https://orcid.org/0000-0002-3944-7112
Figures
Abstract
Bartonellosis refers to disease caused by the Bartonella genus of bacteria. The breadth of disease manifestations associated with Bartonella is currently expanding and includes regional lymphadenopathy, rheumatic, ocular, and neurological disorders. The dearth of knowledge regarding diagnosis, treatment and pathogenesis of this disease can be partially attributed to the lack of a reliable small animal model for the disease. For this study, Bartonella henselae, the most common species associated with human disease, was injected into Swiss Webster (SW) mice. When the outcome indicated that productive infection did not occur, SCID/Beige (immune compromised) mice were inoculated. While SW mice may potentially harbor an acute infection, less than 10 days in length, the SCID/Beige model provided a sustained infection lasting up to 30-days. These data indicate that SCID/Beige mice can provide a model to study Bartonella infection, therapeutics, and vector dynamics in the future.
Citation: Bullard RL, Cheslock M, Goud Gadila SK, Maggi RG, Breitschwerdt EB, Saied AA, et al. (2024) A comparison of Bartonella henselae infection in immunocompetent and immunocompromised mice. PLoS ONE 19(2): e0297280. https://doi.org/10.1371/journal.pone.0297280
Editor: Michael F. Minnick, University of Montana, UNITED STATES
Received: October 5, 2023; Accepted: January 2, 2024; Published: February 12, 2024
Copyright: © 2024 Bullard et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting information files.
Funding: The research was funded by an NIH base grant and the Steven and Alexandra Cohen Foundation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: Edward B. Breitschwerdt, DVM holds U.S. Patent No. 7115385; Media and Methods for cultivation of microorganisms, which was issued October 3, 2006. He is a co‐founder, shareholder and Chief Scientific Officer for Galaxy Diagnostics, a company that provides advanced diagnostic testing for the detection of Bartonella species infections. All other authors declare no potential conflicts of interest.
Introduction
Bartonellosis is comprised of many disease manifestations associated with Bartonella spp. infections [1]. These disease states are often self-limiting to mild and require little or no medical intervention [2]. Due to the predominantly self-limiting nature of this disease, the wide array of disease states, and non-standardized methods of detection, diagnosis, and treatment, little is known about this genus of pathogens. However, the clinical definition of bartonellosis is currently expanding and includes manifestations such as angiomatoses, vasculitis, uveitis and even mental health disorders [3–6]. Bartonella spp. utilize vectors for transmission such as fleas, sandflies, lice, and possibly ticks [1, 7–9]. A multitude of Bartonella spp. have been identified in a wide variety of wild and domestic animals such as mice, shrew, rats, cats, dogs, cows, sheep, and macaques [10]. These animals may or may not exhibit clinical indicators of disease, or due to the slow-growing nature of this pathogen, infected animals may have internal masses or inflammation that go undetected clinically. The dearth of knowledge surrounding the pathogens within the Bartonella genus can in part be explained by the lack of a small animal model.
Comparative pathology and One Health approaches may lead to a better understanding of Bartonella within its multiple host populations [11, 12]. Infection with Bartonella species can lead to a prolonged bacteremia in the reservoir host [13–16]. Asymptomatic animal hosts may serve as a reservoir for infection of a larger population, whereby vector transmission contributes to the zoonotic infections with these bacteria [17]. Many Bartonella spp. have been isolated from human specimens including B. koehlerae, B. clarridgeiae, B. rochalimae, and B. alsatica. However, in the United States, B. henselae is the most common Bartonella species of human importance.
