Ethics statement

Mouse blood used in this study was purchased from BioLASCO Taiwan Co., Ltd. (http://www.biolasco.com.tw), a certified commercial supplier. The company operates in full compliance with the Guide for the Care and Use of Laboratory Animals, all relevant national regulations governing the use of live vertebrate animals in research, and the ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. The use of mouse blood (111134_2023.11.24) in this study was approved by the Institutional Animal Care and Use Committee of the National Health Research Institutes (NHRI-IACUC-107054-A).

Mosquito strains and rearing conditions

WT Ae. aegypti and Ae. albopictus strains were established from larvae and eggs collected through routine entomological surveillance in Kaohsiung City by the National Mosquito-Borne Diseases Control and Research Center (NHRI, Taiwan). Sampling was conducted in four administrative surveillance districts, with approximately 80 ovitraps deployed across multiple field sites to capture spatially representative mosquito populations. Collected specimens were pooled to establish laboratory colonies, ensuring broad representation of local genetic diversity. Mosquitoes were maintained at 28 ± 1 °C and 70 ± 10% relative humidity under a 12 h light/12 h dark photoperiod. Adults were allowed to mate randomly, and females were fed defibrinated, pathogen-free mouse blood (purchased from BioLASCO Taiwan) using an artificial membrane feeding system (Orinno Technology Pte. Ltd., Singapore). Eggs were hatched after 2 days in dechlorinated water, and larvae were reared in plastic trays and fed a 1:1 mixture of yeast powder (Taiwan Sugar Corp.) and goose liver powder (7573, NTN Corporation, Taiwan). Pupae were transferred to acrylic cages for adult emergence, and adult mosquitoes were provided with a constant supply of 10% sucrose solution.

Establishment of a Taiwan-derived wAlbB-infected Aedes aegypti line

A local wAlbB-infected Ae. aegypti line was established via embryonic microinjection using cytoplasmic extract from wild Ae. albopictus eggs collected in Kaohsiung, Taiwan, following protocols modified from Xi et al. [38,39]. Briefly, 4–6-day-old Ae. albopictus females collected from the field were dissected under sterile conditions to isolate ovaries. Ovarian tissues were homogenized in phosphate-buffered saline (PBS) and filtered through a 5 µm membrane to obtain a Wolbachia-containing cytoplasmic suspension. Freshly laid Ae. aegypti embryos (0–1 h post-oviposition) were aligned on coverslips coated with double-sided adhesive tape and overlaid with halocarbon oil to prevent desiccation. Approximately 1–2 nL of the cytoplasmic suspension was injected into the posterior pole of each embryo using a fine glass capillary under a micromanipulator system. Injected embryos were incubated at 25–28 °C under high humidity until hatching. F₀ larvae were reared to adulthood and crossed with WT Ae. aegypti to produce F₁ progeny. In each subsequent generation, wAlbB-infected individuals were selected and backcrossed with WT Ae. aegypti for at least nine generations to ensure genetic background homogenization and stable maternal transmission of Wolbachia. At each generation, backcrossing was performed using population-level WT mosquitoes derived from the established field colony, rather than individuals from a single lineage. The WT colony was maintained at a large population size to minimize potential genetic drift during introgression and to preserve the representative local genetic background. Female mosquitoes in each generation were screened for wAlbB infection using specific PCR primers (forward: 5′-ACGTTGGTGGTGCAACATTTG-3′; reverse: 5′-TAACGAGCACCAGCATAAAGC-3′). The resulting wAlbB-infected Ae. aegypti strain (designated wAlbB-Tw) consistently maintained an infection rate above 95% and was used for all subsequent experiments.

Genomic sequencing and comparative analysis of Wolbachia

Total DNA was extracted from laboratory colonies of Ae. aegypti infected with the Wolbachia strain wAlbB using a standard phenol–chloroform protocol with RNase treatment. DNA quality and concentration were assessed by fluorometry and agarose gel electrophoresis. Long-read whole-genome sequencing was carried out on the Oxford Nanopore MinION platform with a ligation-based library preparation kit. De novo assembly of sequencing reads was performed using standard long-read workflows optimized for bacterial genomes. The assembled contigs were taxonomically classified to confirm their Wolbachia origin and annotated with the NCBI Prokaryotic Genome Annotation Pipeline. Comparative analysis with publicly available references indicated that the assembled genome is highly similar to wAlbB (accession no. CP031221.1) and clearly distinct from wAlbA (accession no. CP101657.1), thereby supporting the identity of the Wolbachia strain used in this study.

