Introduction of substitutions into conserved region V of the RSV L protein

To tease apart the role of CRV during RSV transcription and genome replication, single amino acid alanine substitutions were introduced into T7-expressed L protein so that their effects could be monitored in a cell-based minigenome system. The substituted residues included G1264, T1267, E1269, S1333, N1335 and R1339, which lie within, or proximal to, the pocket defined by the polymerase variants that inhibited capping in VSV, and where BI-D resistance variations could be mapped (E1269 is one of the BI-D resistance sites; Fig 1C). As a control, a substitution was also introduced into conserved region III of L (D811), which is within the RNA synthesis catalytic domain [6, 36, 37]. Prior to performing functional analysis of the variant L proteins, we confirmed that the substitutions did not inhibit expression of the L protein. Because there was no effective antibody available against L protein, hexahistidine tagged versions of wt and variant L proteins were constructed. L requires co-expression of P to be efficiently expressed [6, 38] and so the RSV L and P proteins were co-expressed from T7 plasmids in HEp-2 cells. Western blot analysis gave only a very weak and inconsistent signal for L, likely due to poor transfer of the protein because of its large size. Therefore, as an alternative approach, L-P complexes were isolated by affinity binding to Ni-NTA agarose beads and examined by SDS-PAGE and colloidal blue staining (Fig 1D). This analysis showed that all L protein variants were expressed at a similar level as the wt L protein and retained their ability to bind P.

Some conserved region V substitutions inhibited mRNA transcription

The L variants were then analyzed in a minigenome assay [39] to examine the effects of the substitutions on RSV transcription and replication. The minigenome contained the le promoter at its 3' end and trailer sequence at its 5' end. The ten naturally occurring RSV genes were replaced with two genes containing different fragments of chloramphenicol acetyl transferase (CAT) sequence, each flanked with RSV gs and ge sequences (Fig 2A). To uncouple minigenome transcription from replication and allow the two processes to be examined as independent events, the 5' terminal trailer region was modified with a substitution at position 2 relative to its 5' end. This inactivated the tr promoter at the 3' end of the antigenome, preventing it from acting as a template for genome synthesis and thus limiting minigenome replication to the antigenome synthesis step, as described previously [16]. RSV RNA synthesis was reconstituted intracellularly by transfecting BSR-T7 cells with plasmids expressing the minigenome RNA and RSV N, P, M2-1, and L proteins. For this, and all following experiments using the minigenome system, BSR-T7 cells were used to supply T7 RNA polymerase, instead of MVA-T7, to avoid the possibility of artifacts arising from the capping enzyme activity of vaccinia virus. For these experiments, untagged L constructs were used, as the tag impaired polymerase activity to some extent. The products generated by the L variants were detected by Northern blot analysis using a negative sense riboprobe that would detect both mRNAs and the antigenome (Fig 2A). In cells transfected with wt L protein, three major RNA species accumulated, representing encapsidated antigenome, and polyadenylated CAT 1 and CAT 2 mRNAs (Fig 2B, lanes 2 and 3) [12]. The identities of these bands have been determined previously by manipulating gs and ge signals, and using specific probes (e.g. [13, 17]). Analysis of the L variants showed that the S1333A variant generated a relatively high level of mRNA, and the T1267A and E1269A variants showed moderate levels of mRNA production, as compared to the wt L protein (Fig 2B and 2C). The mRNAs produced by these variant polymerases were diffuse in nature, similar to those produced by the wt polymerase, indicating that they were polyadenylated. In contrast, the G1264A, N1335A, and R1339A polymerases yielded significantly reduced levels of mRNA compared to wt (p <0.05). Thus, several amino acid substitutions inhibited transcription.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Substitutions in CRV inhibited transcription.

(A) Schematic diagram (not to scale) of the minigenome used to analyze mRNA transcription. The total minigenome length is 970 nt, consisting of a 44 nt leader (le) promoter region, 580 nt CAT 1 gene, 1 nt intergenic region, 190 nt CAT 2 gene, and 155 nt trailer (tr) region. The minigenome was limited to the antigenome step of RNA replication by a single nucleotide substitution at position 2 relative to the 5' end of the tr region. The region contained in the CAT riboprobe is indicated in red. (B) Northern blot analysis of positive-sense RNA produced from the minigenome by wt and variant L proteins detected with the CAT riboprobe. The positions of the antigenome, and CAT 1 and 2 mRNAs are indicated. Lane 1 is a negative control of RNA from cells in which L plasmid was omitted from the transfection. (C) Levels of CAT 1 mRNA generated by the variant L proteins as determined by quantification of replicates of the experiment shown in panel B. The data are normalized to the mean of the two wt samples in each experiment at 100%. The bars show the means and standard deviations of three independent experiments.

