Skip to main content
Advertisement

< Back to Article

SPOC1-Mediated Antiviral Host Cell Response Is Antagonized Early in Human Adenovirus Type 5 Infection

Figure 5

SPOC1 overexpression represses Ad5 gene expression.

(A) To validate the model system, DLD1 or U2OS cells were treated with doxycyclin 12 hours before infection to induce SPOC1 expression; throughout the experiment the cells were grown in media supplied with doxycyclin. Cell extracts were subjected to 10% PAGE and immunoblotting using rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (B) DLD1/U2OS cells were infected with wild type H5pg4100 at a multiplicity of 50 FFU per cell. Viral particles were harvested at the indicated time-points after infection and virus yield was determined by quantitative E2A-72K immunofluorescence staining on HEK293 cells. The results represent the average from three independent experiments and were normalized to values for particle synthesis in SPOC1 induced cells infected with wild type H5pg4100. (C) DLD1/U2OS cells were infected with wild type H5pg4100 at a multiplicity of 50 FFU per cell. Total-cell extracts were prepared at the indicated times post infection. Proteins were separated by 10% SDS-PAGE, and immunoblotted with mouse monoclonal antibody M73 (E1A), 2A6 (E1B-55K), anti-Ad5 rabbit polyclonal serum L133, rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (D) DLD1/U2OS cells were infected with wild type H5pg4100 at a multiplicity of 50 FFU per cell. Total cell extracts were prepared and treated with proteinase K. PCR was performed using E1B-specific primers (E1B-fw 3′-CGC GGG ATC CAT GGA GCG AAG AAA CCC ATC TGA GC-5′; E1B-rev 3′-CGG TGT CTG GTC ATT AAG CTA AAA-5′). The same amounts of PCR product were separated on an analytic agarose gels (1%) and quantification was achieved with the Gene Snap Software (Syngene). The results shown represent the averages from three independent experiments. (E) DLD1/U2OS cells were infected with wild type H5pg4100 at a multiplicity of 50 FFU per cell. 24 h p.i. total RNA was extracted, reverse transcribed and quantified by RT-PCR using primers specific for E1A (E1A fwd: 5′ GTGCCCCATTAAACCAGTTG 3′; E1A rev: 5′ GGCGTTTACAGCTCAAGTCC 3′), E1B-55K (E1B fwd: 5′-GAGGGTAACTCCAGGG TGCG-3′; E1B rev: 5′-TTTCACTAGCATGAAGCAACCACA-3′), hexon (hexon rev: 5′-GAACGGTGTGCGCAGGTA-3′; hexon fwd 5′-CGCTGGACATGACTTTTG AG-3′) and GAPDH (GAPDH fwd:5′-ACCACAGTCCATGCCATCAC-3′ rev:5′-TCCACCACCCTGTTGCTGTA-3′). Data were normalized to 18S rRNA levels (18S rRNA fwd: 5′-CGGCTACCACATCCAAGGAA-3′; 18S rRNA rev: 5′-GCTGGAATTACCGCGGCT-3′). Values correspond to the mean of triplicates and error bars indicate the standard error of the mean.

Figure 5

doi: https://doi.org/10.1371/journal.ppat.1003775.g005