Skip to main content
Advertisement
  • Loading metrics

Single-cell transcriptomics reveals expression profiles of Trypanosoma brucei sexual stages

  • Virginia M. Howick ,

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing

    Virginia.Howick@glasgow.ac.uk

    Affiliations Institute of Biodiversity, Animal Health, and Comparative Medicine, University of Glasgow, Glasgow, United Kingdom, Wellcome Centre for Integrative Parasitology, University of Glasgow, Glasgow, United Kingdom, Parasites and Microbes Programme, Wellcome Sanger Institute, Hinxton, United Kingdom

    ⨯
  • Lori Peacock,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliations School of Biological Sciences, University of Bristol, Bristol, United Kingdom, Bristol Veterinary School, University of Bristol, Langford, United Kingdom

    ⨯
  • Chris Kay,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation School of Biological Sciences, University of Bristol, Bristol, United Kingdom

    ⨯
  • Clare Collett,

    Roles Investigation, Methodology, Writing – review & editing

    Current address: UK Health Security Agency, Porton Down, United Kingdom

    Affiliation School of Biological Sciences, University of Bristol, Bristol, United Kingdom

    ⨯
  • Wendy Gibson ,

    Contributed equally to this work with: Wendy Gibson, Mara K. N. Lawniczak

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation School of Biological Sciences, University of Bristol, Bristol, United Kingdom

    ⨯
  • Mara K. N. Lawniczak

    Contributed equally to this work with: Wendy Gibson, Mara K. N. Lawniczak

    Roles Conceptualization, Funding acquisition, Resources, Supervision, Writing – review & editing

    Affiliation Parasites and Microbes Programme, Wellcome Sanger Institute, Hinxton, United Kingdom

    ⨯

Abstract

Early diverging lineages such as trypanosomes can provide clues to the evolution of sexual reproduction in eukaryotes. In Trypanosoma brucei, the pathogen that causes Human African Trypanosomiasis, sexual reproduction occurs in the salivary glands of the insect host, but analysis of the molecular signatures that define these sexual forms is complicated because they mingle with more numerous, mitotically-dividing developmental stages. We used single-cell RNA-sequencing (scRNAseq) to profile 388 individual trypanosomes from midgut, proventriculus, and salivary glands of infected tsetse flies allowing us to identify tissue-specific cell types. Further investigation of salivary gland parasite transcriptomes revealed fine-scale changes in gene expression over a developmental progression from putative sexual forms through metacyclics expressing variant surface glycoprotein genes. The cluster of cells potentially containing sexual forms was characterized by high level transcription of the gamete fusion protein HAP2, together with an array of surface proteins and several genes of unknown function. We linked these expression patterns to distinct morphological forms using immunofluorescence assays and reporter gene expression to demonstrate that the kinetoplastid-conserved gene Tb927.10.12080 is exclusively expressed at high levels by meiotic intermediates and gametes. Further experiments are required to establish whether this protein, currently of unknown function, plays a role in gamete formation and/or fusion.

Author summary

African Trypanosomes are single-celled protozoan parasites that cause disease in humans and livestock. They have a complex life cycle that spans a mammalian and tsetse fly host. Within the tsetse fly, the parasite first travels into the midgut when the fly takes up an infectious blood meal. As it develops it moves into the proventriculus followed by the salivary glands taking on distinct morphological forms in each of these tissues. In the salivary glands, the parasite can undergo non-obligatory sexual reproduction via meiosis and the production of gametes. However, the biological processes that underly this sexual developmental and the molecular signatures that define these morphological forms remain elusive because they are found within heterogeneous populations that also contain mitotically dividing forms. Here we have used single-cell RNAseq to profile the transcriptomes of parasites across development in the tsetse with a focus on identifying the patterns of expression that define these sexual stages. We showed that the sexual forms have a unique transcriptional profile and we connect these expression patterns to specific morphological stages of sexual development using a fluorescent reporter. This allowed us to identify a new gene that may be involved in reproduction. Elucidating the mechanisms underlying sexual reproduction and genetic exchange is fundamental to understanding the evolution of key traits such as virulence and drug resistance.

Introduction

The African tsetse-transmitted trypanosomes are single-celled parasites that cause human and animal diseases, which are a heavy burden for many countries in sub-Saharan Africa. These trypanosomes survive in both the tsetse and mammalian host by taking on distinct morphological forms that suit the diverse metabolic and immune environments they encounter [1]. When blood infected with Trypanosoma brucei is imbibed by the tsetse fly (genus Glossina), trypanosome blood stream forms (BSF) rapidly change their transcriptional profile, including switching off Variant Surface Glycoprotein (VSG) transcription and upregulating expression of other surface proteins such as procyclins [2,3] They also switch their metabolism from dependence on glucose processed via glycolysis in the glycosome to exploitation of amino acids such as proline via the mitochondrial TCA cycle [4]. Trypanosomes then multiply as procyclics in the fly midgut before migrating anteriorly, first colonising the proventriculus or cardia, the valve between the foregut and anterior midgut, and then the paired salivary glands (Fig 1A) [5,6]. Here trypanosomes attach and proliferate as epimastigotes characterised by BARP surface proteins [7], before final differentiation into infective metacyclics that are inoculated into a new host via the saliva.

thumbnail
Fig 1. scRNAseq analysis of trypanosome developmental stages in tsetse.

(A) A schematic of the trypanosome life cycle and collections of the single parasite transcriptomes from midgut (MG; blue), proventriculus (PV; turquoise) and salivary glands (SG; pink) from different time points and strains. The number of parasites that passed QC at each collection is shown in parentheses. Trypanosomes show two conformations: trypomastigote with kinetoplast (small black dot) posterior to nucleus (e.g. bloodstream form, procyclic, metacyclic) and with kinetoplast anterior to nucleus (e.g. epimastigote). (B) A UMAP of the 388 cells that passed QC across collections, coloured by tissue of origin. (C) The UMAP coloured by cluster assignment. (D) A heatmap of the top significant marker genes from each of the five clusters that had marker genes (AUROC >0.75 & adjusted p-value < 0.01).

https://doi.org/10.1371/journal.ppat.1010346.g001

Additionally, the salivary glands are the location of the non-obligatory sexual cycle of T. brucei, which involves meiosis and the production of haploid gametes [8,9]. As trypanosomes are early diverging eukaryotes, their sexual processes are of particular interest because they provide insights into the evolution of sexual reproduction and meiosis. Although the morphologies of the meiotic division stages and gametes have been described [8–10], little is known about the transcriptional dynamics that characterise the sexual stages because these cells are a minority of the heterogenous cell population in the salivary glands. Sexual stages are found during the early phase of establishment of salivary gland infection, with numbers peaking about three weeks after fly infection [8,9]. The sexual cycle appears to be a sideshow in the normal mitotic developmental program, as it occurs in clonal trypanosome lines and does not need to be triggered by external factors such as the presence of another strain.

Single-cell RNAseq opens the door to study heterogenous populations of single-celled parasites by delineating expression patterns of individual cells allowing us to understand continuous developmental processes, cell-type specific patterns of co-expression and bet-hedging strategies [11–17]. Recent studies have profiled T. brucei populations using single-cell droplet-based approaches from BSF culture to profile the development of stumpy forms [18] as well as in vivo salivary gland parasites in order to identify a potential vaccine candidate among mature metacyclics [19] and the dynamics of VSG expression in the developing metacyclic parasites [20]. These studies complement the previous bulk transcriptomic studies in T. brucei that identified the major changes in transcriptional patterns over time and metacyclic development using either whole infected salivary glands or in vitro-derived metacyclics from the RBP6-inducible system [21–28]. Although these studies have been essential to our understanding of the dynamics of gene expression in T. brucei, we still lack an understanding of the molecular processing that characterize meiosis and sexual development in kinetoplastids.

