Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

IMD-mediated innate immune priming increases Drosophila survival and reduces pathogen transmission

  • Arun Prakash ,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing

    arun.prakash@vanderbilt.edu

    Current address: Vanderbilt University, MRB-III, Biological Sciences, Nashville, Tennessee, United States of America

    Affiliation Institute of Ecology and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom

    ⨯
  • Florence Fenner,

    Roles Formal analysis, Investigation, Methodology, Writing – review & editing

    Affiliation Institute of Ecology and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom

    ⨯
  • Biswajit Shit,

    Roles Investigation, Methodology, Writing – review & editing

    Affiliation Ashoka University, Sonepat, Haryana, India

    ⨯
  • Tiina S. Salminen,

    Roles Investigation, Methodology, Writing – review & editing

    Affiliation Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland

    ⨯
  • Katy M. Monteith,

    Roles Investigation, Methodology, Writing – review & editing

    Affiliation Institute of Ecology and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom

    ⨯
  • Imroze Khan,

    Roles Resources, Supervision, Writing – review & editing

    Affiliation Ashoka University, Sonepat, Haryana, India

    ⨯
  • Pedro F. Vale

    Roles Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – original draft

    Affiliation Institute of Ecology and Evolution, School of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom

    ⨯

Abstract

Invertebrates lack the immune machinery underlying vertebrate-like acquired immunity. However, in many insects past infection by the same pathogen can ‘prime’ the immune response, resulting in improved survival upon reinfection. Here, we investigated the mechanistic basis and epidemiological consequences of innate immune priming in the fruit fly Drosophila melanogaster when infected with the gram-negative bacterial pathogen Providencia rettgeri. We find that priming in response to P. rettgeri infection is a long-lasting and sexually dimorphic response. We further explore the epidemiological consequences of immune priming and find it has the potential to curtail pathogen transmission by reducing pathogen shedding and spread. The enhanced survival of individuals previously exposed to a non-lethal bacterial inoculum coincided with a transient decrease in bacterial loads, and we provide strong evidence that the effect of priming requires the IMD-responsive antimicrobial-peptide Diptericin-B in the fat body. Further, we show that while Diptericin B is the main effector of bacterial clearance, it is not sufficient for immune priming, which requires regulation of IMD by peptidoglycan recognition proteins. This work underscores the plasticity and complexity of invertebrate responses to infection, providing novel experimental evidence for the effects of innate immune priming on population-level epidemiological outcomes.

Author summary

When we are vaccinated, our immune response is able to respond quickly if we are ever exposed to the same pathogen in the future. Unlike humans, the immune systems of invertebrates, such as insects, are not capable of the same type of specific immune memory. However, much work has shown that insects previously exposed to an inactivated pathogen will fare better if they are re-infected–a phenomenon broadly called “immune priming”. How insects are able to do this is an exciting focus of current research. We investigated immune priming in the fruit fly, a powerful model system for infection and immunity. We found that exposure to an inactivated form of the bacterial fly pathogen Providencia rettgeri resulted in flies better surviving a subsequent live infection. This effect lasted several days, was stronger in male flies, and was seen in different fly genetic backgrounds. We uncovered that priming requires a specific immune response in the fly fat-body (the equivalent to a fly ‘liver’) that produces an antimicrobial protein called Diptericin. We also found that primed flies were able to keep pathogen growth lower, and that this reduced their ability to spread the infection to other flies.

Citation: Prakash A, Fenner F, Shit B, Salminen TS, Monteith KM, Khan I, et al. (2024) IMD-mediated innate immune priming increases Drosophila survival and reduces pathogen transmission. PLoS Pathog 20(6): e1012308. https://doi.org/10.1371/journal.ppat.1012308

Editor: Francis Michael Jiggins, University of Cambridge, UNITED KINGDOM

Received: April 24, 2024; Accepted: May 31, 2024; Published: June 10, 2024

Copyright: © 2024 Prakash et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All raw data and code is available at 10.5281/zenodo.7624084. All other relevant data are in the manuscript and its supporting information files.

Funding: We acknowledge funding and support from the Branco Weiss fellowship to PFV and a Darwin Trust PhD studentship to AP from the School of Biological Sciences, The University of Edinburgh, UK. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Immunisation using attenuated or inactivated pathogens is one of the most successful public health practices to reduce the incidence of infectious diseases [1]. Immunisation works because humans and other vertebrate animals have evolved an acquired immune response capable of specific immune memory, which ensures a strong, precise, and effective response to a secondary infection [2]. Insects possess a robust innate immune response to pathogens which includes both cellular and humoral components [3–5], but lack vertebrate-like specialized immune cells responsible for acquired immunity. These differences in immune physiology resulted in the long-standing assumption that invertebrates should not be capable of immune ‘memory’, though this view was clearly at odds with empirical evidence from several invertebrate host-pathogen systems [6–8]. A substantial body of work has revealed diverse priming responses in a range of arthropod taxa, including Dipterans: fruit flies [9], mosquitoes [10]; Coleopterans: flour beetles [11,12]; Lepidopterans: the greater wax-moth [13]; Hymenopterans: bumblebee [14]; Crustaceans: water fleas [15] and Arachnids: spiders and scorpions [16]. There is therefore substantial evidence that arthropods possess a form of “immune priming”, where low doses of an infectious pathogen, or even an inactivated pathogen, can lead to increased survival upon reinfection.

There are many ways in which invertebrates may enhance their immune responses upon reinfection [6,17,18]. In Drosophila, the priming response during infection with the gram-positive bacterial pathogen Streptococcus pneumoniae was shown to be dependent on haemocytes and phagocytosis, while the Toll-pathway—the main pathway involved in clearance of gram-positive bacteria—was shown to be insufficient for successful priming [9]. Increased phagocytic activity in primed individuals has also been shown to play a key role in priming during Pseudomonas aeruginosa infection in Drosophila [19], while in the woodlouse, prior exposure to heat-killed bacteria led to increased phagocytosis by haemocytes upon reinfection [20]. In other Drosophila work, PGRP-LB (peptidoglycan recognition protein LB, a negative regulator of the Immune deficiency (IMD)-pathway) was identified as a key mediator of transgenerational immune priming against infection with parasitoid wasps (Leptopilina heterotoma and Leptopilina victoriae). Here, downregulation of PGRP-LB was necessary to increase haemocyte proliferation, required for wasp encapsulation by haemocytes in the offspring [21]. By contrast, in response to infection with Drosophila C virus (DCV), Drosophila progeny can produce a DCV-specific priming response by inheriting viral cDNA from the infected adult flies which is a partial copy of the virus genome [22,23]. The benefits of priming are not always associated with increased pathogen clearance, as shown during Enterococcus faecalis infection, where protection was explained by increased infection tolerance, not increased clearance [24].

Beyond its underlying mechanisms, an important but understudied aspect of immune priming is its potential consequences for pathogen transmission [17,25–27]. Epidemiological modelling predicts that priming should affect the likelihood of pathogen persistence, destabilise host–pathogen population dynamics, and that these effects depend on the degree of protection conferred by priming [26]. Further theoretical work suggests that priming can either increase or decrease infection prevalence depending on the extent to which it affects the pathogen’s colonization success and the host’s ability to clear or tolerate the infection [25]. While primed individuals may live longer, thus extending the infectious period, their pathogen burden may be lower, which could lead to lower pathogen shedding and less severe epidemics. Immune priming is therefore expected to have a significant impact on the outcome of pathogen transmission by directly modifying important epidemiological parameters, but the strength and direction of these effects is not intuitive to predict.

Here, we focus on immune priming in Drosophila when infected with the gram-negative bacterial pathogen Providencia rettgeri to investigate the occurrence, generality, duration, and mechanistic basis of immune priming during systemic infection. Furthermore, motivated by the theoretical predictions about the role of immune priming on epidemiological dynamics, we also designed transmission experiments to enable us to test how immune priming could affect each of these behavioural and immunological components of pathogen spread.

Results

Immune priming in Drosophila is a long-lasting response, showing sex-specific effects in different genetic backgrounds

We first examined if the length of time between the initial non-lethal exposure with heat-killed P. rettgeri and the secondary systemic pathogenic challenge with live P. rettgeri affects the extent of priming. To address this, we exposed w1118 male and female control flies to a systemic infection of live P. rettgeri 18-hours, 48-hours, 96-hours, 1-week or 2-weeks following the initial exposure to heat-killed bacteria. We found significant sex differences in the magnitude of the priming effect (sex treatment effect p<0.05) at 18-hours, 1-week and 2-weeks treatments (S1 Table), reflecting time-dependent and sex-specific priming dynamics. Male w1118 flies showed increased survival after initial priming for time points 18-hours, 48-hours and 96-hours, and still showed a significant, albeit reduced, priming response 1-week and 2-weeks after the initial exposure (Fig 1A–1E). Female flies did not show a priming response when infected 18-hours following the initial challenge, but the priming response increased with 48-hours and 96-hours priming intervals before completely disappearing after a week time-interval (including 2-weeks) (Fig 1A–1E and S1 Table).

thumbnail
Download:
Fig 1. The benefit of priming is long-lasting.