There has been varied success in Bartonella infection experiments using Swiss Webster strain (SW) mice. SW mice infected with B. birtlesii developed bacteremia lasting 9 weeks, whereas mice infected with B. elizabethae exhibited minimal infection success with only 2 of 36 mice developing bacteremia [18, 19]. One interesting note is that SW infected with B. birtlesii were inoculated intravenously and mice infected with B. elizabethae were inoculated subcutaneously. This difference could explain some of the bacteremia discrepancies [18, 19]. In another experiment, SW mice were inoculated with 3 human isolates of B. tamiae [20]. These mice were infected subcutaneously in the neck region and experienced thickening of skin at the inoculation site, which resolved in 4 weeks [20]. DNA for each isolate was amplified from tissues from the infection group and mice developed granulomas in the liver and spleen [20]. This model may be useful in evaluation of therapeutics or vector competency for Bartonella species. SW mice were also infected with four rat-derived Bartonella strains subcutaneously [21]. One induced bacteremia indicating some Bartonella species can switch from primary or preferred hosts to incidental hosts. These data indicate one rat-associated strain of Bartonella related to B. coopersplainensis may have the ability to infect mammals other than rats [21]. More investigations, however, should be performed with human pathogenic Bartonella species to determine whether these Bartonella species demonstrate different susceptibility to antimicrobial drugs compared to efficacy against rodent-derived strains. The variation in infection outcomes in the studies above may, at least in part, be due to the host immune status.
People with immunodeficiencies such as HIV/AIDS, cancer therapy, and/or immune-suppressive drugs from transplants are at a higher risk of severe manifestations [22, 23]. The immunocompetent SW mice may have the ability to eliminate the pathogen before there is damage to the host organs. Immunocompromised mice may provide a better research tool for monitoring infection and assessing bacterial spread throughout the host. In one study, researchers inoculated SCID and SCID/Beige mice with B. grahamii, B. birtlesii, B. doshiae, and B. taylorii through intraperitoneal injection [24]. These infections resulted in low-level persistence of B. taylorii in SCID mice and high-level persistence of B. grahamii, B. birtlesii, and B. taylorii in SCID/Beige mice [24]. Spleens remained enlarged at 2 months post-infection, and notable levels of pathology were recognized in the livers of SCID/Beige mice infected with B. taylorii [24]. SCID/Beige mice may serve as a model to study pathology introduced by infection and treatment response with human pathogenic Bartonella species, although further investigation should be performed. Studies involving immune deficient mice have implicated potential as a model, but most research surrounding immune competent mice has not explored systemic and sustained infection in Bartonella species that cause human disease, which will aide in the evaluation of therapeutics for human use [18, 24, 25].
For research purposes, development of a small mammal model to study bartonellosis is advantageous. Our research described here delves into the improvement of a mouse model to study infection patterns. Specific ways to determine pathogenesis in mice include: (1) observing whether B. henselae can infect mice acutely (10 days) or chronically (30 days), (2) determining whether immune status is a factor in the infection model, and (3) observing B. henselae tissue dissemination and pathology at acute timepoints (10 days) and chronic timepoints (30 days).
Materials and methods
Growth of B. henselae
B. henselae (San Antonio 2 strain) was grown on blood agar plates (tryptic soy agar (TSA) with 5% sheep’s blood, Fisher Scientific) at 35°C with 5% CO2. After 6–8 days, colonies were collected and resuspended in sterile 0.9% saline. Inoculums were made from low passage cultures (<5) to decrease the chance of changes in genetic composition.
Mice
Female mice aged 6- to 8- weeks old (Fox Chase SCID Beige mice [strain code: 250] and Swiss Webster mice [strain code: 024]) were purchased from Charles River Laboratories and housed in group housing. Food and water were given ad libitum throughout the course of the experiment. SCID Beige mice were provided with sterile group housing, water, and food throughout. Experimental procedures were performed while mice were anesthetized with 3–5% isoflurane to minimize suffering. At the time of euthanasia, mice were subjected to CO2 until life signs were no longer present followed by cervical dislocation. Practices in the housing and care of mice conformed to the regulations and standards of the Public Health Service Policy on Humane Care and Use of Laboratory Animals, and the Guide for the Care and Use of Laboratory Animals. The Tulane National Primate Research Center (TNPRC) is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care-International. Animal work was approved by and conducted under the supervision of Tulane’s Institutional Animal Care and Use Committee.