https://doi.org/10.1371/journal.ppat.1006803.g002

Transcription defects correlated with lack of cap addition

Given that CRV is known to be involved in mRNA capping, the block to transcription was likely to be at the capping step. We have been unable to reconstitute efficient PRNTase activity in vitro using purified polymerase, as has been described for VSV, Chandipura and rabies viruses [24, 26, 28, 40] to confirm this directly. This might be because the four guanosines that lie at the 5' end of RSV mRNAs have the potential to form G-quadruplexes, preventing oligonucleotides containing this sequence from being bound as a substrate in a trans-capping assay. Therefore, we used primer extension analysis to examine if the mRNAs produced by the variant polymerases were capped. As described in the Introduction, the cap is added co-transcriptionally after the mRNA has reached a given length. If the substitutions inhibiting transcription were specifically targeting the PRNTase activity of the polymerase, it would be expected that the polymerase would retain its ability to initiate mRNA synthesis at the first gs signal at the beginning of the CAT 1 gene. To determine if the variant L proteins were capable of mRNA initiation, the RNA samples were subjected to primer extension analysis using probe 56–75, which corresponds to nucleotides 56–75 of the minigenome and so hybridizes to nucleotides 12–31 at the 5' end of the CAT 1 mRNA transcript (Fig 3A). If RSV were similar to VSV, in which the cap is added when the transcript reaches 31 nucleotides in length [31], it would be expected that this primer would be able to bind to transcripts irrespective of whether they were capped or uncapped. Primer extension analysis was first performed using a reverse transcriptase that does not recognize the cap, which allowed accurate determination of initiation site selection. Analysis of RNA produced by the wt L protein revealed two bands, corresponding to antigenome initiated at position 1 of the genome, and RNA generated from the gs signal (position 45) (Fig 3B, compare lanes 3 and 4 with lanes 2 and 5). RNA initiated at the gs signal was also readily detected in reactions containing the L variants (Fig 3B, lanes 6–11). There was experimental variation in the levels of this RNA (Fig 3C), likely because some of these products were relatively unstable. Nonetheless, the data clearly showed that all variants were capable of initiating mRNA synthesis from the gs signal. Comparison of transcript length with a molecular weight marker that indicated the length of transcripts initiated at the beginning of the gs signal (position 45) also showed that the transcripts were initiated at the correct position (Fig 3B, compare lane 1 with lanes 3–11). Thus, the variant polymerases were able to initiate mRNA synthesis from the gs signal, with no significant difference from wt.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. CRV substitutions inhibited mRNA capping.

(A) Schematic diagram of the 3' end of the minigenome. The initiation sites within the le promoter (+1, +3) and at the first gs (+45) are indicated with green arrows, and the positive-sense small le (sm le), CAT 1 mRNA, and antigenome RNAs that are produced from this region of the minigenome are shown below in blue. The regions contained within the negative sense 56–75 and 91–113 primers and probes are indicated in red. (B) Primer extension analysis of RNA generated by wt and variant L proteins using the 56–75 primer and Sensiscript reverse transcriptase. Lane 1 is a marker prepared by end-labeling a 31 nt DNA oligonucleotide corresponding in sequence to the primer extension product representing initiation at the first gs signal (M 45–75). (C) Quantification of RNA initiated at the gs signal based on replicates of the experiments shown in panel B. The data are normalized to a mean of the two wt samples included in each experiment at 100% and the bars show the mean and standard deviation for three independent experiments. (D) Primer extension analysis of the RNA generated by wt and the R1339A and H1338A/R1339A variant polymerases using the 56–75 primer and Thermoscript reverse transcriptase. RNAs were treated with buffer only, or pyrophosphatase in buffer, as indicated by -/+ symbols. (E and F) Primer extension analysis of RNA generated by wt and variant L proteins, performed with Thermoscript reverse transcriptase with either the 56–75 (E), or 91–113 primer (F). (G) Northern blot analysis of small RNA transcripts produced from the minigenome. The RNA was migrated on a 6% urea-acrylamide gel and detected with an end-labeled 56–75 oligonucleotide probe.

https://doi.org/10.1371/journal.ppat.1006803.g003

To determine if the mRNAs were capped, experiments were performed using a different reverse transcriptase capable of reverse transcribing the guanosine cap (Fig 3D–3F). To establish this assay, an additional control was used, in which a double alanine substitution was introduced into the HR motif (H1338/ R1339). In VSV, both residues are essential for PRNTase activity, and the histidine forms a covalent linkage to the mRNA substrate [29]. Reverse transcriptase products of RNA produced by the wt polymerase migrated as a doublet: a faint lower band migrated alongside the marker (representing uncapped RNA), and a dominant upper band migrated slightly more slowly (Fig 3D, lane 3). Treatment of the RNAs with pyrophosphatase to cleave the linkage between the guanosine cap and RNA resulted in a reduction in the level of the upper band, and an increase in the signal from the lower band (Fig 3D, lanes 3 and 4). This finding showed that the upper band corresponded to capped RNA (cap removal might have been incomplete because the minigenome mRNA was within a pool of total cellular mRNA, which would have competed for enzyme). In the case of the H1338A/ R1339A variant, the lower band was the only dominant band detected (Fig 3D, lane 7). Faint traces of slower migrating RNA could be detected, but this was unaffected by pyrophosphate cleavage (Fig 3D, lane 8) and might be due to low level stuttering of the reverse transcriptase on the repetitive sequence that lies at the 5' end of RSV mRNAs (5' GGGG). The R1339A variant had a similar phenotype as the H1338A/R1339A variant, demonstrating that this was defective in capping (Fig 3D, lanes 5 and 6). Analysis of the RNAs produced by the other variant polymerases showed that S1333A variant was efficient in capping, the T1267A and E1269A variants were somewhat less efficient, and the G1264A and N1335A variants capped with poor efficiency (Fig 3E). The RNAs were also examined with a primer that hybridized further downstream on the mRNA transcripts (primer 91–113), which binds at positions 47–69 from the 5' end of the mRNA. Although this primer detected products from the wt, T1267A, E1269A and S1333A variants, it could only detect very low levels of RNA from the G1264A, N1335A and R1339A variants (Fig 3F). This result shows a correlation between the ability of the polymerase to cap the RNA and to elongate it far enough to be detected by the 91–113 primer.