Survival curves of w1118 females and males with primed (exposed to heat-killed P. rettgeri in the first exposure) and unprimed (exposed to a sterile solution in the first exposure) treatments challenged with live P. rettgeri pathogen after (A) 18-hours (B) 48-hours and (C) 96-hours (D) 168-hours/1-week and (E) 336-hours/2-weeks post priming that is, initial non-lethal exposure to heat-killed P. rettgeri (n = 7–9 vial with 10–15 flies in each vial/sex/treatment/timepoint).

https://doi.org/10.1371/journal.ppat.1012308.g001

Next, we asked if priming occurred in two other commonly used Drosophila lines, Canton-S and Oregon-R (Ore-R) as observed with w1118 (Fig 2A–2D). Given the widespread effects of the endosymbiont Wolbachia on Drosophila immunity [28–30] we also tested whether the presence of Wolbachia had any effect on immune priming by comparing the priming response of Oregon-R (OreR), a line originally infected with Wolbachia strain wMel, henceforth OreRWol+ and a Wolbachia-free line OreRWol- that was derived from OreRWol+ by antibiotic treatment [30]. Females and males of the four Drosophila lines were treated first with heat-killed P. rettgeri, followed by infection with a systemic infection with live P. rettgeri 96-hours after the first treatment. Since the 96-hour time gap between priming and live P. rettgeri treatments showed maximum priming response (difference in survival) for both males and females of the w1118 line (Figs 1C and 2A), we kept the 96-hours timepoint as the consistent time-gap between priming and live infection throughout the study. w1118 did not show differences between sexes in the priming responses at this timepoint (S2 Table; Sex × Treatment effect p = 0.93). Canton-S flies showed increased survival following priming and we observed a stronger survival benefit in females (Sex effect, p<0.001)(Fig 2C and S2 Table). Oregon-R males also exhibited increased survival following priming, but priming had no significant effect on the females, as indicated by a significant interaction between sex and priming treatment (Sex × Treatment effect p<0.001; Fig 2D and S2 Table). We found that the presence of Wolbachia significantly improved overall survival of both males and females (Fig 2C and 2D and S3 Table). However, the immune priming observed in males in absence of Wolbachia (OreRWol-) was no longer present in flies carrying Wolbachia (OreRWol+), and both sexes showed similar patterns of survival (Sex effect, p = 0.43; Fig 2B and S2 Table).

thumbnail
Download:
Fig 2. Survival curves of females and males of the commonly used Drosophila lines either primed-challenged or unprimed-challenged with P. rettgeri.

(A) w1118 –this is the same data plotted in Fig 1C, and included in this figure to allow a direct comparison with the other lines (B) Canton-S (C) Oregon-R carrying endosymbiont Wolbachia (D) Oregon-R cleared of Wolbachia. (n = 7–9 vials with 10–15 flies in each vial/sex/treatment/line).

https://doi.org/10.1371/journal.ppat.1012308.g002

Primed male w1118 flies exhibit a transient reduction in bacterial load

Previous studies have shown that the priming response to fungi and gram-positive bacteria can be explained by increased clearance of bacterial pathogens in primed individuals [9,31]. We therefore examined whether the increased survival following a prior challenge we observed was a result of greater bacterial clearance in the primed individuals, or if the primed flies were simply better able to tolerate the bacterial infection [24]. To investigate this, we repeated the priming experiment with w1118 as it showed the strongest priming phenotype in both sexes (Figs 1C and 3A), and measured the bacterial load at 24-hours and 72-hours post-infection for both primed and unprimed female and male flies. Again, we observed a clear priming effect in both sexes (Fig 3A and S4 Table). In primed males the systemic infection resulted in higher survival (Sex effect, p = 0<001), but the effect of priming on the survival benefit was the same in both sexes (Sex × Treatment effect p = 0.34; S4 Table) and also in decreased bacterial loads at 24-hours post-infection when compared to unprimed individuals (Fig 3 and S4 Table for survival and S5 Table for load). However, by 72-hours post-infection, bacterial loads had dropped in both primed and unprimed male flies and there was no detectable effect of priming on the bacterial loads (Fig 4B and S5 Table).

thumbnail
Download:
Fig 3. Bacterial loads of primed and unprimed w1118 flies.

(A). Survival curves of primed and unprimed control w1118 flies (B). Internal bacterial load (n = 20–22 vial with 5–7 flies in each vial/sex/treatment) after (i) 24-hours and (ii) 72-hours following P. rettgeri infection. Different letters in panel-B denotes primed and unprimed individuals are significantly different, tested using Tukey’s HSD pairwise comparisons, analysed separately for each timepoint and sex combination. The error bars in panel B represent standard error.

https://doi.org/10.1371/journal.ppat.1012308.g003

thumbnail
Download:
Fig 4. Priming occurs in males but not females during oral infections.

(A) Survival curves of male and female wildtype (w1118) flies with (i) systemic (ii) oral priming where flies initially exposed to heat-killed P. rettgeri or unprimed flies exposed to a sterile solution in the first exposure, this is followed by live P. rettgeri pathogen after 72-hour time gap [systemic infection dose = 0.75 OD (~45 cells/fly) and oral P. rettgeri infection dose = 25 OD600]. (n = 7–9 vials/sex/treatment/infection route) (B). Mean bacterial load measured as colony forming units at 24 hours following (i) systemic and (ii) oral priming, followed by live P. rettgeri infection for male and female w1118. Different letters in panel-B denotes primed and unprimed individuals are significantly different, tested using Tukey’s HSD pairwise comparisons.

https://doi.org/10.1371/journal.ppat.1012308.g004

Priming following oral infection reduces bacterial shedding and transmission in males

Apart from increasing survival during infections, immune priming may also have consequences to pathogen spread and transmission [27]. Despite having enhanced survival, primed individuals may also extend the infectious period or their pathogen burden may be lower, which would lead to less severe epidemics [27]. To investigate how immune priming affects epidemiological parameters, we tested whether primed individuals have reduced bacterial shedding and spread. Given the oral-faecal nature of bacterial transmission and that our previous results all related to systemic infections, we first established that a survival benefit of priming also occurs under oral infection. Following an initial oral exposure to a heat-killed P. rettgeri culture, after a 72-hour period we exposed female and male w1118 flies orally to a lethal dose of live P. rettgeri. Primed w1118 males, but not females, showed increased survival decreased internal bacterial loads after priming via the oral route of infection. (Fig 4A and 4B and S6 and S7 Tables).

Given this priming effect on bacterial loads (Fig 4B) we hypothesised that priming could directly impact the amount of bacterial shedding, and therefore have a direct impact on pathogen transmission. We measured the shedding of single flies 4-hours after infection by live P. rettgeri exposure. We found that male flies previously primed with a heat-killed bacterial inoculum shed less bacteria than unprimed flies. However, both primed and unprimed females showed increased bacterial shedding following oral P. rettgeri infection (Fig 5A and S9 Table). These effects on bacterial shedding are likely to have a direct effect on the spread of infection in groups of individuals. In transmission assays, primed donor males also spread very little pathogen upon re-infection with oral P. rettgeri, compared to the unprimed male treatment where successful transmission was detected recipient flies (Fig 5B and S9 Table). However, both primed and unprimed females showed equivalent levels of bacterial spread following oral P. rettgeri infection (Fig 5B and S9 Table). While multiple traits, including host activity levels and contact rates may influence pathogen transmission [32,33], we did not find any difference in the locomotor activity of primed and unprimed flies (S3 Fig). Our results therefore provide evidence that, in male flies, immune priming reduces pathogen transmission by directly decreasing bacterial shedding from infectious flies.

thumbnail
Download:
Fig 5. The effects of priming on bacterial shedding and transmission.

(A). Bacterial shedding after 4-hours following oral priming (initial heat-killed exposure) and infection with live P. rettgeri (OD600 = 25) for males and females (n = 15 individual flies per treatment). (B) percentage transmission of measurable bacterial loads for male and female w1118 flies (recipient-flies) over the first 4-hours following exposure with infected donor flies (n = 6 independent transmission assays). Different letters denote primed and unprimed individuals are significantly different, tested using Tukey’s HSD pairwise comparisons.

https://doi.org/10.1371/journal.ppat.1012308.g005

The IMD-pathway, but not the Toll pathway, is required for immune priming during P. rettgeri infections

In fruit flies, the production of AMPs during antibacterial immunity is mediated by the Immune deficiency (IMD) and Toll pathways. In both pathways, pathogens are recognised by peptidoglycan receptors (PGRPs), initiating a signalling cascade that culminates in the activation of the NF-κB-like transcription factors (Dorsal in Toll or Relish in IMD), resulting in the upregulation of AMP genes. The Toll-pathway generally recognises LYS-type peptidoglycan found in gram-positive bacteria and fungi. The IMD-pathway recognises DAP-type peptidoglycan found in gram-negative bacteria and produces AMPs such as Diptericins, Attacins and Drosocin among others. AMPs work with a high degree of specificity, so that only a small subset of the total AMP repertoire provides the most effective protection against specific pathogens [34], although this specificity has been shown to be greatly reduced during aging [35].

The inducible AMPs regulated by the IMD signalling pathway play a crucial role in resisting gram-negative bacterial infection such as P. rettgeri [36]. Therefore, we wanted to investigate whether the IMD signalling pathway and IMD-responsive AMPs contribute to immune priming. To address this, we used several transgenic fly lines (CRISPR knockouts and UAS-RNAi knockdowns) with functional absence of or knockdown of different regulatory and effector components of the IMD-signalling pathway. As all CRISPR/cas9 AMP mutants were isogenized onto the iso-w1118 background, we first confirmed that the priming response in iso-w1118 was the same as the w1118 used in the previous experiments (Figs 6A and S4). First, we tested a Relish loss-of-function mutant RelE20, a key regulator of the IMD immune response. As expected, we found that Relish mutants did not show any bacterial clearance, died at faster rate, and therefore did not show any benefit of a priming treatment (Fig 6Aii for survival and Fig 6Bii for bacterial load, S10 Table for survival and S11 Table for bacterial load). Loss-of—function of spätzle (spz), a key regulator in the Toll pathway, showed enhanced survival following initial heat-killed exposure, and their mortality rates were the same as in controls (w1118) (Fig 6Aiii and S10 Table) indicating that Toll-pathway does not contribute to priming during P. rettgeri infection (Fig 6Aiii and S10 Table). In both lines where priming induced a survival benefit, the magnitude of effect was similar for males and females (Sex × Treatment effect >0.6; S10 Table).

thumbnail
Download:
Fig 6. Priming requires the IMD but not the Toll pathway.