Phylogenetic analysis of Wolbachia genomes

To determine the evolutionary placement of the transinfected wAlbB-Tw-Kao strain, comparative phylogenomic analyses were conducted using representative Wolbachia genomes from Supergroups A and B. Complete genome sequences were retrieved from NCBI GenBank, including wAlbB reference strains (e.g., CP031221.1 and wAlbB-Uju), wAlbA (CP101657.1), wMel, wRi, and wPip. All genomes were re-annotated using Prokka v1.14.6 to ensure consistent gene prediction across datasets [40]. Single-copy core genes shared among all genomes were identified using Roary v3.13.0 with a 95% sequence identity threshold [41]. The resulting core gene sequences were concatenated to generate a core-genome alignment. Maximum-likelihood phylogenetic reconstruction was performed using RAxML v8.2.12 under the GTR + Γ nucleotide substitution model with 1,000 bootstrap replicates to assess branch support [42]. The resulting phylogeny placed wAlbB-Tw-Kao within the Supergroup B clade, clustering with previously characterized wAlbB strains and clearly separated from Supergroup A lineages.

Quantification of wAlbB density by real-time PCR

To enable absolute quantification of wAlbB copy number in mosquito samples, we developed a SYBR Green–based real-time PCR assay targeting the CinA gene of the wAlbB strain, with absolute copy numbers derived from a plasmid standard curve [43]. Primer sequences were designed based on the wAlbB CinA gene and evaluated for specificity by in silico alignment against the wAlbA reference genome (CP101657.1), which revealed multiple mismatches in the primer binding regions. A pair of cloning primers (wAlbB-CinA Q-PCR fragment cloning F: AGGGAATTGGGAATTCCCGCGGGGAGCAATCTATTTCCTC and R: CCTCGAGCCGCGGCCGCACTTACCCCTTGTCTACTTGGA) was designed to amplify the target region using genomic DNA from Ae. albopictus as a template. The resulting amplicon was cloned into the EcoRI and NotI sites of a doubly digested pUAST-attB plasmid using the In-Fusion HD Cloning Kit (Takara Bio, Japan). The recombinant plasmid, designated pUAST-attB_wAlbB-CinA, was purified using the Plasmid Midi Kit (Qiagen, Germany) and quantified spectrophotometrically. A ten-fold serial dilution (4 ng to 400 fg) was prepared, corresponding to a theoretical range of 2.2 × 10⁹ to 4.63 × 10⁴ copies per reaction, based on plasmid size and molecular weight. Quantitative PCR reactions were performed in triplicate using the specific primer pair (wAlbB-CinA Q-PCR-F: CCGCGGGGAGCAATCTATTT and Q-PCR-R: ACTTACCCCTTGTCTACTTGGA) and the KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich), on an ABI ViiA7 system. Each 10 μL reaction contained 2 μL of plasmid DNA, 0.125 μM of each primer, and SYBR master mix, following the manufacturer’s protocol. Thermal cycling conditions were: 95 °C for 3 min; 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Melt curve analysis confirmed specificity of amplification. The standard curve was generated by plotting the cycle threshold (Ct) values against the logarithm of the input plasmid copy number. Linear regression analysis yielded a slope of –3.49 and an intercept of 40.359 (R² = 0.9969), indicating high amplification efficiency (E = 93.4%). This equation (Copy number = 10^ [(40.359 – Ct)/3.49]) was subsequently used to determine the absolute copy number of wAlbB in biological samples. Samples with inconsistent triplicate results or Ct values exceeding 35 were excluded from analysis.