Uncapped transcripts were aborted after approximately 40 nt

To examine the lengths of the RNA produced by the G1264A, N1335A and R1339A variants, the RNA samples were subjected to Northern blot analysis using gel electrophoresis conditions optimized for examining short RNAs and probed with the 56–75 oligonucleotide used for the primer extension analysis (Fig 3A and 3G). For wt L protein, there were only faint bands apparent under these electrophoresis conditions, suggesting that this protein generates predominantly full-length mRNA (Fig 3G, lane 2). A similar result was obtained for the S1333A variant, which was highly efficient for capping and full-length mRNA synthesis (Fig 3G, lane 7). In contrast, the other variants produced RNAs that were ~30–50 nt in length, with the dominant signal at ~40 nt. The quantities of the ~40 nt RNAs detected for the G1264A, T1267A, E1269A, N1335A and R1339A variants were somewhat inconsistent between experiments, likely because the small size of this RNA meant it was not efficiently retained on the membrane. However, it was consistently observed that the variants most defective in transcription produced a ~ 40 nt RNA, which was not produced by the wt or S1333A variants. Together the data in Figs 2 and 3 show that substitutions in CRV cause a defect in transcription that correlates with inhibition of capping. The data also suggest that capping is required for RNA to be elongated beyond ~ 40 nt, consistent with what has been shown for VSV.

Substitutions in conserved region V inhibited RNA replication elongation within the promoter region

The data presented in Fig 2 show that, in addition to inhibiting transcription, some CRV variants were deficient in RNA replication, producing low to undetectable levels of antigenome. Given that replication products of nsNSVs are not capped, this finding shows that CRV has another role besides capping. To examine the effect of CRV substitutions on RNA replication specifically, the effects of the substitutions were analyzed using a replication-specific minigenome, in which the le promoter was replaced with nucleotides 1–36 of the tr promoter and the first gs signal was deleted (Fig 4A). The tr is a somewhat stronger replication promoter than the le [41], and the absence of a gs signal adjacent to the promoter prevents mRNA synthesis [11], allowing replication products to be measured without contamination with signal from polyadenylated monocistronic and readthrough mRNAs. Northern blot analysis showed that all the variants generated significantly lower levels of replication product (genome) than wt L protein (p <0.005 for each variant), with variants E1269A, S1333A, and N1335A generating replication product at a reduced level compared to wt (Fig 4B, lanes 7–9; 4C), and no product being detected for variants G1264A, T1267A, or R1339A (Fig 4B, lanes 5, 6, and 10; 4C). Thus, substitutions in CRV caused defects that affected replication in addition to transcription and the amino acid requirements for the two processes were not identical, with substitution of N1335 inhibiting transcription to a greater extent than replication, and the opposite being the case for T1267 (compare Figs 2 and 4).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. CRV substitutions inhibited RNA replication.

(A) Schematic diagram (not to scale) of the minigenome template used to analyze RNA replication. The 3' end of the minigenome contained nucleotides 1–36 of the tr promoter directly adjoining CAT-specific sequence, and the 5' end had a 22 nucleotide deletion at the 5' terminus of the trailer region, indicated with a dotted line. The region contained within the riboprobe is indicated in red. (B) Northern blot analysis of replicative RNA (genome) produced from the minigenome by wt and variant L proteins, detected with the CAT-specific riboprobe. (C) Levels of genome generated by the variant L proteins as determined by quantification of replicates of the experiment shown in panel B, as described for Fig 2.

https://doi.org/10.1371/journal.ppat.1006803.g004

RNA synthesis can be divided into different stages, including initiation and RNA elongation. Primer extension analysis was performed to narrow down which of these steps in RNA replication was affected by the substitutions. The RNA was analyzed using two primers that corresponded in sequence to nt 13–35 and 24–48 relative to the 3' end of the minigenome (Fig 5A). Analysis of the RNA generated by the wt L protein using primer 13–35 showed RNA initiated at the +1 and +3 sites of the tr promoter (Fig 5B, lanes 4 and 5), consistent with previous results [6, 21]. This primer also detected relatively high levels of RNA from +1 and +3 for each of the variants, except G1264A, for which only a very weak signal was obtained (Fig 5B, lanes 7–12, 5D). This shows that each of the variants, except G1264A, was capable of efficiently initiating RNA replication at +1 of the promoter and elongating the RNA far enough to be detected by the 13–35 primer. When RNA generated by the wt L protein was analyzed with primer 24–48, RNA initiated from +1 of the promoter could be efficiently detected, but RNA initiated from +3 was only barely detectable because most of this RNA is terminated at approximately 25 nt (Fig 5C, lanes 4 and 5). Analysis of the RNA generated by the variant L proteins showed that in contrast to what could be detected by the 13–35 primer, replication product initiated from +1 could only be detected for the three variants capable of generating full-length RNA replication products: E1269A, S1333A and N1335A, but not the other variants (Fig 5C and 5E). The levels of RNA detected for the E1269A, S1333A and N1335A variants were approximately 30% of wt levels, consistent with the levels of full-length RNA replication product detected by Northern blot analysis shown in Fig 4. One possible explanation why the 13–35 primer could bind RNA when the 24–48 primer could not, could be that the replicative RNA was degraded. However, primer extension analysis showed no evidence of replicative RNAs with heterogeneous termini, as would be expected if it were degraded by an endonuclease (see also Fig 3B), and it is difficult to rationalize why the 5' terminal fragments detected by the 13–35 primer would be protected if the RNA were degraded by a 3' to 5' exonuclease, given that there is no obvious RNA secondary structure in this region. Therefore, the fact that for each of the variants (except G1264A), the replication products could be detected by the 13–35 primer at a higher level relative to wt than by the 24–48 primer, indicates that substitutions in CRV inhibited elongation of replicative RNA within the promoter region.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. CRV substitutions inhibited the elongation step of replication.

