https://orcid.org/0000-0003-3669-6866
Figures
Abstract
Reticulocalbin 1 (RCN1) is a calcium-binding protein involved in the regulation of calcium homeostasis in the endoplasmic reticulum. The aim of this study was to explore the clinical value and biological role of RCN1 in esophageal squamous cell carcinoma (ESCC). In addition, we investigated the effect of RCN1 on the polarization of tumor-associated macrophages (TAMs). The GSE53625 dataset from the Gene Expression Omnibus database was used to analyze the expression of RCN1 mRNA and its relationship with clinical value and immune cell infiltration. Immunohistochemistry was used to validate the expression of RCN1 and its correlation with clinicopathological characteristics. Subsequently, transwell and cell scratch assays were conducted to evaluate the migration and invasion abilities of ESCC cells. The expression levels of epithelial–mesenchymal transition (EMT)-related proteins were evaluated by western blot, while apoptosis was detected by flow cytometry and western blot. Additionally, qRT‒PCR was utilized to evaluate the role of RCN1 in macrophage polarization. RCN1 was significantly upregulated in ESCC tissues and was closely associated with lymphatic metastasis and a poor prognosis, and was an independent prognostic factor for ESCC in patients. Knockdown of RCN1 significantly inhibited the migration, invasion, and EMT of ESCC cells, and promoted cell apoptosis. In addition, RCN1 downregulation inhibited M2 polarization. RCN1 is upregulated in ESCC patients and is negatively correlated with patient prognosis. Knocking down RCN1 inhibits ESCC progression and M2 polarization. RCN1 can serve as a potential diagnostic and prognostic indicator for ESCC, and targeting RCN1 is a very promising therapeutic strategy.
Citation: Guo H, Shu J, Hu G, Liu B, Li J, Sun J, et al. (2024) Downregulation of RCN1 inhibits esophageal squamous cell carcinoma progression and M2 macrophage polarization. PLoS ONE 19(5): e0302780. https://doi.org/10.1371/journal.pone.0302780
Editor: Bingli Wu, Shantou University Medical College, CHINA
Received: January 31, 2024; Accepted: April 11, 2024; Published: May 7, 2024
Copyright: © 2024 Guo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: Publicly available datasets can be accessed in the GEO database (GSE53625 dataset) (https://www.ncbi.nlm.nih.gov/geo/). All analysis and generated data can be obtained from the supporting information files.
Funding: This research was supported by the Sichuan Provincial Primary Health Development Research Center (grant number: swfz20-z-003), the Key Project in the Scientific Research and Development Plan of the Affiliated Hospital of North Sichuan Medical College (grant number: 2023ZD009), and the National Training Program of Undergraduate Innovation and Entrepreneurship (grant number: 202310634016). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Esophageal cancer is one of the most common malignancies worldwide and is the sixth leading cause of cancer-related death [1]. The annual incidence and mortality rates of esophageal cancer in China comprise more than half of total global cases, with esophageal squamous cell carcinoma (ESCC) being the most common subtype, accounting for more than 90% of cases [2]. Due to the atypical early symptoms of ESCC, the lack of effective diagnostic and treatment targets, and the fact that most patients have already developed metastasis at the time of diagnosis, the 5-year survival rate is less than 30% [3]. Therefore, further research on the pathogenesis of esophageal cancer is of great significance to identifying new therapeutic targets and prognostic indicators to improve the prognosis of patients with esophageal cancer.
Reticulocalbin 1 (RCN1) is a member of the CREC protein family; it is a calcium-binding protein that resides in the endoplasmic reticulum (ER) and is involved in regulating calcium-dependent activity in the ER lumen [4]. RCN1 is not only confined to the ER lumen but also found on the surfaces of cells, with its expression being heterogeneous across various cell types [5]. There have been reports of RCN1 protein dysregulation in a variety of diseases, including cardiovascular disease [6], neuromuscular disease [7], and [8] tumors. In recent years, RCN1 has received widespread attention due to its important role in tumorigenesis and progression [9–13]. For example, in prostate cancer cells, downregulation of RCN1 promoted apoptosis and necrosis of the cells [13]; in non-small cell lung cancer, high expression of the RCN1 protein was found to be significantly associated with poor prognosis in non-small cell lung cancer patients, and inhibition of RCN1 was shown to reduce proliferation, migration, and invasion of lung adenocarcinoma cells [12]. These findings suggest that RCN1 may play a role as an oncogene in cancer. However, the expression pattern and biological behavior of RCN1 in ESCC are not yet clear.