Here we have exploited scRNAseq to investigate transcriptomes of the sexual stages of T. brucei that occur transiently in the heterogeneous trypanosome population in the fly salivary glands. We used a modified Smart-seq2 protocol [12,13,29] to profile T. brucei cells from different tsetse tissues (midgut, proventriculus, salivary glands) at different time points during development. We tied the observed transcriptomic profiles to specific developmental stages, validated by immunofluorescence, and identified cell-type specific markers, which revealed the dynamics of surface protein expression as well as a new candidate gene that may be involved in sexual development.

Results and discussion

Generation of high-quality transcriptomes from in vitro procyclic forms

To confirm that the modified Smart-seq2 protocol produces high-quality data for T. brucei, we initially profiled 46 single-cell transcriptomes from in vitro procyclic forms. We found a mean of 2.6x106 mapped reads per cell and a mean detection of 1756 genes per cell (S1A and S1B Fig), which is a greater number of genes per cell than recently published data from Hutchinson et al 2021 [20] that used a droplet-based method on the same parasite stage (1258 genes per cell). This further supports the use of Smart-seq2 to get in depth transcriptomes (high-coverage and full-length) in a low-throughput, targeted fashion compared to droplet-based methods that have fewer genes detected but are higher throughput [12,30]. Additionally, we observed high expression of genes that encode known procyclic surface antigens including GPEET and EP1-3 [2,31] (S1C Fig). These data support the utility of our protocol to profile single-cell expression profiles in kinetoplastids.

Transcriptomes of fly developmental stages

Having confirmed that the modified Smart-seq2 protocol would produce high-quality data from T. brucei in vitro procyclic forms, we profiled parasite transcriptomes isolated from diverse tsetse tissues at different timepoints, and from two T. brucei strains as outlined in Fig 1A. After quality control (S2 Fig), we obtained a total of 388 single-cell parasite transcriptomes: 78 from the midgut, 34 from the proventriculus and 276 from the salivary glands (Fig 1A). Parasites from all three tissues were isolated from flies infected with T. brucei strain 1738 dissected day 21 post infection (pi) and parasites from the salivary glands were additionally isolated at day 24 and 40 pi (Fig 1A). At days 21 and 24 pi, the tissues were incubated in media to release the free-swimming parasites, whereas at day 40 pi the cells were derived from free (spill-out from tissue) or attached (enzymatically disassociated) cell populations to capture metacyclics or attached epimastigotes and premetacyclics, respectively (Fig 1A). On day 24 pi, we aimed to analyse salivary gland parasites from an experimental cross between strains 1738 and J10. We isolated cells from single infections of each strain as well as co-infected tissue that contained both strains as well as a small number of hybrid progeny. We additionally used two cell preservation methods in the collection of these data to allow for more flexibility in processing time. Although small differences were observed in the number of genes detected between preservation methods and live cells, this was confounded by timepoint, preventing us from fully understanding the impact of the preservation and handling techniques alone (S3 Fig).

To understand transcriptional variation at the single-cell level across tissues, strains, and time, we performed dimensionality reduction with all 388 cells using UMAP (Fig 1B). We observed that cells grouped by their tissue of origin, with clusters representing midgut and proventriculus trypanosomes and two groups of salivary gland parasites that we hypothesized could represent different cell-types or stages (Fig 1B). This idea was supported by the distribution of time points across the two salivary gland groups with 21- and 24-day pi cells distributed throughout the two groups, while the 40-day pi cells (squares) occupied the centre and right-hand area; the left-hand area therefore represents early salivary gland developmental stages, such as sexual stages, which are frequent at 21–24 days pi, but are relatively scarce at 40 days pi compared to epimastigotes and metacyclics [9].

We next used consensus clustering to partition the cells into six clusters based on the top average silhouette score in SC3 [32] (Fig 1C). The midgut and proventriculus parasites each formed a single cluster (clusters C1 and C2 respectively), whereas the salivary gland cells divided into four clusters (C3-C6). We identified 238 marker genes across the six clusters allowing us to assign potential cell types (AUROC > 0.75, p < 0.01, Fig 1D and S1 Table). C1 and C5 had very few significant marker genes and C6 had none (hence not included in Fig 1D). This is likely due to different overall levels of transcriptional activity across the cell types as we observed fewer genes per cell for these clusters (S1 Table). For further characterization, we additionally identified the top 200 genes expressed in each cluster (S2 Table). Based on both the cluster markers and top genes of each cluster, we were able to assign putative cell-types. C1 and C2 showed expression patterns consistent with midgut procyclics and proventricular forms, respectively, based on known marker genes and bulk transcriptomic data [21,33] (S2 Table). C1 was characterized by a single marker gene, FHc (Tb927.3.4500), a fumarate hydratase, which catalyses conversion of fumarate to malate in the TCA cycle (Fig 1) [4,34]. FHc was also the most significant marker gene for the midgut forms when integrated with T. brucei single-cell data from [20], supporting the cell-type assignment across datasets (S4 Fig and S3 Table). C1 also expressed several genes encoding surface proteins at high levels (EP1: Tb927.10.10260, EP3-2: Tb927.6.520, and EP2: Tb927.10.10250), as well as three Proteins Associated with Differentiation (PAD1: Tb927.7.5930, PAD2: Tb927.7.5940, PAD7: Tb927.7.5990) (S2 Table), which are implicated as sensors of environmental stimuli and trigger differentiation [35]. C2 had several marker genes associated with transport (e.g. amino acid transporter AATP11 and purine nucleotide transporter NT10, Fig 1), both also highly expressed in C1 cells (S2 Table). Procyclin EP2 was identified as a marker gene for this cluster, though both EP1 and EP3 (Tb927.6.480) were also highly expressed (S2 Table).

Cluster C3 comprised day 21/24 pi early salivary gland developmental stages (Fig 1B and 1C) including potential sexual forms. Notably, we observed high expression of the gamete fusion protein HAP2 (Tb927.10.10770), which is known to be expressed in meiotic intermediates and gametes (S1 Table) [10]. An analogous cluster was also identified by [20], which showed high expression of HAP2 and HOP1 (Tb927.10.5490), a meiosis-specific protein. Integration across these two datasets showed the cells from both studies clustered together at a granular level (S4 Fig and S3 Table). Other notable marker genes for this cluster were two leucine-rich repeat (LRR) protein genes (Tb927.9.14570, Tb927.7.7180), with a third also highly expressed (S1 Table and S2 Table). Procyclin genes EP1, EP3 and GPEET (Tb927.6.510) (S2 Table) were highly expressed, together with BARP genes, which is the characteristic surface protein of epimastigotes [7].

Several BARP genes were the prominent marker transcripts in cluster C4 (Fig 1D), identifying this cluster as salivary gland epimastigotes, consistent with previous studies [19,20]. The majority of the later time point (day 40 pi) cells were found in clusters C5 and C6 (Fig 1B and 1C), showing that these clusters represent the later salivary gland developmental stages including mature metacyclics and/or their immediate precursors, pre- and nascent metacyclics. However, the identities of these clusters remain unclear. C5 had only three significant marker genes, two of which encode zinc finger proteins and one hypothetical protein, and C6 none (Fig 1D and S2 Table). The zinc finger protein genes, ZC3H11 (Tb927.5.810) and ZC3H45 (Tb927.11.8470) were also identified as biomarkers of pre-metacyclics (Meta 1) in [19], and ZC3H11 was also identified as a highly expressed gene in purified, culture-derived mature metacyclics [27]. Several other highly expressed genes of mature metacyclics ([27]) were also identified in our data for either C5 or C6 (e.g. ZFP2, HSP 110; S2 Table). It is noteworthy that cluster C5 is predominantly strain J10, while cluster C6 is predominantly strain 1738 (Fig 1D), and hence these clusters may also represent strain-specific rather than stage-specific expression differences. Additionally, mature and nascent metacyclics both have VSG on the surface [36], and it is reasonable to suppose that pre-metacyclics already transcribe VSGs. In support of this, both previous scRNAseq studies found high levels of expression of VSGs in cells identified as pre-metacyclics (Meta 1, [19]; Pre-metacyclic, [20]). Here, VSGs were not identified as abundant transcripts in either C5 or C6, likely because of poor match between strain 1738/J10 VSG transcripts and the Tb927 reference genome, as VSG repertoires are strain-specific. We next endeavoured to identify the metacyclic VSG repertoire of strains 1738 and J10, in order to confirm the cell-types of C5 and C6.