Injection and monitoring of infection
Mice were anesthetized with isoflurane and injected subcutaneously with 200uL of inoculum (106 cells/mL in sterile 0.9% saline). Sets of mice (n = 2 controls, 3 experimental each) were humanely euthanized and necropsied at days 10, 20, and 30. Mice were perfused with ice cold 4% paraformaldehyde before tissue removal. Up to 15 tissues were taken at the time of necropsy: brain, ears, thyroid, thymus, heart, lung, liver, kidney, adrenal glands, pancreas, spleen, bladder, tibiotarsal joint, lymph nodes, and bone marrow. Four tissues (brain, heart, liver, kidney) were divided for DNA and pathology. Samples for pathology were placed in cassettes and stored in zinc formalin fixative (Z-fix). Culturing organs in Grace’s insect media from unfixed tissues was attempted but was unsuccessful.
Genomic DNA (gDNA) extraction and PCR
Tissue samples were frozen at -20°C until ready to use. Samples were thawed on ice and a small sample was taken from each and placed in a separate tube. Qiagen DNeasy Blood and Tissue Kits (Qiagen) were used to isolate gDNA. DNA concentration was measured on a Nanodrop Spectrophotometer and stored at -20°C. PCR was performed on all samples using nested vOmp1 primers. (External primers: Bh197676ext FWD—5’ ATTATGCAATTGCTATAGGTTTAGAAGCTGA 3’; Bh198246ext RVS—5’ CAAAGTGAATTCAATTTTATGCTTATTATCTACAG 3’; Internal primers Bh197940int FWD—5’ ACGATCCTGCAGCAAATGCTCCGATAA 3’; Bh198112int RVS—5’ CAGAAATTTTCCAAGCCCCTGCTACCACATCT 3’). Reactions were prepared using Taq polymerase (Qiagen) with the following concentration: 2.5 units Taq DNA polymerase, 1.5mM MgCl2, 200μM of each dNTP, 0.4μM each primer, 250ng gDNA template. Internal reactions contain the same concentration of reagents but take 5μL of the external reaction as the template. External reaction had thermocycling conditions of 95°C for 3 min; 35 cycles of 95°C for 30s, 63°C for 30s, and 72°C for 30s; followed by 72°C for 5 min. The internal reaction utilizes the following thermocycling conditions are used: 95°C for 3 min; 35 cycles of 95°C for 30 and 72°C for 30s; followed by 72°C for 5 min. PCR products were visualized on 2% agarose gel with 0.1% ethidium bromide.
Histopathology
Fixed tissues were cut into 5μm sections and mounted onto slides. Slides were stained with hematoxylin and eosin (H&E) stain and examined by a board-certified veterinary pathologist. Samples were scored on a scale of 0–3 based on the severity of pathology noted: 0 = no significant findings, 1 = minimal findings, 2 = mild findings, and 3 = moderate findings.
Results and discussion
gDNA from B. henselae can be identified in multiple tissues of SCID/beige mice but rarely in SW mice
Mice were examined for B. henselae gDNA using nested PCR of the vOMP1 gene. On day 10, one of 27SW mouse tissues, the heart, was PCR positive. Based on these data, it appears that B. henselae does not develop a productive infection with SW mice. Most mice (all mice in some groups) were Bartonella PCR negative (Table 1). Bartonella gDNA was not identified in any of the control tissues from any of the uninfected mice.
When determining whether immune status is a factor in the infection model, it can clearly be seen that the immune compromised model was successful, whereas the immune competent model was not. A total of 13 tissues were positive for gDNA across all the time points in the SCID/beige group. More tissues containing B. henselae gDNA were identified as time from initial infection progressed, with at least one tissue in each mouse containing gDNA by day 30. The eight tissues containing B. henselae gDNA in the SCID/beige mice euthanized at 30 days post-infection was statistically more than the total number of SW tissues from any of the previous time points (Table 1). Bartonella DNA was amplified from at least one tissue in all except for two SCID/beige mice upon necropsy. It is interesting to note that 4/9 (all data points) and 3/3 (D30) brains were positive for B. henselae DNA. However, B. henselae DNA was not identified in the livers of the mice injected with B. henselae and only in the heart of one mouse and the kidneys of two mice. Seven out of nine mice were infected using the SCID/Beige mice, resulting in significantly more mice infected than the SW model.