Immunofluorescence staining and confocal imaging of wAlbB in mosquito tissues

Dissections of wAlbB-Tw-Kao male mosquitoes (1 day old; n = 6) and female mosquitoes (18–20 h post-blood feeding; n = 6) were performed under a stereo microscope. The testes and ovaries were carefully isolated and fixed on ice in 4% paraformaldehyde with 1% Triton X-100 in PBS for 2 h, followed by fixation in 4% paraformaldehyde in PBS for 30 min. Tissues were then washed three times with 0.3% PBS–Triton X-100 for permeabilization and subsequently blocked with 5% normal goat serum in 0.3% PBS–Triton X-100 at 4 °C overnight. Tissues were incubated overnight at 4 °C with a rabbit polyclonal anti-Wolbachia antibody (1:500; BOSTER, DZ33973–1) [35]. To confirm staining specificity, negative controls were processed in parallel with omission of the primary antibody. No specific fluorescence signal was detected in these controls. The anti-Wolbachia antibody recognizes a conserved Wolbachia surface protein and has been validated in previous studies for detection of Wolbachia in Aedes mosquitoes [44]. As the wAlbB-Tw-Kao line harbors only the wAlbB strain and not wAlbA (confirmed by genomic and PCR analyses), cross-reactivity with other Wolbachia strains was not applicable in this experimental context. After three washes with 0.3% PBS–Triton X-100 (0.1% PBS–Triton X-100 for midgut samples), tissues were incubated overnight at 4 °C with Alexa Fluor 488–conjugated goat anti-rabbit IgG (1:500 in PBS–Triton X-100), together with DAPI (1:1000) and Phalloidin Alexa Fluor 647 (1:100; Invitrogen, A22283). Samples were mounted on slides with antifade mounting medium (Vectashield, H-1000) and imaged using a Leica TCS SP5 II confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany).

Cytoplasmic Incompatibility (CI) assay

CI levels were assessed using a cage-based cross-mating assay, following the protocol described by Zabalou et al. [45], with modifications. All crosses were conducted at 28 °C under controlled laboratory conditions. The following four mating combinations were tested: WT male × WT female, wAlbB-Tw-Kao male × WT female, WT male × wAlbB-Tw-Kao female, and wAlbB-Tw-Kao male × wAlbB-Tw-Kao female. For each mating combination, 20 virgin females (3 days old) and 20 virgin males (3 days old) were introduced into a mating cage, with three biological replicates per cross. After mating, females were blood-fed using an artificial membrane feeding system and allowed to oviposit on moist filter paper. Eggs were matured on the filter paper for 5 days, then submerged in deoxygenated water under vacuum conditions to stimulate hatching. After 3 days, the number of hatched larvae was counted, and the hatch rate was calculated as an indicator of CI expression.

Virus strains and maintenance

The TW2015 strain of DENV serotype 2 (DENV-2; GenBank accession no. KU365901) and the Zika virus (ZIKV) strain PRVABC59 were obtained from the Taiwan Centers for Disease Control (Taiwan CDC) and propagated in Vero cells. Briefly, Vero cells were seeded in 175 cm² culture flasks and grown at 28 °C to approximately 80% confluency. Cells were then infected at a multiplicity of infection (MOI) of 0.5 for 3 h at 28 °C. Following infection, the inoculum was removed and replaced with fresh culture medium. The cultures were maintained at 28 °C for 5 days to allow virus replication. Supernatants were harvested, clarified by filtration through a 0.22 μm membrane filter, aliquoted, and stored at −80 °C until use. Viral titers were determined by plaque assay on BHK-21 cells.