Tumor-associated macrophages (TAMs) are macrophages that exist in the microenvironment of solid tumors and are the most common immune-related cells in the tumor microenvironment. TAMs manifest mainly as two types of macrophages: classically activated macrophages (M1) and alternatively activated macrophages (M2). M1 macrophages have antitumor effects, while M2 macrophages promote tumor progression [14]. Previous studies have also shown that a high density of M2 macrophages is associated with poor prognosis in patients with ESCC [15, 16]. However, it is not clear whether RCN1 regulates TAM infiltration and polarization.
In our study, we first utilized the GSE53625 dataset to evaluate the expression and prognostic significance of RCN1 in ESCC. Subsequently, we validated the protein expression of RCN1 in ESCC and paracancerous tissues by immunohistochemistry (IHC) and analyzed the relationship between RCN1 and clinicopathological characteristics in ESCC patients. We then evaluated the effects of RCN1 knockdown on the migration, invasion, epithelial–mesenchymal transition (EMT), and apoptosis of ESCC cells. Additionally, we explored the regulatory role of RCN1 in macrophage polarization.
Materials and methods
Collection of the dataset
We downloaded the GSE53625 dataset [17] from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) on December 1, 2022, and then used the "limma" package [18] to remove the batch effects. The GSE53625 dataset is the largest ESCC dataset available in the public database, containing 179 pairs of ESCC and paraneoplastic tissues. We extracted the RCN1 mRNA expression matrix and its corresponding clinical data from the GSE53625 dataset for further analysis.
Correlation analysis between RCN1 mRNA expression and clinicopathological characteristics
We analyzed the expression level of RCN1 in ESCC and paracancerous tissues using the "limma" R package from the GSE53625 dataset. We validated the expression of RCN1 in The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) databases using the GEPIA online analysis tool (http://gepia.cancer-pku.cn) [19]. We used the "ggpubr" R package to analyze the correlation between the expression level of RCN1 mRNA and the clinical pathological characteristics of ESCC patients.
Diagnosis and prognostic analysis of RCN1 mRNA
ESCC patients were divided into high- and low-expression groups based on the median value of RCN1 mRNA expression. The Kaplan–Meier method was used to analyze and evaluate the relationship between the expression of RCN1 and the prognosis of ESCC patients. The "pROC" R software package was used to evaluate the diagnostic value of RCN1 in ESCC. The "survival" package was used to perform univariate and multivariate Cox regression analyses to explore independent prognostic factors for ESCC patients. Subsequently, based on the results of a multifactorial Cox regression analysis, we constructed a nomogram to predict the survival of ESCC patients at 1, 3, and 5 years. Furthermore, we plotted a calibration chart to evaluate the accuracy of the nomogram.
Analysis of the correlation between RCN1 mRNA and immune cell infiltration
To evaluate the correlation between RCN1 and immune cell infiltration, we first used Cell-type Identification by Estimating Relative Subsets of RNA Transcripts (CIBERSORT) [20] to analyze the infiltration of immune cells in each patient in the GSE53625 dataset. Then, we used the Wilcoxon signed rank-sum test to compare the differences in 22 types of immune cells between the high and low RCN1 expression groups.
Collection of clinical samples
On December 15, 2022, we collected paraffin sections of cancer and paracarcinoma tissues along with clinical information from 80 ESCC patients who had surgery at the Affiliated Hospital of North Sichuan Medical College between January 2018 and December 2020. None of the patients received any chemoradiotherapy or other antitumor drug therapy before surgery. These 80 patients had complete clinical data, and their baseline data are presented in S1 Table. The pathological sections were confirmed as ESCC by two experienced pathologists. During or after the data collection, we did not obtain any information that could identify individual participants. This study was approved by the Medical Ethics Committee of the Affiliated Hospital of North Sichuan Medical College (Approval number: 2022ER441-1) and was conducted in accordance with the Helsinki Declaration. Since this study is a retrospective study and all patient data are anonymous, informed consent was waived with the approval of the Medical Ethics Committee of the Affiliated Hospital of North Sichuan Medical College.
Immunohistochemistry
IHC analysis was used to examine the protein expression of RCN1 in ESCC tissues and paracancerous tissues. After deparaffinization of the paraffin sections, gradient rehydration was performed, followed by antigen retrieval using the high-pressure steam method. After removing endogenous peroxidases with 3% hydrogen peroxide, the sections were blocked with normal goat serum. Subsequently, the RCN1 antibody (Ab210404, Abcam) was added to the sections at a 1:200 dilution and incubated overnight at 4°C. Then, the sections were incubated with the appropriate secondary antibody, detected with DAB as the chromogenic substrate, counterstained with hematoxylin, dehydrated in graded ethanol, and mounted with neutral resin. The immune reactivity score (IRS) was calculated as the product of the percentage of stained cells (0: unstained; 1: ≤10%; 2: 11–50%; 3: 51–80%; 4: ≥81%) and the staining intensity (0: no staining intensity; 1: weak; 2: moderate; 4: strong).