Immune compromised mice have been used in the past as a Bartonella model, so these data are not strikingly different than what has been previously published [24]. However, we could assess whether infection resulted in acute or chronic infection. In this case, we observed tissue distribution for bacterial dissemination. Although tissue distribution did increase from 10-days post-infection to 20-days-post infection, bacteria did not appear to further disseminate (Table 1; Fig 1). While none of these differences were statistically significant, bacteria were disseminating over time. These data indicate that SCID/Beige mice develop an acute and chronic infection with B. henselae.
The bladders and brains of 2/3 mice and 3/3 mice were positive for infection, respectively, at 30-days post-inoculation. Other patterns remain unclear as only one mouse each was positive for the other tissues. n = 3 for each time point. Hrt = heart, LR = liver, Spl = spleen, BM = bone marrow, LyN = lymph node, ThM = thymus, ThR = thyroid, LG = lung, K = kidney, Bla = bladder, AG = adrenal glands, P = pancreas, TTJ = tiobiotarsal joint, BR = brain, Ear.
This may also indicate that infection may be occurring in the SW mice, but the resulting infection is extremely acute and resolved before the 10-day timepoint. The acute window for these Bartonella species could be as short as 2–5 days of infection for SW mice with the infection terminated by the immune system. It is also possible that these Bartonella species were not given enough time to cause a patent infection in SW mice. Some experiments found that it took multiple weeks for bacteremia to be established with Bartonella in mice. It is possible the bacteria need a longer incubation period within the primary niche before dissemination occurs.
Prior studies have also indicated that enrichment with Bartonella Alpha-proteobacteria growth medium (BAPGM) may be necessary to grow the bacteria to a level that is detectable by PCR. In the study presented here, we attempted to culture the bacteria from tissues using Grace’s media due to supply issues regarding BAPGM. Although we were ultimately unable to culture viable bacteria from the tissues, the presence of living bacteria cannot be ruled out. The presence of red blood cells in this media enhances Bartonella growth from tissues when compared to other liquid media types known to support Bartonella growth such as Grace’s media. BAPGM has been used to isolate different Bartonella species from humans, dogs and cats [26]. However, it has yet to be applied to mouse models [26–29].
Although suspected, the primary niche of Bartonella is not known [30]. It is possible it was not obtained in these mice and could include a tissue such as the lung, where Bartonella has been found before [31–33]. As stated above, based on these data SW may result in an acute infection that is terminated by the immune system. Another important aspect to consider is that since Bartonella species are transmitted by vectors, a component to allow bacterial persistence is missing. Vector saliva has a multitude of components that allows for saliva-assisted transmission (SAT) [34–36]. Characterized components include vasodilators, immune modulators, and antihistamines that may be imperative for Bartonella to establish an infection [34–37]. Other studies have shown that mice can be infected with B. birtlesii, using Ixodes ricinus [38]. It may be that vector competency is instrumental when attempting to infect immune competent mice. The lack of natural infection may also interfere with the protein expression and overall structure of the B. henselae. A previous study examined changes in the structure of B. henselae (Houston 1) from in vitro cultured bacteria and the same strain harvested from infected mice. This study identified changes in relative abundance of the bacteria as well as changes to the outer surface with a reduction of fimbriae in colonies grown from mouse blood. These structural changes may play a significant role in the histopathological findings of both the Velho et al. study [39] and the present data.
Immunocompetent mice exhibit pathological changes in the liver and kidneys
To determine if the mice developed any degree of disease or altered function due to the infection, the hearts and brains of SW and SCID/beige mice infected for 30 days were fixed in Z-fix and processed for histology. None of the brains or hearts had significant pathological findings despite all the SCID/beige brains containing B. henselae gDNA (Tables 2 and 3).