(A) Schematic diagram of the 3' end of the replication-specific minigenome. The two initiation sites in the tr promoter (+1, +3) are indicated with green arrows, and the small tr (sm tr) and genome RNA products are shown in blue. The regions contained within the 13–35 and 24–48 primers are indicated in red. (B, C) Primer extension analysis of RNA generated by wt and variant L proteins using the 13–35 and 24–48 primers, respectively. The position of the +1 and +3 initiation sites were determined by co-migration of end-labeled DNA oligonucleotides, corresponding in length and sequence to cDNAs representing initiation from those sites (Lanes 1 and 2). Lane 3 shows RNA from a control transfection lacking L expression plasmid. The white lines between lanes 2 and 3 indicate where empty lanes were excised. (D, E) Quantification of replicates of the experiments shown in panels B and C. Panel D shows levels of RNA initiated at +1 and +3, detected by primer extension with primer 13–35. Panel E shows levels of RNA initiated at +1 detected by primer 24–48. In D and E the data are normalized to a mean of the two wt samples included in each experiment at 100%. In panel D, the bars show the mean and range of two independent experiments. In panel E, the bars show the mean and standard deviation of three independent experiments.

https://doi.org/10.1371/journal.ppat.1006803.g005

BI-D inhibited minigenome transcription and replication

As a complementary approach for examining the functions of CRV, we investigated how transcription and replication were affected by BI-D. As described in the Introduction section, BI-D is a small molecule inhibitor of the RSV polymerase. Resistance to BI-D maps to CRV (Fig 1C), implying that CRV is either the site where the compound binds the polymerase, or is a domain that it alters allosterically, making BI-D a useful tool for studying the activities of CRV. Cells were transfected with the transcription-competent minigenome used in Fig 2 (Fig 6A) and support plasmids, and incubated with varying concentrations of BI-D from the time of transfection until harvest. Northern blot analysis showed that the level of input minigenome template produced by T7 RNA polymerase was similar for each reaction, confirming that BI-D did not cause significant cytotoxicity at the concentrations used (Fig 6B). Northern blot analysis of the positive sense RNA products using the negative sense riboprobe showed that as the concentration of BI-D was increased, there was a decrease in the levels of full-length mRNA and antigenome, and an accumulation of smaller RNAs of heterogeneous size (Fig 6C, lanes 4–9, 6D). Thus, similarly to substitutions in CRV, BI-D inhibited transcription and replication.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6.

BI-D inhibited transcription (A) Schematic diagram of the transcription-competent minigenome as described in Fig 2A, with the regions contained within the CAT riboprobe indicated in red. (B) Northern blot analysis of input negative-sense minigenome RNA generated by T7 polymerase in the presence of varying concentrations of BI-D. (C) Northern blot analysis of positive-sense RNA produced from the minigenome, detected with the CAT riboprobe. (D) Quantification of CAT mRNA 1 where data are normalized to a mean of the two independent samples treated with DMSO included in each experiment, at 100%. The bars show the mean and range of two independent experiments.

https://doi.org/10.1371/journal.ppat.1006803.g006

BI-D inhibited transcription by preventing release of the ~25 nt small le transcript

Primer extension analysis was performed using the 56–75 primer (Fig 7A) to examine how BI-D was inhibiting transcription. This analysis showed that as the concentration of BI-D was increased, there was a decrease in the level of RNA initiated at the gs signal (+45) (Fig 7B and 7F, gray bars). In parallel with this decrease, there was an appearance and increasing level of RNA initiated close to the antigenome initiation site (Fig 7B). The most likely explanation for the appearance of this additional band was that it represented RNA initiated at +3, but elongated beyond the end of the le region rather than being released after ~25 nt. To determine if this was the case, the RNA was analyzed using a primer that corresponded to nt 15–39 of the le promoter (Fig 7A and 7C). This analysis showed that the only initiation sites near the 3' end of the le region were at +1 and +3 (Fig 7C), confirming that the abnormal band detected with the 56–75 primer was initiated at position 3. At lower concentrations of BI-D (≤ 50 nM) there was no significant increase in +3 initiated RNA that could be detected by the 15–39 primer, however, there was a significant change in the level of +3 RNA that could be detected by the 56–75 primer, being completely undetectable in the absence of BI-D and clearly detectable, albeit as a faint band, at 25 and 50 nM BI-D (Fig 7, compare panel B, lanes 3–6 with panel C, lanes 4–7; panels F and G, white bars). This suggested that BI-D was causing an increase in elongation of the RNA initiated at +3, allowing it to become detectable by the downstream 56–75 primer. As the concentration of BI-D was increased, there was an increase in the level of +3 RNA that could be detected by the 15–39 primer. This could indicate an increase in initiation at the +3 site, which could contribute to the increased levels of this RNA that could be detected by the 56–75 primer, or it could be due to increased elongation of the RNA allowing it to bind more efficiently to the 15–39 primer.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. BI-D inhibited transcription by preventing release of small le RNA and caused accumulation of abortive RNAs.

(A) Schematic diagram of the 3' end of the transcription-competent minigenome. The RNA products are shown in blue and the regions contained within the primers and probes are indicated in red. (B and C) Primer extension analysis of RNAs produced from the minigenome in the presence of varying concentrations of BI-D, using Sensiscript reverse transcriptase and primers 56–75 (B) and 15–39 (C). (D, E) Primer extension analysis of RNAs with Thermoscript reverse transcriptase and either the 56–75 (D) or 91–113 primer (E). In panels B, D, and E, lane 1 shows markers of oligonucleotides representing the primer extension products from the respective initiation sites; in panel C, lanes 1 and 2 show markers. Note that in panels C-E, the markers were migrated on the same gels as the adjacent samples, but a different exposure was required to visualize them. (F, G) Quantification of replicates of the experiments shown in panels B and C. Panel F shows levels of RNA initiated at +1, +3, and gs detected by primer 56–75. Panel G shows levels of RNA initiated at +1 and +3, detected by primer extension with primer 15–39. The +1 and gs products in panel F and the data in panel G were normalized to the—BI-D control in each experiment, which was set to 100%. In panel F, because the +3 products analyzed with primer 56–75 were at the level of background in the absence of BI-D, the +3 products were normalized to the value obtained with 800 nM BI-D, which was set to 100%. The bars show the mean and standard deviation of three independent experiments. (H, I) Northern blot analysis of small RNAs produced from the transcription-competent minigenomes by L protein in the absence or presence of BI-D. (J) Comparison of the sizes of abortive RNAs produced by a capping-deficient L variant (R1339) or by wt L protein in the presence of 800 nM BI-D. In H-J, RNA was migrated on 6% urea-acrylamide gels and detected with the indicated probe. The ladders are described in materials and methods. The 26 nt marker was based on the migration of the bromophenol blue (BB) dye on a 6% gel.

