Skip to main content
Advertisement

< Back to Article

Figure 1.

Sequence analysis of 5′-UTR of int in 42 S. aureus prophages.

A highly conserved region (GGGTAGCCCGCCTACCCTTATTATTTTTTGCCAATTT) is identified. The previous reported stem-loop structure (*) and SD sequence (**) are located at the two sides of the newly defined region. Light blue boxes indicate the conservative nucleotide bases and dark blue boxes indicate the identical bases among all sequences compared. The start codons of int genes are boxed.

More »

Figure 1 Expand

Figure 2.

Sequence analysis of int promoters in several firmicutes harboring phages and a phylogenetic tree of sigH proteins in firmicutes.

(A) A comparison of the DNA sequences upstream of int gene from several other firmicutes harboring prophages and two S. aureus pathogenic islands showing that similar sequences were also identified in S. epidermidis prophage ФCNPH82, ФPH15, and S. haemolyticus ФSH1. SD sequences and the start codons of int genes are indicated by asterisks. (B) A phylogenetic tree of sigH orthologs in the above firmicutes showed that staphylococcal sigH proteins were separated from the others by a deep node. Protein sequences were aligned using ClustalW in Vector NTI software. Alignments were imported into Mega 4 and the tree was generated using the neighbor-joining method, ignoring positions with gaps. The scale bar represents 0.1 substitutions per nucleotide site.

More »

Figure 2 Expand

Figure 3.

Transcriptional analysis of int, cI, and xis in Φ11.

(A) Physical map of the gene organization of the left end of Ф11. The relative positions of the probes used in the Northern blot shown in panel B and C are indicated. The scale indicates the lengths of the genes. (B) Northern blots containing 5 µg of total RNA per lane were probed with Φ11 int probe (left) and reprobed with cI probe (right). Lane 1: phage cured strain RN4220; lane 2: Φ11 lysogen RN4220Φ11; lane 3: sigH mutant strain RN4220ΔsigHΦ11; lane 4: complementary strain RN4220ΔsigHcΦ11; lane 5: RN4220Φ11Δint. Ethidium bromide stained 16S rRNA patterns are shown as an indication of RNA loading. RL6000 (Takara) RNA marker (lane M) was used to estimate the molecular weight of the fragments. (C) Same RNA samples were probed with Φ11 xis probe at low molecular size. Lane 1: RN4220; lane 2: RN4220Φ11; lane 3: RN4220ΔsigHΦ11; lane 4: RN4220ΔsigHcΦ11; lane 5: RN4220Φ11Δint. RL1000 (Takara) RNA marker (lane M) was used to estimate the molecular weight of the fragments.

More »

Figure 3 Expand

Figure 4.

Alternative sigma factor σH up-regulates the mRNA levels of prophage integrases.

Deletion of sigH causes a reduction of prophage integrase mRNAs. The complementation of sigH gene (ΔsigHc) by transforming pMADsigH that integrated into host genome recovered the transcriptional levels of integrases. The integrases levels are indicated as the relative mRNA levels compared with the 16S RNA control (n = 3 samples/group, *p<0.05).

More »

Figure 4 Expand

Figure 5.

Direct evidence of σH-dependent transcription from pint is observed both in vitro and in vivo.

(A) In vitro transcription assay was performed using E. coli core RNA polymerase with or without σH or σA. The absence or presence of core RNAP, σH and σA are indicated. Ten µCi of [α-32P]UTP was used in each sample for radioautography. (B) A pint-lacZ fusion was deployed for the determination of σH-pint recognition in vivo. LacZ-deficient E. coli strain ZK126 was adopted as negative control. Fragment of pint-lacZ was introduced into ZK126 to generate TW0901. Strain TW0902 is derived from TW0901 by adding an IPTG-inducible plasmid pET22btac-sigH that expresses S. aureus σH. High activity of β-galactosidase was only detected in the group with pint-lacZ fusion and expressed S. aureus σH protein (n = 4 samples/group, *p<0.05 versus the controls).

More »

Figure 5 Expand

Figure 6.

Staphylococcal prophages are mobile on host genomes by dynamic equilibrium of excision and reintegration.

The excision of prophage from host genome is detected by PCR with primers check-Fs and check-Rs from two sides of the attB sites. Primers check-Rs outside the attB sites and check-INs inside the prophages, facing outwards, were used to detect the integrated prophage genomes. Phage-cured strain RN4220 was used as control.

More »

Figure 6 Expand

Figure 7.

Int is essential for the process of excison.

CI (Φ11), dnaA (Φ12), and amidase (Φ13) are phage genes that were used as endogenous controls. The deletion of Φ11 int makes prophage Φ11 immovable on its host genome (indicated by an asterisk) though integrases of Φ12 and Φ13 remain the same. Phage-cured strain RN4220 was used for positive control.

More »

Figure 7 Expand

Figure 8.

SigH plays a regulatory role on prophage excision and integration via integrase.

Primer pairs from two sides of attB (check-F and check-R) were used for determination of the ratio of the excised phage genome. Primer pair with one primer outside the att site and the other primer inside the prophage (check-R and check-IN) was used for determination of the ratio of the integrated prophage. SigH deletion resulted in an increase in excised phage genomes. The ratios of excised prophage genomes were similar in WT and the complementation (n = 4 samples/group, *p<0.05).

More »

Figure 8 Expand

Figure 9.

SigH deletion leads to an increase in spontaneous lysis.

The frequencies of the spontaneous lysis of the lysogens were evaluated by determination of the phage titers of the culture supernatants. Susceptible strain RN4220 was used as the indicator. (A) The titer in the supernatant of the sigH mutant culture was much higher. (B) No difference of the titers among WT, the sigH mutant, and the complement was observed when the cells were pretreated with UV radiation for phage induction.

More »

Figure 9 Expand

Table 1.

Frequencies of lysogenization of S. aureus by Ф11 at the multiplicity of about 100.

More »

Table 1 Expand