Immunocompromised patients who have become infected with Bartonella spp. often show symptoms related to kidney and liver pathology in the form of bacillary angiomatosis and peliosis hepatis. For this reason, we harvested these tissues from immunocompromised mice for histological analysis. After 30 days of infection, two of the three mice had pathological lesions (Fig 2). Additionally, the immune compromised nature of this strain of mouse made them more susceptible to pathological changes earlier in the infection process. Granulomatous hepatitis has been reported in humans, a dog, and a horse infected with B. henselae. Hepatic manifestations of B. henselae often include irregular microabscesses surrounded by histiocytes, lymphocytes and a layer of fibrous tissue. Other manifestations include small granulomas with giant cells and small foci of necrosis [40]. The immune compromised model described here further substantiates this pathology [41, 42]. Heart, brain, liver, and kidneys were collected from mice infected for 10- and 20-days and prepared for histological analysis. Table 4 compares the presence of Bartonella gDNA to changes in pathology from all SCID/beige mice. When compared in this manner, only one mouse (WG33) had histological differences in the same tissue that contained Bartonella gDNA; however, only a minimal mineralization of a blood vessel was noted that is likely an artifact from the necropsy or staining process (S1 Fig) Bartonella homing to the brain may be an important component in pathogenesis and may help us understand neurological symptoms occurring in human patients in the future. Although brain was positive for B. henselae DNA by PCR, there were no lesions or irregularities within the brain sections used for pathological analysis. It is possible that a low bacterial burden or length of infection was not sufficient to produce pathology in this location.
(A, B) Mice were necropsied 10 dpi and tissues were stained with H&E stain for histopathological analysis. (A) Liver sections were found to contain mild multifocal portal mononuclear and suppurative infiltrations; (B) Heart sections contained focally extensive, moderate mononuclear epicarditis with extensions into the myocardium. (C,D) Tissues from 20 dpi with B. henselae. (C) Liver sections contained mild multifocal portal mononuclear infiltrations with minimum extramedullary hematopoiesis; (D) Heart sections contained minimal multifocal mineralization of the blood vessels (arrows). (E,F) Tissues from mice 30 dpi with B. henselae. Livers from two different mice contained (E) mild multifocal portal mononuclear inflammation and (F) focal granuloma in the peritoneal fat with minimal portal mononuclear infiltration. All scale bars = 250μm.
At time points prior to 30-days post infection, histopathological changes can be identified in the hearts of two mice. One mouse was found to have mononuclear epicarditis and the other had multifocal mineralization of the blood vessels that were not considered to be artifacts of the staining process. In human cases, B. quintana is more closely related to infectious endocarditis. However, one case study found vegetation of the aortic valve and an abscess near the mitral valve interfering with its function. Histopathological examination revealed infiltrates of mononuclear cells and macrophages, vascular neoformation, and fibrosis [43]. These findings are more advanced but still correlate to the findings in the mouse heart tissues.
Conclusions
Overall, our data indicate a limited model to study bartonellosis within a mouse. The use of SCID/Beige mice may help explore questions about infection and treatment in relationship to B. henselae. While antibiotic susceptibility has been studied in vitro, the use of a mouse to study in vivo results can validate and assist with discerning treatment regimen efficacy for people experiencing serious disease manifestations [44].
An important consideration with these experiments is the use of a needle to inoculate the mice. In nature, the source of infection is likely a hematophagous vector, such as a flea, tick, or other vector [45, 46]. However, needle stick transmission of Bartonella to veterinarians from an infected cat or dog supports transmission of virulent bacteria directly from an infected host. For future studies, the use of a vector in facilitating infection is recommended and may improve our understanding of the significant role a vector plays in transmission to mammals. With such ubiquity within animals and vectors, and the extensive manifestations surrounding bartonellosis, developing an animal model will open opportunities to study the many mysterious qualities of disease, such as vector competency, improved diagnostic modalities, and effective therapeutics for patients infected with B. henselae.