Cell culture and transfection
ESCC cell lines (KYSE150, KYSE510, KYSE30, and KYSE410) and the human monocyte cell line THP-1 were purchased from Cellcook (Guangzhou, China). All cell lines were cultured in RPMI-1640 medium containing 10% fetal bovine serum and were maintained in a humidified atmosphere with 5% CO2 at 37°C. To knock down endogenous RCN1 expression, the short hairpin RNA (shRNA) sequences were cloned and inserted into the hU6-MCS-CBh-gcGFP-IRES-puromycin vector and used to infect the KYSE150 and KYSE410 cell lines with an MOI (multiplicity of infection) value of 10. Lentiviral vectors were synthesized by Genechem (Shanghai, China). The sequences used for knockdown of RCN1 expression were shRCN1#1, AGAAGCTAACTAAAGAGGAAA; shRCN1#2, GACGGGAAGTTAGACAAAGAT; shRCN1#3, CATCTTTGATAATGTCGCCAA; and the negative control (NC) sequence was shNC, TTCTCCGAACGTGTCACGT.
Quantitative real-time PCR (qRT‒PCR)
Total RNA was extracted from the cells using TRIzol reagent. HiScript III RT SuperMix for qPCR (Vazyme Biotech Co., Ltd., China) was used for qRT‒PCRs on the LightCycler® 480 system (Roche Diagnostics, Risch, Switzerland). GAPDH was used as an internal reference gene. The primers used are shown in S2 Table.
Western blot
Cellular proteins were extracted using RIPA buffer (Appygen, Beijing, China) containing phosphatase inhibitors. Proteins were separated on a 10% SDS–PAGE gel and then transferred to a PVDF membrane (Sigma–Aldrich, Missouri, USA). The membrane was blocked with 5% skim milk for 2 h and then incubated with the primary antibody overnight at 4°C. After incubation with the appropriate secondary antibody for 1 h, the bands were detected using the ChemiDoc™ XRS+ system (Bio-Rad, California, USA). The gray values of protein bands were determined using ImageJ software, and the relative protein expression was calculated by normalizing to GAPDH as an internal reference. Western blot was repeated three times for each protein. Detailed information for all the antibodies is shown in S3 Table.
Cell scratch experiment
Cells were seeded in a 6-well plate and cultured until they reached 90% confluency. The cell layer was then scratched using a 200 μl pipette tip and washed with serum-free RPMI 1640 medium. Pictures were taken at 0 and 24 h in the same position.
Migration and invasion assays
Cell migration and invasion abilities were detected using transwell chambers with an 8-μm pore size (Corning, USA). For cell migration, 5 × 104 cells were seeded in the upper chamber, and 600 μl of medium containing 10% FBS was added to the lower chamber. After 48 h, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Images were captured using an inverted microscope. For cell invasion, a layer of basement membrane matrix was coated in the upper chamber before seeding 5 × 104 cells. All other steps were the same as those in the cell migration experiment. Cell numbers were quantified using ImageJ software.
Flow cytometry
Cell apoptosis was detected using the Annexin V-APC/propidium iodide (PI) apoptosis detection kit (KeyGen Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instructions. In brief, we seeded 5 × 105 cells in a 60mm culture dish and collected 5 × 105 cells after 24 h using trypsin, followed by three washes with PBS. We then resuspended the cells in 500 μl of binding buffer, added 5 μl of Annexin V-APC, and added 5 μl of PI. After incubating in the dark for 10 min, flow cytometry (ACEA Bioscience, USA) analysis was performed, with 2–4×104 cells analyzed in each run.
Co-culture experiments with THP-1 cells
THP-1 cells were seeded in 6-well plates and induced with 100 ng/mL phorbol-12-myristate-13-acetate (PMA) for 24 h to differentiate into M0 macrophages. A cell culture insert (0.4-μm pores; Corning, USA) was placed in a 6-well plate, and ESCC cells were seeded in the insert. After co-culture for 48 h, macrophages were collected for mRNA and protein expression analysis.