Oral viral infection and saliva collection

Fresh mouse blood was centrifuged at 4 °C for 10 min to separate plasma and cellular components. The plasma was heat-inactivated at 55 °C for 1 h to eliminate complement activity that may otherwise interfere with viral infectivity during oral challenge assays [46,47]. The treated plasma and washed blood cells were then recombined. Virus stocks of DENV-2 (TW2015) or ZIKV were diluted in treated mouse blood to a final concentration of 2 × 10⁷ plaque-forming units per milliliter (PFU/mL). Female mosquitoes (5–7 days old) were allowed to feed on virus-infected blood for 30 min using an artificial membrane feeding system. Across independent biological replicates, approximately 60 mosquitoes were offered infectious blood per group, from which ~40 fully engorged females were obtained (average feeding rate ≈ 70%). Only fully engorged mosquitoes were retained for downstream analyses. At 5, 10, and 15 days post-blood meal (PBM), midguts, salivary glands, and saliva were collected from a total of 40 mosquitoes per group. Saliva was harvested following a previously described protocol [48]. Briefly, the wings and legs of each mosquito were removed, and the proboscis was inserted into a 200-μL pipette tip containing 5 μL of fetal bovine serum (FBS). After 30 min, the saliva-containing FBS was mixed with 45 μL of serum-free RPMI medium and subjected to plaque assay to quantify infectious viral particles. Viral infection rates (IR) were defined as the proportion of mosquitoes with detectable infectious virus in the midgut as determined by plaque assay. For viral titer quantification, tissues from infected individuals were analyzed individually using standard plaque assays on BHK-21 cells. Samples with no detectable plaques were recorded as uninfected and excluded from mean viral titer calculations but included in IR analyses. Uninfected blood-fed mosquitoes were included as negative controls to confirm the specificity of viral detection in both midgut and saliva samples.

Plaque assay

To determine the titers of DENV-2 and ZIKV, BHK-21 cells were seeded at a density of 2 × 10⁵ cells per well in six-well plates and incubated for 24 h at 37 °C in an incubator. Virus-containing supernatants were serially diluted (10 ⁻ ¹ to 10 ⁻ ⁶) in Dulbecco’s Modified Eagle Medium (DMEM) and added to the BHK-21 monolayers. After 2 h of adsorption, the inoculum was removed and the cells were washed with PBS. The infected cells were then overlaid with DMEM supplemented with 1% methyl cellulose and 5% FBS, and incubated for 5 days at 37 °C. Following incubation, the overlay medium was removed, and cells were fixed and stained with 0.5% crystal violet solution [49]. Uninfected midgut and saliva samples from blood-fed mosquitoes were processed in parallel as negative controls to confirm assay specificity and exclude background contamination. Visible plaques were counted, and viral titers were expressed as PFU/mL.

Insecticide susceptibility bioassay

Mosquito knockdown and mortality rates were quantified using space spray protocols previously described by Gray et al. [50]. Female mosquitoes from three Ae. aegypti strains were tested: a WT field-derived strain collected from Kaohsiung, Taiwan; the Wolbachia-infected wAlbB-Tw-Kao strain; and the laboratory-maintained Liverpool strain known to be insecticide-susceptible. Non-blood-fed female mosquitoes aged 3–5 days were used in all bioassays to minimize physiological variability that may influence insecticide susceptibility. At the time of testing, the WT colony had been maintained at F6–F7 following field establishment, while the wAlbB-Tw-Kao line had undergone nine generations of backcrossing with this field-derived WT population and was maintained at F7–F9 prior to experimental evaluation. Three insecticides commonly used in Taiwan were tested at two concentrations each: etofenprox at 4000 ppm and 250 ppm, cypermethrin at 150 ppm and 9.4 ppm, and permethrin at 1 ppm and 0.25 ppm. For each treatment, 25 female Ae. aegypti mosquitoes from a single strain were placed in a cylindrical nylon-mesh bioassay cage (approximately 10 × 5 cm) suspended 30 cm above the floor. Prior to exposure, cages were acclimated for 30 min in a sealed room (3.1 × 2.3 × 3 m) with no air circulation. Technicians wearing appropriate personal protective equipment (gloves and masks) applied the insecticide using a horizontal spraying angle for 10s. Each insecticide treatment was replicated three times. Knockdown was assessed by 30 min post-exposure, defined as the inability of a mosquito to fly (including dead individuals). Mortality was recorded 24 h after spraying.

