodoacetic acid; 2.0 mM EDTA; and 2.0 mM phenylmethylsulfonyl fluoride [PMSF]), passed through a 26-gauge needle, and centrifuged at 18,400 ×g for 20 minutes at 4°C. The DOC-soluble fraction (supernatant) was retained and determined for protein concentrations by the BCA Protein Assay Kit, while the DOC-insoluble pellet was dissolved in SDS-solubilization buffer (1% [w/v] SDS; 20.0 mM Tris-Cl, pH 8.8; 2.0 mM EDTA; 2.0 mM iodoacetic acid; 2.0 mM N-ethylmaleimide; and 2.0 mM PMSF).

One hundred (100.0) μg protein per lane was loaded on 6% (w/v) or 10% SDS-PAGE gels and transferred to 0.45 μm PVDF membranes. Membranes were blocked with 5% (w/v) BSA for 1 hour, incubated overnight at 4°C with primary antibodies, subsequently incubated with HRP-conjugated secondary antibodies for 1 hour at RT, and visualized using chemiluminescence (Bio-Rad, USA). The signal intensities were quantified using the Image J software [32].

Primary antibodies included: Anti-Integrin alpha5 antibody (1:5000; ab150361; Abcam, USA); Anti-Integrin beta1 antibody (1:2000; ab30394; Abcam, USA); Anti-Fibronectin antibody (1:500–1:1000; ab281574; Abcam, USA); Anti-GAPDH antibody (1:5000; ab8245; Abcam, USA); Anti-Vimentin antibody (1:1000; ab8069; Abcam, USA); Phospho-Vimentin (Ser39) Antibody (1:1000; 13614; Cell Signaling Technology, USA); Anti-Vimentin (phospho S56) antibody (1:1000; ab217673; Abcam, USA); Anti-Vimentin (phospho S72) antibody (1:5000–1:10000; ab52944; Abcam, USA); Phospho-Vimentin (Ser83) Antibody (1:1000; 12569; Cell Signaling Technology, USA); Anti-α-tubulin antibody (1:10000; ab7291; Abcam, USA); AKT1 (C73H10) Rabbit mAb (1:1000; 2938; CST, USA); Anti-AKT1 (phospho S473) antibody (1:5000–1:10000; ab81283; Abcam, USA). Secondary antibodies included: Goat Anti-Rabbit IgG H&L (HRP) (1:5000; ab6721; Abcam, USA); Goat Anti-Mouse IgG H&L (HRP) (1:5000; ab205719; Abcam, USA).

Co-immunoprecipitation experiment (co-IP)

Cell lysates were divided into two parts: 10% of the total lysate was reserved as the input control to collect total proteins and measure the concentration, while the remaining lysate was used for immunoprecipitation (IP), which was incubated overnight at 4°C with either an anti-Vimentin antibody (1:200; ab137321; Abcam, USA), an anti-AKT1 antibody (1:200; ab235958; Abcam, USA), or control IgG. The next day, the IP lysates were enriched with magnetic Protein A/G beads (P2179; Beyotime, China) following the manufacturer’s instructions. Finally, the input and IP collections were subjected to western blotting analysis.

Endothelial barrier traversal experiment

HMEC-1 cells (1 × 106/mL, 200.0 μL per well) were added to the upper chamber of a 24-well Transwell plate (3422; Corning, USA) with a pore diameter of 8 μm to form a dense monolayer overnight, followed by cFN/pFN/laminin pretreatment (2.5 μg for 1 hour, respectively) and live Tp infection. After 24 hours, the culture medium in the lower chamber was collected for DNA quantitative analysis.

In vivo Tp-challenged experiment

Three adult male New Zealand white rabbits (2.5–3.5 kg) per group were housed individually at 18–20°C and given antibiotic-free food and water. Rabbits were inoculated intradermally at eight sites on their clipped backs with 100.0 μL of suspension containing 2.5 μg of cFN, pFN, laminin, or PBS per site, immediately followed by in situ inoculation with 100.0 μL of live Tp (1 × 106 /mL). Skin biopsy and blood collection were performed every 3 days in the first week after Tp inoculation; and subsequently, blood collection and lesion monitoring were performed every 4 days, followed by organ (cutaneous lesion/liver/spleen/lymph node) collection performed in the day when the cutaneous lesion in the PBS+live Tp group began to ulcerate or the TRUST titer in this group turned positive.

DNA extraction from cell culture medium and rabbit tissue

DNA was extracted from cell culture medium and rabbit tissue using the DNeasy Blood & Tissue Kit (69504; Qiagen, Germany), following the manufacturers’ instructions. For DNA extraction from cell culture medium, samples were added 200.0 μL AL buffer and 20.0 μL Proteinase K, followed by vortexing thoroughly and incubation at 56°C for 30 minutes. And for DNA extraction from Tp-challenged rabbits, samples of skin (20.0 mg per biopsy, 2 biopsies per rabbit), liver (20.0 mg per biopsy, 2 biopsies per rabbit), spleen (10.0 mg per biopsy, 2 biopsies per rabbit), and lymph node (an entire one from the popliteal fossa per rabbit) were transferred into 15 mL tube containing cool PBS and then digested with 200.0 μL AL buffer and 20.0 μL Proteinase K, followed by vortexing thoroughly and incubation at 56°C for 16 hours. DNA precipitation was washed in accordance with the manufacturer’s protocol, and DNA elution was performed twice with one aliquot of 120.0 μL elution buffer.

Quantitative analysis by real-time PCR (qPCR) for Tp burden

Real-time PCR was performed to detect the absolute quantitative copies of Tp polA and rabbit β-actin [26,33], for which the Tp polA qPCR standard and rabbit β-actin qPCR standard with ten-fold serial dilutions were also prepared as described. The sequences of primers and probes were as follows: Tp polA F’ primer (5’→3’) CAGGATCCGGCATATGTCC; Tp polA R’ primer (5’→3’) AAGTGTGAGCGTCTCATCATTCC; Tp polA probe (5’→3’) 6FAM-CTGTCATGCACCAGCTTCGACGTCTT-BHQ1; Rabbit β-actin F’ primer (5’→3’) TGGCTCTAACAGTCCGCCTAG; Rabbit β-actin R’ primer (5’→3’) AGTGCGACGTGGACATCCG; Rabbit β-actin probe (5’→3’) 6FAM-CGAGTCGGGCCCCTCCATCGTGCACCGCAA-BHQ1. And the total 25.0 μL of PCR reaction volume was prepared as follows, avoiding light exposure: 12.5 μL TaqMan Gene Expression Master Mix (4369016; Thermo Fisher, USA), 1.0 μL MgCl2 (50 mM) (AM9530G; Thermo Fisher, USA), 2.5 μL 10× Primer Mix (2.5 μM), 2.5 μL 10× probe (2.0 M), 1.5 μL DNase/RNase-free Distilled water (10977015; Thermo Fisher, USA), and 5.0 μL DNA template. Thermocycling was performed in a Bio-Rad CFX384 system as follows: 1 cycle of 95°C for 10 minutes, followed by 50 cycles of 95°C for 15 seconds and 60°C for 1 minute. The standard curves were generated automatically by the Bio-Rad system, based on which the gene copies of each sample could be calculated. And the Tp polA copies should be normalized by rabbit β-actin (for rabbit tissues) or by the volume of culture medium (for the endothelial barrier traversal experiment).