Statistical analysis
Data analysis and graphing were performed using R 4.0.2 software and GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA). Paired t tests and unpaired t tests were used for comparisons between two groups, and the one-way ANOVA followed by the Tukey post hoc test was used for comparisons among multiple groups. The chi-square test was used to analyze the correlation between RCN1 expression and clinical pathological factors. Cox regression analysis was used to determine independent prognostic factors for ESCC patients. A p < 0.05 indicated statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001).
Results
RCN1 is highly expressed in ESCC tissues
To elucidate the expression pattern of RCN1 in ESCC tissues, we first analyzed the GSE53625 dataset and the GEPIA database. The results showed that RCN1 mRNA was highly expressed in cancerous tissues (Fig 1A and 1B). Next, we also found that the protein expression level of RCN1 in ESCC tissues was higher than that in paracancerous tissues (Fig 1C and 1D). The above results indicate that the expression of RCN1 is upregulated in ESCC tissues.
(A) Differential expression analysis of RCN1 mRNA in ESCC and paracancerous tissues was performed using the GSE53625 dataset. (B) The mRNA expression levels of RCN1 in ESCC and normal tissues were analyzed using the GEPIA database. (C) Representative immunohistochemical (IHC) images of RCN1 protein expression in ESCC and paraneoplastic tissues (original magnification, × 200). (D) Comparison of the protein expression levels of RCN1 in 80 pairs of ESCC and paraneoplastic tissues. *p <0.05, ***p <0.001, ****p <0.0001.
RCN1 is a potential diagnostic and prognostic marker for patients with ESCC
To investigate the clinical significance of RCN1 expression levels, we utilized the GSE53625 dataset to evaluate the diagnostic and prognostic value of RCN1 in ESCC patients. Receiver operating characteristic (ROC) curve analysis showed that the area under the curve (AUC) was 0.954 (Fig 2A), indicating that RCN1 may be a potential diagnostic biomarker for ESCC patients. The Kaplan–Meier survival analysis showed that increased expression of RCN1 was associated with a poor prognosis in ESCC patients (p = 0.018; Fig 2B). Univariate and multivariate Cox regression analyses revealed that RCN1, age, and stage were independent risk factors for ESCC patients (Fig 2C and 2D). Subsequently, a nomogram was constructed using RCN1, age, and stage to predict the 1, 3, and 5-year overall survival (OS) of ESCC patients (Fig 2E). The calibration curve showed that the nomogram had a certain predictive ability (Fig 2F). These results indicate that RCN1 can serve as an important prognostic biomarker for ESCC patients.
(A) The diagnostic efficiency of RCN1 for ESCC patients was assessed by plotting receiver operating characteristic (ROC) curves. (B) The relationship between RCN1 expression and overall survival (OS) in ESCC patients was analyzed using Kaplan–Meier curves. (C and D) The prognostic risk factors for ESCC patients were analyzed using univariate and multifactorial Cox regression analyzes. (E) Plotting the nomogram predicts the overall survival of ESCC patients at 1, 3, and 5 years. (F) Calibration curve of the nomogram.
Relationship between RCN1 and the clinicopathological characteristics of ESCC patients
To investigate the relationship between RCN1 and the clinicopathological characteristics of ESCC patients, we analyzed the clinical data of ESCC patients in the GSE53625 dataset. As shown in Fig 3, the expression level of RCN1 mRNA was not significantly correlated with age, gander, T stage, or pathological stage (all p > 0.05). However, the increase in RCN1 mRNA expression was significantly associated with the N stage progression (N0 vs. N3, N2 vs. N3) and histological grade (G1 vs. G3, G2 vs. G3) (all p < 0.05). Subsequently, we evaluated the relationship between the protein level of RCN1 and the clinicopathological characteristics of ESCC patients. We analyzed the clinical data of 80 ESCC patients collected from the clinic; according to the median value of the immunohistochemical IRS score, patients with an IRS score ≤6 were classified into the low-expression group, while those with an IRS score >6 were classified into the high-expression group. The results also showed that high expression of the RCN1 protein was significantly associated with lymph node metastasis in ESCC patients (p = 0.026) and advanced pathological stage (p = 0.045) (Table 1). Based on the above results, we hypothesize that RCN1 may participate in the progression of ESCC by promoting tumor metastasis.
(A) Age. (B) Gender. (C) T stage. (D) Pathological stage. (E) Histological grade. (F) N stage.