Expression of mVSG transcripts

Mature metacyclics can be unequivocally identified by their lack of expression of the cell surface proteins GPEET, EP and BARP, replaced by expression of a single mVSG gene in each cell [27], but pre-metacyclics also transcribe mVSGs at high level in [20]. To explore mVSG expression in salivary gland-derived cells, we first needed to identify the mVSG repertoires of strains 1738 and J10, which differ from those of previously published strains. We built a de novo transcriptome assembly based on all reads from the 388 tsetse-derived cells and identified putative mVSGs by comparison of the resulting ORFs to the total VSG repertoire of each strain, previously identified using a Hidden Markov Model on full-genome Illumina sequence data [37]. These assembled mVSG transcripts were then mapped to strain 1738 or J10 contigs to place them in a genomic context. Using this method, we identified 11 mVSGs that were expressed in our dataset all of which contained an upstream mVSG promoter based on the consensus sequence [38,39]. Additionally, downstream telomeric repeats were present in six of these contigs (Fig 2A). Although several ESAGs were found on the contigs, these were up- not downstream of the promotor and therefore not part of the mVSG expression site. The presence of these characteristic features of mVSG gave us further confidence that the identified transcripts were originating from bona fide mVSG. Interestingly, strains J10 and 1738 shared one mVSG (DN18105), suggesting some level of conservation across strains. This is the first identification of the mVSG repertoire in these strains.

thumbnail
Fig 2. mVSG expression in fly-derived trypanosomes.

(A) The genomic context of 11 mVSGs identified in strains 1738 and J10. The rectangles with a solid black outline represent the mVSG and are coloured to match Fig 2D. The sequences of each mVSG can be found in S1 File. (B) The transcript abundance of mVSG across 388 fly-derived trypanosome cells on the UMAP coloured by the logged sum of the mVSG counts in each cell and sized by the number of different mVSG detected in that cell. (C) The breakdown of mVSG expression per cluster. C5 had the highest proportion of cells expressing mVSG and the greatest proportion of those cells expressing multiple mVSG. (D) A barchart of all cells expressing mVSG (>1 read) organised by cluster and strain. Strain-specific expression of mVSG was seen at high levels in C5, which is primarily composed of strain J10.

https://doi.org/10.1371/journal.ppat.1010346.g002

Individual parasite transcriptomes were then mapped to the assembly to generate counts for each putative mVSG. MVSG transcripts were expressed by most cells in cluster C5, followed in order by C4, C6 and C3, with negligible expression in C1 and C2 (Fig 2B and 2C). Overall levels of expression were highest in cluster C5 (Fig 2B–2D), with 38% (16/42 cells) expressing more than one mVSG (Fig 2B–2D). Multiple mVSGs were also expressed by 38% (6/16) and 21% (4/19) cells in clusters C4 and C6 respectively, and a single cell in C3 (Fig 2C and 2D). Recent work by [20] confirmed expression of two mVSGs in pre-metacyclics using single molecule mRNA-FISH and put forward a model where multiple mVSGs are transcribed at low levels initially, with a single mVSG dominating expression in the mature metacyclic forms. Based on this model, C4, C5 and C6 all contain a high proportion of pre-metacyclics, as well as some mature metacyclics. The mVSGs expressed varied over development and between strains, with DN1222 being the dominant transcript in C5, which were primarily strain J10 cells, and DN16022 being the dominant transcript in C6, which were primarily strain 1738 cells (Fig 2D). Observed expressed mVSGs are largely consistent with the VSGs present in their strain (when there is sufficient read depth), but low read count and partial coverage result in ambiguous assignment due to sequence conservation between VSGs.

Pseudotime analysis of salivary gland development

To understand fine-scale changes in expression patterns during development of salivary gland parasites, we focused on the 161 salivary gland cells of strain 1738 collected over three time points (day 21, 24, 40 pi). The UMAP projection of these cells showed a general correspondence with the clusters identified in Fig 1C, with the left-hand group of cells representing clusters C3 and C4 (day 21/24 pi, early and late epimastigotes) and the right-hand group predominantly representing cluster C6 which included most of the day 40 pi transcriptomes (Fig 3A and 3B). The small branch connecting these two groups contained many cells collected from the dissociated salivary gland tissue, which likely represent attached epimastigotes and premetacyclics. Although we cannot rule out that these parasites were trapped unattached cells, their enrichment at this bottleneck in the UMAP indicates their importance in the developmental transition to metacyclics (Fig 3C).

thumbnail
Fig 3. Pseudotime trajectory analysis of developing salivary gland parasites.

Strain 1738 parasites collected from the salivary gland at day 21, 24 and 40 pi were used to map fine-scale changes in gene expression over development. (A-D) A UMAP of the 161 strain 1738 salivary glands parasites coloured by global cluster assignment from Fig 1 (A), day PI (B), attachment treatment (C) and pseudotime assignment (D). (E) A heatmap of 20 clusters of genes differentially expressed over the pseudotime trajectory from (D).

https://doi.org/10.1371/journal.ppat.1010346.g003

We next used Slingshot [40] to temporally order these cells in pseudotime, revealing a trajectory running from left to right from gametes and early epimastigotes to metacyclics (Fig 3D). We discovered 691 genes that were differentially expressed over this trajectory (Fig 3E and S4 Table) and used hierarchical clustering to identify modules of co-expressed genes. Modules expressed early in development were enriched for genes involved in negative regulation of mitotic cell cycle and ATP metabolism (modules 2 and 13, Fig 3E and S4 Table), while middle-late modules were enriched for genes involved in translation and the ribosome, perhaps necessitated by the changes in surface proteins and metabolism associated with differentiation from epimastigotes to metacyclics (Fig 3E and S4 Table).

Identification of hybrid progeny and strain-specific expression

To investigate potential cell-types and cell-type specific responses that could be involved in sexual reproduction at day 24 post-infection, we collected strains J10 and 1738 parasites from both single-strain infected and co-infected tsetse. In the co-infected treatment, we sorted cells from both strains based on fluorescence (strain 1738 GFP+, strain J10 RFP+), and sorted a small number of RFP+/GFP+ potential hybrid parasites (16 sorted, 14 passed QC). To confirm strain assignment, we used Souporcell to cluster different genotypes based on SNPs in the RNA-seq reads [41]. The two genotype clusters identified were each composed of one of the strains based on fluorescent identification with FACS (strain 1738 GFP+ = cluster 0; strain J10 RFP+ = 1), and the potential hybrid progeny were identified as inter-genotypic doublets (clusters 0/1 and 1/0), with alleles present from both strains (Fig 4A). This confirmed that six of the RFP+/GFP+ cells were genuine hybrids, while a further three hybrid cells were identified from the RFP-/GFP+ or RFP+/GFP- groups; as the GFP and RFP genes are present on only one homologue, four hybrid genotypes with respect to fluorescent protein genes are expected [42]. Looking at a UMAP of all day 24 pi cells, we observed some separation of strain in both the early and late epimastigote clusters (C3 and C4) and clusters C5 and C6 (Fig 4B). However, we did not see clear clustering based on the infection treatment (co- vs single-infection), suggesting that there is no strong transcriptomic response to presence of another parasite strain (Fig 4C). In order to understand if the observed strain-specific clustering was a result of different cell-type composition or differential expression between strains within a cell-type, we integrated the data across strains using Seurat v3 [43]. Using this method, we were able to co-cluster the early epimastigote cells and identify 11 genes differentially expressed between the two strains (S5 Fig and S5 Table). However, the later stage cells seen in strain J10 had no representation of strain 1738, suggesting this cell-type is unique to this strain at day 24 pi, which could be observed if the strains have different developmental rates (S5 Fig).

thumbnail
Fig 4. Classification of hybrid progeny.

