Identifying donors with broadly neutralizing antibody responses

We previously identified bnAbs against DENV1-4 [39] via secondary analyses of relatively few (~350) B cells from an existing scRNAseq dataset of bulk peripheral blood mononuclear cells (PBMCs). This dataset was generated in an unrelated study with the primary goal of identifying biomarkers of severe dengue [41] in a cohort of individuals with acute DENV or ZIKV infection [42,43]. Here, we initiated a new study to specifically leverage scRNAseq for bnAb discovery by focusing our analysis on B cells (instead of bulk PBMCs) from individuals whose serum broadly neutralized DENV1-4 and ZIKV (Fig 1). [42,43]. To identify such individuals, we screened longitudinal serum samples from 38 cohort participants for their ability to neutralize commonly used DENV1-4 and ZIKV strains in two independent experiments. S1 Fig summarizes the serum neutralization profile of cohort participants, along with demographic and clinical information. When tested at a single dilution, no serum sample reproducibly neutralized West Nile virus (WNV), a more distantly related flavivirus included as a control. In contrast, even at the earliest available time point (range: 0 to 7 days after fever onset), serum samples from 26/38 individuals inhibited infection by two or more DENV serotypes by >50% in both experiments (S1 Fig). This high prevalence of cross-serotype neutralizing activity likely reflects repeated DENV exposures, as confirmed by IgG avidity testing of these samples in prior studies [42,43]. In addition to broad neutralizing activity against DENV1-4, serum samples from 11/38 individuals reproducibly neutralized >50% infection by ZIKV.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Workflow to identify broadly neutralizing antibodies (bnAbs) from donor samples.

(A) Serum neutralization profile of 4 cohort participants chosen for downstream analysis based on potent neutralizing activity against DENV1-4 and ZIKV. The mean reciprocal serum dilution that neutralized 50% of virus infection (NT50) in 3 independent experiments is depicted as a heatmap with a darker color indicating greater potency according to the key. (B) B cells isolated from the peripheral blood mononuclear cells (PBMCs) of donors selected in (A) were processed for (C) single-cell RNA sequencing of both global gene expression (GEX) and B cell receptor (BCR)-specific libraries. (D) We analyzed BCR libraries using the software package partis [44], which groups antibodies into clonal families and infers their shared ancestry. (E) Antibody sequences most likely to encode broadly neutralizing antibodies (bnAbs) were bioinformatically downselected for functional characterization. (F) We recombinantly expressed selected antibodies as IgG1 and screened them for the ability to neutralize DENV1-4 and ZIKV. This figure was created with Biorender.com.

https://doi.org/10.1371/journal.ppat.1011722.g001

Mining broadly neutralizing antibody repertoires at the single B cell level

To discover monoclonal bnAbs, we chose 4 individuals with cross-flavivirus serum neutralizing activity, as confirmed by dose-response neutralization assays (Fig 1A). In addition to serum neutralization breadth and potency, these individuals were selected due to the availability of corresponding PBMCs at early time points during which bnAb responses were detected (within 11 days post-fever onset) (S1 Fig). We chose early time points to maximize our likelihood of detecting transiently circulating plasmablasts. This B cell subset undergoes a large expansion following acute DENV exposure [25,40,45–48] and often encodes neutralizing antibodies against multiple DENV serotypes and in some cases, ZIKV, after repeated exposures [25,27,28,39]. Moreover, unlike memory B cells, plasmablasts constitutively secrete antibodies so their antibody repertoire likely mimics that of contemporaneous serum.

We isolated CD19+ B cells from PBMCs of these 4 donors (Fig 1B) for scRNAseq of B cell receptor-specific and overall gene expression libraries (Fig 1C). We obtained a total of 25,293 paired heavy and light chain antibody coding sequences, with a mean of 6,323 per donor (range 4,644–9,249), comparable to previous studies that profiled antibody repertoires using this method [49–51]. To mine this rich repertoire for flavivirus bnAbs, we first grouped antibodies into clonally related sequences derived from the same rearrangement event (i.e. clonal families, Fig 1D) using partis [44]. We also used gene expression libraries to determine the B cell subset—naïve, memory, or plasmablast—from which antibody sequences were derived. These analyses allowed us to apply a set of criteria that we and others have found to predict antibody affinity and/or neutralizing activity (summarized in Fig 1E and detailed in Methods) to downselect antibodies for neutralization screens (Fig 1F). Briefly, we chose antibodies that were 1) from large clonal families with >2% somatic hypermutation, suggesting antigen-specific selection [39,51,52]; 2) encoded by plasmablasts as these are often broadly neutralizing [25,27,28,39]; and 3) most similar to their family’s amino acid consensus sequence, suggesting high affinity [53].

As shown in Fig 2A, the sizes of clonal families and the distributions of B cell subsets within these samples varied substantially. Samples from donors 001 and 012 were dominated by naive B cells that were not members of any clonal family we could discern. By contrast, samples from donors 002 and 014 were composed mostly of plasmablasts, including those in large (4–50 members) or very large (50+ members) clonal families. While most previous methods for antibody discovery have specifically enriched for IgG+ B cells [28,33–35], our scRNAseq-based approach was isotype-agnostic and recorded the native isotype of every sequenced antibody. Like the distributions of B cell subsets, we found that antibody isotype distribution varied by donor: antibodies in samples from donors 001 and 012 were mostly IgM while those from donors 002 and 014 were primarily IgG1 (Fig 2B). The isotype data were not used in our selection algorithm (Fig 1E), though we explored the role of isotype in antibody function, as described later.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Distribution of B cell subsets and antibody isotypes within clonal families.

Graphs depict the number of antibodies encoded (A) by distinct B cell subsets and (B) as various isotypes in clonal families of different sizes in each of the four donor samples analyzed. B cell subset and antibody isotype were determined by analysis of the cell’s transcriptome as captured by the gene expression library (see Methods and S4 Table for details). Only B cells for which a corresponding antibody sequence was observed in the B cell receptor library were included. “Undetermined” B cell subset indicates that the cell had too few reads or unique molecular identifiers to yield accurate gene expression information as analyzed by 10X Genomics Cell Ranger. “Undetermined” isotype indicates insufficient sequence coverage to determine the constant gene segment within the antibody.

https://doi.org/10.1371/journal.ppat.1011722.g002

Functional screens for broadly neutralizing antibodies

We performed screening in two rounds. In the first round, our goal was to identify clonal families encoding bnAbs. To do this, we selected 1–3 antibodies from each of ~20 clonal families per donor according to the above criteria (Fig 1E). These antibodies were recombinantly expressed initially as IgG1 by transfection of mammalian cells and the antibody-containing supernatant screened at a single dilution (1:10) for neutralization of DENV1-4, ZIKV, and West Nile Virus (WNV). As controls, we produced and screened previously published antibodies, EDE1-C10 [28,31] and CR4354 [54] in parallel. Consistent with their known specificities, EDE1-C10 broadly neutralized DENV1-4 and ZIKV, but not WNV, while CR4354 specifically neutralized WNV (S2A Fig). Although our downselected antibodies had little to no neutralizing activity (<50%) against WNV, several potently neutralized DENV and/or ZIKV (S2B–S2G Fig; antibodies screened in this first round are left aligned). The number and neutralization profile of clonal families encoding neutralizing antibodies against DENV and/or ZIKV varied by donor. For example, of 14 total families tested from donor 001 (S2B Fig), only two (F05, F07) encoded neutralizing antibodies: F05 displayed ZIKV-specific neutralization, while F07 neutralized DENV1-3 and ZIKV, but not DENV4. Similarly, of the 18 selected families from donor 012 only two (F12, F15) encoded neutralizing antibodies (S2C Fig). In contrast, almost all 25 families from donor 002 neutralized DENV1 and DENV3, and one (F09) broadly neutralized DENV1-4 and ZIKV (S2D Fig). Donor 014 antibodies displayed the broadest neutralization profile (S2E–S2G Fig): almost all 27 selected clonal families neutralized multiple serotypes of DENV and, in some cases, ZIKV with varying potencies. Of these, antibodies from two families (F05 and F09) neutralized DENV1-4 by a mean of 97% and one family (F25) neutralized DENV1-4 and ZIKV by a mean of 92%.