Knockdown of RCN1 inhibits migration, invasion, and EMT of ESCC cells
To investigate the biological function of RCN1 in ESCC, we first evaluated the protein expression levels of RCN1 in ESCC cell lines (KYSE30, KYSE150, KYSE410, and KYSE510) by western blotting analyses. The results showed that KYSE150 and KYSE410 cells had higher expression levels of RCN1 (Fig 4A). Subsequently, we transfected three types of RCN1 shRNAs (shRCN1#1, shRCN1#2, and shRCN1#3) into KYSE150 and KYSE410 cells and found that sh-RCN1#1 had the highest knockdown efficiency in both cell lines by western blot (Fig 4B and 4C). Therefore, sh-RCN1#1 was used for subsequent studies. Previously, our results suggested that RCN1 was associated with tumor metastasis. To confirm this at the cellular level, we conducted cell scratch and transwell assays. The results showed that knockdown of RCN1 significantly inhibited the migration and invasion abilities of KYSE150 and KYSE410 cells in both the scratch and transwell assays (Fig 4D and 4E). Previous studies have shown that EMT plays an important role in the invasion and metastasis of tumor cells [21]. To confirm whether RCN1 is involved in the regulation of EMT in ESCC cells, we analyzed the expression of an epithelial marker (E-cadherin) and mesenchymal markers (N-cadherin, vimentin) by western blotting. The results showed that the knockdown of RCN1 in KYSE150 and KYSE410 cells significantly increased the expression of E-cadherin and decreased the expression of N-cadherin and Vimentin (Fig 4F). In conclusion, knockdown of RCN1 inhibits the migration and invasion of ESCC cells by suppressing EMT.
(A) Protein expression of RCN1 in four ESCC cell lines (KYSE30, KYSE150, KYSE450, and KYSE510) was analyzed by western blotting. (B and C) The protein expression of RCN1 in the KYSE150 and KYSE410 cell lines was decreased by transfection with shRNAs (shRCN1#1, shRCN1#2, and shRCN1#3). (D) The migration ability of KYSE150 and KYSE410 cells transfected with shRCN1#1 was assessed by scratch experiments. (E) Migration and invasion abilities of KYSE150 and KYSE410 cells transfected with shRCN1#1 were assessed in transwell assays. (F) The expression levels of EMT-related markers (E-cadherin, N-cadherin, and vimentin) in KYSE150 and KYSE410 cells transfected with shRCN1#1 were detected by western blotting. *p <0.05, **p <0.01, ***p <0.001.
Knockdown of RCN1 promotes apoptosis of ESCC cells
Next, we investigated the role of RCN1 in ESCC cell apoptosis. Flow cytometry analysis revealed that knocking down RCN1 significantly increased the apoptosis of KYSE150 and KYSE410 cells (Fig 5A). In addition, western blot analysis revealed a decrease in pro-caspase-3 and an increase in cleaved caspase-3 in two cell lines transfected with shRCN1#1 (Fig 5B). These results suggest that knockdown of RCN1 promotes ESCC cell apoptosis.
(A) The effect of RCN1 knockdown on the apoptosis of KYSE150 and KYSE410 cells was examined using flow cytometry. (B) The effect of RCN1 knockdown on pro-caspase-3 and cleaved caspase-3 protein expression in KYSE150 and KYSE410 cells was examined using western blotting. *p <0.05, **p <0.01.
Knockdown of RCN1 in ESCC cells inhibits M2 macrophage polarization
To investigate the role of RCN1 in the tumor microenvironment, we first analyzed the effect of RCN1 expression on tumor-infiltrating immune cells using the GSE53625 dataset. As shown in Fig 6A, the high-expression group exhibited a significant increase in M2 macrophages, resting natural killer (NK) cells, and eosinophils, while there was also a positive correlation between RCN1 expression and M2 macrophages, as demonstrated in Fig 6B. Previous studies have shown that M2 macrophages can promote the growth, migration, and invasion ability of tumor cells and inhibit immune cell-mediated killing of tumor cells, leading to tumor progression [22]. To confirm that RCN1 can regulate M2 macrophage polarization, we first induced suspension THP-1 cells to adhere to the culture dish as M0 macrophages using PMA. qRT‒PCR results showed a significant upregulation of mRNA levels for the macrophage marker CD68 (Fig 6C). Subsequently, KYSE150 and KYSE410 cells with RCN1 knockdown were cocultured with M0 macrophages, and markers (IL-10, Arg-1, and CD206) of M2 macrophages were detected using qRT‒PCR. The results showed a significant downregulation of IL-10, Arg-1, and CD206 expression in the cocultured macrophages after knockdown of RCN1 in KYSE150 and KYSE410 cells (Fig 6D–6F). These results suggest that knocking down RCN1 inhibits the M2 polarization of macrophages.