(A): Survival curves for control flies and flies lacking different innate immune pathway components in females and males (i) control iso-w1118 (ii) RelE20- IMD-pathway transcription factor (iii) Spz- Toll pathway regulator in both males and females (B) (i-iii) bacterial load measured after 24-hours post-secondary pathogenic exposure (n = 7–9 vial/sex/treatment/transgenic lines). Different letters in panel-B indicate that primed and unprimed individuals are significantly different, tested using Tukey’s HSD pairwise comparisons, analysed separately for each timepoint and sex combination. The error bars in panel B represent standard error.

https://doi.org/10.1371/journal.ppat.1012308.g006

Expression of IMD-regulated Diptericin B in the fat body is required for priming

Given the important role of the IMD pathway for the priming response (Fig 6), next, we tested whether mutants with defective IMD signalling or unable to produce specific antimicrobial peptides were capable of immune priming. We first used a ΔAMP transgenic line, which lacks most of the known Drosophila AMPs (10 AMPs in total). ΔAMPs flies are extremely susceptible to the majority of microbial pathogens, including gram-negative bacteria [34], and we confirmed that both primed and unprimed ΔAMP flies succumb to death at a similar rate following systemic infection, and both primed and unprimed ΔAMP flies also exhibited elevated bacterial loads (measured 24-hours after the secondary pathogenic exposure) (Fig 7Ai for survival, Fig 7Bi for bacterial load, S10 and S11 Tables, relative to control w1118 flies–compare with previous figure Fig 6Bi), showing that AMPs are needed for the priming response against P. rettgeri. To investigate which AMPs are required for priming against P. rettgeri infection, we used a Group-B transgenic line, lacking major IMD regulated AMPs (including Diptericins and Attacins and Drosocin) but have all upstream IMD signalling intact. Primed Group-B flies showed mortality similar to unprimed Group-B flies (Fig 7Aii and S11 Table) and exhibited increased bacterial loads across both the sexes irrespective of being primed or not (Fig 7Bii and S11 Table). Thus, despite being able to produce other AMPs, removal of IMD-regulated AMPs completely eliminated the priming effect, indicating that AMPs regulated by the IMD-pathway are required for immune priming against P. rettgeri infection.

thumbnail
Download:
Fig 7. Priming requires specific AMP expression.

(A). Survival curves for CRISPR/Cas9 AMP mutants (i) ΔAMP fly line: lacking all known 10 fly AMPs–(ii) Group-B: lacking major IMD pathway AMPs (iii) Dpt knockout and (iv) ΔAMP+Dpt: lacking all AMPs except Dpt. (B) internal bacterial load quantified after 24-hours post-secondary exposure (n = 7–9 vials with 10–15 flies in each vial/sex/treatment/transgenic lines). Different letters in panel-B denotes primed and unprimed individuals are significantly different, tested using Tukey’s HSD pairwise comparisons, analysed separately for each fly line and sex combination. The error bars in panel B represent standard error.

https://doi.org/10.1371/journal.ppat.1012308.g007

Since Diptericins have been shown previously to play a key role in defence against P. rettgeri, we then used a Dpt mutant (lacking Diptericin-A and B) and AMPs+Dpt transgenic fly lines (flies lacking all known AMPs except Diptericin) to test whether Diptericins are required and sufficient for priming in both females and males. The survival benefit of priming disappeared in flies lacking DptA+B across both females and males and both primed and unprimed Dpt mutants exhibited increased bacterial load (Fig 7Biii and S11 Table). Notably, the priming response was recovered completely in male flies that lacked other AMPs but possessed functional Diptericins (AMPs+Dpt). However, the same effect was not seen in females (Sex × Treatment effect p<0.01; Fig 7Aiv for survival, Fig 7Biv for bacterial load; S10 Table for survival and S11 Table for bacterial load).

In response to gram-positive Streptococcus pneumoniae infection, previous work described the role of haemocytes in immune priming through increased phagocytosis [9]. Subsequent work has also shown that reactive oxygen species (ROS) burst from haemocytes is important for immune priming during Enterococcus faecalis infection [37]. Since our results pointed to a Diptericins being required for immune priming against P. rettgeri, we wanted to determine if Diptericin expression in either the fat body or haemocytes was more important for immune priming. Using-tissue specific Diptericin-B UAS-RNAi knockdown, we found that male flies with knocked-down DptB in fat bodies no longer showed immune priming compared to the background or control iso-w1118, while knocking down DptB in haemocytes resulted in a smaller but still significant increase in survival following an initial exposure (Fig 8 and S12 Table). This would therefore support that immune priming requires DptB expression in the fat body, while haemocyte-derived DptB is not important for priming. It is worth noting that it is possible that haemocytes contribute to immune priming through phagocytosis or melanisation, or via cross-talk with the IMD pathway, and this remains a question for future research.

thumbnail
Download:
Fig 8. Survival curves tissue-specific Dpt knockdowns.

(i) control iso-w1118 and UAS-RNAi mutants—(ii) FB>DptB RNAi knock down of DptB in fat body and (iii) FB>DptB RNAi knock down of DptB in haemocytes. (n = ~50 flies/sex/treatment/fly lines).

https://doi.org/10.1371/journal.ppat.1012308.g008

Priming is not an outcome of constant Dpt upregulation

As our results indicated that AMPs, especially Diptericins play a key role in Drosophila priming against P. rettgeri, we wanted to test if the priming effect we had observed was a result of constant upregulation of AMPs after initial heat-killed exposure allowing rapid bacterial clearance during the secondary exposure, or if AMP expression returned to a baseline level within the 96-hours between priming and the live infection. To do this, we measured Dpt gene expression at 18-hours and 72-hours following initial heat-killed exposure, and then 12-hours, 24-hours and 72-hours following secondary live P. rettgeri infection. DptB expression increased 18-hours after initial heat-killed exposure but returned to baseline levels by 72-hours (Fig 9A and 9B and S13 Table) indicating that flies did mount an immune response to the heat killed bacteria, but that this was resolved by the time they were infected with the live bacteria at 96-hours.

thumbnail
Download:
Fig 9. Antimicrobial gene expression following priming.

(A) Mean±SE (standard error) of Diptericin-AMPs expression at different time points (hours) for females and males wild-type w1118 flies—naïve or unhandled flies (time 0h); flies exposed to initial heat-killed P. rettgeri (blue); primed flies that are initially exposed to heat-killed P. rettgeri followed by challenge with P. rettgeri (dark red); unprimed flies that receive 1xPBS during primary exposure followed by live P. rettgeri during secondary exposure (grey) [n = 5 groups of 3 pooled flies per sex/treatment/timepoint]. (B). Diptericin (A+B), Attacin-C and Drosocin AMPs expression 12-hours and 24-hours after exposure to live P. rettgeri in w1118 female flies. Diptericin data is the same as shown in panel A (top right panel), shown here for clarity and for comparison with Attacin-C and Drosocin. Asterisks ‘*’ indicates that primed and unprimed individuals are significantly different (p<0.05). The error bars represent standard error.

https://doi.org/10.1371/journal.ppat.1012308.g009

Further, 72-hours following a lethal secondary live P. rettgeri infection, we found that primed w1118 females and males showed increased DptB levels compared to unprimed individuals (Fig 9A and 9B). The increased DptB expression also resulted in increased bacterial clearance in males. In case of females, despite higher Dpt levels at 72-hours following secondary live infection in primed flies, we did not detect any difference in bacterial clearance between primed and unprimed flies. We also tested the expression pattern of other IMD-responsive AMPs such as Attacin-C and Drosocin in females. Overall, we found that the expression of Attacin-C and Drosocin was not different between primed and unprimed females (Fig 9C for AttC and Dro and S13 Table).

Regulation of IMD by PGRPs is required for immune priming

Following gram-negative bacterial infection, DAP-type peptidoglycans from gram-negative bacteria are recognised by the peptidoglycan receptors PGRP- LC (a transmembrane receptor) and PGRP-LE (a secreted isoform and an intracellular isoform), which then activate the IMD intracellular signalling cascade [36,38]. Immune regulation is achieved by several negative regulators, including PGRP-LB, a secreted peptidoglycan with amidase activity, that break down peptidoglycans into smaller, less immunogenetic fragments [36,38]. PGRP-LB has also been shown to be important for transgenerational immune priming in Drosophila against parasitoid wasp infection [21]. Given the role of DptB in the observed priming benefit, we therefore decided to investigate the role of PGRPs in the immune priming we observed during P. rettgeri infection.

To address this, we used fly lines with loss-of-function in PGRP-LB, LC and LE. Regardless of which PGRP was disrupted, we observed that flies were no longer able to increase their survival following an initial exposure (Fig 10A and S14 Table). However, unlike similar outcomes with Relish or ΔAMP, here the lack of priming was not driven by an inability to clear bacterial loads, as microbe loads in PGRP mutants were ~100-fold lower than in Relish or AMP mutants (Fig 10B and S15 Table). Further, Dpt expression compared to the w1118 control was either similar (PGRP-LC, PGRP-LE) or higher (PGRP-LB), as expected, in both primed and unprimed flies (S5 Fig and S16 Table). This suggests that Diptericin expression is required, but not sufficient, for successful priming, which requires adequate regulation by PGRPs. Which specific molecular signal modifies PGRP-mediated regulation of Diptericin expression following an initial priming challenge is unclear, but must lie upstream of the IMD pathway.

thumbnail
Download:
Fig 10.