Having identified clonal families encoding bnAbs (bolded in S2B–S2G Fig), we initiated a second round of screening to identify additional bnAbs within those families. Antibodies screened in round two are italicized and indented in S2B–S2G Fig. In general, antibodies within a given family displayed similar neutralization breadth. For example, all 10 antibodies selected from family F07 of donor 001 neutralized DENV1, DENV2, DENV3, and ZIKV, but not DENV4 (S2B Fig). Similarly, all tested antibodies from donor 014 family F09 neutralized DENV1-4 but not ZIKV (S2F Fig), while 6/8 antibodies from family F25 broadly neutralized DENV1-4 and ZIKV (S2G Fig). These results demonstrate that our bioinformatics-based approach successfully identified clonal families encoding multiple bnAbs.

Functional characterization of the broadest neutralizing antibodies

Based on the above crude screens performed with transfection supernatant (S2 Fig), we purified 23 IgG1 antibodies that inhibited DENV1-4 and in some cases ZIKV by >50% for further characterization. All but one (F15.S01 from donor 012) of these antibodies were from donor 014. We confirmed their neutralizing activities in dose-response assays and calculated the concentration at which they inhibited 50% of virus infection (IC50) (S1 Table). As comparison, we expressed and tested previously identified bnAbs in parallel. These include: EDE1 [28,31] and SIgN-3C [27,37] antibodies, all of which potently neutralize DENV1-4 and ZIKV; EDE2 antibodies, which are distinguished from EDE1 by their weak potency against ZIKV [31]; MZ4, which neutralizes ZIKV and some DENV serotypes [33]; and J9, an antibody we previously isolated from a different donor in the same cohort, which potently neutralizes DENV1-4, but not ZIKV [39].

We assigned antibodies into two categories based on neutralization breadth: 1) those that neutralized DENV1-4 and ZIKV, and 2) those that neutralized DENV1-4 but not ZIKV. Antibodies in each category were ranked based on geometric mean IC50 (S1 Table). Among all category 1 antibodies tested, the top-ranking was F25.S02 from donor 014 (geometric mean IC50 value of 69 ng/mL). Compared to previously published category 1 bnAbs, the potency of F25.S02 against ZIKV was similar to EDE1-C10 (IC50 of 18 and 14 ng/ml, respectively) but was ~39 times higher than that of SIgN-3C (IC50 of 694 ng/ml). The geometric mean potency of F25.S02 against DENV1-4 was also ~2-fold higher than that of EDE1-C10 (IC50 of 96 ng/ml versus 207 ng/ml, respectively). Family F25 contained 3 other antibodies that broadly neutralized DENV1-4 and ZIKV. These antibodies (F25.S03, F25.S04, F25.S06) neutralized DENV1, DENV2, DENV3, and ZIKV with relatively similar potency as F25.S02, but they were less potent against DENV4 (IC50 > 1 μg/ml). Among newly identified category 2 antibodies, F09.S05 was most potent; its geometric mean IC50 against DENV1-4 was comparable to the previously identified J9 [39] (36 ng/ml and 33 ng/ml, respectively). Additional high-ranking category 2 antibodies include others from family F09 and antibody F05.S03 from family F05.

Even within the same donor, bnAbs were derived from multiple germline genes and did not display unusually high levels of somatic hypermutation (S2 Table), as has been reported for some bnAbs against other viruses [55, 56]. For subsequent detailed characterization, we chose the top-ranking antibody from each clonal family of donor 014, namely F25.S02, F09.S05, and F05.S03. Fig 3A shows representative dose-response neutralization assays demonstrating that these new bnAbs were roughly as potent as, and in some cases, more potent than previously published bnAbs (Fig 3B and S1 Table).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Neutralization profile of top bnAbs expressed as IgG1.

(A) Representative dose-response neutralization curves of each antibody against DENV1 WP-74, DENV2 16681, DENV3 CH53489, DENV4 TVP376, and ZIKV H/PF/2013 reporter virus particles performed in at least 3 biological replicates in duplicate wells. The data points and error bars represent the mean and range of the duplicates, respectively. (B) Mean IC50 values for antibody-virus pairs shown in (A) and compiled from S1 Table. *The final column displays the geometric mean IC50 values against neutralized viruses. (C) IC50 values against additional DENV variants selected due to known antigenic divergence from the panel in (B). Values shown are means from at least two biological replicates. (D) Mean IC50 values against fully infectious DENV clinical isolates from 2004–2007. Values were obtained from at least two biological replicates. *The final column displays the geometric mean IC50 of each antibody against the four viruses. In (B-D), IC50 values are displayed as heatmaps according to the key. Gray indicates that 50% neutralization was not observed at the highest antibody concentration tested (10,000 ng/ml).

https://doi.org/10.1371/journal.ppat.1011722.g003

Newly identified antibodies neutralize flavivirus antigenic variants

There is antigenic variation even within a given DENV serotype [57–59], which is composed of distinct genotypes [60,61]. For example, the DENV1 strain West Pac-74 (WP-74) used in the above screens belongs to genotype IV, which is the most antigenically distinct within this serotype [58]. Additionally, this DENV1 strain is thought to display altered structural dynamics that globally affect antigenicity [62,63]. To rule out the possibility that DENV1 inhibition we observed was limited to an unusually neutralization-sensitive strain, we confirmed that our novel bnAbs also potently neutralized the genotype II DENV1 strain 16007 (IC50 range of 4 to 30 ng/ml, Fig 3C). DENV4 also displays antigenic variation across genotypes (I and II) that circulate in humans [64,65]. Many of our newly identified lower-ranking antibodies neutralized the DENV4 genotype II TVP376 strain used in the above screens with modest potency (S1 Table). When tested against the DENV4 genotype I strain H241, we found that category 1, but not category 2 bnAbs retained neutralization potency (Fig 3C). This preferential neutralization of DENV4 genotype II by most antibodies is consistent with previous observations [65–68]. Among our top-ranking newly identified bnAbs, F25.S02 and F09.S05 neutralized DKE-121 (IC50 of 212 and 59 ng/ml, respectively), a recently described, highly divergent DENV4 strain [69–71], though F05.S03’s neutralization of this strain was relatively weak (IC50 of 4500 ng/ml) (Fig 3C).

Except for DKE-121, most strains used above were lab-adapted and isolated many decades ago (1956–1982). Additionally, most were tested as single-round infectious reporter virus particles (except for DENV4 H241, which was tested as a replication competent virus). Reassuringly, F25.S02, F09.S05, and F05.S03 also neutralized more contemporaneous, fully infectious DENV1-4 clinical isolates collected between 2004 and 2007 with geometric mean IC50 values lower than for the known bnAb EDE1-C10 but higher than SIgN-3C and J9 (Fig 3D).