https://doi.org/10.1371/journal.ppat.1006803.g007

To investigate these possibilities further, RNA samples were subjected to Northern blot analysis using gel electrophoresis conditions optimized for examining short RNAs and probed with an oligonucleotide that correlated in sequence to nucleotides 7–37 relative to the 3' end of the minigenome (Fig 7A) so that the lengths of RNAs initiated within the promoter region could be determined. In the absence of BI-D, the ~ 25 nt band, representing RNA initiated at +3 and released within the le promoter region was the only clearly detectable band. As the concentration of BI-D was increased, the levels of this band remained similar, but longer heterogeneous RNAs were detected (Fig 7H). The bands ≥ 70 nt could also be detected with the 56–75 probe, consistent with these being le-CAT 1 read through RNAs (Fig 7I). This analysis suggested that at least some of the RNA initiated at +3 was being elongated into the CAT 1 gene. Together, the primer extension and Northern blot data indicate that BI-D caused the polymerase to elongate the RNA beyond the promoter region, preventing efficient initiation at the first gs signal.

Previous studies with compound BI-A, an inhibitor in the same class as BI-D, had suggested that it could inhibit mRNA capping as it resulted in inhibition of full-length mRNA synthesis and instead caused production of abortive transcripts of < 50 nt [25]. To determine if BI-D inhibited capping, the RNA was also analyzed by primer extension analysis using a reverse transcriptase capable of detecting a cap, and primers 56–75 and 91–113, as described for Fig 3. This analysis showed that, compared to the untreated control, 200 nM BI-D caused no detectable difference in the ratio between the bands representing capped and uncapped RNA, indicating that this concentration did not inhibit capping activity. However, the ratio of bands was altered in reactions that had been treated with 800 nM BI-D, with the upper band of capped RNA being much less intense relative to the lower band of uncapped RNA (Fig 7D and 7E). These data show that BI-D could inhibit capping, in addition to affecting elongation within the promoter region. A direct comparison of RNA produced by the cap-defective R1339A variant L protein and by the wt L protein in the presence of 800 nM BI-D showed that the abortive RNAs that were produced were different in size (Fig 7J). Thus, these data show that BI-D inhibited capping, as expected, however, they also suggest that an additional effect was to cause abnormal elongation of the RNA.

BI-D inhibited RNA replication from the tr promoter

To more clearly detect the effects of BI-D on replication, the inhibitor was tested using the replication-specific minigenome that lacked a gs signal after the promoter, as described in Fig 4 (Fig 8A). This analysis confirmed that BI-D did not affect synthesis of the input minigenome (Fig 8B) and showed that BI-D inhibited replication, and instead caused production of abortive RNAs (Fig 8C and 8D). Primer extension analysis was performed to examine RNAs initiated at positions 1 and 3 (Fig 9A and 9B). As was the case with the le promoter, there was an increase in the level of RNA initiated from +3, but in experiments with the tr promoter, there was a more pronounced decrease in the level of RNA that could be detected from +1 (Fig 9C). Analysis of the small tr promoter specific RNA by Northern blotting with a probe corresponding to nt 5–35 of tr showed a similar pattern of RNA products as those synthesized from the le promoter (Fig 9D). In this case, as the concentration of BI-D was increased, there was a clear decrease in the ~25 nt RNA and an increase in the levels of longer RNAs, again suggesting that BI-D was causing an increase in elongation of the RNA initiated at +3.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. BI-D inhibited replication.

(A) Schematic diagram of the 3' end of the replication-competent minigenome, with the regions contained within the riboprobe indicated in red. (B) Northern blot analysis of input minigenome generated by T7 polymerase during BI-D treatment. (C) Northern blot analysis of replicative RNA produced from the minigenome detected with the CAT riboprobe. (D) Quantification of genome RNA. The data are normalized to the mean of the two DMSO-only control samples in each experiment at 100%. The bars show the mean and standard deviation for three independent experiments, except for the 800 nM BI-D value, which is the mean of two experiments.

https://doi.org/10.1371/journal.ppat.1006803.g008

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 9. BI-D inhibited replication initiation and caused abnormal elongation within the promoter.

(A) Schematic diagram of the 3' end of the replication-specific minigenome. The two initiation sites in the tr promoter (+1, +3) are indicated with green arrows, and the small tr (sm tr) and genome RNAs are shown in blue. The regions contained within the 5–35 and 13–35 primers and probes are indicated in red. (B) Primer extension analysis of RNAs produced from the minigenome; the positions of the +1 and +3 initiation sites were determined as described in Fig 5. (C) Quantification of replicates of the experiments shown in panel B. The data are normalized to the mean of the two DMSO-only control samples in each experiment at 100%. The bars show the mean and standard deviation for three independent experiments, except for the 800 nM BI-D value, which is the mean of two experiments. (D) Northern blot analysis of small RNA transcripts produced from the BI-D treated replication specific minigenome. The RNA was migrated on a 6% urea-acrylamide gel and detected with the 5–35 probe. The 26 nt marker was based on the migration of the bromophenol blue (BB) dye on a 6% gel.