(A). Survival curves for males and females of Loss-of-function in PGRPs (peptidoglycan recognition proteins) of IMD (i) PGRP-LB (ii) PGRP-LC and (iii) PGRP-LE (B). internal bacterial load quantified after 24-hours post-secondary exposure in female and male flies (n = 7–9 vials with 10–15 flies in each vial/sex/treatment/ fly lines). The same letters in panel-B denote that primed and unprimed individuals are not significantly different, tested using Tukey’s HSD pairwise comparisons for each fly line and sex combination. The error bars represent standard error.

https://doi.org/10.1371/journal.ppat.1012308.g010

Discussion

The observation of immune priming in invertebrates underlines the importance of whole organism research in immunity in lieu of a purely mechanistic approach to immunology, highlighting that the same phenomenology can originate in very different mechanisms [18,39]. Thus, substantial experimental evidence in both lab adapted and wild-caught arthropods suggests that immune priming is a widespread phenomenon, and is predicted to have a profound impact on the outcome of host–pathogen interactions, including infection severity and pathogen transmission [40,26,27,17].

In the present work, we investigated the occurrence, generality, and mechanistic basis of immune priming in fruit flies when infected with the gram-negative pathogen Providencia rettgeri. We present evidence that priming with an initial non-lethal bacterial inoculum results increased survival after a secondary lethal challenge with the same live bacterial pathogen. This protective response may last at least two weeks after the initial exposure, is particularly strong in male flies, and occurs in several genetic backgrounds. We show that the increased survival of primed individuals coincides with a transient decrease in bacterial loads, and that this is likely driven by the expression of the IMD-responsive AMP Diptericin-B in the fat body. Further, we show that while Diptericin is required as the effector of bacterial clearance, it is not sufficient for immune priming, which requires the regulation by at least three PGRPs (PGRP-LB, PGRP-LC, and PGRP-LE). Therefore, despite having an intact IMD signalling cascade, and being able to express Diptericin, flies lacking any one of PGRP-LB, LC or LE were not capable of increasing survival following an initial sublethal challenge. Together, our data indicates that PGRPs are necessary for regulating immune priming against P. rettgeri.

These results are largely consistent with other work showing that the pathways that signal pathogen clearance may not be the same that underlie the signalling of the priming response. For example, Cabrera et al [24] investigated priming with the Gram-positive E. faecalis and found that while the Toll pathway was required for responding to a single infection, Toll signalling was dispensable for immune priming [24]. By contrast, IMD-deficient flies were still able to clear single E. faecalis infections (due a functional Toll response) but were no longer able to increase survival following an initial exposure. That is, in support of our results here, the IMD played a distinct role in signalling priming that was independent of its role in clearance. Further, previous work found that the Toll pathway is required (though not sufficient) for priming in response to gram-positive bacterial Streptococcus pneumoniae infection [9] and here we find that the Toll pathway is not required for a functional immune priming response.

In response to infection, the expression of several AMP genes in Drosophila increases and then drops once the infection threat is resolved or controlled. Previous studies have shown that this occurs within a period of few hours during bacterial infections [41], and that in many cases, this increased AMP expression underlies the immune priming response [18,42]. In other host-pathogen systems, genome wide insect transcriptome studies have identified upregulation of several AMPs in primed individuals, for example, Attacins, Defensins and Coleoptericins in flour beetles [43,44], Cecropin, Attacin, Gloverin, Moricin and Lysozyme in silkworms [45], Gallerimycin and Galiomicin in wax-moths [46] and finally, Cecropin in tobacco moths and fruit flies [47,37]. However, there are also examples where innate immune priming involves the downregulation of AMP expression, such as priming with the gram-positive E. faecalis [24].

One key aspect of our results is that immune priming was not the result of continued upregulation of Diptericin following the initial exposure to heat-killed bacteria. Instead, we observed that the initial immune response to heat-killed bacteria had already been resolved at 72-hours, before the secondary exposure to a lethal infection at 96-hours (see Fig 9A). This second up-regulation of AMP expression was at least 10-times higher than the response to heat-killed bacteria, and was initially similar between both primed and unprimed flies (exposed to a sterile solution in the first exposure). It was only at 72-hours following the second lethal exposure that we observed significantly higher expression of Diptericin in primed flies. This difference appears to arise because unprimed flies show a faster resolution of the immune response compared to primed flies; that is, the expression of Diptericin shows a faster decline between 24-hours and 72-hours post-exposure in unprimed compared to primed flies (see Fig 9A). These patterns of gene expression provide a partial explanation for the increased survival following priming, but they do not explain why primed individuals had lower bacterial loads at 24-hours after exposure to the second lethal infection, as at this timepoint we did not detect any differences in Diptericin expression between primed and unprimed flies. It is also unclear why primed females showed increased expression of Diptericin after 24-hours, but do not show any reduction in bacterial loads at this timepoint following priming, in the way male flies did.

The sex differences we observed in priming reflect a larger pattern of sexual dimorphism in immunity present in most organisms, including Drosophila [48–50]. Here, we found that males showed better bacterial clearance after initial exposure to heat-killed P. rettgeri which enabled them to experience enhanced survival compared to females, who exhibited higher bacterial loads and greater mortality. Previous work has established several ways in which the immune responses of male and female Drosophila may differ, including Toll [51] and IMD [52] signalling or signalling of damage during enteric infections [53]. Our results indicate that the Toll pathway is not required for successful priming, so sex-differences in Toll signalling are unlikely to be important in explaining sexually dimorphic priming. However, other work has shown that disrupting the negative regulator of IMD, PGRP-LB, affected survival to a greater extent in females following E. coli infection [52]. Given that we identified a role for PGRP-mediated regulation of Dpt as key for immune priming, sex differences in PGRP regulation could potentially explain differences in priming between males and females.

Another aspect related to sex differences in priming, was that males experienced a survival benefit of prior exposure in every experiment we report; female flies showed more variable response, showing a survival benefit of priming repeatedly in several independent experiments (Figs 1, 2, 3, and 6) but not in others (Fig 4). Further while the priming phenotype was successfully recovered in males by restoring expression of the AMP Dtp, this was not observed in females. These variable outcomes in females remain puzzling, and are likely not the outcome of heritable sex-differences–it is hard to imagine how a priming response might evolve in males, but not females, and we did repeatedly observe it. Instead, one possibility for the observed sex-differences could relate to unmeasured environmental variation in our experimental setups–although these were always minimised as much as possible–which may interact with different nutritional demands and metabolic activities in female Drosophila. For instance, female fruit flies are often able to reallocate resources in accordance with their reproductive demands, as observed in terminal investment during infection [54–56]. Studies from other insects suggest that inducing priming responses can directly reduce the reproductive fitness in mosquitoes [57], wax moth [58], and mealworm beetles [59]. There are therefore potential trade-offs between investment in reproductive effort and investment in stronger immune responses following priming. Given that all females used in this study were mated, it is possible that such trade-offs forced a reallocation of resources towards reproduction, thereby reducing the observed magnitude of the priming response in females. Future studies may consider comparing priming responses in females with different reproductive states in order to test whether immune priming is costlier for female Drosophila.

A subsidiary finding of this work was the effect of the endosymbiont Wolbachia on immune priming. How endosymbionts that are widespread among insects are likely to influence innate immune priming is a topic of considerable interest [60]. There is abundant evidence that Drosophila carrying the endosymbiont Wolbachia are better able to survive infections, especially viral infections [61,29,62,30]. In this case, we observed that the priming response that was present in male flies cleared of Wolbachia disappeared in males carrying the endosymbiont. This effect is unlikely due to a direct effect of Wolbachia on the ability to clear P. rettgeri in primed flies, as previous work has found that Wolbachia had no effect on the ability to suppress P. rettgeri during systemic infection [63]. Indeed, if priming is the result of upregulation of AMP expression, this may suggest that Wolbachia may be actively suppressing the expression of AMPs, thereby reducing the beneficial effects of priming. However, this hypothesis would contradict work showing that some Wolbachia strains upregulate the host’s immune response and result in a reduction of pathogen growth [64,65]. Another possibility is that while both Wolbachia and P. rettgeri are Gram-negative bacteria, they could elicit the expression of competing AMP responses, leading to a less efficient priming response. Further rigorous experimental work is therefore required to fully understand this effect of Wolbachia on immune priming.

Finally, it is important to consider the implications of immune priming for disease ecology and epidemiology, and particularly how it may affect pathogen transmission. If priming acts by improving bacterial clearance via increased AMP expression, as observed in the present work, we predict that priming is likely to reduce pathogen shedding at the individual level, resulting in reduced disease transmission at the population level. Epidemiological models that have incorporated priming predict that primed individuals with enhanced survival following an initial sub-lethal pathogenic exposure are less likely to become infectious upon re-infections [27]. It remains unclear whether immune priming reduces pathogen transmissibility, varies the infectious period, or alters infection-induced behavioural changes in the host [27]. An additional level of complexity is that there is likely to be substantial within-population genetic variation in how priming affects each of these components of pathogen transmission. Insects offer a powerful system to investigate these effects, because they rely on an innate immune system that can induce an easily measurable priming response, but further, insect are also important vectors of many infectious diseases. Immune priming has thus emerged as a provocative idea to reduce the vectorial capacity of insect vectors, thereby reducing the transmission of vector-borne pathogens [17]. A better understanding of how immune priming contributes to host heterogeneity in disease outcomes would aid our understanding of the causes and consequences of variation in infectious disease dynamics.