Aside from genetic diversity, flavivirus antigenic variation can also arise from heterogeneous virion maturation states resulting from inefficient cleavage of prM, a chaperone for the E protein. Many but not all flavivirus-specific antibodies preferentially neutralize incompletely mature virions that retain prM on the surface [72–74]. Importantly, there is increasing evidence that the ability to neutralize the structurally mature form of flaviviruses is important for in vivo protection [75,76]. We tested the ability of our novel bnAbs to neutralize partially mature DENV2 or ZIKV produced either under standard conditions or in the presence of excess furin to enhance prM cleavage, resulting in more fully mature viruses [73] (S3 Fig). As controls, we included antibodies E60 and ZV-67, which poorly neutralize mature forms of DENV2 and ZIKV, respectively, resulting in a large fraction of non-neutralized virions even at high antibody concentrations (S3A Fig), consistent with previous studies [73,77,78]. In contrast to these control antibodies, F25.S02, F09.S05, and F05.S03 potently neutralized DENV2 regardless of maturation state (maximum IC50 fold change of 2.7) (S3A and S3B Fig). Moreover, F25.S02 was more potent against the mature form of ZIKV (15-fold decrease in IC50) (S3B Fig). We also observed preferential neutralization of mature ZIKV by known bnAbs EDE1-C10 and SIgN-3C (S3A and S3B Fig).

Overall, these results demonstrate that our new bnAbs can neutralize flavivirus antigenic variants arising from both genetic and structural heterogeneity that are relevant for vaccine efficacy [67,68,76], though the ability to broadly neutralize multiple DENV4 genotypes was restricted to F25.S02.

Mapping E protein determinants of antibody binding

Many potently neutralizing flavivirus antibodies target complex epitopes displayed optimally on virions and not on soluble monomeric E protein [79]. To determine the E protein oligomeric form recognized by our bnAbs, we performed ELISA to assess binding to soluble monomeric E protein or to virus particles of the prototype DENV2 16681 strain. Unlike antibody B10, which we previously showed to efficiently bind E proteins displayed in both contexts [39], F25.S02, F09.S05, and F05.S03 bound efficiently to E proteins displayed on virus particles only, similar to the known bnAb EDE1-C10 [28] (Fig 4A and 4B). These results suggest that our newly identified bnAbs preferentially recognize quaternary epitopes.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Determinants of E protein binding by bnAbs.

Relative binding efficiency of the indicated antibodies to (A) E protein monomers (B) or reporter virus particles of DENV2 16681 measured by ELISA. Results are from two independent experiments, each performed in duplicate wells. The absorbance of each duplicate, reported in arbitrary units (AU), was normalized to the wells that received positive control antibody B10 [39]. The HIV-specific antibody PGT121 [80] was used as a negative control. Data points represent the normalized means of each experiment and the bars represent the means of the two experiments. (C-F) DENV2 16681 E protein sites important for binding by antibody (C) F25.S02 or (E) F05.S03 are shown on the ribbon structure of the DENV2 E dimer (PDB: 1OAN) and labeled on one monomer. Sites in E domains I, II, and III are depicted in red, yellow, and blue, respectively. Bar graphs show the mean binding reactivity to individual alanine mutants that selectively impact (D) F25.S02 or (F) F05.S03 as a percentage of wildtype (WT) DENV2 E protein reactivity. Binding of control antibodies EDE1-C10 and J9 to these mutants was tested in parallel. Error bars show the range of binding reactivity from two independent experiments. The dotted line in (D-E) indicates 70% reduction in antibody binding activity to mutant compared to WT.

https://doi.org/10.1371/journal.ppat.1011722.g004

To identify E protein amino acid residues critical for binding, we screened antibodies against a shotgun alanine-scanning mutagenesis library of DENV2 prM/E proteins [39,81]. As controls, we included known bnAbs EDE1-C10 and J9. We identified alanine mutations that specifically reduced F25.S02 or F05.S03 binding by >70% relative to wild type DENV2 (Fig 4C–4F and S3 Table shows screen results against the entire library). Despite testing multiple conditions, we did not detect binding of F09.S05 to wild type DENV2 in this format.

For F25.S02, all E residues identified as important for binding were located in domain II (G78, L82, V97, I113, N242) with the exception of M6 in domain I (Fig 4C and 4D). Mutation at these residues minimally impacted binding by the known bnAb EDE1-C10, which retained 50–85% of wild type binding reactivity (Fig 4D). EDE1-C10 and F25.S02 are further distinguished by their dependence on K310A, which abolished binding by EDE1-C10, but not by F25.S02 (Fig 4F). Thus, although F25.S02 and EDE1-C10 display a similar neutralization profile against DENV1-4 and ZIKV, their binding determinants on DENV2 are distinct.

For F05.S03, we identified two clusters of mutations that were important for binding. The first, at E residues N153 and T155 in domain I, abolishes a potential N-linked glycosylation site and reduced binding efficiency by ~85% (Fig 4E and 4F). The presence of this potential N-linked glycosylation site has also been shown to be important for recognition by J9 [39] (Fig 4F) and by the EDE2 subclass of bnAbs [28], all of which potently neutralize DENV1-4, but not ZIKV (Fig 3). The second cluster, which is composed of residues V308, V309, and K310, is in domain III but is near the domain I N-linked glycosylation site (Fig 4E). Of these mutations, K310A also strongly reduced binding efficiency by J9 and EDE1-C10 (Fig 4F).

Mapping neutralization determinants

As F09.S05 neutralized DENV1-4 but not ZIKV, we screened neutralizing activity against a previously described DENV library encoding mutations at solvent accessible E residues that were identical or similar across representative DENV1-4 strains but different from ZIKV [39]. Specifically, amino acids at these E protein sites in DENV2 16681 were substituted with corresponding ZIKV H/PF/2013 amino acids individually or in combination to identify those that reduce antibody potency against DENV2 and thus comprise the neutralization epitope. We also tested a subset of DENV2 alanine mutations identified in the binding screen above to validate their role in neutralization.

Except for the K310A mutation in E domain III, which reduced F09.S05 potency by ~14-fold, mutations that strongly impacted F09.S05 neutralizing activity were in domain I (Fig 5A). Removing the potential N-linked glycosylation site through mutation at residue N153 or T155 abrogated neutralization, while the nearby V151T mutation reduced F09.S05 potency by ~50-fold. Combining V151T with H149S abolished neutralizing activity. These glycosylation site mutations also abolished neutralization by F05.S03 (Fig 5B) and J9 (Fig 5C), consistent with results from our binding screen above (Fig 4F) and our previous study with J9 [39]. In addition to these shared residues important for neutralization, we identified determinants that distinguished F09.S05 and F05.S03 from each other and from the previously characterized J9. For example, although the individual S145A and H149S mutations minimally impacted F09.S05 (Fig 5A) and J9 (Fig 5C) (maximum of 5-fold change in IC50), each mutation reduced F05.S03 neutralization potency by ~20-fold (Fig 5B). Moreover, the combination of K47T+F279S mutations in domain I minimally impacted F09.S05 and F05.S03 (< 4-fold IC50 change, Fig 5A and 5B), but reduced J9 potency by 76-fold (Fig 5C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. E protein residues critical for neutralization by bnAbs.

