SNX8 modulates innate immune response to DNA virus by mediating trafficking and activation of MITA

Jin Wei; Huan Lian; Wei Guo; Yun-Da Chen; Xia-Nan Zhang; Ru Zang; Li Zhong; Qing Yang; Ming-Ming Hu; Wei-Wei Luo; Hong-Bing Shu; Shu Li

doi:10.1371/journal.ppat.1007336

Loading metrics

Open Access

Peer-reviewed

Research Article

SNX8 modulates innate immune response to DNA virus by mediating trafficking and activation of MITA

Jin Wei ,

Roles Conceptualization, Investigation, Writing – original draft

¶‡ These authors share first authorship on this work.

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Huan Lian ,

Roles Investigation, Writing – original draft

¶‡ These authors share first authorship on this work.

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Wei Guo,

Roles Investigation

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Yun-Da Chen,

Roles Investigation

Affiliations Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China, College of Life Sciences, Wuhan University, Wuhan, China
⨯
Xia-Nan Zhang,

Roles Investigation

Affiliations Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China, College of Life Sciences, Wuhan University, Wuhan, China
⨯
Ru Zang,

Roles Investigation

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Li Zhong,

Roles Investigation

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Qing Yang,

Roles Investigation

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Ming-Ming Hu,

Roles Formal analysis

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China
⨯
Wei-Wei Luo,

Roles Formal analysis

Affiliation Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
⨯
Hong-Bing Shu ,

Roles Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review & editing

* E-mail: shuh@whu.edu.cn (HBS); shuli@whu.edu.cn (SL)

Affiliations Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China, College of Life Sciences, Wuhan University, Wuhan, China
⨯
Shu Li

Roles Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review & editing

* E-mail: shuh@whu.edu.cn (HBS); shuli@whu.edu.cn (SL)

Affiliation Medical Research Institute, School of Medicine, Wuhan University, Wuhan, China

http://orcid.org/0000-0002-0007-5198

⨯

SNX8 modulates innate immune response to DNA virus by mediating trafficking and activation of MITA

Jin Wei,
Huan Lian,
Wei Guo,
Yun-Da Chen,
Xia-Nan Zhang,
Ru Zang,
Li Zhong,
Qing Yang,
Ming-Ming Hu,
Wei-Wei Luo

Published: October 15, 2018
https://doi.org/10.1371/journal.ppat.1007336

Reader Comments

Post a new comment on this article

A note to the readers of this article from the corresponding author

Posted by hshu539 on 10 Apr 2021 at 02:37 GMT

The numbers of mice described in Fig 3A&B are inaccurate. The corrected description is "n=9" in Fig 3A and "n=11" in Fig 3B. The results and conclusions are not affected.

In the SI Materials and Methods, there are typos in the qPCR primers for GAPDH and IFNB1. The actual primers were correct. The corrected primer information is:
GAPDH:GAGTCAACGGATTTGGTCGT (forward) and GACAAGCTTCCCGTTCTCAG (reverse).
IFNB1:TTGTTGAGAACCTCCTGGCT (forward) and TGACTATGGTCCAGGCACAG (reverse).

No competing interests declared.

Subject Areas
?

For more information about PLOS Subject Areas, click here.
We want your feedback. Do these Subject Areas make sense for this article? Click the target next to the incorrect Subject Area and let us know. Thanks for your help!

Transfection
Is the Subject Area "Transfection" applicable to this article?

Thanks for your feedback.
DNA
Is the Subject Area "DNA" applicable to this article?

Thanks for your feedback.
Co-immunoprecipitation
Is the Subject Area "Co-immunoprecipitation" applicable to this article?

Thanks for your feedback.
HeLa cells
Is the Subject Area "HeLa cells" applicable to this article?

Thanks for your feedback.
Immunoblot analysis
Is the Subject Area "Immunoblot analysis" applicable to this article?

Thanks for your feedback.
Immune response
Is the Subject Area "Immune response" applicable to this article?

Thanks for your feedback.
Cytokines
Is the Subject Area "Cytokines" applicable to this article?

Thanks for your feedback.
Microsomes
Is the Subject Area "Microsomes" applicable to this article?

Thanks for your feedback.

SNX8 modulates innate immune response to DNA virus by mediating trafficking and activation of MITA

SNX8 modulates innate immune response to DNA virus by mediating trafficking and activation of MITA

Reader Comments

Post Your Discussion Comment

Why should this posting be reviewed?

Thank You!

A note to the readers of this article from the corresponding author

Posted by hshu539 on 10 Apr 2021 at 02:37 GMT