Materials and methods

Fly strains and maintenance

Several D. melanogaster strains: w1118 (Vienna Drosophila Resource Center), iso-w1118 (Bloomington Drosophila Stock Center), Canton-S, Oregon-R Wolbachia+ve and Oregon-R Wolbachia-ve [30]. Transgenic flies included immune mutants RelE20 (relish—IMD pathway regulator [66]) and spz (spätzle–Toll pathway regulator [67], and were a gift from the Saleh lab (Pasteur, Paris). We also used the following CRISPR/Cas9 deletion lines, originally gifted by the Lematire lab (EPFL, Lausanne) [34]: (a) ΔAMPs—flies lacking 10 fly AMPs, (b) Group-B—flies lacking major IMD regulated AMPs including Attacins (AttCMi; AttDSK1), Drosocin (DroSK4) and Diptericins (DptSK12), (c) DptSK12 –flies lacking Diptericins (DptA and DptB), and (d) ΔAMPs+Dpt–flies lacking 10 known AMPs except Diptericins. All the CRISPR/Cas9 mutants were generated previously from the iso-w1118 genetic background using CRISPR/Cas9 gene editing technology to induce null mutations in the selected genes [34].

We also used the binary GAL4/UAS system for tissue specific silencing of target genes with the RNA interference (RNAi) method. Diptericin-B (DptB) (Bloomington stock# 28975) was tissue-specifically knocked down in the fat body (w1118-iso,Fb-Gal4i+(P{fat}) and in haemocytes [w1118-iso,Hmldelta- Gal4; He-Gal4 –a combination of two haemocyte GAL4 drivers, the Hml-GAL4.Δ [68] and He-GAL4.Z [69]]. All fly stocks and experimental flies were maintained at 25°C ±1°C on a 12:12 hour light: dark cycle in vials containing 7ml of standard cornmeal fly medium [70]. For the experiments, we controlled larval density by placing 10 females and 5 males in each vial and the females were allowed to lay eggs for 48-hours. Fourteen days later, the eclosing males and females were sorted and collected and separated into group of 25 flies in each vial. Three-day old, mated individuals were used in all experiments.

Systemic immune priming and infection assays

P. rettgeri was grown at 37°C in 10ml Luria broth (Sigma Ltd) overnight to reach optical density OD600 = 0.95 (measured at 600nm in a Cell Density Meter, Fisherbrand). The culture was centrifuged at 5000 rpm for 5 min at 4°C, and the supernatant was removed, and the final OD was adjusted to 0.1 and 0.2 by using sterile 1xPBS (Phosphate buffer saline). To obtain heat-killed bacteria the dilution was incubated at 90°C for 20–30 mins [11]. To ensure all bacteria were dead in the heat-treated culture, it was plated and no growth was confirmed. To prime individuals, 3-day old adults were pricked with a 0.14-mm pin (Fine Science Tools) dipped in either heat-killed bacteria for the primed treatment or in 1xPBS solution for the unprimed treatment (exposed to a sterile solution in the first exposure) in the mesopleuron region (the area situated under the wing and to the left of the pleural suture) [71]. Following this initial priming treatment, the individuals were pricked using OD600 = 0.1 live P. rettgeri bacteria (resulting in approximately 70 bacterial cells/fly). To test whether male and female adult flies show priming (measured as enhanced survival) with increasing time intervals between the initial heat-killed exposure and later challenge with live P. rettgeri, we tested several time points between the two challenges 18-hours, 48-hours, 96-hours, 1-week and 2-weeks (See S1 Fig for experimental design; n = 9–13 vial treatment/sex/ fly line). We used a split vial experimental design to obtain replicate matched data for both survival and bacterial load see [72] for details. Briefly after infection each vial containing about 25 flies (of each treatment, sex and fly line combination) were divided into 2 vials for measuring (i). survival following infection (see S1i Fig; 13–17 flies/combination) and (ii). internal bacterial load (see S1ii Fig).

Bacterial load quantification

To test whether the host’s ability to supress bacterial growth varies across primed and unprimed individuals, we quantified bacterial load as colony forming units (CFUs) at 24-hours after P. rettgeri infection for controls and transgenic flies in both sexes. Flies were surface sterilized in groups of 3–5 flies per vial in 70% ethanol for 30s and washed twice with distilled water before homogenising flies individually using micro pestles. We immediately performed serial dilutions of the homogenate with 1xPBS and plated them on LB agar plates and cultured at 29°C overnight. The following day, we counted the CFUs manually [73] (n = 9–13 vial/sex/treatment/fly mutants).

Gene expression quantification

The expression of Diptericins was quantified by qRT-PCR. In parallel with the survival experiment, we randomly selected a subset of control w1118 individuals (both males and females) for RNA extraction, we included 15 flies [5–7 replicates of 3 flies pooled together for each treatment (primed and unprimed) for both males and females]. We randomly removed selected flies (3 flies per vial) at different time points post exposure to P. rettgeri (18-hours and 72-hours post-priming, 12-hours and 24-hours post-challenge). We then homogenised pools of three in 80μl of TRIzol reagent (Invitrogen, Life Technologies). Homogenates were kept frozen at -70°C until RNA extraction. We performed mRNA extractions using the standard phenol-chloroform method and included a DNase treatment (Ambion, Life Technologies).

We confirmed the purity of eluted RNA using a Nanodrop 1000 Spectrophotometer (version 3.8.1) before going ahead with reverse transcription (RT). The cDNA was synthesized from 2μl of the eluted RNA using M-MLV reverse transcriptase (Promega) and random hexamer primers, and then diluted 1: 1 in nuclease free water. We then performed quantitative RT-PCR (qRT-PCR) on an Applied Biosystems StepOnePlus machine using Fast SYBR Green Master Mix (Invitrogen) using a 10μl reaction containing 1.5L of 1:1 diluted cDNA, 5μl of Fast SYBR Green Master Mix an 3.5μl of a primer stock containing both forward and reverse primer at 1μM suspended in nuclease free water (final reaction concentration of each primer 0.35μM). For each cDNA sample, we performed two technical replicates for each set of primers and the average threshold cycle (Ct) was used for analysis. We obtained the AMP primers from Sigma-Aldrich Ltd; Dpt_Forward: 5’ GACGCCACGAGATTGGACTG 3’, Dpt_Reverse: 5’ CCCACTTTCCAGCTCGGTTC 3’, AttC_Forward: TGCCCGATTGGACCTAAGC, AttC_Reverse: GCGTATGGGTTTTGGTCAGTTC, Dro_Forward: ACTGGCCATCGAGGATCACC, Dro_Reverse: TCTCCGCGGTATGCACACAT. We used RpL49 as endogenous reference gene, RpL49_Forward: 5’ ATGCTAAGCTGTCGCACAAATG 3’, RpL49_Reverse: 5’ GTTCGATCCGTAACCGATGT 3’. We optimised the annealing temperature (Tₐ) and the efficiency (Eff) of the Dpt primer pair was calculated by 10-fold serial dilution of a target template (each dilution was assayed in duplicate); Dpt: Tₐ = 59°C, Eff = 102%; AttC: Tₐ = 60°C, Eff = 94%; Dro: Tₐ = 61°C, Eff = 104%. We analysed the gene expression data by calculating the ΔΔCT value [74]. Fold change = 2-ΔΔCt

Where, ΔΔCt = [(Ct of Gene A–Ct of Internal control) of Infected sample]–

[(Ct of Gene A–Ct of Internal control) of Control sample]

We used RpL32 as a reference gene as it was expressing steadily in our treatment and control conditions. We calculated fold change in gene expression relative to the uninfected controls to calculate ΔΔCT and used ANOVA to test whether AMP expression differed significantly between primed and unprimed treatment for males and females.

Oral priming and infection

For oral priming and live infection, we adjusted the final concentration to OD600 = 25 [53,73]. We initially prepared vials for oral priming by pipetting 350–400 μl of standard agar [see [73]] onto lid of a 7ml tubes (bijou vials) and allowed it to dry. Simultaneously, we starved the experimental flies on 12ml agar vials for 4 hours. Once the agar on the lids dried, we placed a small filter disc (Whattmann-10) in the lid and pipetted 80μl of heat-killed bacterial culture (primed treatment) or 5% sucrose solution (unprimed control treatment) directly onto the filter disc. Once the agar dried, we orally exposed flies (heat-killed only, primed and unprimed treatment) by adding approximately 10 flies per vial for 18-hours and then transferred the flies onto fresh Lewis food vials. After 3-days, we again prepared the bijou vials and once the agar dried, this time we added 80μl of live bacterial culture (OD600 = 25) and exposed flies to live P. rettgeri for 18-hours. We then transferred flies onto fresh food vials and observed survival after oral exposure to P. rettgeri every 12 hours for the following 8 days.