(Left panel) Bar graphs show the mean IC50 fold change against DENV2 16681 reporter virus particles encoding E protein variants relative to wild type (WT) DENV2 for antibodies (A) F09.S05, (B) F05.S03, (C) J9, (D) F25.S02, and (E) EDE1-C10. Sites in E domains I, II, and III are shown in red, yellow, and blue, respectively. Values of 1, >1, and <1 indicate no change, decreased sensitivity, and increased sensitivity of mutant relative to WT DENV2, respectively. Mean values were obtained from at least 2 independent experiments shown as individual data points in which WT and mutant DENV2 were tested in parallel. WT ZIKV H/PF/2013 (gray) was included as a control. Error bars indicate the standard deviation (n>2) or range (n = 2). In each graph, the dotted horizontal line represents a 4-fold IC50 change. (Right panel) For each bnAb, sites of mutations that reduced neutralization potency when tested either individually or in combination by > 4-fold are depicted as spheres on both monomers of the DENV2 E dimer subunit (PDB 1OAN).

https://doi.org/10.1371/journal.ppat.1011722.g005

In contrast to their effects on F09.S05, F05.S03, and J9, mutations at N153 and T155 increased neutralization potency of EDE1-C10 and F25.S02 by up to 50-fold (Fig 5D and 5E). Another shared feature between EDE1-C10 and F25.S02 is a reduced neutralization potency against the K47T+F279S double mutation in E domain I (36- and 14-fold IC50 increase, respectively, Fig 5D and 5E). However, there were distinct neutralization determinants for these bnAbs. Specifically, the I113A and N242A mutations in domain II each reduced F25.S02 potency by ~30-fold (Fig 5D) but minimally impacted EDE1-C10 neutralization (<4-fold IC50 change, Fig 5E). Conversely, the K310A mutation in domain III strongly reduced EDE1-C10 (~90-fold IC50 increase, Fig 5E) but not F25.S02 potency (0.7-fold IC50 change, Fig 5D). These results are consistent with the alanine binding screen (Fig 4D). Thus, despite some similarities, we identified E residues that differentially impacted neutralization by newly discovered bnAbs relative to each other and to known bnAbs, suggesting they have distinct epitope specificities.

Effect of antibody valency on neutralizing activity

To gain additional insight into the epitope specificities, we compared the neutralization potency of F25.S02, F09.S05, and F05.S03 tested as bivalent IgG1 or monovalent Fab against DENV2 and ZIKV (S4 Fig). Except for F09.S05, the Fab versions of all antibodies tested, including known bnAb controls EDE1-C10 and SIgN-3C, failed to neutralize DENV2 by at least 50% at the highest antibody concentration tested (400 nM), suggesting that bivalent engagement is important for potent DENV2 neutralization by these antibodies [82]. Although SIgN-3C IgG1 neutralized ZIKV with moderate potency, no neutralization was detected with Fab, consistent with previous findings [37]. In contrast, EDE1-C10 and F25.S02 retained the ability to completely neutralize ZIKV as Fab. Although IgG1 versions of EDE1-C10 and F25.S02 neutralized ZIKV with similar potency, their Fab neutralization profiles were more distinct; unlike EDE1-C10 Fab, which retained relatively potent neutralization consistent with previous findings (<10-fold increase in IC50 compared to IgG) [82], F25.S02 neutralized ZIKV with much reduced potency as Fab (64-fold increase in IC50 compared IgG). These results suggest that EDE1-C10, SIgN-3C, and F25.S02 target distinct epitopes on ZIKV.

Neutralizing activity of IgA1 antibodies is similar to or better than IgG1 versions

As neutralizing activity is traditionally thought to be dependent mainly on changes within the antibody variable region, neutralizing antibodies have typically been tested as the IgG1 subclass, regardless of their native isotype [83]. Moreover, most studies profiling the neutralizing antibody repertoire against flaviviruses have specifically isolated IgG antibodies [28,33–35,40,45]. While we did not bias our scRNAseq-based approach towards a particular antibody isotype, we initially expressed and screened all antibodies as IgG1, similar to previous studies. Given increasing evidence that antibody Fc isotype can impact neutralizing activity against many viruses [84–89], we used scRNAseq data to confirm that the native isotype of almost all 23 antibodies downselected for detailed characterization was indeed IgG1 (S2 Table). However, unlike other flavivirus bnAbs described here or previously, our top-ranking bnAb, F25.S02, was derived from the IgA1 isotype.

To investigate the impact of isotype on neutralizing activity, we expressed F25.S02, EDE1-C10, and SIgN-3C as monomeric or dimeric IgA1 and compared their neutralization profile to IgG1 versions. Although we purified IgA1 dimers by size-exclusion chromatography (SEC), we could not exclude the presence of higher order polymers [90] by SDS-PAGE analysis (S5 Fig) so we refer to these antibodies as polymeric IgA1 hereafter.

As shown in Fig 6, all 3 bnAbs retained neutralization breadth and potency as monomeric IgA1. Moreover, while F25.S02 monomeric IgA1 and IgG1 displayed comparable potency against DENV1-4 and ZIKV (maximum of 2-fold IC50 change), monomeric IgA1 versions of EDE1-C10 and SigN-3C were more potent against some viruses (Fig 6B). For example, compared to their IgG1 versions, EDE1-C10 and SigN-3C monomeric IgA1 antibodies were ~4 times more potent against DENV3, though sample sizes (n = 3) were too small to achieve statistical significance. SigN-3C potency against ZIKV was also 9 times higher as monomeric IgA1 compared to IgG1.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Neutralization profile of antibodies expressed as IgA1.

(A) IgG1 (open circles), monomeric IgA1 (blue circles), and polymeric IgA1 (orange circles) versions of F25.S02 (top row), EDE1-C10 (middle row), and SigN-3C (bottom row) were tested for their ability to neutralize DENV1 WP-74, DENV2 16681, DENV3 CH53489, DENV4 TVP376, and ZIKV H/PF/2013 reporter virus particles. Dose-response curves are representative of 3 independent experiments, each tested in duplicate wells. Data points and error bars represent the mean and range of the duplicates, respectively. (B) Comparison of IC50 values of F25.S02 (left), EDE1-C10 (middle), SigN-3C (right) expressed as IgG1, monomeric IgA1, and polymeric IgA1 against the viruses indicated on the x-axes. Color scheme is similar to (A). Each data point represents an independent experiment in which antibody isotypes were tested in parallel. Horizontal bars indicate the mean. Error bars represent the standard error of the mean.

https://doi.org/10.1371/journal.ppat.1011722.g006

Antibody expression as polymeric IgA1 further increased potency compared to IgG1 to varying extents. This effect was most apparent for viruses against which the IgG1 version of the particular antibody was the least potent; for F25.S02, EDE1-C10 and SigN-3C polymeric IgA1, the largest IC50 reduction compared to IgG1 was observed against DENV2 (20-fold), DENV3 (9-fold), and ZIKV (167-fold), respectively (Fig 6B). This increased potency of IgA1 bnAbs is unlikely due to non-specific effects as none neutralized the more antigenically distant WNV (Fig 6A).

IgA1 antibodies inhibit enhancement of infection by IgG1

Virtually all IgG antibodies can enhance flavivirus infection in vitro at sub-neutralizing concentrations, presumably by facilitating uptake of IgG-virus complexes into FcɣR-expressing cells [91]. Accordingly, IgG1 versions of newly and previously identified bnAbs enhanced infection to various extents in K562 cells (S6A Fig) commonly used to study ADE as they express FcɣRIIa (S7 Fig) and are poorly permissive to flavivirus infection in the absence of IgG [92]. We did not detect enhancement of ZIKV infection by J9, F09.S05, and F05.S03 (S6A Fig). As IgG-bound, but not naked virions efficiently infect K562 cells, this finding suggests an inability for these antibodies to bind ZIKV, which could explain their lack of ZIKV neutralizing activity (Fig 3A and 3B).