https://doi.org/10.1371/journal.ppat.1006803.g009

BI-D inhibitor prevented release of the RNA within the promoter region

The data described above are consistent with the hypothesis that BI-D prevented the polymerase from releasing RNA within the promoter region. However, the data described above from cell-based assays do not exclude the possibility that the truncated transcripts detected on Northern blots arose because BI-D affected the stability of the full-length mRNA and replicative RNAs. Therefore, to confirm if BI-D could cause abnormal elongation of the ~25 nt transcript, RNA synthesis was examined in an in vitro RNA synthesis assay using purified recombinant RSV L-P complexes and an RNA oligonucleotide template, as described previously [6] (Fig 10). Because it is challenging to purify the RSV polymerase to a high concentration, we were not able to perform assays in which the initiation and elongation steps were uncoupled, to measure the elongation step of RNA synthesis specifically, neither was it possible to examine the kinetics of elongation. However, it was possible to determine if BI-D affected how far the polymerase could elongate the RNA by analyzing the radiolabeled products using denaturing gel electrophoresis, and then comparing the amounts of shorter and longer transcripts produced in the presence of BI-D, relative to those produced in its absence. The same assay design has been used previously to study how the elongation properties of the VSV polymerase are altered under various conditions [42–44]. RSV polymerase activity was reconstituted with purified L-P complexes, an RNA oligonucleotide consisting of nucleotides 1–40 of the tr promoter and NTPs, including [α³²P]GTP. In previous studies, we have shown that in the in vitro assay, the RSV polymerase initiates at positions 1 and 3, as it does in cells, with initiation from +3 being dominant to the extent that the readily detected bands are due to initiation at this position [6, 45] (see also Fig 11). Analysis of RNA generated from the 40 nt template in the absence of BI-D showed two sets of products. At the top of the gel were bands > 40 nt that represent the products of 3' extension (labeled 3'ext.). These arise when the template folds into a panhandle structure, with nucleotides 1 and 2 base pairing with nucleotides 13 and 14 (or 15 and 16), and the polymerase adds up to three nucleotides onto the 3' end of the RNA in a templated fashion, an activity that occurs in infected cells [6]. The level of 3' extension product was not significantly affected by increasing BI-D concentration. The bands ≤ 40 nt represent newly synthesized RNAs that had been initiated at the promoter. In the absence of BI-D the polymerase did not extend these transcripts to the end of the template, but instead paused or released RNAs along the length of template, with the major products being ≤ 25 nt in length (Fig 10B). This correlates with what is found in cells, and shows that the polymerase is not able to efficiently elongate the promoter transcript beyond approximately 25 nt. Titration of BI-D into the reactions did not change the migration patterns of the RNA transcripts ≤ 25 nt (indicating that it did not affect initiation site selection; see legend to Fig 11), but resulted in production of lower amounts of shorter transcripts and the appearance of longer RNA transcripts that were extended to the end of the template (Fig 10B, the asterisk indicates full-length products). This finding shows that BI-D increased the elongation properties of the polymerase and allowed it to overcome the trigger that normally causes release of the RNA after approximately ~25 nt.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 10. BI-D increased transcription elongation in vitro.

(A) Sequence of the tr 1–40 template used to reconstitute RNA synthesis in vitro, with the +1 and +3 initiation sites indicated. Positions 23, 32, and 33 (in red) relative to the 3' end had single nucleotide substitutions to avoid secondary structure within the template. The full-length products that could potentially be generated from this template are shown below and include de novo RNA synthesis products initiated at +1 and +3, and the product of 3' extension of the tr 1–40 template RNA by back-priming. The nucleotides added by 3' extension are underlined. (B) RNA products generated by wt L-P complexes in the presence of increasing concentrations of BI-D, as indicated. The RNAs were migrated on a 20% urea-acrylamide gel. Lane 1 shows a molecular weight ladder consisting of [γ-³²P] labeled 40 nt RNA that had been subjected to alkali digestion. Lanes 2 and 3 show negative control reactions performed with either L-P complexes omitted (lane 2), or the catalytically inactive D811A L protein (lane 3). The full length products are indicated with an asterisk.

https://doi.org/10.1371/journal.ppat.1006803.g010

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 11. CRV substitutions inhibited polymerase elongation within the promoter.

(A) Sequence of the tr 1–25 template used to reconstitute RNA synthesis in vitro, with the +1 and +3 initiation sites and products of de novo RNA synthesis and 3' extension indicated. (B) Analysis of the isolated L-P complexes used for in vitro RNA synthesis assays. Colloidal-blue stained SDS-polyacrylamide gel showing isolated wt and variant L-P-his complexes as indicated. The bands corresponding to the expected migration patterns for L, P-his and HSP70, which co-purifies with the complex, are indicated. (C, D) RNA products generated by the wt or variant L-P proteins with either [α-³²P] GTP or [α-³²P] ATP were migrated on either a 20% (C) or 25% (D) urea-acrylamide gel adjacent to molecular weight ladders consisting of [γ-³²P] labeled RNA products corresponding in sequence to the RNA products of the +1 and +3 initiation sites, which had been subjected to alkali digest. Note that because the +1 and +3 products are of different sequence, they migrate slightly differently, particularly in the region from 10–14 nt. Lanes 2 and 6 show negative control reactions performed with the catalytically inactive D811A variant. The white lines on panels B, C and D indicate where lanes on the gel, with samples not described here, were excised. It should be noted that in C, the left and right panels show autoradiograms that were exposed 4 and 3 times longer, respectively than the corresponding panels in D. (E) Quantification of bands from experiments represented by panels C and D. The quantification was performed on data obtained from experiments using [α-³²P] GTP. The data were normalized to the wt L-P sample, which was set to 100% and is indicated by the red dashed line. The bars show the means and standard deviation of three independent experiments.