(A) Differential analysis of tumor-infiltrating immune cells between the high and low RCN1 expression groups. (B) Correlation of RCN1 expression with M2 macrophages. (C) Differential expression of CD68 mRNA between M0 macrophages differentiated from THP-1 cells. (D-F) The mRNA expression levels of M2 macrophage markers (IL10, Arg-1, and CD206) after coculture of M0 macrophages with ESCC cells. *p <0.05, **p <0.01.
Discussion
RCN1 encodes a highly conserved calcium-binding protein belonging to the CREC family of proteins. Recent studies have shown that RCN1 plays a tumor-promoting role in tumor progression [9, 10, 12, 23]; however, the role of RCN1 in ESCC has not yet been studied. Our study explored the expression pattern, clinical value, and biological role of RCN1 in ESCC and the regulatory role of RCN1 in macrophage polarization.
First, we confirmed that RCN1 is highly expressed in ESCC tissues at both the mRNA and protein levels using the GSE53625 dataset and clinical samples. Previous studies have also reported that RCN1 is highly expressed in lung cancer [12], liver cancer [10], laryngeal carcinoma [24], renal cell carcinoma [25], and prostate cancer [13], which is consistent with our research findings. The results of the ROC curve analysis indicated that RCN1 could serve as a potential diagnostic biomarker. Moreover, our study found that high expression of RCN1 is associated with a poor prognosis in patients, rendering them more likely to develop lymph node metastasis. Therefore, we speculate that RCN1 may promote the progression ESCC by increasing the invasiveness of ESCC cells. Subsequent in vitro experiments also confirmed that knocking down RCN1 inhibited the migration and invasion ability of ESCC cells. An increasing number of studies have confirmed the close correlation between acquisition of the migration and invasion abilities of tumor cells and EMT [26, 27]. Our research results indicate that knockdown of RCN1 can inhibit EMT in ESCC cells, which is consistent with the research results in liver cancer cells [10].
Previous studies have found that calcium influx can regulate cell apoptosis [28]; RCN1 is a calcium-binding protein that participates in regulating the transport of calcium ions. Therefore, we speculate that RCN1 can regulate cell apoptosis. Subsequently, our experimental results also confirmed that knockdown of RCN1 can promote tumor cell apoptosis. Similarly, it has been confirmed in prostate cancer [13] and nasopharyngeal carcinoma [29] that RCN1 can promote tumor progression by inhibiting cell apoptosis.
TAMs have been widely recognized to be closely related to tumor development and metastasis. TAMs are highly plastic, and M1 macrophages with antitumor effects and M2 macrophages with pro-tumor effects can convert into each other under the stimulation of the tumor microenvironment. Multiple studies have shown that M2 macrophages can promote tumor growth, invasion, and metastasis [30, 31]. Therefore, reducing the infiltration or polarization of M2 macrophages is a very promising therapeutic approach. Our analysis of tumor-infiltrating immune cells found that the expression of M2 macrophages was positively correlated with RCN1. Subsequently, through co-culturing M0 macrophages with ESCC cells, we found that knocking down RCN1 resulted in a significant decrease in M2 macrophage markers. These results suggest that knocking down RCN1 can inhibit M2 polarization. Recently, a study in oral squamous cell carcinoma also found that RCN1 can regulate M2 macrophage polarization [32]. Previous studies have shown that RCN1 can downregulate the expression of the PTEN gene [13]. Multiple studies have further confirmed that PTEN serves as a regulatory factor in TAMs, and inhibiting PTEN can promote M2 macrophage polarization by activating the PI3K/AKT signaling pathway [33–35]. Therefore, we speculate that RCN1 may regulate M2 macrophage polarization through the PTEN/PI3K/AKT signaling pathway. We plan to conduct further research to validate our hypothesis. Overall, these findings suggest that RCN1 has multiple pro-tumorigenic roles and is a potential therapeutic target for ESCC.
Despite our findings, there are certain limitations and shortcomings in our study. First, it is necessary to collect specimens from multiple medical centers to evaluate the prognostic and diagnostic value of RCN1 in patients with ESCC. Second, it is necessary to confirm the regulatory role of RCN1 in the biological behavior of ESCC cells and macrophage polarization by overexpressing RCN1. Third, more experiments are needed to verify the regulatory role of RCN1 in macrophage polarization, and the specific regulatory mechanisms need to be further elucidated.