As existing studies of ADE of viral infection or disease have focused on the role of IgG-FcɣR interactions [12,17,21,93–95], we next investigated the role of IgA in enhancing DENV infection. We first tested the ability of monomeric IgA1 versions of F25.S02, EDE1-C10, and SIgN-3C to enhance infection of DENV in K562 cells. For these experiments, we chose DENV1 and DENV4 as the infectivity curves obtained across the concentration range of IgG1 versions of bnAbs of interest fully captured both enhancement and neutralization in K562 cells (S6A Fig). As expected, IgG1 but not IgA1 versions of F25.S02, EDE1-C10, and SIgN-3C enhanced DENV infection in K562 cells (S6B Fig), which do not express Fc alpha receptor (FcɑRΙ) (S7 Fig).

We next investigated ADE in U937 monocytic cells, which express FcɑRI in addition to FcɣRIIa (S7 Fig) [96,97]. For these experiments, we used a concentrated preparation of DENV2 as we observed relatively inefficient IgG1-mediated ADE in U937 compared to K562 cells. Although we obtained the canonical dose-response ADE curve using IgG1 versions of bnAbs, neither monomeric nor polymeric IgA1 antibodies enhanced DENV infection in U937 monocytes (Fig 7A). Moreover, competitive ADE assays using mixtures of IgG1 and monomeric IgA1 antibodies at various ratios demonstrated that autologous IgA1 antibodies inhibited IgG1-mediated ADE of DENV infection in U937 cells (Fig 7B) in a dose-dependent manner (Fig 7C). This effect was also observed for all three bnAbs in K562 cells (S6B Fig), indicating that IgA1 antibodies can interfere with IgG1-mediated ADE in multiple cell types regardless of native isotype and epitope specificity. Crucially, an isotype control IgA1 antibody had virtually no effect on ADE mediated by IgG1 in U937 (Fig 7B and 7C) or K562 (S6B Fig) cells, indicating that inhibition was due neither to a reduction in IgG1 concentration in IgG1/IgA1 mixtures nor the presence of non-specific IgA1. Rather, IgA1 inhibited ADE mediated by IgG1 likely via direct competition of binding to virions.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Effect of antibody isotype on antibody dependent enhancement (ADE) of infection of U937 monocytes.

(A) DENV2 16681 reporter virus particles were pre-incubated with serial dilutions of IgG1 (filled circles), monomeric IgA1 (open circles), or polymeric IgA1 (open squares) forms of F25.S02 (blue), EDE1-C10 (orange), or SIgN-3C (green) prior to infection of U937 cells, which express Fc receptors for both IgG and IgA. IgG1 and IgA1 antibodies were tested individually in the assay. (B) Competitive ADE assays in U937 monocytes. F25.S02 (top row, blue), EDE1-C10 (middle row, orange) or SIgN-3C (bottom row, green) IgG1 was mixed with either autologous IgA1 (left panel, solid lines) or an IgA1 isotype control (right panel, dashed lines) at the indicated ratios by mass before serial dilution and pre-incubation with concentrated DENV2 16681 reporter virus particles. The assay was performed in two independent experiments, each in duplicate wells. The data points and the error bars represent the means and the range of the duplicates, respectively, from one representative experiment. (C) Area under the curve analysis for experiments represented in (B). For both biological replicates the area of the curve for each infection condition was calculated and normalized to infection in the 100% IgG1 condition. The data points and error bars represent the mean and the range of two independent experiments, respectively.

https://doi.org/10.1371/journal.ppat.1011722.g007

Ethics statement

The study’s use of samples from human donors with acute DENV and/or ZIKV infection was approved by the Stanford University Administrative Panel on Human Subjects in Medical Research (Protocol #35460) and the Fundación Valle del Lili Ethics committee in biomedical research (Cali, Colombia). All participants, their parents, or legal guardians provided written informed consent, and subjects 6 years of age and older provided assent.

Cohort samples

We collected blood samples from individuals who presented with symptoms compatible with dengue between 2016 and 2017 to the Fundación Valle del Lili in Cali, Colombia. Each blood sample was centrifuged to separate serum and peripheral blood mononuclear cells (PBMCs). Sera was stored at -80°C and corresponding PBMCs were cryopreserved and stored in liquid nitrogen. Cohort details have been previously described [41,42].

Cell lines

ExpiCHO-S Cells (Cat# A29127; ThermoFisher Scientific, Waltham MA) were cultured in ExpiCHO Expression Medium (Cat# A2910001; ThermoFisher Scientific) and maintained at 37°C in 8% CO2 on a platform rotating at 125 rpm with a rotational diameter of 19 cm. They were subcultured according to the manufacturer’s instructions. HEK-293T/17 cells (Cat# CRL-11268, ATCC, Manassas, VA) and Vero-C1008 cells (Cat# CRL-1586, ATCC) were maintained in DMEM (Cat# 11965118; ThermoFisher Scientific) supplemented with 7% fetal bovine serum (FBS) (Cat# 26140079, lot 2358194RP, ThermoFisher Scientific) and 100 U/mL penicillin-streptomycin (Cat# 15140–122; ThermoFisher Scientific). Raji cells stably expressing DCSIGNR (Raji-DCSIGNR) [135] (provided by Ted Pierson, NIH), K562 cells (Cat# CCL-243, ATCC), and U937 cells (Cat# CRL-1593.2, ATCC) were maintained in RPMI 1640 supplemented with GlutaMAX (Cat# 72400–047; ThermoFisher Scientific), 7% FBS and 100 U/mL penicillin-streptomycin. C6/36 cells (Cat# CRL-1660, ATCC) were maintained in EMEM (Cat# 30–2003, ATCC) supplemented with 10% FBS at 30°C in 5% CO2. All cell lines were maintained at 37°C in 5% CO2 unless otherwise stated.

Preparation of cells for single-cell RNA sequencing

Cryopreserved PBMCs were thawed quickly in a 37°C water bath and transferred to a 50 mL conical tube. Thirty mL of RPMI 1640 supplemented with 10% FBS (no antibiotics) was added to the cells dropwise while gently swirling. Cells were counted and CD19+ B cells were isolated using the EasySep Human Pan-B cell enrichment kit (Cat# 19554, StemCell Technologies, Vancouver, Canada) according to the manufacturer’s instructions. The resulting cells were incubated in a cocktail containing a live/dead stain (Cat# L34957, Thermo Scientific) and fluorescently labeled antibodies for CD20-eFluor450 (Cat# 48-0209-42, Invitrogen, Waltham, MA), CD38-FITC (Cat# 303504, Biolegend, San Diego, CA), CD27-PE-Cy7 (Cat# 25-0271-82, Invitrogen), CD19-APC (Cat# 555415, BD Biosciences, Franklin Lakes, NJ), CD3-APC-Cy7 (Cat# 300318, Biolegend), CD8-APC-Cy7 (Cat# 344714) and CD14-APC-Cy7 (Cat# 301820) for 30 min at 4°C. Stained cells were washed twice in FACS wash buffer (10% FBS in PBS) and strained through FACS tubes with strainer caps (Cat# 352235, BD Biosciences). The cells were analyzed on a BD FACS Aria flow cytometer to assess the purity of B cells (CD19+) and determine the fraction of cells that were plasmablasts (CD3^-, CD8^-, CD14^-, CD19 ^{mid to hi}, CD20^-, CD27⁺, CD38⁺). In pilot experiments, we found that when we sorted samples with fewer than 30,000 plasmablasts, we had difficulty recovering enough cells to achieve the required density and volume for subsequent processing on the 10X Genomics chip. We therefore chose to enrich plasmablasts by FACS only if the sample met two criteria: 1) the fraction of B cells that were plasmablasts was <10%, and 2) the total number of plasmablasts in the sample was > 30,000. Based on these criteria, only one donor’s sample (002) was enriched for plasmablasts via FACS; magnetically enriched CD19+ B cells from the remaining samples (001, 012, 014) were processed for scRNAseq without further enrichment.