Serological tests

Serum samples were separated from 5.0 mL peripheral blood of each rabbit, followed by centrifugation of 3,000 rpm for 10 minutes. And the sera were monitored with Treponema pallidum particle agglutination (TPPA) test (SERODIA-TP•PA Kit; 1633; Fujirebio Inc., Japan) and the toluidine red unheated serum (TRUST) test (TRUST Kit; S10940058; Rongsheng Bio., China), following the manufacturers’ instructions.

Statistical analysis

Values were the means ± SDs of triplicate samples and representative of three independent experiments. One-way ANOVA and student’s t test were used to compare values among multiple groups and two groups, respectively. p-value < 0.05 represents statistical difference.

Results

Live Tp disaggregated FN matrix around microvascular endothelial cells

Localized colonization and subsequent rapid dissemination of Tp in the skin are intricately connected with the microvasculature. Notably, when observed by fluorescent microscopy, the clustered FN matrix around HMEC-1 cells diminished after 6 hours of live Tp (Ltp group) stimulation compared with that in the control group (Ctrl group); however, no such alteration was observed with an equivalent amount of inactivated dead Tp (Dtp group)stimulation (Fig 1A). Subsequently, the motility and viability of Tp after 6-hour and even 8-hour stimulation to HMEC-1 was detected using DFM and Tp-infected rabbit model (S1 Fig and S1 and S2 Movies). The findings revealed the benign motility of Tp in the Ltp group during the stimulation period and the retained pathogenicity of nonadherent Tp in this group to develop primary syphilitic lesions after intradermal injection in rabbits, suggesting that within the short co-culture period, Tp retained its capacity to interact with endothelial cells in a manner likely consistent with early stages of infection.

thumbnail
Fig 1. Live Tp disaggregated FN matrix around microvascular endothelial cells.

(A) FN matrix around HMEC-1 after 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2); as observed by fluorescence microscopy; blue for the nucleus, green for the FN matrix, and red for Tp, scale bar = 50 μm. (B) Protein expressions of integrin α5, integrin β1, and total FN in HMEC-1 after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (C, D) Protein expressions of integrin α5, integrin β1, and total FN in HMEC-1 (C) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2) and (D) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours). (E) Protein expressions of insoluble FN and soluble FN in HMEC-1 after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (F, G) Protein expressions of insoluble FN and soluble FN in HMEC-1 (F) after 6 hours of stimulation with live Tp at various MOIs and (G) after stimulation with live Tp for different durations. Ctrl: negative control; Ltp: live Tp; Dtp: dead Tp; FN: fibronectin; n.s.: no significance; *: p value < 0.05; **: p value < 0.01.

https://doi.org/10.1371/journal.ppat.1012483.g001

Given the proposed pathway for ECM stabilization involving cFN dimer, transmembrane integrin, and intracellular vimentin, we hypothesized that the disappearance of the FN matrix could be associated with a decrease in the levels of FN protein and integrin α5β1 protein on HMEC-1 cells. Therefore, upon comparing the protein levels in the three groups at 0 and 6 hours, no difference was determined in the total FN and integrin α5β1 protein content (Fig 1B). Results obtained from co-culturing HMEC-1 cells with viable Tp at different multiplicities of infection (MOI) (Fig 1C) and cultivating for varied durations (Fig 1D) revealed that the levels of total FN and integrin α5β1 remained stable. Previous studies have indicated that the formation of FN matrix results from the aggregation of insoluble FN assembled by soluble individual FN molecules [30,34]. This suggests that the decrease in the FN matrix could potentially be associated with its polymerization. In the Ltp group, the levels of soluble FN were significantly higher than those in the other two groups, as determined by extracting soluble and insoluble FN separately, whereas the levels of insoluble FN were markedly lower (Fig 1E). Furthermore, soluble FN increased with increasing live Tp MOIs or prolonged stimulation time, whereas insoluble cFN decreased (Fig 1F–1G). This demonstrated that live Tp directly induced FN matrix disaggregation around microvascular endothelial cells, mediating by altering the polymerization state of FN rather than in a degradative manner.

Tp-induced vimentin phosphorylation and rearrangement promoted disaggregation of the FN matrix

According to well-established evidence, the phosphorylation of serine residues in intracellular vimentin enhances vimentin’s solubility, thereby hindering the translocation of vimentin from the perinucleus to the inner cell membrane [23]. HMEC-1 cells was co-cultured with live Tp (Ltp group) at the indicated MOIs for 6 hours; no significant difference in the protein levels of total vimentin was observed in Western blotting analysis; however, the soluble vimentin level increased as the MOIs elevated; insoluble vimentin decreased, notably at MOI ≥ 1 (Fig 2A). Similarly, the Ltp group exhibited a time-dependent trend, with significant changes occurring after ≥ 1 hour (Fig 2B). Evidently, only live Tp stimulation induced the above-mentioned alteration (Fig 2C). The results of immunofluorescence revealed that live Tp confined vimentin distribution around the nucleus, in contrast to the Ctrl and Dtp groups, in which vimentin was uniformly distributed throughout the cells (Fig 2D).

thumbnail
Fig 2. Tp induced the conversion of insoluble and soluble vimentin protein, leading to its rearrangement and Ser39 residue phosphorylation.