Conclusion
This study confirmed that RCN1 is highly expressed in ESCC tissues and is associated with lymphatic metastasis and poor prognosis, indicating that RCN1 has the potential to serve as a diagnostic and prognostic marker in ESCC patients. Further research revealed that knocking down RCN1 can inhibit ESCC cell migration, invasion, and EMT; promote ESCC cell apoptosis; and suppress M2 macrophage polarization. These results suggest that RCN1 may become a new therapeutic target for ESCC treatment.
Supporting information
S1 Table. Clinicopathological parameters of ESCC cohort in Affiliated Hospital of North Sichuan Medical College.
https://doi.org/10.1371/journal.pone.0302780.s001
(DOCX)
S3 Table. Information of all antibodies used in the experiments.
https://doi.org/10.1371/journal.pone.0302780.s003
(DOCX)
Acknowledgments
We are very grateful to the developers of the GEO and TCGA public databases. We also thank the North Sichuan Medical College Innovation Center for Science and Technology and the Institute of Hepatobiliary, Pancreatic, and Intestinal Disease for providing experimental equipment.
References
- 1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71: 209–249. pmid:33538338
- 2. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA Cancer J Clin. 2016;66: 115–132. pmid:26808342
- 3. Lagergren J, Smyth E, Cunningham D, Lagergren P. Oesophageal cancer. Lancet. 2017;390: 2383–2396. pmid:28648400
- 4. Ozawa M, Muramatsu T. Reticulocalbin, a novel endoplasmic reticulum resident Ca(2+)-binding protein with multiple EF-hand motifs and a carboxyl-terminal HDEL sequence. J Biol Chem. 1993;268: 699–705. pmid:8416973
- 5. Cooper CR, Graves B, Pruitt F, Chaib H, Lynch JE, Cox AK, et al. Novel surface expression of reticulocalbin 1 on bone endothelial cells and human prostate cancer cells is regulated by TNF-alpha. J Cell Biochem. 2008;104: 2298–2309. pmid:18561328
- 6. Grzeskowiak R, Witt H, Drungowski M, Thermann R, Hennig S, Perrot A, et al. Expression profiling of human idiopathic dilated cardiomyopathy. Cardiovasc Res. 2003;59: 400–411. pmid:12909323
- 7. Zhang Y, Ye J, Chen D, Zhao X, Xiao X, Tai S, et al. Differential expression profiling between the relative normal and dystrophic muscle tissues from the same LGMD patient. J Transl Med. 2006;4: 53. pmid:17176482
- 8. Amatschek S, Koenig U, Auer H, Steinlein P, Pacher M, Gruenfelder A, et al. Tissue-wide expression profiling using cDNA subtraction and microarrays to identify tumor-specific genes. Cancer Res. 2004;64: 844–856. pmid:14871811
- 9. Fu H, Chen R, Wang Y, Xu Y, Xia C, Zhang B. Reticulocalbin 1 is required for proliferation and migration of non-small cell lung cancer cells regulated by osteoblast-conditioned medium. J Cell Mol Med. 2021;25: 11198–11211. pmid:34747128
- 10. Wang JW, Ma L, Liang Y, Yang XJ, Wei S, Peng H, et al. RCN1 induces sorafenib resistance and malignancy in hepatocellular carcinoma by activating c-MYC signaling via the IRE1α-XBP1s pathway. Cell Death Discov. 2021;7: 298. pmid:34663798
- 11. Lu W, Chen H, Liang B, Ou C, Zhang M, Yue Q, et al. Integrative analyses and verification of the expression and prognostic significance for RCN1 in glioblastoma multiforme. Front Mol Biosci. 2021;8: 736947. pmid:34722631
- 12. Chen X, Shao W, Huang H, Feng X, Yao S, Ke H. Overexpression of RCN1 correlates with poor prognosis and progression in non-small cell lung cancer. Hum Pathol. 2019;83: 140–148. pmid:30172915
- 13. Liu X, Zhang N, Wang D, Zhu D, Yuan Q, Zhang X, et al. Downregulation of reticulocalbin-1 differentially facilitates apoptosis and necroptosis in human prostate cancer cells. Cancer Sci. 2018;109: 1147–1157. pmid:29453900
- 14. Biswas SK, Allavena P, Mantovani A. Tumor-associated macrophages: functional diversity, clinical significance, and open questions. Semin Immunopathol. 2013;35: 585–600. pmid:23657835