Souporcell was used to assign genotypes based on SNPs found between the two strains. The two genotype assignments (0,1) were each primarily composed of one of the strains based on fluorescent identification with FACS (strain 1738 GFP+/RFP- = cluster 0; strain J10 GFP-/RFP+ = 1), and the potential hybrid progeny were classified as inter-genotypic doublets (clusters 0/1 and 1/0). The likelihood ratio of cluster 0 assignment is shown for each of the three sorted populations (A). The UMAP of day 24 mixed- and single-infection experiments coloured by strain assignment and shaped by Fig 1 cell cluster assignment (B) and infection treatment (C).

https://doi.org/10.1371/journal.ppat.1010346.g004

Transcript levels of procyclin and candidate novel sexual stage genes correlate with protein expression in vivo

A primary aim of this study was to identify the sexual stages of T. brucei and our results support the hypothesis that cluster C3 (Fig 1) represents meiotic intermediates and gametes, which are abundant around day 21 pi [8–10]. Looking at expression of genes encoding proteins known to be essential for sexual reproduction, we found high levels of expression of HAP2 and also GEX1 in cluster C3, with some signal from the meiosis-specific genes DMC1 and HOP1 (Fig 5A). Surprisingly, these cells also expressed the procyclin gene GPEET, which is considered to be a marker of early procyclics in the tsetse midgut, replaced by EP procyclins in late procyclics [31,44]. GPEET, EP1, HAP2 and GEX1 all have the highest expression in cluster C3 (Fig 5B). We used immunofluorescence to tie these observations to specific morphological forms and to validate the presence of GPEET on the surface of salivary gland parasites (Fig 5C and S6 Table). We found that GPEET, together with EP and BARP were present in >90% of the meiotic dividers (2K1N cell with large posterior nucleus and two flagella) and gametes (1K1N or 2K1N cells with small pear-shaped body and relatively long anterior flagellum) [9], and as expected absent in metacyclics (Fig 5C). Epimastigotes showed a similar pattern to the sexual forms but lower total proportions (S6 Table). Additionally, we looked at proventricular parasites (mesocyclics) and found expression of EP and GPEET but no BARPs, further confirming our gene expression data is matched at the protein level for these markers (Fig 5C).

thumbnail
Fig 5. Expression of surface antigens and genes involved in sexual reproduction throughout development in the tsetse fly.

We observed co-expression of procyclic surface antigen genes and HAP2 in early parasite development in the salivary glands (A) and this general pattern of expression was also seen in proventricular forms (mesocyclics) (C2) as well as putative epimastigotes (C4) that also had high expression of BARPs (B). Immunofluorescence assays confirmed that these surface proteins corresponded to their transcriptional profiles and were present on the epimastigote and sexual stages (C).

https://doi.org/10.1371/journal.ppat.1010346.g005

Although previous work has shown that GPEET and EP transcripts are present in salivary gland parasites, expression of the corresponding proteins have not been demonstrated [45]. Instead, BARPs have been considered the major surface proteins in non-metacyclic, salivary gland forms [7]. Our data support a model where epimastigotes and sexual forms are expressing a diversity of surface proteins at high levels including BARPs, GPEET and EP. Additionally, the expression of these procyclins outside the midgut indicates they might play a functional role in these stages as well, and further experiments are needed to understand if they are required for development or interactions of meiotic dividers and gametes.

Cluster C3 was additionally characterised by strong and unique expression of Tb927.10.12080 (Figs 1D, 5A, 5B, and 6A), and we hypothesized that this gene may play a role in sexual development. It encodes a hypothetical protein devoid of recognisable functional domains that is well-conserved in other trypanosomes including T. congolense, T. vivax, T. cruzi and T. grayi, and the C-terminal domain in more distantly related members of the trypanosomatid family such as Leishmania spp. The gene falls upstream of two RNA binding proteins (Tb927.10.12090 (RBP7a); Tb927.10.12100 (RBP7b)) and the recently identified long non-coding RNA, grumpy, which all play a role in stumpy form differentiation [46,47]. Along with Tb927.10.12080, this genomic region could potentially act as a hotspot for differentiation and developmental processes across the parasite life cycle. Localisation data for Tb927.10.12080 from Tryptag.org [48,49] is equivocal, showing punctate cytoplasmic fluorescence for the N-terminal tagged protein and a mitochondrial location in a proportion of cells for the C-terminal tagged protein. To investigate expression of this protein during development in the tsetse fly, we used the 3’ UTR to regulate expression of GFP driven by the procyclin promotor (S6 Fig). At 20–22 days pi, there was very little detectable expression in midgut procyclics or proventricular forms, but strong expression in salivary gland trypanosomes (Fig 6B). Overall, of the parasites from the salivary gland scored, 39% (182/464) showed expression (S7 Table). These included meiotic intermediates and both 1K1N and 2K1N gametes but not metacyclics or unattached epimastigotes (Fig 6C and 6D). Cell types involved in the early stages of meiosis, such as meiotic dividers and 3N cells with one diploid and two haploid nuclei [10], had lower percentages of cells expressing (10% and 50% respectively) than did those involved in the later stages of meiosis and in gametes (77–80%; Fig 6C and S7 Table). At 37–38 days pi, the percentage of fluorescent trypanosomes dropped (103/682; 15%) and these cells were misshapen with no recognisable gametes or sexual intermediates. Further experiments are needed to understand the functional role of Tb927.10.12080 in meiosis and sexual development; however, it’s unique pattern of transcript and protein expression indicate it could play a vital role in processes that allow for genetic exchange in T. brucei and perhaps more broadly in kinetoplastids.

thumbnail
Fig 6. Expression of Tb927.10.12080 coincides with sexual forms.

(A) Co-expression of Tb927.10.12080 with genes encoding HAP2 and GEX1, proteins associated with gamete and nuclear fusion in eukaryotes, and the surface antigen genes GPEET and EP1; co-expression is seen in a subset of cells from C3 (Fig 1D). (B) T. brucei strain 1738 GFP::Tb927.10.12080–3’UTR transcribed from the procyclin promotor in the salivary gland (SG) and proventricular forms (PV). (C) Diagram showing major cell types observed during meiosis in T. brucei (adapted from [10]); nuclei are shown in black (4C or 2C DNA contents) or grey (1C, haploid) and kinetoplasts are shown as smaller black dots. Values beneath are the numbers and percentages of cells recorded for each cell type; both 1K1N and 2K1N gametes are included in the gamete total. Full data are presented in S7 Table. (D) Trypanosomes from tsetse fly salivary gland spill-out 16–21 days pi with T. brucei strain 1738 expressing GFP::Tb927.10.12080–3’UTR transcribed from the procyclin promotor. Left to right: phase contrast, DAPI, GFP::Tb927.10.12080–3’UTR. The scale bar represents 10 μm.

https://doi.org/10.1371/journal.ppat.1010346.g006

Conclusion

Here we applied single-cell RNA sequencing to explore the heterogeneous trypanosome populations in the tsetse fly. These data provide a resource for the parasitology community, which we have made available via an interactive website (http://cellatlas.mvls.gla.ac.uk/). Additionally, this data set allowed us to elucidate the transcriptional profiles of key life cycle stages in the salivary glands including the sexual stages. From this mixture of cell types, we were able to identify a cluster of cells that shared a particular transcriptomic profile characterized by high expression of the gene encoding the gamete fusion protein HAP2, together with several unstudied genes. One of these was a kinetoplastid-conserved gene Tb927.10.12080, which was exclusively expressed at high levels by meiotic intermediates and gametes. We speculate that this protein, currently of unknown function, plays a role in gamete formation and/or fusion, but further experiments are needed to test this hypothesis.

Materials and methods

Data collection

Trypanosome culture and tsetse infection.