Measuring locomotor activity

We measured the locomotor activity of single flies (n = 52 flies for each for each sex and treatment combination) during three continuous days using a Drosophila Activity Monitor–DAM (v2 and v5) System [75], in an insect incubator maintained at 25°C ± 1°C in a 12 D: 12 L cycle. We then processed the raw activity data using the DAM System File Scan Software [75]. We analysed fly activity data using three metrics [76–79]: total activity, the average activity during 5-min activity bouts, and proportion of 5-min bouts with zero activity (which has been defined as sleep in Drosophila [80]) (S2III Fig)

Measuring bacterial shedding

We measured the bacterial shedding of single flies (n = 8–12 flies per treatment and sex combination) at a single time point, 4-hours following overnight oral bacterial exposure. We chose this timepoint as in other work we have found that most faecal shedding of bacterial pathogens occurs within the first 4 hours, and steadily decreases by 8 hours following overnight oral infection. Following oral priming to either heat-killed bacterial culture (primed treatment) or 5% sucrose solution (unprimed treatment), flies were exposed to an oral infection with live infection with 80μl of live P. rettgeri culture (OD600 = 25). Following 18 hours of oral exposure, flies were placed individually into 1.5ml Eppendorf tubes with approximately 50μl of Lewis medium in the bottom of the tube for 4-hours. After 4-hours, flies were removed from the tube and the remaining content of each tube was washed with 50μl of 1xPBS buffer by vortexing thoroughly for at least 5 secs. We then plated these samples on a LB agar plates, incubated them at 29°C and counted the colonies manually after 18-hours.

Measuring bacterial transmission

We measured transmission in groups of flies, by collecting age-matched donor and recipient w1118 flies, separately for each sex. To test the effect of priming on the ability of flies to transmit P.rettgeri, we orally exposed 3-day old w1118 flies (donor flies) with either 5% sucrose and heat-killed bacteria (primed) or 5% sucrose only (unprimed). After 96-hours the donor flies were exposed to OD600 = 25 of P. rettgeri (see oral infection section above). The infected donors were marked by cutting the corner of a fly wing. We then placed one donor and five uninfected recipient flies in 7ml bijou vials with a small amount of Lewis food on the lid for each treatment (heat-killed bacteria only and 5% sucrose exposed without live infection) and sex-combination. After 4-hours exposure we surface-sterilised and homogenized the flies and plated the homogenate to measure the presence or absence of P. rettgeri infection inside each recipient fly, as an indication of successful transmission of bacteria from the donors to the recipient flies. We also set up and plated flies in groups with no infection, to confirm that our measures of P. rettgeri prevalence reflected successful transmission from the donor flies.

Data analysis

All statistical analyses and graphics were carried out and produced in R (version 4.2.2) using the ggplot2, coxhz and lme4 packages [81–83], and all raw data and code is available at 10.5281/zenodo.7624084 [84] or in S1 Data. We analysed the survival data following systemic P. rettgeri infection with a mixed effects Cox model using the R package ‘coxme’ [82] for different treatment groups (that is, primed and unprimed) across both the sexes and fly lines (controls and transgenic lines). We specified the model as: survival ~ treatment * sex * (1|vials/block), with ‘treatment’ and ‘sex’ and their interactions as fixed effects, and ‘vials’ nested within each ‘block’ as a random effect for control and transgenic lines. We used ANOVA to test the impact of each fixed effect in the ‘coxme’ model. We analysed the bacterial load, measured as log10 bacterial colony-forming units (CFUs) at 24-hours following P. rettgeri infection. As bacterial load data was non-normally distributed, we log-transformed the data and analysed using a non-parametric one-way ANOVA (Kruskal-Wallis test) to test whether the ‘treatment’ groups that is, primed and unprimed individuals significantly differed in internal bacterial load for males and females of each fly lines (control and transgenic lines). Data for bacterial shedding and transmission were non-normally distributed (tested using Shapiro-Wilks test for normality) hence we performed non-parametric Wilcoxon Kruskal-Wallis tests for bacterial shedding and transmission data.

Supporting information

S1 Data. All data used to generate figures.

https://doi.org/10.1371/journal.ppat.1012308.s001

(XLSX)

S1 Fig.

Schematic representation of different priming experiments aimed at (I). testing whether the length of the period between primary heat-killed exposure and the secondary pathogenic challenge affects the extent of priming (II). how different lab-adapted control/genetic background flies vary in priming (III). dissecting the role of innate immune pathways (IMD and Toll) and inducible AMPs in immune priming and (IV). deciphering mechanisms that bring about immune priming in Drosophila using tissue-specific fat body and haemocytes UASRNAi mutants. The experimental design for priming assays includes survival and internal bacterial load quantification.

https://doi.org/10.1371/journal.ppat.1012308.s002

(TIFF)

S2 Fig. Experimental design to measure epidemiological components following systemic (OD600 = 1) and oral (OD600 = 25) priming and infection with initial heat-killed exposure followed by live P. rettgeri in male and female wildtype w1118 flies.

The assays include (I). survival following different infection routes (II). internal bacterial load (III). behavioural components of pathogen exposure such as sleep and awake activity (IV). bacteria shedding and (V). transmission. n = 6–7 vials of 8–12 flies in each vial, for each treatment and sex combination.

https://doi.org/10.1371/journal.ppat.1012308.s003

(TIFF)

S3 Fig. The effect of priming on fly locomotor activity.

Mean ±SE total locomotor activity for males and females (n = 52 individual flies per treatment), during first 72-hours following systemic and oral priming and infection. (A) average total locomotor activity (B) average awake activity and (C) proportion of flies spent sleeping.

https://doi.org/10.1371/journal.ppat.1012308.s004

(TIFF)

S4 Fig. Survival curves of w1118 and iso-w1118 (drosdel).

flies after initial heat-killed exposure and followed by live P. rettgeri infection with OD600 = 0.1. As another control, we infected both w1118 and iso-w1118 control because the CRISPR/cas9 AMP mutants we used were on the iso-w1118 background, so we wanted to confirm that any changes in priming were not due to the background of the mutants, as opposed to the mutations. We found that the differences between w1118 and iso-w1118 (primed and unprimed treatments) were not significantly different.

https://doi.org/10.1371/journal.ppat.1012308.s005

(TIFF)

S5 Fig. Diptericin expression in PGRP deletion lines.

24-hours after exposure to live P. rettgeri in male and female control w1118 flies and flies with loss-of-function in different PGRPs, PGRP-LB, PGRP-LC & -LE.

https://doi.org/10.1371/journal.ppat.1012308.s006

(TIFF)

S1 Table. Summary of mixed effects Cox model, fitting the model to estimate time-delayed priming response in control w1118 male and female flies.

https://doi.org/10.1371/journal.ppat.1012308.s007

(DOCX)

S2 Table. Summary of mixed effects Cox model, fitting the model to estimate priming response in different laboratory control w1118 male and female flies.

https://doi.org/10.1371/journal.ppat.1012308.s008

(DOCX)

S3 Table. Summary of mixed effects Cox model, fitting the model to estimate the impact Wolbachia on immune priming response using genetic background OreR male and female flies.

https://doi.org/10.1371/journal.ppat.1012308.s009

(DOCX)

S4 Table. Summary of mixed effects Cox model, fitting the model to estimate priming response in male and female control w1118 flies.

https://doi.org/10.1371/journal.ppat.1012308.s010

(DOCX)

S5 Table. Summary of log10 transformed bacterial load.

https://doi.org/10.1371/journal.ppat.1012308.s011

(DOCX)

S6 Table. Summary of Cox prop-hazard model, for female and male flies of wild type w1118.

https://doi.org/10.1371/journal.ppat.1012308.s012

(DOCX)

S7 Table. Summary of log transformed bacterial load data.

https://doi.org/10.1371/journal.ppat.1012308.s013

(DOCX)

S8 Table. Model outputs for statistical test (GLM) performed on host activity data.

https://doi.org/10.1371/journal.ppat.1012308.s014

(DOCX)

S9 Table. Summary of non-parametric Wilcoxon (Kruskal-Wallis) test for oral bacterial shedding (log transformed bacterial load).

https://doi.org/10.1371/journal.ppat.1012308.s015

(DOCX)

S10 Table. Summary of mixed effects Cox model, fitting the model to estimate priming response in male and female control w1118, IMD and toll transgenic flies.

https://doi.org/10.1371/journal.ppat.1012308.s016

(DOCX)

S11 Table. Summary of log10 transformed bacterial load data in amp deletion lines.

https://doi.org/10.1371/journal.ppat.1012308.s017

(DOCX)

S12 Table. Summary of mixed effects Cox prop-hazard in tissue-specific Dpt knockdown lines.

https://doi.org/10.1371/journal.ppat.1012308.s018

(DOCX)

S13 Table. Summary of log10 transformed Dpt gene expression data.

https://doi.org/10.1371/journal.ppat.1012308.s019

(DOCX)

S14 Table. Summary of mixed effects Cox model, fitting the model to estimate priming response in male and female PGRP mutant flies.

https://doi.org/10.1371/journal.ppat.1012308.s020

(DOCX)

S15 Table. Summary of log10 transformed bacterial load data after P. rettgeri infection.

https://doi.org/10.1371/journal.ppat.1012308.s021

(DOCX)

S16 Table. Summary of log10 transformed Dpt gene expression data in flies with different PGRP deletion transgenic flies.

https://doi.org/10.1371/journal.ppat.1012308.s022

(DOCX)

Acknowledgments

We thank Bruno Lemaitre’s lab for generating and generously sharing the CRISPR/Cas9 AMP transgenic lines. We thank Emily Robertshaw, Srijan Seal, Saubhik Sarkar and Pavan Thunga for laboratory assistance. We thank Sveta Chakrabarti and Ashworth fly group members for helpful discussion. Finally, we thank Angela Reid, Lucinda Rowe, James King and Alison Fulton for help with media preparation.