The cells were prepared for RNA library generation using the Chromium Next GEM Single Cell 5’ Library and Gel Bead Kit v1.1 (Cat# PN-1000167, 10X Genomics, Pleasanton, CA) according to the manufacturer’s instructions. A library enriched for variable regions of B cell receptors (BCR library) was generated using the Chromium Single Cell V(D)J Enrichment Kit, Human B Cell (Cat# PN-1000016, 10X Genomics) and the global gene expression library (GEX library) was generated using the Chromium Single Cell 5’ Library Construction Kit (Cat# PN-1000020, 10X Genomics), both according to the manufacturer’s instructions. Both libraries from the sample from donor 014 (D014) were sequenced on an Illumina HiSeq. The libraries for the samples D001 (donor 001), D002 (donor 002), and D012 (donor 012) were sequenced on an Illumina NovaSeq 6000. Sequencing data were demultiplexed and aligned to the human transcriptome GRCh38-2020-A using cellranger (10X Genomics) version 5.0.1 (D001, D002, D012) or 5.0.0 (D014), which also identified the isotype of each antibody. The “filtered” cellranger output was then passed to partis for paired heavy/light chain clustering and annotation with default parameters [44]. This included the default partis disambiguation of incomplete and ambiguous heavy/light pairing information, which for instance resolved an atypically large number of droplets in D014 with reads from more than one cell. After grouping all sequences from an individual donor into clonal families, partis estimated the V, D, and J gene segments that composed the naive antibody sequence. B cell subtypes were identified using previously described gene markers [49] in the AUCell package (1.12.0). Isotype annotations were taken from the cellranger output.

Selection of candidate bnAbs from single-cell RNA sequencing data

The variable regions of the paired heavy and light chain sequences were grouped into clusters based on inferred shared ancestry (clonal families) using partis. This method first groups together sequences stemming from the same rearrangement event for each chain separately, using a combination of inferred ancestral sequences and likelihood calculation with hierarchical agglomeration. It then refines these clusters using heavy/light chain pairing information. Further details are described in [51]. B cell isotype was determined by aligning sequences to known constant region genes, and selecting the best match. B cell subtype was determined from gene expression data by using the AUCell package [136] to categorize each cell’s expression profile by similarity to a set of reference genes that are highly up or downregulated for each subtype (gene sets in S4 Table). For the first round of screening intended to find families that encode bnAbs, we selected the largest clonal families from each donor excluding those in which the mean somatic hypermutation (measured by nucleotide sequence) was below 2%. Within the selected families we selected 1–2 sequences that had the lowest Hamming distance to consensus (i.e. the sequence consisting of the most common amino acid present at each position), excluding those that were not encoded by plasmablasts. The selected antibodies were screened for their ability to neutralize DENV1-4 and ZIKV (described below) and those that neutralized >50% of infection of 3 or more viruses were considered “hits”. We initiated a second round of screening of antibodies from clonal families that had produced hits in the first round. Within each family we selected antibodies in ascending order of Hamming distance to the consensus, again excluding those that were not encoded by plasmablasts.

Expression of recombinant antibodies

Heavy and light chain constructs for recombinant MZ4 IgG1 expression have been described previously [33] and were provided by Shelly Krebs (Walter Reed Army Institute of Research). For other antibodies, heavy and light chain variable regions were synthesized (Twist Bioscience, South San Francisco, CA). Variable region sequences for newly identified antibodies were obtained from our scRNAseq data; those for control antibodies were determined based on the protein database (PDB) entries 4UT9 (EDE1-C10), 4UTA (EDE1-C8), 4UT6 (EDE2-B7), 4UTB (EDE2-A11), 7BUD (SIgN-3C), and 3N9G (CR4354) and codon-optimized for gene synthesis. All variable regions were cloned into the expression vectors provided by Patrick Wilson (University of Chicago): AbVec-hIgG1 (GenBank accession # FJ475055), AbVec-hIgKappa (GenBank accession# FJ475056) and AbVec-hIgLambda (GenBank accession # FJ517647), respectively. The variable regions were synthesized with adaptor sequences overlapping their respective vectors. The adaptor sequence that was appended to the 5’ end was the same for all vectors: TAGTAGGAACTGCAACCGGTT. The sequence appended to 3’ ends was specific to each vector: for AbVec heavy: CGGTCGACCAAGGGCCCATCGG, for AbVec kappa: CGTACGGTGGCTGCACCATC, and for AbVec lambda: GGTCAGCCCAAGGCCAACCCCACTGTCACTCTGTTCCCACCCTCGAGTGAGGAGCTTCAAGC. Heavy, kappa, and lambda vectors were linearized by digestion with SalI/AgeI, BsiWI/AgeI, and XhoI/AgeI, respectively as described [137]. Synthesized fragments and linearized vectors were ligated using NEBuilder HiFi DNA Assembly Master Mix (Cat# E2612L, New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions.

IgA1 heavy chains were generated by cloning the variable regions of selected antibodies into the expression vector pFUSEss-CHIg-hA1 (Cat# pfusess-hcha1, Invivogen, San Diego, CA). Variable regions of the antibody coding sequences were PCR amplified using the IgG1 heavy chain expression plasmid as a template and custom primers that appended an EcoRI site and an NheI site at the 5’ and 3’ ends respectively. Primer sequences were as follows: for F25.S02 GTACACGAATTCGCAGGTGCAGCTGGTGC (forward) and GACTCTGCTAGCTGAGGAGACGGTGACC (reverse); for EDE1-C10 GTACACGAATTCGGAGGTCCAACTTGTTG (forward) and GACTCTGCTAGCAGAGCTTACGGTTACG (reverse); and for SIgN-3C GTACACGAATTCGGAAGTACAACTGGTGC (forward) and GACTCTGCTAGCTGAACTAACAGTTACCAG (reverse). The PCR amplicons and the vector were digested with EcoRI and NheI and the resulting fragments were ligated using T7 DNA ligase (Cat# M0318, New England Biolabs).

All AbVec antibody expression plasmids (IgG1-heavy, kappa, and lambda) were confirmed by Sanger sequencing (Fred Hutch Genomics Core) using the primer “AbVec sense”: GCTTCGTTAGAACGCGGCTAC. IgA1 expression plasmids were confirmed by whole plasmid nanopore sequencing (Plasmidsaurus, Eugene, OR). To produce IgG1 and monomeric IgA1, heavy and light chain expression vectors were co-transfected into cultures of ExpiCHO-S cells at 0.8 ng/mL total DNA concentration at 1:1 mass ratio using OptiPro serum free medium (Cat#12309, Gibco) and Expifectamine CHO Transfection Kit (Cat# A29130, Gibco) according to the manufacturer’s instructions. To produce IgA1 dimers, plasmids encoding heavy, light, and joining chain (Cat# pUNO4-hJCHAIN, InvivoGen) were co-transfected at 0.8 ng/mL total DNA concentration at 1:1:1 mass ratio using the same medium and transfection reagents. Supernatant containing secreted antibodies was collected 8 days post transfection, centrifuged at 3220 x g for 10 minutes and filtered through a 0.45 μm Steriflip filter (Cat# SE1M003M00, Millipore-Sigma).