- 15. Yagi T, Baba Y, Okadome K, Kiyozumi Y, Hiyoshi Y, Ishimoto T, et al. Tumour-associated macrophages are associated with poor prognosis and programmed death ligand 1 expression in oesophageal cancer. Eur J Cancer. 2019;111: 38–49. pmid:30822683
- 16. Li J, Xie Y, Wang X, Li F, Li S, Li M, et al. Prognostic impact of tumor-associated macrophage infiltration in esophageal cancer: a meta-analysis. Future Oncol. 2019;15: 2303–2317. pmid:31237146
- 17. Li J, Chen Z, Tian L, Zhou C, He MY, Gao Y, et al. LncRNA profile study reveals a three-lncRNA signature associated with the survival of patients with oesophageal squamous cell carcinoma. Gut. 2014;63: 1700–1710. pmid:24522499
- 18. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43: e47. pmid:25605792
- 19. Li C, Tang Z, Zhang W, Ye Z, Liu F. GEPIA2021: integrating multiple deconvolution-based analysis into GEPIA. Nucleic Acids Res. 2021;49: W242-W246-w6. pmid:34050758
- 20. Newman AM, Liu CL, Green MR, Gentles AJ, Feng W, Xu Y, et al. Robust enumeration of cell subsets from tissue expression profiles. Nat Methods. 2015;12: 453–457. pmid:25822800
- 21. Wei Q, Qian Y, Yu J, Wong CC. Metabolic rewiring in the promotion of cancer metastasis: mechanisms and therapeutic implications. Oncogene. 2020;39: 6139–6156. pmid:32839493
- 22. Chen S, Saeed AFUH, Liu Q, Jiang Q, Xu H, Xiao GG, et al. Macrophages in immunoregulation and therapeutics. Signal Transduct Target Ther. 2023;8: 207. pmid:37211559
- 23. Zhang H, Zhao X, Wang J, Ji W. Development and validation of an immune-related signature for the prediction of recurrence risk of patients with laryngeal cancer. Front Oncol. 2021;11: 683915. pmid:34976784
- 24. Yin X, Wu Q, Hao Z, Chen L. Identification of novel prognostic targets in glioblastoma using bioinformatics analysis. Biomed Eng OnLine. 2022;21: 26. pmid:35436915
- 25. Giribaldi G, Barbero G, Mandili G, Daniele L, Khadjavi A, Notarpietro A, et al. Proteomic identification of reticulocalbin 1 as potential tumor marker in renal cell carcinoma. J Proteomics. 2013;91: 385–392. pmid:23916412
- 26. Lim J, Thiery JP. Epithelial-mesenchymal transitions: insights from development. Development. 2012;139: 3471–3486. pmid:22949611
- 27. Brabletz S, Schuhwerk H, Brabletz T, Stemmler MP. Dynamic EMT: a multi-tool for tumor progression. EMBO J. 2021;40: e108647. pmid:34459003
- 28. Parekh AB, Penner R. Store depletion and calcium influx. Physiol Rev. 1997;77: 901–930. pmid:9354808
- 29. Huang ZH, Qiao J, Feng YY, Qiu MT, Cheng T, Wang J, et al. Reticulocalbin-1 knockdown increases the sensitivity of cells to Adriamycin in nasopharyngeal carcinoma and promotes endoplasmic reticulum stress-induced cell apoptosis. Cell Cycle. 2020;19: 1576–1589. pmid:32436770
- 30. Noy R, Pollard JW. Tumor-associated macrophages: from mechanisms to therapy. Immunity. 2014;41: 49–61. pmid:25035953
- 31. Qian BZ, Pollard JW. Macrophage diversity enhances tumor progression and metastasis. Cell. 2010;141: 39–51. pmid:20371344
- 32. Liu H, Guo H, Wu Y, Hu Q, Hu G, He H, et al. RCN1 deficiency inhibits oral squamous cell carcinoma progression and THP-1 macrophage M2 polarization. Sci Rep. 2023;13: 21488. pmid:38057406
- 33. Shou Y, Wang X, Chen C, Liang Y, Yang C, Xiao Q, et al. Exosomal miR-301a-3p from esophageal squamous cell carcinoma cells promotes angiogenesis by inducing M2 polarization of macrophages via the PTEN/PI3K/AKT signaling pathway. Cancer Cell Int. 2022;22: 153. pmid:35436935
- 34. Zhao S, Mi Y, Guan B, Zheng B, Wei P, Gu Y, et al. Tumor-derived exosomal miR-934 induces macrophage M2 polarization to promote liver metastasis of colorectal cancer. J Hematol Oncol. 2020;13: 156. pmid:33213490
- 35. Yang C, Chen C, Xiao Q, Wang X, Shou Y, Tian X, et al. Relationship between PTEN and angiogenesis of esophageal squamous cell carcinoma and the underlying mechanism. Front Oncol. 2021;11: 739297. pmid:34796109