The following tsetse-transmissible strains of Trypanosoma brucei brucei were used: T. b. brucei strain J10 (MCRO/ZM/73/J10) and strain 1738 (MOVS/KE/70/EATRO 1738); each was genetically modified to express a fluorescent protein gene (strain J10 RFP, strain 1738 GFP). Mating between these strains has been demonstrated previously [42] and strain 1738 reliably produces large numbers of gametes around day 21 post-infection [9]. Procyclic form (PF) trypanosomes were grown in Cunningham’s medium (CM) [50] supplemented with 15% v/v heat-inactivated foetal calf serum, 5 μg/ml hemin and 10 μg/ml gentamycin at 27°C. Tsetse flies (Glossina pallidipes) were infected with PF trypanosomes, maintained and dissected as described previously [8].

Parasite isolation from tsetse tissues for scRNAseq.

Free swimming parasites were obtained from G. pallidipes by separately pooling tissues into CM (5 midguts in 500 μl CM; 5 proventriculi in 50 μl CM; 20 sets of salivary glands in 50 μl CM). Tissues were incubated at room temperature (RT) for 10 minutes prior to filtration through a 100 μm filter. Cells were washed once with 1 ml CM prior to preservation or sorting. At day 40 pi, the parasites attached to the salivary glands were isolated by disassociation of the tissue after the 10-minute incubation period. Forceps were used to transfer the tissue to an enzymatic solution consisting of 200 μl Collagenase IV (1 mg/ml) and 25 μl of Elastase (4 mg/ml). The sample was then incubated at 30°C for 40 min with shaking at 300 rpm. During the incubation, the tissue was disrupted by pipetting up and down 40 times every 15 minutes at first with a p1000 pipette set to 150 μl and then with a p200 set to 100 μl once the tissue started to break up.

Cell preservation.

A subset of cells was preserved prior to cell sorting to allow for greater flexibility in the time between collections and FACS. The day 40 pi salivary glands parasites (attached and free) cells were fixed by adding 200 μl of dithio-bis(succinimidyl propionate) (DSP; Lomant’s reagent) dropwise to the cell pellet as described in [51]. DSP fixed samples were incubated at room temperature for 30 minutes prior to adding 4 μl 1 M Tris-HCl pH 7.5. Samples were then stored at 4°C for up to 24 hours. Prior to sorting, DTT was added to a final concentration of 50 mM. The day 24 pi salivary gland parasites (cross vs single infection) were preserved by resuspending the cell pellet in 200 μl Hypothermosol-FRS (BioLifeSolutions) [52]. Samples were then stored at 4°C for 5 hours prior to sorting. Live cells were stored at 4°C after collection from the tsetse tissue for up to 5 hours prior to sorting.

Cell sorting, library preparation and sequencing.

All parasite cells were sorted within 24 hours of collection on an Influx cell sorter (BD Biosciences) with a 200 μm nozzle or a Sony SH800 with 100 μm chip. Parasites were sorted based on RFP and/or GFP fluorescence into nuclease-free 96 well plates containing lysis buffer as described previously [12]. Sorted plates were spun at 1000 g for 10 seconds and immediately placed on dry ice. Reverse transcription, PCR, and library preparation were performed as described in [12]. Cells were multiplexed to 384 and sequenced on a single lane of Illumina HiSeq2500 v4 with 75 bp paired-end reads.

Immunofluorescence.

Salivary glands, proventriculi and midguts from infected flies (20–22 days pi) were pooled separately into CM and incubated at RT for 10 minutes (to allow trypanosomes to swim out of tissue) and then filtered through a 100 μm filter with PBS. Trypanosomes were pelleted by centrifugation and resuspended in 100 μl PBS. Cells were fixed overnight at 4°C by adding 100 μl 6% paraformaldehyde, 0.1% glutaraldehyde in PBS, and then washed twice with PBS before resuspension in 50 μl PBS. Cell suspensions were pipetted onto 2 x 10 mm coverslips, allowed to settle for 20 mins in a humid chamber, and then liquid was removed and replaced by 2% BSA in PBS. After 30 mins liquid was removed and cells incubated with 2% BSA in PBS containing diluted antibody for 30 mins at RT. Rabbit anti-GPEET (1:1000) and rabbit anti-BARP (1:1000) were a kind gift from Isobel Roditi, University of Bern, Switzerland; mouse anti-EP mAB (1:100) was from Cedarlane. Cells were washed three times with PBS and incubated with 2% BSA in PBS containing anti-rabbit FITC (1:1000) and anti-mouse TRITC (1:1000) for 30 mins at RT. Cells were washed three times with PBS, briefly air dried, stained with DAPI in VECTASHIELD mounting medium (Vector Laboratories) and viewed using a DMRB microscope (Leica) equipped with a Retiga Exi camera (QImaging) and Volocity software (PerkinElmer). The whole area of the coverslip was scanned systematically from top to bottom, capturing FITC, TRITC, DAPI and phase contrast images of each trypanosome. Digital images were analysed using ImageJ (http://rsb.info.nih.gov/ij).

Tb927.10.12080 gene expression.

The 3’ UTR of Tb927.10.12080 was amplified from genomic DNA of strain 1738 using the primers 5’- GATCCTCGAGTAGTGGCGAGTGTTTACAACAGTGTC and 5’-GATCGGGCCCCTTGTGCGGATCCAAACAA, and inserted immediately downstream of a GFP gene driven by the procyclin promotor from plasmid backbone pHD449, which is designed for insertion into the tubulin locus (S6 Fig) [53,54]. The plasmid construct was used for stable transfection of procyclic strain 1738 and following hygromycin selection, clones were tsetse fly transmitted as described by [8,9]. Flies were dissected 10–40 days pi and organs viewed by fluorescence microscopy and imaged live or fixed in 2% paraformaldehyde and stained with DAPI in VECTASHIELD mounting medium (Vector Laboratories).

scRNAseq data analysis

Mapping and generation of expression matrices.

Nextera adaptor sequences were trimmed from fastq files using trim_galore (-q 20 -a CTGTCTCTTATACACATCT—paired—stringency 3—length 50 -e 0.1) (v 0.4.3) [55]. Trimmed reads were mapped using HISAT2 (hisat2—max-intronlen 5000 -p 12) (v 2.1.0) [56] to the T. b. brucei 927 genome. The GFF was converted to GTF using the UCSC genome browser tool [57]. Reads were then summed against genes using HTseq (htseq-count -f bam -r pos -s no -t CDS) (v 0.7.1) [58].

Assembly of VSG transcripts.

Because there is a lack of conservation of VSGs across T. brucei strains, we built a de novo transcriptome assembly to identify the mVSG transcripts expressed in strains 1738 and J10. First, we merged the BAM files across the 388 cells and converted to FASTQ using bedtools (v. 2.29.2) [59]. Using Trinity (v. 2.1.1) [60] to assemble the transcripts from this merged file, we detected 53521 ‘genes’ with a mean contig length of 800 bp. We then mapped each cell to this assembly using RSEM (v. 1.3.3) to generate a counts matrix and used Transdecoder (v. 5.5.0) to detect open reading frames [61]. BLASTp (v. 2.9.0) was used to match to putative VSGs that had been curated independently from whole genome data as described below. Transcripts with >90% identity were used for further analysis.

Genomes for the parent strains J10 and 1738 were assembled from 76 bp paired read Illumina data from [62] using SPADES under default parameters [63]. Predicted mVSGs were identified to genomic loci, using BLAST against the assembled contigs with a percent identity across the entire transcript >95%, alignments of a raw score of greater than 1000 were further investigated. Additional open reading frames were identified by BLAST alignment of the curated 927 annotated CDS set. Nhmmer was used to identify putative mVSG promoters from the alignments [38,39].

Quality control and normalization.

Quality control and visualisation was performed in Scater (v. 1.12.2) [64]. Cell quality was assessed based on the distribution of genes detected per single-cell transcriptome. Cells with fewer than 40 genes or more than 3000 genes detected were removed, as well as cells that had fewer than 1000 total reads. These QC thresholds allowed us to keep more cells in the analysis that are likely to be less transcriptionally active such as mature metacyclics. Out of 515 parasites isolated from tsetse tissue that were sequenced, 388 passed quality control and were used for downstream analyses. Raw count data was normalized using a deconvolution size factor in Scran (v. 1.16.0) [65] to account for differences in overall level of expression between cell-types.