(A, B) Protein expressions of insoluble vimentin, soluble vimentin, and total vimentin in HMEC-1 (A) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2) and (B) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours). (C) Protein expression of insoluble vimentin, soluble vimentin, and total vimentin in HMEC-1 after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (D) The vimentin arrangement in HMEC-1 after 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2), as observed by fluorescence microscopy; blue for the nucleus, green for vimentin, red for F-actin, scale bar = 10 μm. (E, F) Protein expressions of pSer39-vimentin and total vimentin in HMEC-1 (E) after 6 hours of stimulation with live Tp at various MOIs and (F) after stimulation with live Tp (MOI 2) for different durations. (G) Protein expressions of pSer39-vimentin and total vimentin in HMEC-1 after 0 and 6 hours of stimulation with Ctrl, live Tp, and dead Tp. Ctrl: negative control; Ltp: live Tp; Dtp: dead Tp; Vim: vimentin; n.s.: no significance; *: p value < 0.05; **: p value < 0.01.

https://doi.org/10.1371/journal.ppat.1012483.g002

Subsequently, an analysis of phosphorylation changes occurring at four serine residues (Ser39, Ser56, Ser72, and Ser83) on vimentin revealed that only the phosphorylated Ser39-vimentin (pSer39-vimentin) markedly augmented with ascending MOI or co-culture duration (Fig 2E–2F). This distinct change was exclusively observed in the Ltp group (Fig 2G), as no differences were detected at the remaining residues (S2 Fig). Additionally, a vimentin overexpression vector (OE-S39-Vim) and a mutated vector (Serine to alanine; OE-S39A-Vim) were constructed (Fig 3A) and stably transfected into HMEC-1 cells, respectively. Co-culturing with live Tp uncovered that HMEC-1OE-S39A-Vim boosted insoluble FN and considerably reduced soluble FN in comparison to HMEC-1WT and HMEC-1OE-S39-Vim (Fig 3B). The results of immunofluorescence manifested that HMEC-1OE-S39A-Vim did not exhibit FN matrix disaggregation (Fig 3C). Moreover, the endothelial barrier traversal experiment indicated that the Tp burden in the lower chamber of the OE-S39A-Vim group was significantly lower compared to the other two groups (Fig 3D–3E). These results confirmed that Tp induced pSer39-vimentin and its intracellular rearrangement in HMEC-1 cells, thereby mediating the disaggregation of the FN matrix.

thumbnail
Fig 3. Tp mediated the disaggregation of the FN matrix by promoting Ser39 residue phosphorylation of vimentin.

(A) Construction of overexpressed S39-Vimentin (OE-S39-Vim) and S39A-Vimentin (OE-S39A-Vim) lentiviral vectors. (B) Protein expressions of insoluble FN and soluble FN in HMEC-1WT, HMEC-1OE-S39-Vim, and HMEC-1OE-S39A-Vim after 6 hours of stimulation with live Tp (MOI 2). (C) FN after co-culturing Tp (MOI 2) and HMEC-1 for 6 hours, as observed by fluorescence microscopy; blue for the nucleus, green for the FN matrix, and red for Tp, scale bar = 50 μm. (D) Schematic diagram of the endothelial barrier traversal experiment; after the formation of HMEC-1 monolayer, live Tp (MOI 2) added for stimulation. (E) Penetrated spirochete burden (copies of Tp polA) of all culture medium (200.0 μL) in the lower chamber; detected by qPCR. WT: wild type; Ctrl: negative control; Ltp: live Tp; Dtp: dead Tp; Vim: vimentin; FN: fibronectin; n.s.: no significance; *: p value < 0.05; **: p value < 0.01.

https://doi.org/10.1371/journal.ppat.1012483.g003

Tp facilitated the phosphorylation of Ser39-vimentin via the pAKT1 pathway

Obviously, follow-up explorations into how Tp activates vimentin phosphorylation would contribute to a comprehensive understanding of the molecular mechanisms underlying Tp dissemination. Furthermore, the Group-based Prediction System 6.0 (https://gps.biocuckoo.cn/) was utilized to identify potential serine/threonine phosphorylation sites on vimentin and their associated protein kinases [35]. The results revealed that the Ser39 residue was most likely phosphorylated by AGC kinases (Fig 4A and S1 Table). This finding aligned with a previous investigation suggesting that pSer39-vimentin can be mediated by AKT1 [24]. To validate this statement, the level of phosphorylated AKT1 (pAKT1) in HMEC-1 cells was examined, which unveiled an increased pAKT1 level with higher MOIs or longer durations (Fig 4B–4C). Compared to the other groups, the pAKT1 level in the Ltp group was significantly higher (Fig 4D), while total AKT1 expression remained unchanged in all these experiments. Subsequently, the physical interaction between vimentin and AKT1 was demonstrated using co-immunoprecipitation (co-IP) experiments (S3 Fig). Moreover, the upregulation of pAKT1 in HMEC-1 cells induced by live Tp stimulation was effectively reversed by pre-treatment with the AKT1 inhibitor Capivasertib for 1 hour (Fig 4E), which also profoundly increased the level of insoluble FN and the inhibition of soluble FN (Fig 4F). The Ltp+Capivasertib group did not exhibit distinct extracellular FN matrix disaggregation, as opposed to the Ltp group (Fig 4G). These results suggested that attenuated AKT1 kinase activity effectively prevented Tp-induced pSer39-vimentin and restrained the subsequent disaggregation of the FN matrix.

thumbnail
Fig 4. Tp infection resulted in Ser39 residue phosphorylation of vimentin via the pAKT1 pathway.

(A) Screening the potential candidates of the protein kinase AGC group for Ser39 phosphorylation of vimentin; as predicted by high score and cutoff value. (B, C) Protein expressions of phosphorylated AKT1 (pAKT1) and total AKT1 in HMEC-1 (B) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2) and (C) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours). (D) Protein expressions of pAKT1 and total AKT1 in HMEC-1 after 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (E-G)Addition of the AKT1 phosphorylation inhibitor capivasertib (1.0 μM) 1 hour prior to live Tp (MOI 2) stimulation in HMEC-1, followed by protein expression examination of (E) Ser39-phosphorylated vimentin (pSer39-Vim) and total vimentin, (F) insoluble and soluble FN, and (G) immunofluorescence observation of FN matrix with blue for the nucleus, green for the FN matrix, and red for Tp, scale bar = 50 μm. Ctrl: negative control; Ltp: live Tp; Dtp: dead Tp; Vim: vimentin; FN: fibronectin; n.s.: no significance; *: p value < 0.05; **: p value < 0.01.

https://doi.org/10.1371/journal.ppat.1012483.g004

Dense FN matrix attenuated Tp penetration through the trans-endothelial barrier in vitro