https://doi.org/10.1371/journal.ppat.1006803.g011

Substitutions in CRV inhibited elongation in the promoter region

We used a similar approach to examine if CRV variant polymerases had elongation defects within the promoter. For this analysis, we focused on two of the L variants which showed different deficiencies in the minigenome system: G1264A and R1339A. G1264A was capable of initiating mRNA synthesis at the gs signal, albeit at a lower level than wt polymerase, indicating that it was capable of RNA synthesis (Fig 3). However, it was so deficient in RNA synthesis within the promoter region that RNA initiated from positions 1 and 3 was barely detectable by primer extension analysis, even with the primer that hybridized at positions 13–35 relative to the 5' end of the replicative RNA (Fig 5). In contrast, R1339A was capable of producing RNAs that could be detected with the 13–35 primer, but similarly to G1264A, was defective in producing full-length replication product (Figs 4 and 5). The polymerase complexes containing these variant L proteins were expressed and purified and compared by colloidal blue staining to ensure that similar the preparations contained similar amounts of L and P proteins (Fig 11B). To examine their abilities to elongate RNA within the promoter region, we used a template consisting of the first 25 nt of the tr promoter (Fig 11A), as this is the longest distance that the wt polymerase can synthesize RNA (in the absence of BI-D) and is more efficient than the 1–40 template (probably because it is less prone to adopting secondary structures). Previously, we have shown that the polymerase tends to abort RNA synthesis after formation of the first dinucleotide [46]. Therefore, the RNA products from the same RNA synthesis reactions were analyzed using two different gel electrophoresis conditions that were optimized for resolving either the first dinucleotide initiated at position 3 (Fig 11D), or 11–25 nt products, which would be a mixture of RNAs initiated at positions 1 and 3, with the +3 products being dominant, as described above (and being up to 23 nt in length) (Fig 11C). The background in the region of the gel which resolved RNA 3–10 nt in length was typically too high to clearly detect these products. Nonetheless, comparison of the levels of each of the 2 and 11–23 nt products generated by the variants to those generated by the wt polymerase allowed us to gain information regarding how efficiently the variants elongated the RNA relative to the wt polymerase (Fig 11E).

This analysis showed that the R1339A substitution caused subtle, but consistent, differences in the elongation properties of the polymerase, resulting in increased accumulation of products of 17–20 nucleotides, relative to the wt polymerase, and reduced accumulation of products of 21–23 nt (Fig 11C, compare lanes 3 and 5, and 7 and 9; 11E, note that the red dotted line represents the level of each RNA produced by the wt polymerase). This finding shows that the R1339A variant inhibited elongation, resulting in increased accumulation of shorter RNAs. Although the G1264A variant produced dinucleotide at a similar level as the R1339A variant, it produced lower levels of longer RNAs, indicating that this variant was even more deficient in elongation (Fig 11C and 11E). The 3' extension products could be detected in reactions containing [α³²P]GTP and were similar for each of the variants (Fig 11C, lanes 3–5, 11E). This result shows that all the variants were competent for RNA synthesis per se, and that CRV has relatively little impact on the 3' extension activity of the polymerase. However, the G1264A and R1339A substitutions inhibited elongation within the promoter region. The variants might also have been altered in their abilities to initiate RNA synthesis, but we were unable to determine if this was the case because the inability to detect the 3–10 nt products above a high background signal meant that we could not quantify total RNA synthesis relative to the wt polymerase.

Cells

HEp-2 cells (ATCC) were used to confirm expression of the mutant L proteins and were grown in Opti-MEM reduced serum media supplemented with 2% fetal bovine serum (Invitrogen). BSR-T7 cells, that are engineered to constitutively express T7 RNA polymerase [51], were used to reconstitute RSV RNA synthesis using a minigenome template. BSR-T7 cells were grown in G-MEM supplemented with 10% fetal bovine serum, 1X MEM non-essential amino acids solution, 6 mM L-glutamine and 1 mg/ml geneticin (Invitrogen). Sf21 insect cells were used for expression of the RSV L-P complex for assaying RSV RNA synthesis in vitro. These cells were cultured in suspension in SF-900 II serum free medium (Invitrogen).

L plasmid design and mutagenesis

Three types of plasmid expression constructs were generated. To confirm mutant L proteins were expressed in mammalian cells, a codon optimized version of the L ORF of RSV strain A2 containing an N-terminal hexahistidine tag sequence was cloned under the control of the T7 polymerase promoter in pTM1. Mutations in the GDNQ motif of L (D811A) and in CRV (G1264A, T1267A, E1269A, S1333A, N1335A and R1339A) were generated by QuickChange site-directed mutagenesis (Agilent Technologies) in a fragment of the L ORF subcloned into a pGEM T easy vector (Promega). The mutated ORF fragment was sequenced and then substituted in the L ORF of pTM1 by restriction digest and ligation. For analysis of L protein function in the minigenome system, a similar panel of plasmids was generated, lacking the hexahistidine tag. For high-level baculovirus expression of an L-P complex containing substitutions in the GDNQ motif of L (D811A) and in CRV (G1264A and R1339A), CRV mutations were introduced into an L ORF contained in a pFastBac Dual vector. The vector also contained the RSV A2 P ORF tagged with the tobacco etch virus (TEV) protease cleavage site and a hexahistidine sequence, as described previously [6]. Bacmids and recombinant baculoviruses were generated from the pFastBac Dual vectors using the Bac-to-Bac system (Invitrogen), according to the manufacturer’s instructions. All DNA clones were sequenced to confirm the presence of mutations, and to ensure that no other changes were introduced during PCR-mediated mutagenesis.

Confirmation of variant L protein expression in mammalian cells

To confirm that each of the variant L proteins could be expressed in mammalian cells, HEp-2 cells were transfected with pTM1 plasmids containing histidine-tagged versions of wt or variant L plasmids. Cells were transfected with 0.5 μg of pTM1 P and 0.25 μg wt or mutant L using lipofectin (Invitrogen). Cells were simultaneously infected with modified vaccinia virus Ankara-T7 (MVA-T7) to express the T7 polymerase [52]. The cells were incubated at 37°C and at 48 h post-transfection, they were collected and disrupted with lysis buffer (750 mM NaCl, 50 mM NaH₂PO₄, 20 mM imidazole, 0.5% NP40). The cell lysates were clarified by brief centrifugation in a bench top centrifuge and incubated with Ni-NTA agarose (Invitrogen) with gentle rotation for 2h at 4°C The beads were pelleted by centrifugation and after two washes with lysis buffer, the Ni-NTA agarose was pelleted and resuspended in 2X SDS sample buffer. Proteins were analyzed by 10% SDS-PAGE and colloidal blue staining.