Purification of antibodies

Recombinant IgG1 produced in transfected ExpiCHO-S cells was purified using MabSelect Sure LX protein A agarose beads (Cat# 17-5474-01, Cytiva Life Sciences, Marlborough, MA) according to the manufacturer’s instructions. Recombinant IgA1 produced in ExpiCHO-S cells as described above was purified using protein M agarose beads (Cat# gel-pdm-2, InvivoGen US) according to the manufacturer’s instructions. IgA1 multimers were separated from monomers via size exclusion chromatography on a HiLoad 16/600 Superdex 200 pg column using 70 mL PBS as the eluate. A monomeric IgA1 antibody (Cat# 31148, ThermoFisher) was used as a standard for SDS-PAGE and as a negative control for ADE assays as indicated.

The hybridoma D1-4G2-4-15, which expresses the antibody 4G2, was obtained from ATCC (Cat# HB-112). The hybridoma was expanded and IgG was purified from culture supernatant by the Fred Hutchinson Cancer Center Antibody Technology Core. The purified antibody was conjugated to APC using the Lighting-Link APC-conjugation kit (Cat# ab201807, Abcam) according to the manufacturer’s instructions and used to detect intracellular E protein in assays using fully infectious DENV. Unconjugated, purified 4G2 antibody was used in ELISA experiments.

ELISA to quantify antibodies

96 well absorbent plates (Cat# 3361, Corning Inc.) were coated overnight with 50 μL/well of 25 mg/mL goat antibody raised against human IgG, IgA, and IgM (Cat# I1761 Sigma-Aldrich). The next day wells were washed with 200 μL wash buffer (0.1% Tween-20 in PBS) and blocked with 200 μL of 3% nonfat milk in PBS for 1 hour. Wells were washed once in wash buffer and 50 μL of sample was added to each well. Samples were incubated for 2 hours at room temperature on a rocker. After incubation, wells were washed 3 times in wash buffer, followed by addition of 50 μL of peroxidase-conjugated goat anti-human IgG secondary antibody (Cat# A0170, ThermoFisher) diluted 1:50,000. The secondary antibody was incubated for 1 hour at room temperature on a rocker. Wells were washed 3 times in wash buffer, received 50 μL of TMB (Cat# 34028, ThermoFisher), and were incubated at room temperature until a color change was apparent. The reaction was stopped with 50 μL of 1N HCl and absorbance at 450 nm was read on SpectraMax i3x plate reader (Molecular Devices). The IgG1 concentrations of unknown samples were measured by comparison to wells containing known concentrations of purified CR4354 IgG1.

Production of single-round infectious reporter virus particles

Reporter virus particles of DENV1, DENV2, ZIKV, and WNV were produced by co-transfection of HEK-293T/17 cells with (i) a plasmid expressing a WNV subgenomic replicon encoding GFP in place of structural genes [138], and (ii) a plasmid encoding C-prM-E structural genes from the following viruses: DENV1 Western Pacific-74 (WP-74) [139], DENV1 16007 [140], DENV2 16681 [139], DKE-121 [71], WNV NY99 [138], and ZIKV H/PF/2013 [141]. Briefly, 8 x 10^5 HEK-293T/17 cells were plated in each well of a 6-well plate, The following day each well was co-transfected with 1 μg of replicon-encoding plasmid and 3 μg of C-prM-E-encoding plasmid using Lipofectamine 3000 (Cat# L3000-015; ThermoFisher Scientific) according to the manufacturer’s instructions. Four hours post-transfection, media was replaced with low-glucose DMEM (Cat# 12320–032; ThermoFisher Scientific) containing 7% FBS and 100 U/mL penicillin-streptomycin (i.e. low-glucose DMEM complete) and cells were transferred to 30°C in 5% CO2. Virus-containing supernatant was harvested twice per day at days 3 through 8 post-transfection and centrifuged at 700 x g for 5 min. The clarified supernatant was passed through a 0.45 μm Steriflip filter (Cat# SE1M003M00, Millipore-Sigma, St. Louis, MO), pooled, aliquoted, and stored at -80°C. Reporter virus particles with increased efficiency of prM cleavage were produced as above by co-transfecting plasmids encoding the replicon, structural genes, and human furin (provided by Ted Pierson, NIH) at a 1:3:1 mass ratio.

Reporter virus particles of DENV3 strain CH53489 (Cat# RVP-301; Integral Molecular, Philadelphia, PA) and DENV4 strain TVP376 (Cat# RVP-401; Integral Molecular) were obtained commercially and were produced by co-transfection of the DENV3 or DENV4 CprME plasmid with the DENV2 strain 16681 replicon as previously described [142].

For the RVP binding ELISA described below ELISA (Fig 4A and 4B) and ADE experiments in U937 cells (Fig 7), DENV2 16681 reporter virus particles were concentrated 100X by ultracentrifugation through 20% sucrose at 166,880 x g for 4 hr at 4°C, resuspended in 1/100 volume of HNE buffer (5 mM HEPES, 150 mM NaCl, 0.1 mM EDTA, pH 7.4), and stored at -80°C.

Infectious titers of reporter viruses were determined by infection of Raji-DCSIGNR cells using 2-fold serial dilutions of virus stocks. At 2 days post-infection, cells were fixed in 2% paraformaldehyde (Cat# 15714S; Electron Microscopy Sciences, Hatfield, PA), and %GFP positive cells quantified by flow cytometry (Intellicyt iQue Screener PLUS, Sartorius AG, Gottingen, Germany).

Generation of E protein variants

Construction of DENV2 16681 reporter virus variants in which E protein sites were substituted with corresponding ZIKV H/PF/2013 amino acid residues individually or in combination have been previously described [39]. Here, we used similar methods to generate individual alanine mutations. Specifically, the DENV2 16681 CprME expression construct [139] was used as a template for Q5 site-directed mutagenesis (Cat# E0554S; New England Biolabs, Ipswich, MA) and primers generated by NEBaseChanger (New England Biolabs, Ipswich, MA). The entire plasmid was sequenced (Plasmidsaurus, Eugene, OR) to confirm the presence of the desired mutation(s) only.