In the endothelial barrier traversal experiment, different types of ECM proteins (including cFN, pFN, and laminin) that had been previously reported to adhere to Tp [15] were utilized to investigate their impact on Tp penetration (Fig 5A). One hour before live Tp stimulation (MOI 2), ECM proteins were added to the HMEC-1 monolayer. The penetrating Tp burden in the lower chamber was the lowest in the cFN+Ltp group, whereas the pFN+Ltp and Laminin+Ltp groups showed burdens similar to the Ltp group (Fig 5B). The same grouping and procedure were performed on chamber slides without permeabilizing the samples, as displayed in Fig 5C. This ensured that immunofluorescence corresponded entirely to the extracellular states of FN and Tp (mostly punctate or short rod-shaped in red color) around the cell surface. In contrast to the FN pattern observed in the Ctrl group, the Ltp group exhibited noticeable gaps in the cFN matrix, with cord-like cFN aggregates mainly disappearing. Meanwhile, the cFN+Ltp group demonstrated a more tightly packed reticular FN structure with the emergence of numerous small filamentous aggregates. The Laminin+Ltp group displayed a minor difference compared with the Ctrl group, with only a slight decrease in the fluorescence intensity of FN. A similar trend was observed in the pFN+Ltp group, but the matrix structure became sparse. In particular, among the four groups with live Tp stimulation, the cFN+Ltp group had the largest quantity of Tp around the cell surface, whereas the remaining groups showed comparable amounts. On the other hand, the ahesion capability of Tp to cFN, pFN, and laminin was determined, which was utilized the medium after after Tp’s adhesion to these proteins for 6 hours to collect and enumerate the nonadherent Tp (S4 Fig). Surprisingly, our results demonstrated that Tp exhibits maximal adherence to laminin instead of cFN. These existing data suggested that the structural integrity of the FN matrix plays a critical role in preventing Tp invasion, potentially independent of direct Tp-ECM adhesion interactions.

thumbnail
Fig 5. cFN attenuated Tp penetration across the MEB.

(A) Schematic diagram of the endothelial barrier traversal experiment with additional ECM proteins; after the formation of HMEC-1 monolayer, 2.5 μg of each ECM protein added for 1 hour, and subsequent live Tp (MOI 2) added for stimulation. (B) Penetrated spirochete burden (copies of Tp polA) of all culture medium (200.0 μL) in the lower chamber; detected by qPCR. (C) Fibronectin matrix of HMEC-1 after as the same procedure to (A) in chamber slides; as observed by fluorescence microscopy; blue for the nucleus, green for the FN matrix, and red for Tp, scale bar = 50 μm. cFN: cellular fibronectin; pFN: plasma fibronectin; Ltp: live Tp; FN: fibronectin; n.s.: no significance; *: p value < 0.05; **: p value < 0.01.

https://doi.org/10.1371/journal.ppat.1012483.g005

Cellular FN inhibited the cutaneous in situ dissemination of Tp and its organic infection in vivo

Our in vitro experiments highlighted the importance of maintaining FN matrix integrity to impede the Tp dissemination. As a fairly high homology between human and rabbit FN proteins was predicted (S1 File), the function of additional cFN was then determined using the Tp-challenged rabbit model, as presented in Fig 6A. Initially, changes in Tp burden at the injection site were identified prior to the appearance of lesions since the inflammatory response would not disturb this phase. The results indicated that the cFN+Ltp group exhibited the highest in situ burden on Day 1 and Day 4 post-challenge, with a significant increase on Day 7 (Fig 6B), suggesting the possibility of a synergistic effect within the long-term interception and proliferation of Tp. Independently, there was no discernible impact of a single dose of each protein (cFN, pFN, or laminin, respectively) on the skin appearance of rabbits (S5A Fig), revealing no specific immune response of rabbit to heterologous proteins. However, the rabbits in each group began to develop rashes on Day 15 post-challenge (S5B Fig). The average area of cutaneous lesions in the cFN+Ltp group was constantly at the highest level (Fig 6C). Furthermore, when serological positivity for treponemal antibodies prevailed among the other groups (Day 11), the serum of the cFN+Ltp group remained antibody-negative, lagging in progress (Table 1). In contrast, the trend of non-treponemal antibodies in the cFN+Ltp group was more likely to turn positive and develop high titers (Table 2). Moreover, despite the darker coloration, increased fluctuation in sensation, and pronounced ulceration trend of skin lesions in the cFN+Ltp group on Day 26, there was no statistically significant difference in the in cutaneous Tp burden compared with the other groups (Fig 6D). Notably, pretreatment with pFN or laminin did not significantly affect Tp infection in the lymph node, liver, and spleen. However, cFN pre-treatment appeared to decrease organic infection, particularly in the lymph node (p value < 0.05) (Fig 6E–6F). When extrapolating the Tp burden from each biopsy to the entire organ by weight, the overall Tp load of liver or spleen and it would be much higher, highlighting a decreasing trend in the cFN+Ltp group compared to the others. In conclusion, cFN stability can effectively limit the cutaneous in situ dissemination and organic infection of Tp to some extent.

thumbnail
Fig 6. cFN inhibited the cutaneous in situ dissemination of Tp and its organic infection in vivo.

(A) Timeline of the in vivo Tp-challenged experiment. (B) Spirochete burden (copies of Tp polA normalized to rabbit β-actin) of in situ Tp-infected skin (20 mg per sample) in the early period. (C) Average lesion area (mm2) post Tp-challenge. (D-G) Spirochete burdens (copies of Tp polA normalized to rabbit β-actin) of (D) cutaneous lesions (20 mg per sample, 2 biopsies per rabbit), (E) inguinal lymph nodes (one entire lymph node per rabbit, 25.0 mg per node), (F) livers (20 mg per sample, 2 biopsies per rabbit), and (G) spleens (10 mg per sample, 2 biopsies per rabbit) at the time of sacrifice (Day 26). cFN: cellular fibronectin; pFN: plasma fibronectin; n.s.: no significance; *: p value < 0.05; ***: p value < 0.001.

https://doi.org/10.1371/journal.ppat.1012483.g006

thumbnail
Table 1. TPPA titer monitoring of treponemal antibodies in Tp-challenged rabbits.

https://doi.org/10.1371/journal.ppat.1012483.t001

thumbnail
Table 2. TRUST titer monitoring of treponemal antibodies in Tp-challenged rabbits.

https://doi.org/10.1371/journal.ppat.1012483.t002

Discussion

FN has been recognized as a critical facilitator of pathogenic microorganism invasion. However, the specific mechanisms underlying Tp infection progression via FN attachment remain largely unexplored. Studies on the interactions between FN and other pathogenic microorganisms have indicated that ECM adhesion primarily triggers downstream colonization- and internalization-related mechanisms [36,37]. For instance, colonization followed by FN and laminin adhesion aided Streptococcus uberis in biofilm formation that developed antibiotic resistance [38]. Staphylococcus aureus was capable of activating an internalization response mediated by the interaction of its FN-binding adhesins with the integrin of the host cell. This mechanism assisted the pathogen in entering non-professional phagocytes to evade host immune clearance and hijack nutrients [39].