Supporting information
S1 Fig. Kidney from a mouse 30 dpi Bartonella henselae infection.
Arrow indicates the formation of visible mineralization. This type of mineralization is considered to be an artifact of the staining process and not a true pathology.
https://doi.org/10.1371/journal.pone.0297280.s001
(TIF)
Acknowledgments
The authors would like to thank Drs. Timothy Haystead and David Alcorta for their collaboration on testing therapeutic interventions for Bartonella and for their subject matter expertise.
References
- 1. Cheslock MA, Embers ME. Human bartonellosis: An underappreciated public health problem? Trop Med Infect Dis. 2019;4. pmid:31010191
- 2. Zangwill KM. Cat Scratch Disease and Bartonellaceae: The Known, the Unknown and the Curious. Pediatr Infect Dis J. 2021;40(5s):S11–s5. pmid:34042905
- 3. Puri K, Kreppel AJ, Schlaudecker EP. Bartonella Osteomyelitis of the Acetabulum: Case Report and Review of the Literature. Vector Borne Zoonotic Dis. 2015;15(8):463–7. pmid:26273806
- 4. Balakrishnan N, Ericson M, Maggi R, Breitschwerdt EB. Vasculitis, cerebral infarction and persistent Bartonella henselae infection in a child. Parasit Vectors. 2016;9(1):254. pmid:27161220
- 5. Matta S, Rousseau A, Chenouard R, Lemarié C, Eveillard M, Kempf M, et al. Cerebral epidural empyema due to Bartonella henselae: a case report. BMC Infect Dis. 2021;21(1):765. pmid:34362324
- 6. Maggi RG, Kosoy M, Mintzer M, Breitschwerdt EB. Isolation of Candidatus Bartonella melophagi from human blood. Emerg Infect Dis. 2009;15(1):66–8. pmid:19116054
- 7. Chomel BB, Kasten RW, Floyd-Hawkins K, Chi B, Yamamoto K, Roberts-Wilson J, et al. Experimental transmission of Bartonella henselae by the cat flea. J Clin Microbiol. 1996;34(8):1952–6. pmid:8818889
- 8. Regier Y, Ballhorn W, Kempf VA. Molecular detection of Bartonella henselae in 11 Ixodes ricinus ticks extracted from a single cat. Parasit Vectors. 2017;10(1):105. pmid:28285589
- 9. Cherry NA, Jones SL, Maggi RG, Davis JL, Breitschwerdt EB. Bartonella spp. infection in healthy and sick horses and foals from the southeastern United States. J Vet Intern Med. 2012;26(6):1408–12. pmid:22998229
- 10. Jones SL, Maggi R, Shuler J, Alward A, Breitschwerdt EB. Detection of Bartonella henselae in the blood of 2 adult horses. J Vet Intern Med. 2008;22(2):495–8. pmid:18346149
- 11. Breitschwerdt EB. Bartonellosis, One Health and all creatures great and small. Vet Dermatol. 2017;28(1):96–e21. pmid:28133871
- 12. Breitschwerdt EB, Linder KL, Day MJ, Maggi RG, Chomel BB, Kempf VA. Koch’s postulates and the pathogenesis of comparative infectious disease causation associated with Bartonella species. J Comp Pathol. 2013;148(2–3):115–25. pmid:23453733
- 13. Brouqui P, Lascola B, Roux V, Raoult D. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med. 1999;340(3):184–9. pmid:9895398
- 14. Chomel BB, Henn JB, Kasten RW, Nieto NC, Foley J, Papageorgiou S, et al. Dogs are more permissive than cats or guinea pigs to experimental infection with a human isolate of Bartonella rochalimae. Vet Res. 2009;40(4):27. pmid:19272295
- 15. Abbott RC, Chomel BB, Kasten RW, Floyd-Hawkins KA, Kikuchi Y, Koehler JE, et al. Experimental and natural infection with Bartonella henselae in domestic cats. Comp Immunol Microbiol Infect Dis. 1997;20:41–51.