References

  1. 1. Pollard AJ, Bijker EM. A guide to vaccinology: from basic principles to new developments. Nat Rev Immunol. 2021;21: 83–100. pmid:33353987
  2. 2. Boehm T, Swann JB. Origin and Evolution of Adaptive Immunity. Annual Review of Animal Biosciences. 2014;2: 259–283. pmid:25384143
  3. 3. Hoffmann JA. The immune response of Drosophila. Nature. 2003;426: 33–38. pmid:14603309
  4. 4. Hultmark D. Drosophila immunity: paths and patterns. Current Opinion in Immunology. 2003;15: 12–19. pmid:12495727
  5. 5. Buchon N, Silverman N, Cherry S. Immunity in Drosophila melanogaster—from microbial recognition to whole-organism physiology. Nat Rev Immunol. 2014;14: 796–810. pmid:25421701
  6. 6. Prakash A, Khan I. Why do insects evolve immune priming? A search for crossroads. Dev Comp Immunol. 2022;126: 104246. pmid:34453994
  7. 7. Lanz-Mendoza H, Gálvez D, Contreras-Garduño J. The plasticity of immune memory in invertebrates. Journal of Experimental Biology. 2024;227: jeb246158. pmid:38449328
  8. 8. Milutinović B, Kurtz J. Immune memory in invertebrates. Seminars in Immunology. 2016;28: 328–342. pmid:27402055
  9. 9. Pham LN, Dionne MS, Shirasu-Hiza M, Schneider DS. A Specific Primed Immune Response in Drosophila Is Dependent on Phagocytes. Vernick K, editor. PLoS Pathog. 2007;3: e26. pmid:17352533
  10. 10. Ramirez JL, de Almeida Oliveira G, Calvo E, Dalli J, Colas RA, Serhan CN, et al. A mosquito lipoxin/lipocalin complex mediates innate immune priming in Anopheles gambiae. Nat Commun. 2015;6: 7403. pmid:26100162
  11. 11. Khan I, Prakash A, Agashe D. Divergent immune priming responses across flour beetle life stages and populations. Ecol Evol. 2016;6: 7847–7855. pmid:30128134
  12. 12. Moret Y, Siva-Jothy MT. Adaptive innate immunity? Responsive-mode prophylaxis in the mealworm beetle, Tenebrio molitor. Proceedings of the Royal Society of London Series B: Biological Sciences. 2003;270: 2475–2480. pmid:14667338
  13. 13. Fallon JP, Troy N, Kavanagh K. Pre-exposure of Galleria mellonella larvae to different doses of Aspergillus fumigatus conidia causes differential activation of cellular and humoral immune responses. Virulence. 2011;2: 413–421. pmid:21921688
  14. 14. Sadd BM, Schmid-Hempel P. Insect Immunity Shows Specificity in Protection upon Secondary Pathogen Exposure. Current Biology. 2006;16: 1206–1210. pmid:16782011
  15. 15. Little TJ, O’Connor B, Colegrave N, Watt K, Read AF. Maternal Transfer of Strain-Specific Immunity in an Invertebrate. Current Biology. 2003;13: 489–492. pmid:12646131
  16. 16. Gálvez D, Añino Y, Vega C, Bonilla E. Immune priming against bacteria in spiders and scorpions? PeerJ. 2020 [cited 2 Oct 2021]. pmid:32547885
  17. 17. Gomes FM, Silva M, Molina-Cruz A, Barillas-Mury C. Molecular mechanisms of insect immune memory and pathogen transmission. PLOS Pathogens. 2022;18: e1010939. pmid:36520682
  18. 18. Arch M, Vidal M, Koiffman R, Melkie ST, Cardona P-J. Drosophila melanogaster as a model to study innate immune memory. Frontiers in Microbiology. 2022;13. Available: https://www.frontiersin.org/articles/10.3389/fmicb.2022.991678
  19. 19. Apidianakis Y, Mindrinos MN, Xiao W, Lau GW, Baldini RL, Davis RW, et al. Profiling early infection responses: Pseudomonas aeruginosa eludes host defenses by suppressing antimicrobial peptide gene expression. Proceedings of the National Academy of Sciences. 2005;102: 2573–2578. pmid:15695583
  20. 20. Roth O, Kurtz J. Phagocytosis mediates specificity in the immune defence of an invertebrate, the woodlouse Porcellio scaber (Crustacea: Isopoda). Developmental & Comparative Immunology. 2009;33: 1151–1155. pmid:19416736
  21. 21. Bozler J, Kacsoh BZ, Bosco G. Maternal Priming of Offspring Immune System in Drosophila. G3 Genes|Genomes|Genetics. 2020;10: 165–175. pmid:31685524
  22. 22. Mondotte JA, Gausson V, Frangeul L, Blanc H, Lambrechts L, Saleh M-C. Immune priming and clearance of orally acquired RNA viruses in Drosophila. Nat Microbiol. 2018;3: 1394–1403. pmid:30374170
  23. 23. Mondotte JA, Gausson V, Frangeul L, Suzuki Y, Vazeille M, Mongelli V, et al. Evidence For Long-Lasting Transgenerational Antiviral Immunity in Insects. Cell Reports. 2020;33: 108506. pmid:33326778
  24. 24. Cabrera K, Hoard DS, Gibson O, Martinez DI, Wunderlich Z. Drosophila immune priming to Enterococcus faecalis relies on immune tolerance rather than resistance. PLoS Pathog. 2023;19: e1011567. pmid:37566589
  25. 25. Tate AT. A general model for the influence of immune priming on disease prevalence. Oikos. 2017;126: 350–360.
  26. 26. Tidbury HJ, Best A, Boots M. The epidemiological consequences of immune priming. Proceedings of the Royal Society B: Biological Sciences. 2012;279: 4505–4512. pmid:22977154
  27. 27. Tate AT. The Interaction of Immune Priming with Different Modes of Disease Transmission. Frontiers in Microbiology. 2016;7: 1102. pmid:27468283
  28. 28. Brownlie JC, Johnson KN. Symbiont-mediated protection in insect hosts. Trends in Microbiology. 2009;17: 348–354. pmid:19660955
  29. 29. Teixeira L, Ferreira Á, Ashburner M. The Bacterial Symbiont Wolbachia Induces Resistance to RNA Viral Infections in Drosophila melanogaster. PLOS Biology. 2008;6: e1000002. pmid:19222304
  30. 30. Gupta V, Vasanthakrishnan RB, Siva-Jothy J, Monteith KM, Brown SP, Vale PF. The route of infection determines Wolbachia antibacterial protection in Drosophila. Proc R Soc B. 2017;284: 20170809. pmid:28592678
  31. 31. Khan I, Prakash A, Agashe D. Pathogen susceptibility and fitness costs explain variation in immune priming across natural populations of flour beetles. Cotter S, editor. J Anim Ecol. 2019;88: 1332–1342. pmid:31131899
  32. 32. Siva-Jothy JA, Vale PF. Dissecting genetic and sex-specific sources of host heterogeneity in pathogen shedding and spread. PLOS Pathogens. 2021;17: e1009196. pmid:33465160
  33. 33. White LA, Siva-Jothy JA, Craft ME, Vale PF. Genotype and sex-based host variation in behaviour and susceptibility drives population disease dynamics. Proceedings of the Royal Society B: Biological Sciences. 2020;287: 20201653. pmid:33171094
  34. 34. Hanson MA, Dostálová A, Ceroni C, Poidevin M, Kondo S, Lemaitre B. Synergy and remarkable specificity of antimicrobial peptides in vivo using a systematic knockout approach. eLife. 2019;8: e44341. pmid:30803481
  35. 35. Shit B, Prakash A, Sarkar S, Vale PF, Khan I. Ageing leads to reduced specificity of antimicrobial peptide responses in Drosophila melanogaster. Proceedings of the Royal Society B. 2022; 2022.06.25.497570. pmid:36382522
  36. 36. Lemaitre B, Hoffmann J. The Host Defense of Drosophila melanogaster. Annu Rev Immunol. 2007;25: 697–743. pmid:17201680
  37. 37. Chakrabarti S, Visweswariah SS. Intramacrophage ROS Primes the Innate Immune System via JAK/STAT and Toll Activation. Cell Reports. 2020;33: 108368. pmid:33176146
  38. 38. Valanne S, Vesala L, Maasdorp MK, Salminen TS, Rämet M. The Drosophila Toll Pathway in Innate Immunity: from the Core Pathway toward Effector Functions. The Journal of Immunology. 2022;209: 1817–1825. pmid:36426939
  39. 39. Little TJ, Hultmark D, Read AF. Invertebrate immunity and the limits of mechanistic immunology. Nat Immunol. 2005;6: 651–654. pmid:15970937
  40. 40. Tate AT, Rudolf VHW. Impact of life stage specific immune priming on invertebrate disease dynamics. Oikos. 2012;121: 1083–1092.
  41. 41. Lemaitre B, Reichhart J-M, Hoffmann JA. Drosophila host defense: Differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proceedings of the National Academy of Sciences. 1997;94: 14614–14619. pmid:9405661
  42. 42. Wen Y, He Z, Xu T, Jiao Y, Liu X, Wang Y-F, et al. Ingestion of killed bacteria activates antimicrobial peptide genes in Drosophila melanogaster and protects flies from septic infection. Developmental & Comparative Immunology. 2019;95: 10–18. pmid:30731096
  43. 43. Ferro K, Peuß R, Yang W, Rosenstiel P, Schulenburg H, Kurtz J. Experimental evolution of immunological specificity. Proc Natl Acad Sci USA. 2019;116: 20598–20604. pmid:31548373
  44. 44. Greenwood JM, Milutinović B, Peuß R, Behrens S, Esser D, Rosenstiel P, et al. Oral immune priming with Bacillus thuringiensis induces a shift in the gene expression of Tribolium castaneum larvae. BMC Genomics. 2017;18: 329. pmid:28446171