On the other hand, when infected with an equal dose of Staphylococcus aureus, osteoblasts with higher expression levels of FN and integrin exhibited reduced bacterial uptake than epithelial cells, while phagocytosis was promoted by FN knockdown [40]. This phenomenon did not contradict the above-mentioned enhanced bacterial internalization, which was explained by the inhibition of internalization by the matrix of FN fibrils surrounding osteoblasts. A similar scenario emerged in our study, in which Tp disrupted the ambient FN matrix by stimulating pSer39-vimentin within vascular endothelial cells. In both the in vitro endothelial barrier traversal experiment and in vivo dissemination experiment, the outcomes of the cFN+Ltp group (compared with those of the pFN+Ltp group or the Laminin+Ltp group) revealed a rescue of the FN matrix disaggregation due to cFN pretreatment, indicating that the dense FN matrix significantly hindered Tp from crossing the endothelial barrier and disseminating (Figs 5 and 6). In contrast, the addition of laminin or pFN failed to change the supramolecular structure of cFN, even though previous studies [1517] have documented Tp’s adhesive effects on cFN, pFN, and laminin; however, our findings demonstrate that Tp exhibits maximal adherence to laminin instead of cFN (S4 Fig). Therefore, we established that while Tp can adhere to both laminin and FN, there exists a notable disparity in its ability to traverse the endothelial barrier. Simultaneously, cFN retained more Tp at the inoculated niches in vivo, exacerbating the severity of localized skin lesions and delaying the progression of systemic infection. These findings highlight the multifaceted role of FN matrix during the initial and deteriorated stages of infection and emphasize the complex interplay between pathogen invasion and host defense, at least for Staphylococcus aureus and Tp.

Thus, it’s essential to distinguish the Tp dissemination mediated by FN matrix disaggregation and by FN adhesion. We acknowledge that Tp may utilize its surface proteins to bind FN and other ECM proteins, thereby promoting vascular interactions [41,42]. Due to the challenges associated with gene-editing for Tp, these investigations typically employ heterologous expression of Tp surface proteins in Borrelia burgdorferi to explore the functions of Tp proteins. However, this kind of intervention may not fully reflect the natural infection dynamics of Tp in our experiments: i) Whether these proteins exhibit the same adhesion properties under conditions of heterologous expression and natural infection remains a topic for further discussion, and no recent studies have demonstrated that overexpression or inhibition of Tp proteins can induce structural alterations in the FN matrix surrounding host cells. ii) The adhesion of Tp to specific ECM proteins results from the collective action of numerous surface proteins. We believe that FN matrix disaggregation-mediated and FN adhesion-mediated Tp dissemination are actually two independent pathways in accelerating the infection process.

When we keep focusing on FN matrix disaggregation, we recognized the involvement and significance of pAKT1/pSer39-vimentin pathway activated in Tp infection (Fig 7). It should be noted that the FN matrix disaggregation refers to changes in the matrix structure from dense to sparse without altering the total FN content of monomers or dimers assembled into the matrix (such as Fig 1A–1D), while the lack of FN would lead to the almost disappearance of the matrix (S6 Fig). Our findings indicate that Tp activates this pathway by regulating post-translational modifications without affecting the overall protein levels of key molecules (total vimentin, total FN, and total AKT1 showed no significant changes after Tp stimulation), but inhibited expression of vimentin protein in HMEC-1 cells (HMEC-1siVim) slightly reduced the FN protein level (S7A Fig), indicating that vimentin knockdown is unlikely to affect FN synthesis. However, the total FN significantly decreased in HMEC-1siVim after Tp infection (S7B–S7C Fig), which was different from the results in Fig 1B–1D. We speculated that Tp did not induce FN protein degradation or synthesis when vimentin expression was sufficient. However, knocking down vimentin reduced the total levels of various forms of vimentin, including the vimentin reserve that binds to integrins on the cell membrane to stabilize extracellular FN, which may disrupt the FN matrix by enhancing the matrix transformation pathway, likely leading to increased FN degradation. Furthermore, we showed that total vimentin levels remained unchanged while pSer39-vimentin decreased during Tp infection (Fig 4E), indicating that AKT1 impacts vimentin phosphorylation but not its synthesis or degradation. Knocking down AKT1 in HMEC-1 cells reduced total FN levels even without Tp stimulation, but did not affect total vimentin levels (S8 Fig), suggesting that AKT1 influences the protein level of total FN independently of vimentin phosphorylation, consistent with previous studies [43,44]. This suggests that knockdown of AKT1 is not entirely appropriate for our study, as it would result in a significant reduction in the most direct subject of study, the FN matrix, whether or not it was stimulated by Tp, leading to more confounders.

The results of our study also prompts a sudden and catastrophic quantitative change during Tp infection that: constrained by the FN matrix outside the cutaneous MEB, most Tp are subject to the rapid response of immune clearance pressure. In contrast, a minimal amount of Tp (MOI 2) is adequate to initiate a noticeable imbalance in vimentin phosphorylation and matrix disruption within a short period (1–3 hours). Meanwhile, pronounced deconstruction of the cFN matrix ensues promptly (within 6 hours), offering significant convenience for the rapid MEB traversal.

Spirochetes breached the in situ MEB in Tp-challenged rabbits within 24 hours after subcutaneous injection; however, the cFN+Ltp group had a more elevated burden than the other groups. Moreover, the cFN+Ltp group exhibited a relatively larger area of localized lesions, and the appearance of treponemal antibodies in peripheral blood occurred four days later than in the other groups. Considering our published data and previous literature suggesting that the non-treponemal (TRUST) antibodies are mediated by damaged host cell-released cardiolipin [45,46], rabbits were euthanized when TRUST began to turn positive in the PBS+Ltp group (Day 26) to minimize the effect of host cells. It is noteworthy that the cFN+Ltp group showed the highest TRUST titer on Day 26, accompanied by the lowest organic Tp burden and the most severe lesion ulcers, which may be attributed to the retention of excessive Tp at the injection niches. Some rabbits in the Laminin+Ltp group showed elevated TRUST titers; however, the lesion area and organic Tp burden were more similar to those of the PBS+Ltp group, likely due to the laminin adhesion with a portion of spirochetes. These findings confirm the notion that short-term maintenance of the stability of the FN matrix can effectively halt syphilitic progression.

Due to the variety of Tp proteins that facilitate adhesion to ECM and the dualistic role of cFN, we are likely to preserve a diminished phosphorylation level of vimentin within vascular endothelial cells during Tp infection. This strategy not only benefits endothelial barrier stabilization but also amplifies the Tp concentration sequestered within the infected niches, thereby significantly assisting in the immune eradication of this fragile microorganism.

Supporting information

S1 Fig. The viability and mortality of Tp.