Cell clustering, projection, and marker genes.

In order to unbiasedly group transcriptomes based on similar expression profiles, 388 cells collected from the tsetse were clustered using K-means clustering in SC3 (v. 1.12.0) [32]. Dimensionality reduction was performed in Scater (v. 1.12.2) [64] using UMAP with the top 200 most variable genes and n_neighbors = 5, min_dist = 1, spread = 3. Marker genes were identified for each cluster using SC3 (AUROC >0.75 & adjusted p-value < 0.01).

Identification of hybrid parasites and data integration.

To select different parasite genotypes (strains J10, 1738, or J10x1738 cross) in the mixed infection treatment, we first FACS sorted based on GFP+ (strain 1738), RFP+ (strain J10), or GFP+/RFP+ (hybrid) expression. We then used souporcell (-k 2 -p 2) (v2.0) [41] to confirm genotype assignment based on SNP profiles from the scRNAseq reads. Souporcell uses mixture model clustering to identify genotypes and potential cell doublets after SNPs are called and counted with freebayes and vartrix, respectively [41,66,67]. We identified hybrid parasites as those that were categorised as doublets (containing alleles from both strains).

To identify genes that were differentially expressed between the two strains, we used Seurat (v3.1.5) to integrate the data by identifying anchors with the FindIntegrationAnchors() and IntegrateData() functions. The data was then clustered using FindNeighbors() with the top 30 principal components and FindClusters() with a resolution of 0.5. Differential expression was performed using the FindMarkers() function (adjusted p-value < 0.001). The same integration methods were used to compare the data to [20] except that the top 20 principal components were used, the cluster resolution was 0.8 and the FindConservedMarkers() function identified markers found in both studies (max p-value < 0.001).

Pseudotime and differential expression.

To assess developmental progression in strain 1738 salivary gland parasites from day 21-, 24-, and 40-days pi, Slingshot (v. 1.8.0) was used to estimate pseudotime by first inferring the global lineage structure of the cells and then fitting a smooth curve to infer the pseudotime variables for cells along that lineage [40]. Input clusters (k = 4) and the UMAP reduction were initially identified in SC3 and scater, respectively [32,64]. Genes differentially expressed over this trajectory were identified using the associationTest() function in TradeSeq (v. 1.4.0) [68].

Supporting information

S1 Fig. Quality assessment and expression of marker genes in procyclic culture singe-cell transcriptomes.

Forty-eight transcriptomes were generated using Smart-seq2 from parasites in a procyclic culture including a no cell and ten cell control. (A) The distribution of the total counts and total features (genes) detected in these 48 transcriptomes. (B) The total features plotted against total counts for the 46 single-cell transcriptomes shows a plateau as features and counts increase, suggesting that sequencing was saturated for these cells. We detected a mean of 2.6x106 reads and 1756 features per single-cell transcriptome. (C) Expression of procyclic surface antigen genes GPEET (Tb927.6.510), EP1 (Tb927.10.10260), EP2 (Tb927.10.10250), EP3_1 (Tb927.6.520), EP3_2 (Tb927.6.480).

https://doi.org/10.1371/journal.ppat.1010346.s001

(TIF)

S2 Fig. Quality control of insect stage parasites.

The distribution of genes detected (left) and counts (right) in each cell across the three insect tissues: midgut (MG), proventriculus (PV), and salivary glands (SG). Cells with fewer than 40 or more than 3000 genes per cell were removed. Additionally, cells with fewer than 1000 reads were removed. Cut-offs are represented by the red vertical lines in each histogram. After QC we detected a mean of 889 genes per cell and 1.1x105 counts per cell.

https://doi.org/10.1371/journal.ppat.1010346.s002

(TIF)

S3 Fig. Assessment of preservation methods of salivary gland parasites.

The distribution of features detected in salivary gland cells across the two preservation treatments (DSP and hypothermosol) compared to live parasites. Although there were slight differences in detection between the different treatments, caution must be taken in interpreting these differences as the fixation methods are confounded with the different timepoints collected (DSP: day 40; hypothermosol: day 24; live: day 21).

https://doi.org/10.1371/journal.ppat.1010346.s003

(TIF)

S4 Fig. Integration with Hutchinson dataset.

All 388 tsetse transcriptomes were integrated with the Hutchinson dataset collected from salivary glands [20] using Seurat’s data integration function. Plots show the UMAP of integrated data coloured by study (A), cluster identity from the different studies (paper_id) (B), integrated cluster assignment (C), or gene of interest (D-F). FHc (Tb927.3.4500) was the top marker gene (based on adjusted p-value) for the midgut and proventricular form cluster 4 (D). Tb927.7.380 (hypothetical protein, conserved) was the top marker gene for cluster 3 which contained gamete and epimastigote forms. HAP2 (Tb927.10.10770) (F) was not a marker gene for the gamete cluster likely because of its ubiquitous expression across non-metacyclic forms. Although we were able to identify conserved marker genes across the two studies, separation remained in the UMAP for all cell-types (A-B) and only the non-metacyclic forms co-clustered across the two studies and only at a granular level. The metacylic forms likely did not cluster together because of different VSG repertoires, and the separation across other cell-types may be due to time point, strain-specific expression patterns, or collection methods. Conserved marker genes for clusters 3 and 4 can be found in S3 Table.

https://doi.org/10.1371/journal.ppat.1010346.s004

(TIF)

S5 Fig.

Strain-specific gene expression (A). A UMAP of the day 24 SG parasites integrated by strain (1738 and J10). Points are coloured by strain and shaped by Fig 1 cluster. (B). The integrated UMAP coloured by new cluster from the integration analysis. Cluster 0 has a representation of both strains, whereas cluster 1 and 2 are composed primarily of strain 1738 or J10, respectively. (C) Differential expression was performed between strains within cluster 0. The ten genes differentially expressed between the two strains are displayed on a heatmap.

https://doi.org/10.1371/journal.ppat.1010346.s005

(TIF)

S6 Fig. Plasmid map for GFP::Tb927.10.12080–3’UTR construct.

Life cycle selective expression of Tb927.10.12080 was investigated through a reporter construct where the expression of GFP was controlled by ~500 bp of UTR downstream of the gene. For this study a stable transformant line was generated in strain 1738 using the 3’ UTR from its endogenous gene and integrated into the tubulin locus.

https://doi.org/10.1371/journal.ppat.1010346.s006

(TIF)

S2 Table. Top 200 genes expressed in each cluster from Fig 1.

https://doi.org/10.1371/journal.ppat.1010346.s008

(CSV)

S3 Table. Marker genes from integration with Hutchinson dataset.

https://doi.org/10.1371/journal.ppat.1010346.s009

(XLSX)

S4 Table. Genes differentially expressed over pseudotime (corresponding to Fig 3).

https://doi.org/10.1371/journal.ppat.1010346.s010

(XLSX)

S5 Table. Genes differentially expressed between strains (corresponding to S5 Fig).

https://doi.org/10.1371/journal.ppat.1010346.s011

(CSV)

S6 Table. Surface protein expression of trypanosomes from salivary glands from tsetse dissected 19–21 days post infected feed, using immunofluorescence.

https://doi.org/10.1371/journal.ppat.1010346.s012

(DOCX)

S7 Table. Cell types recovered from tsetse salivary gland exudate 16–21 days post infection with T. brucei strain 1738 expressing GFP::Tb927.10.12080–3’UTR scored for GFP fluorescence.

https://doi.org/10.1371/journal.ppat.1010346.s013

(DOCX)

Acknowledgments

We gratefully acknowledge the generous supply of tsetse pupae from the International Atomic Energy Agency, Vienna. We thank the Sanger Institute flow cytometry core facility for technical support and guidance. We thank Thomas Otto and Jesse Ropp for development and deployment of the interactive website.