E protein and reporter virus particle binding ELISA

Nunc 384-Well Clear Polystyrene Plates (Cat# 164688 ThermoFisher) were coated with 20 μL/well of recombinant E monomers (Cat#DENV2-ENV, Native Antigen Co, Kidlington, United Kingdom) at 3 μg/mL or 20 μL/well of antibody 4G2 at 50 μg/mL overnight. The next day plates were washed once with 50 μL wash buffer (0.05% Tween-20 in PBS) and blocked with 50 μL of blocking buffer (3% nonfat milk, Cat# 20–241 Apex Bioresearch products, in PBS) at 37°C for 45 min. Blocking buffer was aspirated from wells that had received 4G2 and replaced with 20 μL of 100X concentrated reporter virus particles diluted 1:1 in blocking buffer. Wells that had received E monomers were left in blocking buffer and plates were incubated at 37°C for 45 min. Wells were washed 3 times with 50 μL of wash buffer, received 30 μL of primary antibody at 100 μg/mL, and were incubated at 37°C for 45 min. Wells were washed 6 times with 50 μL wash buffer, received 30 μL of mouse anti-human antibody (Cat# 05–4220, ThermoFisher) at 1 μg/mL, and were incubated at 37°C for 45 min. Finally, wells were washed 6 times with 50 μL wash buffer, received 30 μL of TMB (Cat# 34028 ThermoFisher), and were incubated at room temperature until a color change was apparent. The reaction was stopped with 15 μL of 1N HCl and absorbance at 450 nm was read on SpectraMax i3x plate reader (Molecular Devices, San Jose, CA)

Binding screen against alanine library

We screened binding of antibodies F25.S02 and F05.S03 to a DENV2 16681 library where each prM/E polyprotein residue was mutated to alanine (or alanine residues to serine) [81]. In total, 559 sequence confirmed DENV2 mutants (99.6% coverage of the prM/E protein) were arrayed into 384-well plates (one mutation per well). The optimal screening condition was determined using an independent immunofluorescence titration curve against wild-type prM/E expressed in HEK293T cells to ensure that signals were within the linear range of detection and that signal exceeded background by at least 5-fold. F25.S02 and F05.S03 bound sufficiently well for screening only when the prM/E expression plasmid was co-transfected with a furin expression plasmid to enhance cleavage of prM. Thus, for antibody screening, plasmids encoding the DENV protein variants were individually co-transfected with furin expression plasmid into HEK-293T cells and expressed for 22 hr before incubation with purified IgG1 antibodies (0.1–2.0 μg/mL) diluted in 10% normal goat serum (NGS) (Sigma-Aldrich, St. Louis, MO) in PBS plus calcium and magnesium (PBS++).

Antibodies were detected using 3.75 μg/mL Alexa Fluor 488-conjugated secondary antibody (Jackson ImmunoResearch Laboratories) in 10% NGS. Cells were washed three times with PBS++ followed by 2 washes in PBS, then fixed in 4% paraformaldehyde (Electron Microscopy Sciences), washed in PBS, and resuspended in Cellstripper (Cat# 25-056-CI, Corning Inc, Corning, NY) plus 0.1% BSA (Sigma-Aldrich). Mean cellular fluorescence was detected by flow cytometry (Intellicyt iQue Screener PLUS, Sartorius AG).

Antibody reactivity against each mutant was calculated relative to reactivity with wild-type prM/E, by subtracting the signal from mock-transfected controls and normalizing to the signal from wild-type protein-transfected controls. The entire library data for each antibody was compared to control antibodies. Mutations were identified as critical to the antibody epitope if they did not support reactivity of the test antibody, but supported reactivity of other control antibodies. This counter-screen strategy facilitates the exclusion of DENV prM/E protein mutants that impact folding or expression.

Neutralization and antibody-dependent enhancement assays using single-round infectious reporter virus particles

All neutralization and ADE assays using the following strains were performed with reporter virus particles: DENV1 West-Pac 74, DENV1 16007, DENV2 16681, DENV3 CH53489, DENV4 TVP376, DKE-121, ZIKV H/PF/2013, WNV NY99. For experiments with DENV reporter viruses, except for Fig 3, which tested the entire panel of strains listed above in addition to fully infectious viruses described in the next section, neutralization assays were performed using a condensed panel of commonly used strains of reporter viruses representing each serotype (DENV1 West-Pac 74, DENV2 16681, DENV3 CH54389, DENV4 TVP376). Depending on the assay, stocks of reporter virus particles diluted to 5–10% final infectivity were incubated with either heat-inactivated serum (56°C for 30 min), 1/10 diluted ExpiCHO-S cell supernatant containing recombinant IgG1, or 5-fold serial dilutions of purified monoclonal antibodies for 1 hr at room temperature before addition of 2e5 Raji-DCSIGNR cells (neutralization assays), K562 cells (ADE assays), or U937 cells (ADE assays). After incubation for 2 days at 37°C, cells were fixed in 2% paraformaldehyde and GFP positive cells were quantified by flow cytometry (Intellicyt iQue Screener Plus, Sartorius AG). For experiments using single dilutions of serum or ExpiCHO-S cell supernatant, infection was normalized to conditions without serum/supernatant and expressed as % infection of the untreated condition. For experiments using serial dilutions of serum or of purified monoclonal antibodies, infection was normalized to conditions without serum/antibody and analyzed by non-linear regression with a variable slope and the bottom and top of the curves constrained to 0% and 100%, respectively (Graph-PadPrism v8, GraphPad Software Inc). Results from experiments using serially diluted serum were reported as the reciprocal dilution at which 50% of infection was neutralized (NT50). Results from experiments using serially diluted purified antibodies were reported as the concentration at which 50% of infection was neutralized (IC50).

Production and neutralization of fully infectious virus

DENV1 UIS 998 (isolated in 2007, Cat# NR-49713), DENV2 US/BID-V594/2006 (isolated in 2006, Cat# NR-43280), DENV3/US/BID- V1043/2006 (isolated in 2006, Cat# NR-43282), DENV4 strain UIS497 (isolated in 2004, Cat# NR-49724) were obtained from BEI Resources (Manassas, VA). Viral stocks were expanded by infecting 70% confluent C6/36 cells and virus-containing supernatant was collected and pooled at days 3 to 8 post infection. DENV4 H241 (isolated 1956, Cat# TVP17463) was obtained from the World Reference Center for Emerging Viruses and Arboviruses (WRCEVA) at the University of Texas Medical Branch (Galveston, TX). The seed stock was expanded by infecting 90% confluent Vero cells and virus-containing supernatant was collected 7 days post infection. All virus-containing supernatants were centrifuged at 500 x g for 5 min, filtered through a 0.45 μm Steriflip filter (Cat# SE1M003M00, Millipore-Sigma), and stored at -80°C. Viral stocks were titered by infecting 2e5 Raji-DCSIGNR cells with 2-fold serial dilutions. Two days post infection cells were fixed and permeabilized using BD cytofix/cytoperm (Cat# 554717, BD Biosciences) according to the manufacturer’s instructions before incubation with APC-conjugated 4G2 (an antibody specific for E protein) for 30 minutes at 4°C. Cells were washed twice in cytoperm/wash buffer and APC+ positive cells were quantified by flow cytometry.

For dose response neutralization assays using fully infectious virus, stocks were diluted to achieve 5–10% infection in Raji-DCSIGNR cells were incubated with 5-fold serial dilutions of antibodies for 1 hour, then combined with 2e5 Raji-DCSIGNR cells and incubated at 37°C 5% CO2, before being stained for E protein as described above. IC50 values were calculated as described above for neutralization assays using reporter virus particles.

Determining Fc receptor expression

K562 cells and U937 cells were washed in FACS wash (FW, 2% FBS in PBS) and resuspended in 50 μL of staining or isotype control antibody and incubated at 4°C for 30 min. For FcγRII we stained with anti-CD32-FITC (Cat# 60012.FI, StemCell) and corresponding mouse IgG2b-FITC isotype control (Cat# 11-4732-81, ThermoFisher Scientific). For FcαRI we stained with anti-CD89/-PE (cat# 555686, BD Biosciences) and corresponding mouse IgG1-PE isotype control (cat# 12-4714-42, ThermoFisher Scientific). Cells were washed twice in FW and analyzed by flow cytometry.