(A-B) Motile Tp after stimulating HMEC-1 cells for (A) 6 hours and (B) 8 hours; observed by DFM under a 400-fold magnification, scale bar = 100 μm. (C) Rabbit back skin, 4 weeks after intradermal injection of live Tp isolated from the 6-hour co-culture medium. (D) Rabbit back skin, 4 weeks after intradermal injection of dead Tp inactivated by the co-cultured medium containing 1% (v/v) penicillin-streptomycin.

https://doi.org/10.1371/journal.ppat.1012483.s001

(TIF)

S2 Fig. Impact of Tp on phosphorylation of serine residues at other sites of vimentin.

(A-C) Protein expressions of Ser56-phosphorylated (pSer56-) and total vimentin in HMEC-1 (A) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2), (B) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours), and (C) after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (D-F) Protein expressions of Ser72-phosphorylated (pSer72-) and total vimentin in HMEC-1 (D) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2), (E) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours), and (F) after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). (G-I) Protein expressions of Ser83-phosphorylated (pSer83-) and total vimentin in HMEC-1 (G) after 6 hours of stimulation with live Tp at various MOIs (0, 0.1, 0.5, 1, and 2), (H) after stimulation with live Tp (MOI 2) for different durations (0, 0.5, 1, 3, and 6 hours), and (I) after 0 and 6 hours of stimulation with Ctrl, live Tp (MOI 2), and dead Tp (MOI 2). Ctrl: negative control; Ltp: live Tp; Dtp: dead Tp; Vim: vimentin.

https://doi.org/10.1371/journal.ppat.1012483.s002

(TIF)

S3 Fig. Co-immunoprecipitation of vimentin and AKT1.

Cell lysates from negative control and live Tp-infected HMEC-1 cells after a 6-hour infection period were subjected to immunoprecipitation using an (A) anti-vimentin antibody or (B) an anti-AKT1 antibody, followed by Western blotting to detect the immunoprecipitated complexes of AKT1 and vimentin. The IgG antibody was used to demonstrate the absence of non-specific binding, and the input lysates (10% of the total lysate) were probed to confirm the presence of both proteins in the lysates. Ctrl: negative control; Ltp: live Tp; IP: immunoprecipitation; IB: immunoblotting; Vim: vimentin.

https://doi.org/10.1371/journal.ppat.1012483.s003

(TIF)

S4 Fig. The adhesion capability of Tp to different ECM proteins.

(A) Nonadherent Tp (red arrow) in the supernatant combined with those washed down by PBS, after Tp’s adhesion to cFN, pFN, or laminin for 6 hours; observed by DFM under a 400-fold magnification, scale bar = 100 μm. (B) Quantification of non-adherent Tp per field of view under a 400-fold magnification using DFM. cFN: cellular fibronectin; pFN: plasma fibronectin; n.s.: no significance; ***: p value < 0.001.

https://doi.org/10.1371/journal.ppat.1012483.s004

(TIF)

S5 Fig. Changes in cutaneous lesions in Tp-challenged rabbits.

(A) The appearance of rabbit’s skin after the single use of different ECM proteins or PBS, respectively. (B) Changes in Tp-challenged rabbit’s skin at various time points from no evident signs (Day 11) to obvious redness and ulcer (Day 15, 19, and 23) and to sacrifice (Day 26). cFN: cellular fibronectin; pFN: plasma fibronectin; Ltp: live Tp.

https://doi.org/10.1371/journal.ppat.1012483.s005

(TIF)

S6 Fig. Western blotting and immunofluorescence analysis of HMEC-1 cells with fibronectin knockdown by siRNA.

(A) Protein experssions of total fibronectin in HMEC-1 cells with fibronectin knockdown by siRNA (HMEC-1siFN) and cells with scramble siRNA interference as negative control (HMEC-1siNC), respectively. (B) Protein experssions of total fibronectin in HMEC-1 siFN and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively. (C) Fibronectin matrix of HMEC-1siFN and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively; observed by fluorescence microscopy, blue for the nucleus, green for the FN matrix, red for Tp, scale bar = 100 μm. NC: negative control; FN: fibronectin; Ltp: live Tp.

https://doi.org/10.1371/journal.ppat.1012483.s006

(TIF)

S7 Fig. Western blotting and immunofluorescence analysis of HMEC-1 cells with vimentin knockdown by siRNA.

(A) Protein experssions of pSer39-vimentin, total vimentin, and total fibronectin in HMEC-1 cells with vimentin knockdown by siRNA (HMEC-1siVim) and cells with scramble siRNA interference as negative control (HMEC-1siNC), respectively. (B) Protein experssions of pSer39-vimentin, total vimentin, and total fibronectin in HMEC-1siVim and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively. (C) Fibronectin matrix of HMEC-1siVim and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively; as observed by fluorescence microscopy; blue for the nucleus, green for the FN matrix, and red for Tp, scale bar = 100 μm. NC: negative control; Vim: vimentin; FN: fibronectin; Ltp: live Tp.

https://doi.org/10.1371/journal.ppat.1012483.s007

(TIF)

S8 Fig. Western blotting and immunofluorescence analysis of HMEC-1 cells with AKT1 knockdown by siRNA.

(A) Protein experssions of AKT1, vimentin, and fibronectin in HMEC-1 cells with AKT1 knockdown by siRNA (HMEC-1siAKT1) and cells with scramble siRNA interference as negative control (HMEC-1siNC), respectively. (B) Protein experssions of pSer39-vimentin, total vimentin, and fibronectin in HMEC-1 siAKT1 and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively. (C) Fibronectin matrix of HMEC-1 siAKT1 and HMEC-1siNC after stimulation with live Tp (MOI 2) for 6 hours, respectively; observed by fluorescence microscopy, blue for the nucleus, green for the FN matrix, red for Tp, scale bar = 100 μm. NC: negative control; Vim: vimentin; FN: fibronectin; Ltp: live Tp.

https://doi.org/10.1371/journal.ppat.1012483.s008

(TIF)

S1 Table. Screening the potential serine/threonine phosphorylation sites on vimentin and their associated protein kinases.

https://doi.org/10.1371/journal.ppat.1012483.s009

(DOCX)

S1 Movie. Video of Tp mobility after 6-hour co-culture with HMEC-1 cells, corresponding to S1A Fig.

https://doi.org/10.1371/journal.ppat.1012483.s010

(MP4)

S2 Movie. Video of Tp mobility after 8-hour co-culture with HMEC-1 cells, corresponding to S1B Fig.

https://doi.org/10.1371/journal.ppat.1012483.s011

(MP4)

S1 File. Alignment and 3D structure prediction of FN_human and FN_rabbit.