References

  1. 1. Matthews KR. The developmental cell biology of Trypanosoma brucei. J Cell Sci. 2005;118: 283–290. pmid:15654017
  2. 2. Vassella E, Acosta-Serrano A, Studer E, Lee SH, Englund PT, Roditi I. Multiple procyclin isoforms are expressed differentially during the development of insect forms of Trypanosoma brucei. J Mol Biol. 2001;312: 597–607. pmid:11575917
  3. 3. Bütikofer P, Vassella E, Mehlert A, Ferguson MAJ, Roditi I. Characterisation and cellular localisation of a GPEET procyclin precursor in Trypanosoma brucei insect forms. Mol Biochem Parasitol. 2002;119: 87–95. pmid:11755189
  4. 4. Bringaud F, Rivière L, Coustou V. Energy metabolism of trypanosomatids: adaptation to available carbon sources. Mol Biochem Parasitol. 2006;149: 1–9. pmid:16682088
  5. 5. Van Den Abbeele J, Claes Y, van Bockstaele D, Le Ray D, Coosemans M. Trypanosoma brucei spp. development in the tsetse fly: characterization of the post-mesocyclic stages in the foregut and proboscis. Parasitology. 1999;118 (Pt 5): 469–478. pmid:10363280
  6. 6. Sharma R, Peacock L, Gluenz E, Gull K, Gibson W, Carrington M. Asymmetric cell division as a route to reduction in cell length and change in cell morphology in trypanosomes. Protist. 2008;159: 137–151. pmid:17931969
  7. 7. Urwyler S, Studer E, Renggli CK, Roditi I. A family of stage-specific alanine-rich proteins on the surface of epimastigote forms of Trypanosoma brucei. Mol Microbiol. 2007;63: 218–228. pmid:17229212
  8. 8. Peacock L, Ferris V, Sharma R, Sunter J, Bailey M, Carrington M, et al. Identification of the meiotic life cycle stage of Trypanosoma brucei in the tsetse fly. Proc Natl Acad Sci U S A. 2011;108: 3671–3676. pmid:21321215
  9. 9. Peacock L, Bailey M, Carrington M, Gibson W. Meiosis and haploid gametes in the pathogen Trypanosoma brucei. Curr Biol. 2014;24: 181–186. pmid:24388851
  10. 10. Peacock L, Kay C, Farren C, Bailey M, Carrington M, Gibson W. Sequential production of gametes during meiosis in trypanosomes. Commun Biol. 2021;4: 555. pmid:33976359
  11. 11. Poran A, Nötzel C, Aly O, Mencia-Trinchant N, Harris CT, Guzman ML, et al. Single-cell RNA sequencing reveals a signature of sexual commitment in malaria parasites. Nature. 2017;551: 95–99. pmid:29094698
  12. 12. Reid AJ, Talman AM, Bennett HM, Gomes AR, Sanders MJ, Illingworth CJR, et al. Single-cell RNA-seq reveals hidden transcriptional variation in malaria parasites. Elife. 2018;7: e33105. pmid:29580379
  13. 13. Howick VM, Russell AJC, Andrews T, Heaton H, Reid AJ, Natarajan K, et al. The Malaria Cell Atlas: Single parasite transcriptomes across the complete Plasmodium life cycle. Science. 2019;365. pmid:31439762
  14. 14. Real E, Howick VM, Dahalan FA, Witmer K, Cudini J, Andradi-Brown C, et al. A single-cell atlas of Plasmodium falciparum transmission through the mosquito. Nat Commun. 2021;12: 3196. pmid:34045457
  15. 15. Witmer K, Dahalan FA, Metcalf T, Talman AM, Howick VM, Lawniczak MKN. Using scRNA-seq to Identify Transcriptional Variation in the Malaria Parasite Ookinete Stage. Front Cell Infect Microbiol. 2021;11: 68. pmid:33732658
  16. 16. Sà JM, Cannon MV, Caleon RL, Wellems TE, Serre D. Single-cell transcription analysis of Plasmodium vivax blood-stage parasites identifies stage- and species-specific profiles of expression. PLoS Biol. 2020;18: e3000711. pmid:32365102
  17. 17. Nötzel C, Kafsack BFC. There and back again: malaria parasite single-cell transcriptomics comes full circle. Trends Parasitol. 2021. pmid:34391665
  18. 18. Briggs EM, Rojas F, McCulloch R, Matthews KR, Otto TD. Single-cell transcriptomic analysis of bloodstream Trypanosoma brucei reconstructs cell cycle progression and developmental quorum sensing. Nat Commun. 2021;12: 5268. pmid:34489460
  19. 19. Vigneron A, O’Neill MB, Weiss BL, Savage AF, Campbell OC, Kamhawi S, et al. Single-cell RNA sequencing of Trypanosoma brucei from tsetse salivary glands unveils metacyclogenesis and identifies potential transmission blocking antigens. Proc Natl Acad Sci U S A. 2020. pmid:31964820
  20. 20. Hutchinson S, Foulon S, Crouzols A, Menafra R, Rotureau B, Griffiths AD, et al. The establishment of variant surface glycoprotein monoallelic expression revealed by single-cell RNA-seq of Trypanosoma brucei in the tsetse fly salivary glands. PLoS Pathog 17(9): e1009904. pmid:34543350
  21. 21. Savage AF, Cerqueira GC, Regmi S, Wu Y, El Sayed NM, Aksoy S. Transcript expression analysis of putative Trypanosoma brucei GPI-anchored surface proteins during development in the tsetse and mammalian hosts. PLoS Negl Trop Dis. 2012;6: e1708. pmid:22724039
  22. 22. Telleria EL, Benoit JB, Zhao X, Savage AF, Regmi S, Alves e Silva TL, et al. Insights into the trypanosome-host interactions revealed through transcriptomic analysis of parasitized tsetse fly salivary glands. PLoS Negl Trop Dis. 2014;8: e2649. pmid:24763140
  23. 23. Kolev NG, Ramey-Butler K, Cross GAM, Ullu E, Tschudi C. Developmental progression to infectivity in Trypanosoma brucei triggered by an RNA-binding protein. Science. 2012;338: 1352–1353. pmid:23224556
  24. 24. Savage AF, Kolev NG, Franklin JB, Vigneron A, Aksoy S, Tschudi C. Transcriptome Profiling of Trypanosoma brucei Development in the Tsetse Fly Vector Glossina morsitans. PLoS One. 2016;11: e0168877. pmid:28002435
  25. 25. Naguleswaran A, Doiron N, Roditi I. RNA-Seq analysis validates the use of culture-derived Trypanosoma brucei and provides new markers for mammalian and insect life-cycle stages. BMC Genomics. 2018;19: 227. pmid:29606092
  26. 26. Ramey-Butler K, Ullu E, Kolev NG, Tschudi C. Synchronous expression of individual metacyclic variant surface glycoprotein genes in Trypanosoma brucei. Mol Biochem Parasitol. 2015;200: 1–4. pmid:25896436
  27. 27. Christiano R, Kolev NG, Shi H, Ullu E, Walther TC, Tschudi C. The proteome and transcriptome of the infectious metacyclic form of Trypanosoma brucei define quiescent cells primed for mammalian invasion. Mol Microbiol. 2017;106: 74–92. pmid:28742275
  28. 28. Doleželová E, Kunzová M, Dejung M, Levin M, Panicucci B, Regnault C, et al. Cell-based and multi-omics profiling reveals dynamic metabolic repurposing of mitochondria to drive developmental progression of Trypanosoma brucei. PLoS Biol. 2020;18: e3000741. pmid:32520929
  29. 29. Picelli S, Faridani OR, Björklund ÅK, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from single cells using Smart-seq2. Nat Protoc. 2014;9: 171–181. pmid:24385147
  30. 30. Briggs EM, Warren FSL, Matthews KR, McCulloch R, Otto TD. Application of single-cell transcriptomics to kinetoplastid research. Parasitology. 2021;148: 1223–1236. pmid:33678213
  31. 31. Bütikofer P, Ruepp S, Boschung M, Roditi I. “GPEET” procyclin is the major surface protein of procyclic culture forms of Trypanosoma brucei brucei strain 427. Biochem J. 1997;326 (Pt 2): 415–423. pmid:9291113