Reconstitution of minigenome replication and transcription in cells

Polymerase activities were assessed in the minigenome system using pTM1 vectors containing untagged versions of the L proteins. The minigenome templates that were used have been described previously [7, 21]. Minigenome RNA synthesis and protein expression were reconstituted in BSR-T7 cells at 32°C, as described previously [20], note that the cells were not co-infected with vaccinia virus or treated with actinomycin D. For samples treated with BI-D, BI-D was diluted in DMSO and added to the media at the time of transfection at the concentrations indicated. DMSO was maintained at a consistent concentration in each reaction. At 48 h post-transfection, cells were harvested to isolate total intracellular RNA. RNA samples were prepared using Trizol according to the manufacturer’s instructions (Invitrogen).

Northern blot analysis

To detect full length mRNA and replication products generated from minigenomes, RNA samples were subjected to electrophoresis in 1.5% agarose-formaldehyde gels in MOPS buffer and subjected to Northern blot analysis as previously described [7]. The identities of each of the bands were determined by comparing the RNAs produced by minigenomes that have different arrangements of gs and ge sequences, and by examining RNAs with gene specific probes (e.g. as described in [13]). In each experiment, the levels of input minigenome RNA were determined by probing Northern blots with a positive sense CAT riboprobe. To detect low molecular weight RNAs, RNA was analyzed by gel electrophoresis in 6% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer. The ladders used were either a low-range ssRNA ladder (NEB), which was excised from the gel prior to transfer, stained with ethidium bromide for visualization with UV light and then realigned with the Northern blot, or the Decade Marker System (Ambion) which was Northern blotted directly. Direct comparison showed correlation between the two markers. Northern Blots were analyzed by autoradiography and phosphorimager analysis.

Primer extension analysis

5'-ends of the RNA transcription and replication products were analyzed by primer extension as described previously [7, 20, 21]. In addition, a primer that hybridized at position 91–113 of the positive sense RNA products was used (5' TATCCAGTGATTTTTTTCTCCAT). RNA samples were reverse transcribed at 37°C using the Sensiscript RT kit (Qiagen) and radiolabeled primers. To detect capped RNA, reverse transcription reactions were performed using Thermoscript reverse transcriptase (Invitrogen) at 55°C. In cases in which the guanosine cap of transcription products were digested with pyrophosphatase, RNA was treated with Cap-Clip Acid Pyrophosphatase (CellScript) for 2 h at 37°C prior to primer extension. Primer extension reactions were analyzed by electrophoresis in 6% or 8% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer. End-labeled oligonucleotides corresponding in sequence to cDNA representing initiation from +1 and +3 of the le and tr promoters and the first position of the gs signal were used as markers. Primer extension reactions were analyzed by autoradiography and phosphorimager analysis.

In vitro RNA synthesis assays

The RSV L and P proteins were expressed in insect cells using recombinant baculovirus and the L-P complex was purified as described previously [6], except that the proteins were eluted from Ni-NTA beads with sodium phosphate buffer containing 250 mM imidazole and then dialyzed into 150 mM NaCl, 20 mM Tris HCl pH 7.4, 10% glycerol, 1 mM DTT. To compare wt and variant polymerases, polymerase preparations were tested for RNase contamination by incubating them for 30 minutes, 1 h, and 2 h in a reaction buffer of the same composition used for RNA synthesis assays, with an end labeled RNA corresponding in sequence to the product of the 25 nt template, and the products were analyzed by denaturing gel electrophoresis, as described below. Polymerase preparations showing evidence of nuclease contamination were not included in the results presented here.

RNA synthesis was reconstituted in vitro using a similar approach as described previously [6, 7], but with some modifications. A PAGE-purified RNA oligonucleotide corresponding to nucleotides 1–25 or 1–40 of the tr promoter was used as a template. Positions 23, 32, and 33 relative to the 3' end of the 1–40 template were changed to C, U, and U respectively to limit secondary structure. RNA (2 μM) was combined with the purified L-P complex (containing ~200 ng of L protein) in RNA synthesis buffer (50 mM Tris HCl pH 7.4, 8 mM MgCl₂, 5 mM DTT, 10% glycerol), with 500 μM rNTPs, and 10 μCi of [α-³²P] GTP or [α-³²P] ATP in a final volume of 50 μl. For reactions containing BI-D, BI-D was diluted in DMSO and added to reactions at the concentrations indicated. DMSO was maintained at a consistent concentration in each reaction. Reactions were incubated at 30°C for 2 h, followed by incubation at 90°C for 3 minutes to inactivate the polymerase, and then diluted in an equal volume of stop buffer (deionized formamide containing 20 mM EDTA, bromophenol blue, xylene cyanol). To resolve 2 nt products, the reactions were analyzed on a 25% polyacrylamide gel containing 7 M urea in Tris-taurine-EDTA buffer. Longer RNA products were resolved by electrophoresis on a 20% polyacrylamide gel containing 7 M urea in Tris-borate-EDTA buffer. The nucleotide lengths of the RNA products were determined by comparison with a molecular weight ladder generated by alkaline hydrolysis of [γ³²P] ATP end-labeled RNA oligonucleotides representing the anticipated 25 and 23 nt RNA products produced from the +1 and +3 sites, respectively or by alkaline hydrolysis of [γ³²P] ATP end-labeled 1–40 RNA. Bands were visualized by autoradiography and quantified using Licor Image Studio Lite.