(A) Alignment by the whole sequences of FN_human and FN_rabbit. (B) Alignment by the individual domains of FN_human and FN_rabbit and the 3D structure prediction.

https://doi.org/10.1371/journal.ppat.1012483.s012

(PDF)

S2 File. Methods for gene knockdown and the sequences of small interfering RNAs (siRNAs).

https://doi.org/10.1371/journal.ppat.1012483.s013

(PDF)

S1 Data. Excel spreadsheet containing, in separate sheets, the underlying numerical data and statistical analysis for Figs 1B, 1C, 1D, 1E, 1F, 1G, 2A, 2B, 2C, 2E, 2F, 2G, 3B, 3E, 4B, 4C, 4D, 4E, 4F, 5B, 6B, 6C, 6D, 6E, 6F, 6G, and S4B.

https://doi.org/10.1371/journal.ppat.1012483.s014

(XLSX)

Acknowledgments

We thank Dr. Wentao Chen (Dermatology Hospital, Southern Medical University) for providing the Tp polA qPCR standard and Ms. Jialin Huang (Dermatology Hospital, Southern Medical University) for providing the Rabbit β-actin qPCR standard. And we appreciate Dr. Jun Liu (Dermatology Hospital, Southern Medical University) for manuscript grammar editing.

References

  1. 1. Peeling RW, Mabey D, Kamb ML, Chen XS, Radolf JD, Benzaken AS. Syphilis. Nature reviews Disease primers. 2017;3:17073. pmid:29022569.
  2. 2. Dutta Majumder P, Chen EJ, Shah J, Ching Wen Ho D, Biswas J, See Yin L, et al. Ocular Syphilis: An Update. Ocular immunology and inflammation. 2019;27(1):117–25. pmid:29020491.
  3. 3. Morphet J. Cardiovascular syphilis. The Canadian journal of cardiology. 2008;24(12):886–7. pmid:19068539.
  4. 4. Jorge LM, da Costa Nery JA, Bernardes Filho F. Tertiary syphilis: tubero-serpiginous and tubero-ulcerous syphilids. The Brazilian journal of infectious diseases: an official publication of the Brazilian Society of Infectious Diseases. 2016;20(3):308–9. pmid:27026572.
  5. 5. RAIZISS GW, SEVERAC M. RAPIDITY WITH WHICH SPIROCHAETA PALLIDA INVADES THE BLOOD STREAM. Archives of Dermatology and Syphilology. 1937;35(6):1101–9.
  6. 6. Lithgow KV, Tsao E, Schovanek E, Gomez A, Swayne LA, Cameron CE. Treponema pallidum Disrupts VE-Cadherin Intercellular Junctions and Traverses Endothelial Barriers Using a Cholesterol-Dependent Mechanism. Frontiers in microbiology. 2021;12:691731. pmid:34354688.
  7. 7. Surve MV, Apte S, Bhutda S, Kamath KG, Kim KS, Banerjee A. Streptococcus pneumoniae utilizes a novel dynamin independent pathway for entry and persistence in brain endothelium. Current research in microbial sciences. 2020;1:62–8. pmid:34841302.
  8. 8. Al-Obaidi MMJ, Desa MNM. Mechanisms of Blood Brain Barrier Disruption by Different Types of Bacteria, and Bacterial-Host Interactions Facilitate the Bacterial Pathogen Invading the Brain. Cellular and molecular neurobiology. 2018;38(7):1349–68. pmid:30117097.
  9. 9. Thomas DD, Fogelman AM, Miller JN, Lovett MA. Interactions of Treponema pallidum with endothelial cell monolayers. European journal of epidemiology. 1989;5(1):15–21. pmid:2651144.
  10. 10. Jiang C, Xu M, Kuang X, Xiao J, Tan M, Xie Y, et al. Treponema pallidum flagellins stimulate MMP-9 and MMP-13 expression via TLR5 and MAPK/NF-κB signaling pathways in human epidermal keratinocytes. Experimental cell research. 2017;361(1):46–55. pmid:28982539.
  11. 11. Gao ZX, Luo X, Liu LL, Lin LR, Tong ML, Yang TC. Recombinant Treponema pallidum protein Tp47 induces angiogenesis by modulating the matrix metalloproteinase/tissue inhibitor of metalloproteinase balance in endothelial cells. Journal of the European Academy of Dermatology and Venereology: JEADV. 2019;33(10):1958–70. pmid:31166625.
  12. 12. Fitzgerald TJ, Gannon EM. Further evidence for hyaluronidase activity of Treponema pallidum. Canadian journal of microbiology. 1983;29(11):1507–13. pmid:6423249.
  13. 13. Andrews RN, Caudell DL, Metheny-Barlow LJ, Peiffer AM, Tooze JA, Bourland JD, et al. Fibronectin Produced by Cerebral Endothelial and Vascular Smooth Muscle Cells Contributes to Perivascular Extracellular Matrix in Late-Delayed Radiation-Induced Brain Injury. Radiation research. 2018;190(4):361–73. pmid:30016219.
  14. 14. Grossman JE. Plasma fibronectin and fibronectin therapy in sepsis and critical illness. Reviews of infectious diseases. 1987;9 Suppl 4:S420–30. pmid:3326138.
  15. 15. Fitzgerald TJ, Repesh LA, Blanco DR, Miller JN. Attachment of Treponema pallidum to fibronectin, laminin, collagen IV, and collagen I, and blockage of attachment by immune rabbit IgG. The British journal of venereal diseases. 1984;60(6):357–63. pmid:6394096.
  16. 16. Fitzgerald TJ, Repesh LA. Interactions of fibronectin with Treponema pallidum. Genitourinary medicine. 1985;61(3):147–55. pmid:3891582.
  17. 17. Lee JH, Choi HJ, Jung J, Lee MG, Lee JB, Lee KH. Receptors for Treponema pallidum attachment to the surface and matrix proteins of cultured human dermal microvascular endothelial cells. Yonsei medical journal. 2003;44(3):371–8. pmid:12833573.
  18. 18. Cameron CE, Brown EL, Kuroiwa JM, Schnapp LM, Brouwer NL. Treponema pallidum fibronectin-binding proteins. Journal of bacteriology. 2004;186(20):7019–22. pmid:15466055.
  19. 19. Lithgow KV, Hof R, Wetherell C, Phillips D, Houston S, Cameron CE. A defined syphilis vaccine candidate inhibits dissemination of Treponema pallidum subspecies pallidum. Nature communications. 2017;8:14273. pmid:28145405.
  20. 20. Ridge KM, Eriksson JE, Pekny M, Goldman RD. Roles of vimentin in health and disease. Genes & development. 2022;36(7–8):391–407. pmid:35487686.
  21. 21. Ramos I, Stamatakis K, Oeste CL, Pérez-Sala D. Vimentin as a Multifaceted Player and Potential Therapeutic Target in Viral Infections. International journal of molecular sciences. 2020;21(13). pmid:32630064.