  32. 32. Kiselev VY, Kirschner K, Schaub MT, Andrews T, Yiu A, Chandra T, et al. SC3: consensus clustering of single-cell RNA-seq data. Nat Methods. 2017;14: 483–486. pmid:28346451
  33. 33. Naguleswaran A, Fernandes P, Bevkal S, Rehmann R, Nicholson P, Roditi I. Developmental changes and metabolic reprogramming during establishment of infection and progression of Trypanosoma brucei brucei through its insect host. PLoS Negl Trop Dis. 2021;15: e0009504. pmid:34543277
  34. 34. Coustou V, Biran M, Besteiro S, Rivière L, Baltz T, Franconi J-M, et al. Fumarate is an essential intermediary metabolite produced by the procyclic Trypanosoma brucei. J Biol Chem. 2006;281: 26832–26846. pmid:16857679
  35. 35. Dean S, Marchetti R, Kirk K, Matthews KR. A surface transporter family conveys the trypanosome differentiation signal. Nature. 2009;459: 213–217. pmid:19444208
  36. 36. Vickerman K. Developmental cycles and biology of pathogenic trypanosomes. Br Med Bull. 1985;41: 105–114. pmid:3928017
  37. 37. Sistrom M, Evans B, Bjornson R, Gibson W, Balmer O, Mäser P, et al. Comparative genomics reveals multiple genetic backgrounds of human pathogenicity in the Trypanosoma brucei complex. Genome Biol Evol. 2014;6: 2811–2819. pmid:25287146
  38. 38. Ginger ML, Blundell PA, Lewis AM, Browitt A, Günzl A, Barry JD. Ex vivo and in vitro identification of a consensus promoter for VSG genes expressed by metacyclic-stage trypanosomes in the tsetse fly. Eukaryot Cell. 2002;1: 1000–1009. pmid:12477800
  39. 39. Cross GAM, Kim H-S, Wickstead B. Capturing the variant surface glycoprotein repertoire (the VSGnome) of Trypanosoma brucei Lister 427. Mol Biochem Parasitol. 2014;195: 59–73. pmid:24992042
  40. 40. Street K, Risso D, Fletcher RB, Das D, Ngai J, Yosef N, et al. Slingshot: cell lineage and pseudotime inference for single-cell transcriptomics. BMC Genomics. 2018;19: 477. pmid:29914354
  41. 41. Heaton H, Talman AM, Knights A, Imaz M, Gaffney DJ, Durbin R, et al. Souporcell: robust clustering of single-cell RNA-seq data by genotype without reference genotypes. Nat Methods. 2020. pmid:32366989
  42. 42. Gibson W, Peacock L, Ferris V, Williams K, Bailey M. The use of yellow fluorescent hybrids to indicate mating in Trypanosoma brucei. Parasit Vectors. 2008;1: 4. pmid:18298832
  43. 43. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat Biotechnol. 2018;36: 411–420. pmid:29608179
  44. 44. Vassella E, Den Abbeele JV, Bütikofer P, Renggli CK, Furger A, Brun R, et al. A major surface glycoprotein of trypanosoma brucei is expressed transiently during development and can be regulated post-transcriptionally by glycerol or hypoxia. Genes Dev. 2000;14: 615–626. Available: https://www.ncbi.nlm.nih.gov/pubmed/10716949 pmid:10716949
  45. 45. Urwyler S, Vassella E, Van Den Abbeele J, Renggli CK, Blundell P, Barry JD, et al. Expression of procyclin mRNAs during cyclical transmission of Trypanosoma brucei. PLoS Pathog. 2005;1: e22. pmid:16276404
  46. 46. Guegan F, Bento F, Neves D, Sequeira M, Notredame C, Figueiredo L. A long non-coding RNA controls parasite differentiation in 2 African trypanosomes. Biorxiv [Preprint]. 2020 [cited 2022 February 18]. Available from: https://www.biorxiv.org/content/10.1101/2020.05.03.074625v1.full
  47. 47. Mony BM, MacGregor P, Ivens A, Rojas F, Cowton A, Young J, et al. Genome-wide dissection of the quorum sensing signalling pathway in Trypanosoma brucei. Nature. 2014;505: 681–685. pmid:24336212
  48. 48. Dean S, Sunter JD, Wheeler RJ. TrypTag.org: A Trypanosome Genome-wide Protein Localisation Resource. Trends Parasitol. 2017;33: 80–82. pmid:27863903
  49. 49. Halliday C, Billington K, Wang Z, Madden R, Dean S, Sunter JD, et al. Cellular landmarks of Trypanosoma brucei and Leishmania mexicana. Mol Biochem Parasitol. 2019;230: 24–36. pmid:30550896
  50. 50. Cunningham I. New culture medium for maintenance of tsetse tissues and growth of trypanosomatids. J Protozool. 1977;24: 325–329. pmid:881656
  51. 51. Attar M, Sharma E, Li S, Bryer C, Cubitt L, Broxholme J, et al. A practical solution for preserving single cells for RNA sequencing. Sci Rep. 2018;8: 2151. pmid:29391536
  52. 52. Wang W, Penland L, Gokce O, Croote D, Quake SR. High fidelity hypothermic preservation of primary tissues in organ transplant preservative for single cell transcriptome analysis. BMC Genomics. 2018;19: 140. pmid:29439658
  53. 53. Biebinger S, Wirtz LE, Lorenz P, Clayton C. Vectors for inducible expression of toxic gene products in bloodstream and procyclic Trypanosoma brucei. Mol Biochem Parasitol. 1997;85: 99–112. Available: https://www.ncbi.nlm.nih.gov/pubmed/9108552 pmid:9108552
  54. 54. Bingle LE, Eastlake JL, Bailey M, Gibson WC. A novel GFP approach for the analysis of genetic exchange in trypanosomes allowing the in situ detection of mating events. Microbiology. 2001;147: 3231–3240. pmid:11739755
  55. 55. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011;17: 10–12. Available: https://journal.embnet.org/index.php/embnetjournal/article/view/200/479
  56. 56. Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12: 357–360. pmid:25751142
  57. 57. Kuhn RM, Haussler D, Kent WJ. The UCSC genome browser and associated tools. Brief Bioinform. 2013;14: 144–161. pmid:22908213
  58. 58. Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics. 2015;31: 166–169. pmid:25260700
  59. 59. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010;26: 841–842. pmid:20110278
  60. 60. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29: 644–652. pmid:21572440
  61. 61. Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8: 1494–1512. pmid:23845962
  62. 62. Kay C, Peacock L, Williams T, Gibson W. Signatures of hybridization in Trypanosoma brucei. PLoS Pathog. 18(2): e1010300. pmid:35139131
  63. 63. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19: 455–477. pmid:22506599
  64. 64. McCarthy DJ, Campbell KR, Lun ATL, Wills QF. Scater: pre-processing, quality control, normalization and visualization of single-cell RNA-seq data in R. Bioinformatics. 2017;33: 1179–1186. pmid:28088763
  65. 65. Lun AT L., Bach K, Marioni JC. Pooling across cells to normalize single-cell RNA sequencing data with many zero counts. Genome Biol. 2016;17: 75. pmid:27122128
  66. 66. Garrison E, Marth G. Haplotype-based variant detection from short-read sequencing. arXiv [q-bio.GN]. 2012. Available: http://arxiv.org/abs/1207.3907
  67. 67. Petti AA, Williams SR, Miller CA, Fiddes IT, Srivatsan SN, Chen DY, et al. A general approach for detecting expressed mutations in AML cells using single cell RNA-sequencing. Nat Commun. 2019;10: 3660. pmid:31413257
  68. 68. Van den Berge K, Roux de Bézieux H, Street K, Saelens W, Cannoodt R, Saeys Y, et al. Trajectory-based differential expression analysis for single-cell sequencing data. Nat Commun. 2020;11: 1201. pmid:32139671