- 16. Eremeeva ME, Gerns HL, Lydy SL, Goo JS, Ryan ET, Mathew SS, et al. Bacteremia, Fever, and Splenomegaly Caused by a Newly Recognized Bartonella Species. N Engl J Med. 2007;356(23):2381–7. pmid:17554119
- 17. Gomes C, Ruiz J. Carrion’s Disease: The Sound of Silence. Clin Microbiol Rev. 2018;31. pmid:29187394
- 18. Marignac G, Barrat F, Chomel B, Vayssier-Taussat M, Gandoin C, Bouillin C, et al. Murine model for Bartonella birtlesii infection: New aspects. Comp Immunol Microbiol Infect Dis. 2010;33:95–107.
- 19. Colton L, Kabeya H, Kosoy M. Experimental infection of three laboratory mouse stocks with a shrew origin Bartonella elizabethae strain: an evaluation of bacterial host switching potential. Infect Eco Epidemiol. 2012;2(1).
- 20. Colton L, Zeidner N, Lynch T, Kosoy MY. Human isolates of Bartonella tamiae induce pathology in experimentally inoculated immunocompetent mice. BMC Infect Dis. 2010;10(229). pmid:20673363
- 21. Colton L. Laboratory Mouse Models for Bartonella Bacterial Infection: Bacteremia, Host Specificity, and Pathology. Dissertation. 2011.
- 22. Lamas CC, Mares-Guia MA, Rozental T, Moreira N, Favacho AR, Barreira J, et al. Bartonella spp. infection in HIV positive individuals, their pets and ectoparasites in Rio de Janeiro, Brazil: serological and molecular study. Acta Trop. 2010;115(1–2):137–41. pmid:20206113
- 23. Mosepele M, Mazo D, Cohn J. Bartonella infection in immunocompromised hosts: immunology of vascular infection and vasoproliferation. Clin Dev Immunol. 2012;2012:612809. pmid:22162717
- 24. Chiaraviglio L, Duong S, Brown DA, Birtles RJ, Kirby JE. An Immunocompromised Murine Model of Chronic Bartonella Infection. Am J Pathol. 2010;176(6):2753–63.
- 25. Choi EW, Lee HW, Lee JS, Kim IY, Shin JH, Seong JK. Ahnak-knockout mice show susceptibility to Bartonella henselae infection because of CD4+ T cell inactivation and decreased cytokine secretion. BMB Rep. 2019;52(4):289–94.
- 26. Pultorak EL, Maggi RG, Mascarelli PE, Breitschwerdt EB. Serial testing from a 3-day collection period by use of the Bartonella Alphaproteobacteria growth medium platform may enhance the sensitivity of Bartonella species detection in bacteremic human patients. J Clin Microbiol. 2013;51(6):1673–7. pmid:23486720
- 27. Breitschwerdt EB, Broadhurst JJ, Cherry NA. Bartonella henselae as a cause of acute-onset febrile illness in cats. JFMS Open Rep. 2015;1(2):2055116915600454. pmid:28491382
- 28. Balakrishnan N, Musulin S, Varanat M, Bradley JM, Breitschwerdt EB. Serological and molecular prevalence of selected canine vector borne pathogens in blood donor candidates clinically healthy colunteers and stray dogs in North Carolina. Parasit Vectors. 2014;7(116).