  45. 45. Yi Y, Xu H, Li M, Wu G. RNA-seq profiles of putative genes involved in specific immune priming in Bombyx mori haemocytes. Infection, Genetics and Evolution. 2019;74: 103921. pmid:31207402
  46. 46. Bergin D, Murphy L, Keenan J, Clynes M, Kavanagh K. Pre-exposure to yeast protects larvae of Galleria mellonella from a subsequent lethal infection by Candida albicans and is mediated by the increased expression of antimicrobial peptides. Microbes and Infection. 2006;8: 2105–2112. pmid:16782387
  47. 47. Roesel CL, Rosengaus RB, Smith W, Vollmer SV. Transcriptomics reveals specific molecular mechanisms underlying transgenerational immunity in Manduca sexta. Ecology and Evolution. 2020;10: 11251–11261. pmid:33144962
  48. 48. Belmonte RL, Corbally M-K, Duneau DF, Regan JC. Sexual Dimorphisms in Innate Immunity and Responses to Infection in Drosophila melanogaster. Front Immunol. 2020;10: 3075. pmid:32076419
  49. 49. Klein SL, Flanagan KL. Sex differences in immune responses. Nat Rev Immunol. 2016;16: 626–638. pmid:27546235
  50. 50. Simon V. Wanted: women in clinical trials. Science. 2005;308: 1517–1518. Available: https://go.gale.com/ps/i.do?p=AONE&sw=w&issn=00368075&v=2.1&it=r&id=GALE%7CA133569531&sid=googleScholar&linkaccess= pmid:15947140
  51. 51. Duneau DF, Kondolf HC, Im JH, Ortiz GA, Chow C, Fox MA, et al. The Toll pathway underlies host sexual dimorphism in resistance to both Gram-negative and Gram-positive bacteria in mated Drosophila. BMC Biol. 2017;15: 124. pmid:29268741
  52. 52. Vincent CM, Dionne MS. Disparate regulation of IMD signaling drives sex differences in infection pathology in Drosophila melanogaster. Proceedings of the National Academy of Sciences. 2021;118: e2026554118. pmid:34341118
  53. 53. Prakash A, Monteith KM, Vale PF. Mechanisms of damage prevention, signalling, and repair impact disease tolerance. Proceedings of the Royal Society B. 2022; 2021.10.03.462916. pmid:35975433
  54. 54. Camus MF, Piper MD, Reuter M. Sex-specific transcriptomic responses to changes in the nutritional environment. Keller L, Eisen MB, Zajitschek F, editors. eLife. 2019;8: e47262. pmid:31436529
  55. 55. Martínez BA, Hoyle RG, Yeudall S, Granade ME, Harris TE, Castle JD, et al. Innate immune signaling in Drosophila shifts anabolic lipid metabolism from triglyceride storage to phospholipid synthesis to support immune function. Hietakangas V, editor. PLoS Genet. 2020;16: e1009192. pmid:33227003
  56. 56. Hudson AL, Moatt JP, Vale PF. Terminal investment strategies following infection are dependent on diet. Journal of Evolutionary Biology. 2020;33: 309–317. pmid:31705829
  57. 57. Contreras-Garduño J, Rodríguez MC, Rodríguez MH, Alvarado-Delgado A, Lanz-Mendoza H. Cost of immune priming within generations: trade-off between infection and reproduction. Microbes and Infection. 2014;16: 261–267. pmid:24291714
  58. 58. Trauer U, Hilker M. Parental Legacy in Insects: Variation of Transgenerational Immune Priming during Offspring Development. PLOS ONE. 2013;8: e63392. pmid:23700423
  59. 59. Zanchi C, Troussard J-P, Martinaud G, Moreau J, Moret Y. Differential expression and costs between maternally and paternally derived immune priming for offspring in an insect. Journal of Animal Ecology. 2011;80: 1174–1183. pmid:21644979
  60. 60. Prigot-Maurice C, Beltran-Bech S, Braquart-Varnier C. Why and how do protective symbionts impact immune priming with pathogens in invertebrates? Developmental & Comparative Immunology. 2022;126: 104245. pmid:34453995
  61. 61. Hedges LM, Brownlie JC, O’Neill SL, Johnson KN. Wolbachia and Virus Protection in Insects. Science. 2008;322: 702–702. pmid:18974344
  62. 62. Martinez J, Longdon B, Bauer S, Chan Y-S, Miller WJ, Bourtzis K, et al. Symbionts Commonly Provide Broad Spectrum Resistance to Viruses in Insects: A Comparative Analysis of Wolbachia Strains. PLOS Pathogens. 2014;10: e1004369. pmid:25233341
  63. 63. Rottschaefer SM, Lazzaro BP. No Effect of Wolbachia on Resistance to Intracellular Infection by Pathogenic Bacteria in Drosophila melanogaster. PLOS ONE. 2012;7: e40500. pmid:22808174
  64. 64. Rancès E, Ye YH, Woolfit M, McGraw EA, O’Neill SL. The Relative Importance of Innate Immune Priming in Wolbachia-Mediated Dengue Interference. PLOS Pathogens. 2012;8: e1002548. pmid:22383881
  65. 65. Chrostek E, Marialva MSP, Esteves SS, Weinert LA, Martinez J, Jiggins FM, et al. Wolbachia Variants Induce Differential Protection to Viruses in Drosophila melanogaster: A Phenotypic and Phylogenomic Analysis. PLOS Genetics. 2013;9: e1003896. pmid:24348259
  66. 66. Hedengren M, BengtÅsling , Dushay MS, Ando I, Ekengren S, Wihlborg M, et al. Relish, a Central Factor in the Control of Humoral but Not Cellular Immunity in Drosophila. Molecular Cell. 1999;4: 827–837. pmid:10619029
  67. 67. Levashina EA, Ohresser S, Lemaitre B, Imler JL. Two distinct pathways can control expression of the gene encoding the Drosophila antimicrobial peptide metchnikowin. J Mol Biol. 1998;278: 515–527. pmid:9600835
  68. 68. Sinenko SA, Mathey-Prevot B. Increased expression of Drosophila tetraspanin, Tsp68C, suppresses the abnormal proliferation of ytr-deficient and Ras/Raf-activated hemocytes. Oncogene. 2004;23: 9120–9128. pmid:15480416
  69. 69. Zettervall C-J, Anderl I, Williams MJ, Palmer R, Kurucz E, Ando I, et al. A directed screen for genes involved in Drosophila blood cell activation. PNAS. 2004;101: 14192–14197. pmid:15381778
  70. 70. Lewis E. A new standard food medium. 1960 Drosophila Information Service. in. Cold Spring Harb Protoc. 2014;2014: pdb.rec081414. https://doi.org/10.1101/pdb.rec081414
    • 71. Prakash A, Monteith KM, Vale PF. Negative regulation of IMD contributes to disease tolerance during systemic bacterial infection in Drosophila. bioRxiv. 2021; 2021.09.23.461574. https://doi.org/10.1101/2021.09.23.461574
      • 72. Prakash A, Monteith KM, Bonnet M, Vale PF. Duox and Jak/Stat signalling influence disease tolerance in Drosophila during Pseudomonas entomophila infection. Developmental & Comparative Immunology. 2023; 104756. pmid:37302730
      • 73. Siva-Jothy JA, Prakash A, Vasanthakrishnan RB, Monteith KM, Vale PF. Oral Bacterial Infection and Shedding in Drosophila melanogaster. JoVE. 2018; 57676. pmid:29912178
      • 74. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25: 402–408. pmid:11846609
      • 75. Pfeiffenberger C, Lear BC, Keegan KP, Allada R. Processing Sleep Data Created with the Drosophila Activity Monitoring (DAM) System. Cold Spring Harb Protoc. 2010;2010: pdb.prot5520. pmid:21041393
      • 76. Anderson L, Camus MF, Monteith KM, Salminen TS, Vale PF. Variation in mitochondrial DNA affects locomotor activity and sleep in Drosophila melanogaster. Heredity. 2022; in press. https://doi.org/10.1101/2021.10.30.464953
        • 77. Gupta V, Stewart CO, Rund SSC, Monteith K, Vale PF. Costs and benefits of sublethal Drosophila C virus infection. Journal of Evolutionary Biology. 2017;30: 1325–1335. pmid:28425174
        • 78. Siva-Jothy JA, Vale PF. Viral infection causes sex-specific changes in fruit fly social aggregation behaviour. Biology Letters. 2019;15: 20190344. pmid:31530113
        • 79. Vale PF, Jardine MD. Sex-specific behavioural symptoms of viral gut infection and Wolbachia in Drosophila melanogaster. Journal of Insect Physiology. 2015;82: 28–32. pmid:26301521
        • 80. Shaw PJ, Cirelli C, Greenspan RJ, Tononi G. Correlates of sleep and waking in Drosophila melanogaster. Science. 2000;287: 1834–7. pmid:10710313
        • 81. Wickham H. Ggplot2: elegant graphics for dataanalysis. New York, NY: Springer.; 2016. Available: https://mran.microsoft.com/snapshot/2015-02-16/web/packages/ggplot2/ggplot2.pdf
          • 82. Therneau T. Mixed Effects Cox Models. Mixed Effects Cox Models. CRAN repository; 2015. Available: https://repo.bppt.go.id/cran/web/packages/coxme/vignettes/coxme.pdf
            • 83. Bates D, Mächler M, Bolker B, Walker S. Fitting Linear Mixed-Effects Models using lme4. arXiv:14065823 [stat]. 2014 [cited 25 Sep 2021]. Available: http://arxiv.org/abs/1406.5823
              • 84. Prakash A, Vale P. Data and code for “The immune regulation and epidemiological consequences of specific immune priming in Drosophila.” Zenodo; 2023. https://doi.org/10.5281/zenodo.7624085