  22. 22. Chi F, Bo T, Wu CH, Jong A, Huang SH. Vimentin and PSF act in concert to regulate IbeA+ E. coli K1 induced activation and nuclear translocation of NF-κB in human brain endothelial cells. PLoS One. 2012;7(4):e35862. pmid:22536447.
  23. 23. Kim J, Jang J, Yang C, Kim EJ, Jung H, Kim C. Vimentin filament controls integrin α5β1-mediated cell adhesion by binding to integrin through its Ser38 residue. FEBS letters. 2016;590(20):3517–25. pmid:27658040.
  24. 24. Zhu QS, Rosenblatt K, Huang KL, Lahat G, Brobey R, Bolshakov S, et al. Vimentin is a novel AKT1 target mediating motility and invasion. Oncogene. 2011;30(4):457–70. pmid:20856200.
  25. 25. Lukehart SA, Marra CM. Isolation and laboratory maintenance of Treponema pallidum. Current protocols in microbiology. 2007;Chapter 12:Unit 12A.1. pmid:18770607.
  26. 26. Huang J, Jiang Y, Lin W, Chen R, Zhou J, Guo S, et al. Virulence and Adhesion of the Treponema pallidum Nichols Strain Simultaneously Decrease in a Continuous-Infection New Zealand White Rabbit Model. ACS infectious diseases. 2023;9(6):1221–31. pmid:37192527.
  27. 27. Chandler FW, Norins LC. Studies on the quantitation of intraocular Treponema pallidum. An in vitro model. The British journal of venereal diseases. 1969;45(2):117–20. pmid:4892121
  28. 28. Edmondson DG, Hu B, Norris SJ. Long-Term In Vitro Culture of the Syphilis Spirochete Treponema pallidum subsp. pallidum. mBio. 2018;9(3). pmid:29946052.
  29. 29. Li Z, Teng M, Jiang Y, Zhang L, Luo X, Liao Y, et al. YTHDF1 Negatively Regulates Treponema pallidum-Induced Inflammation in THP-1 Macrophages by Promoting SOCS3 Translation in an m6A-Dependent Manner. Frontiers in immunology. 2022;13:857727. pmid:35444649.
  30. 30. Wierzbicka-Patynowski I, Mao Y, Schwarzbauer JE. Analysis of fibronectin matrix assembly. Current protocols in cell biology. 2004;Chapter 10:Unit 10.2. pmid:18228438.
  31. 31. Crooke CE, Pozzi A, Carpenter GF. PLC-gamma1 regulates fibronectin assembly and cell aggregation. Experimental cell research. 2009;315(13):2207–14. pmid:19379731.
  32. 32. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nature methods. 2012;9(7):671–5. pmid:22930834.
  33. 33. Luthra A, Montezuma-Rusca JM, La Vake CJ, LeDoyt M, Delgado KN, Davenport TC, et al. Evidence that immunization with TP0751, a bipartite Treponema pallidum lipoprotein with an intrinsically disordered region and lipocalin fold, fails to protect in the rabbit model of experimental syphilis. PLoS pathogens. 2020;16(9):e1008871. pmid:32936831.
  34. 34. Singh P, Carraher C, Schwarzbauer JE. Assembly of fibronectin extracellular matrix. Annual review of cell and developmental biology. 2010;26:397–419. pmid:20690820.
  35. 35. Chen M, Zhang W, Gou Y, Xu D, Wei Y, Liu D, et al. GPS 6.0: an updated server for prediction of kinase-specific phosphorylation sites in proteins. Nucleic acids research. 2023;51(W1):W243–W50. pmid:37158278
  36. 36. Shabayek S, Spellerberg B. Group B Streptococcal Colonization, Molecular Characteristics, and Epidemiology. Frontiers in microbiology. 2018;9:437. pmid:29593684.
  37. 37. Hoffmann C, Berking A, Agerer F, Buntru A, Neske F, Chhatwal GS, et al. Caveolin limits membrane microdomain mobility and integrin-mediated uptake of fibronectin-binding pathogens. Journal of cell science. 2010;123(Pt 24):4280–91. pmid:21098633.
  38. 38. Dieser SA, Fessia AS, Zanotti AR, Raspanti CG, Odierno LM. Fibronectin and laminin induce biofilm formation by Streptococcus uberis and decrease its penicillin susceptibility. Microbial pathogenesis. 2019;136:103652. pmid:31398534.
  39. 39. Speziale P, Pietrocola G. The Multivalent Role of Fibronectin-Binding Proteins A and B (FnBPA and FnBPB) of Staphylococcus aureus in Host Infections. Frontiers in microbiology. 2020;11:2054. pmid:32983039.
  40. 40. Niemann S, Nguyen MT, Eble JA, Chasan AI, Mrakovcic M, Preissner KT, et al. More Is Not Always Better-the Double-Headed Role of Fibronectin in Staphylococcus aureus Host Cell Invasion. mBio. 2021;12(5):e0106221. pmid:34663090.
  41. 41. Kao WA, Pětrošová H, Ebady R, Lithgow KV, Rojas P, Zhang Y, et al. Identification of Tp0751 (Pallilysin) as a Treponema pallidum Vascular Adhesin by Heterologous Expression in the Lyme disease Spirochete. Sci Rep. 2017;7(1):1538. pmid:28484210.
  42. 42. Parker ML, Houston S, Pětrošová H, Lithgow KV, Hof R, Wetherell C, et al. The Structure of Treponema pallidum Tp0751 (Pallilysin) Reveals a Non-canonical Lipocalin Fold That Mediates Adhesion to Extracellular Matrix Components and Interactions with Host Cells. PLoS pathogens. 2016;12(9):e1005919. pmid:27683203.
  43. 43. Xin X, Chen S, Khan ZA, Chakrabarti S. Akt activation and augmented fibronectin production in hyperhexosemia. American journal of physiology Endocrinology and metabolism. 2007;293(4):E1036–44. pmid:17666488.
  44. 44. White ES, Sagana RL, Booth AJ, Yan M, Cornett AM, Bloomheart CA, et al. Control of fibroblast fibronectin expression and alternative splicing via the PI3K/Akt/mTOR pathway. Experimental cell research. 2010;316(16):2644–53. pmid:20615404.
  45. 45. Luo X, Xie X, Zhang L, Shi Y, Fu B, Yuan L, et al. Uncovering the mechanisms of host mitochondrial cardiolipin release in syphilis: Insights from human microvascular endothelial cells. International Journal of Medical Microbiology. 2024;316:151627. pmid:38908301
  46. 46. Gao K, Shen X, Lin Y, Zhu XZ, Lin LR, Tong ML, et al. Origin of Nontreponemal Antibodies During Treponema pallidum Infection: Evidence From a Rabbit Model. The Journal of infectious diseases. 2018;218(5):835–43. pmid:29701849.