- 29. Davenport AC, Mascarelli PE, Maggi R, Breitschwerdt EB. Phylogenetic Diversity of Bacteria Isolated from Sick Dogs Using the BAPGM Enrichment Culture Platform. J Vet Intern Med. 2013;27:854–61. pmid:23647339
- 30. Dehio C. Molecular and cellular basis of bartonella pathogenesis. Annu Rev Microbiol. 2004;58:365–90. pmid:15487942
- 31. Marseglia GL, Monafo V, Marone P, Meloni F, Martini A, Burgio GR. Asymptomatic persistent pulmonary infiltrates in an immunocompetent boy with cat-scratch disease. Eur J Pediatr. 2001;160(4):260–1. pmid:11317652
- 32. Bandyopadhyay A, Burrage LC, Gonzalez BE. Pulmonary nodules in an immunocompetent child with cat scratch disease. Pediatr Infect Dis J. 2013;32(12):1390–2. pmid:24030347
- 33. Moore EH, Russell LA, Klein JS, White CS, McGuinness G, Davis LG, et al. Bacillary angiomatosis in patients with AIDS: multiorgan imaging findings. Radiology. 1995;197(1):67–72. pmid:7568856
- 34. Šimo L, Kazimirova M, Richardson J, Bonnet SI. The Essential Role of Tick Salivary Glands and Saliva in Tick Feeding and Pathogen Transmission. Front Cell Infect Microbiol. 2017;7:281. pmid:28690983
- 35. Nuttall PA, Labuda M. Tick-host interactions: saliva-activated transmission. Parasitology. 2004;129 Suppl:S177–89. pmid:15938511
- 36. Kotal J, Langhansova H, Lieskovska J, Andersen JF, Francischetti IM, Chavakis T, et al. Modulation of host immunity by tick saliva. J Proteomics. 2015;128:58–68. pmid:26189360
- 37. Wikel S. Ticks and tick-borne pathogens at the cutaneous interface: host defenses, tick countermeasures, and a suitable environment for pathogen establishment. Front Microbiol. 2013;4:337. pmid:24312085
- 38. Reis C, Cote M, Le Rhun D, Lecuelle B, Levin ML, Vayssier-Taussat M, et al. Vector Competence of the Tick Ixodes ricinus for Transmission of Bartonella birtlesii. PLoS Negl Trop Dis. 2011;5(5):e1186. pmid:21655306
- 39. Velho PENF, Moraes AMd, Uthida-Tanaka AM, Cintra ML, Gigliogi R Ultrastructural Changes in a Standard Strain of Bartonella henselae After Passages Throught BALBcAn Mice. Ultrastruct Pathol. 2002;26:161–9.
- 40.
Masia R, Misdraji J. Liver and Bile Duct Infections. In: Kradin RL, editor. Diagnostic Pathology of Infectious Disease. 2 ed 2018. p. 272–322.
- 41. Setlakwe EL, Sweeney R, Engiles JB, Johnson AL. Identification of Bartonella henselae in the liver of a thoroughbred foal with severe suppurative cholangiohepatitis. J Vet Intern Med. 2014;28(4):1341–5. pmid:24814868
- 42. Gillespie TN, Washabau RJ, Goldschmidt MH, Cullen JM, Rogala AR, Breitschwerdt EB. Detection of Bartonella henselae and Bartonella clarridgeiae DNA in hepatic specimens from two dogs with hepatic disease. J Am Vet Med Assoc. 2003;222(1):47–51. pmid:12523479
- 43. Goncalves-Oliveira J, Damasco PV, Assis M, Freitas DE, Pessoa Junior AA, de Sousa LS, et al. Infectious endocarditis caused by Bartonella henselae associated with infected pets: two case reports. J Med Case Rep. 2023;17(1):143.
- 44. Gadila SKG, Embers ME. Antibiotic Susceptibility of Bartonella Grown in Different Culture Conditions. Pathogens. 2021;10(6). pmid:34201011
- 45. Cotte V, Bonnet S, Le Rhun D, Le Naour E, Chauvin A, Boulouis HJ, et al. Transmission of Bartonella henselae by Ixodes ricinus. Emerg Infect Dis. 2008;14(7):1074–80. pmid:18598628
- 46. Kernif T, Leulmi H, Socolovschi C, Berenger J-M, Lepidi H, Bitam I, et al. Acquisition and excretion of Bartonella quintana by the cat flea, Ctenocephalides felis felis. Mol Ecol. 2014;23(5):1204–12. pmid:24400877