Female fecundity assessment

To evaluate the effect of wAlbB-Tw-Kao infection on female fecundity, 3- to 7-day-old female mosquitoes were used in the assay. Four mating combinations between WT and wAlbB-Tw-Kao mosquitoes were tested. Each combination included three independent biological replicates with 20 females per replicate (total n = 60 females per cross). After a 3-day mating period, females were blood-fed on mouse blood using an artificial membrane feeding system. Following blood feeding, non-blood-fed females and all males were removed from the cages. Three days after blood feeding, female mosquitoes were anesthetized on ice for 5 min and then transferred individually into plastic vials for egg collection. Each vial contained 3 mL of water and a piece of filter paper (3 × 2 cm²). After an additional 3 days, the number of eggs laid by each female on the filter paper was counted, followed by assessments of hatching rate and adult emergence. Females that died during the experiment were excluded from the analysis.

Mating capability assay

To assess the mating competitiveness of wAlbB-Tw-Kao males, four crossing combinations were established: (1) female (♀) wAlbB-Tw-Kao × male (♂) wAlbB-Tw-Kao, (2) ♀wAlbB-Tw-Kao × ♂WT, (3) ♀WT × ♂wAlbB-Tw-Kao, and (4) ♀WT × ♂WT. For each cross, five 3-day-old males and twenty 3-day-old virgin females were placed in transparent acrylic cages (30 × 30 × 30 cm) under standard insectary conditions. After 2 h of mating opportunity, females were collected, and their spermathecae were dissected under a stereo microscope to determine the presence of sperm as an indicator of successful insemination. The mating success rate was calculated as the proportion of inseminated females relative to the total number dissected. Each experiment was repeated three times.

Adult mosquito longevity assay

To evaluate adult mosquito longevity, experiments were conducted under both laboratory and semi-field simulated conditions [51]. Twenty virgin male or female WT and wAlbB-Tw-Kao mosquitoes (3 days old) were individually introduced into transparent acrylic cages (30 × 30 × 30 cm) and provided with unlimited 10% sucrose solution. In the semi-field setting, environmental conditions, including temperature, humidity, and photoperiod, were governed by natural fluctuations. During the study period (July to September), temperatures ranged from 28 °C to 35 °C, relative humidity fluctuated between 80% and 95%, and the photoperiod was approximately 14 h per day. For both types of experiments, dead mosquitoes were removed and counted daily until no individuals remained alive. Each condition was replicated three times.

Male mating competitiveness assay

To evaluate the mating competitiveness of Wolbachia-infected male Ae. aegypti (wAlbB-Tw-Kao), we conducted cage experiments using varying ratios of virgin WT females, WT males, and wAlbB-Tw males (♂wAlbB-Tw-Kao). The experimental ratios of ♀WT: ♂WT: ♂wAlbB-Tw-Kao were as follows: 1:1:0, 1:1:1, 1:1:3, 1:1:5, and 1:1:10, respectively. Each condition included 10 WT males and 0, 10, 30, 50, or 100 wAlbB-Tw-Kao males, depending on the group, and was replicated five times. Before introducing 10 virgin WT females, WT and wAlbB-Tw-Kao males were first introduced together for 2 h in acrylic cages (30 × 30 × 30 cm). Mosquitoes were then allowed to mate freely for 3 days under standard insectary conditions. Females were blood-fed for 30 min, and 2 days later, oviposition cups were placed inside the cages for egg collection. Egg numbers and hatching rates were recorded using collected egg papers. After 5 days of egg maturation on wet filter paper, eggs were immersed in deoxygenated water. Three days later, hatched eggs were counted to determine hatch rates.

Fried competitiveness index (C) calculation

To quantify the relative mating competitiveness of wAlbB-Tw-Kao males under competitive conditions, the Fried competitiveness index (C) was calculated following the method originally described by Fried [52]. This index estimates the mating competitiveness of incompatible (sterile) males relative to WT males based on observed egg hatch rates under mixed mating conditions. For each release ratio, the competitiveness index (C) was calculated using the formula:

where:

H₀ represents the mean hatch rate in the fully compatible control cross (♀WT × ♂WT), H represents the observed hatch rate in the competitive mating treatment,

Hₛ represents the hatch rate in fully incompatible crosses (assumed to be 0% based on complete cytoplasmic incompatibility),

N is the number of WT males,

and S is the number of wAlbB-Tw-Kao males released.

Calculations were performed independently for each biological replicate (n = 4 per ratio), and mean C values ± SD were reported. A C value of 1 indicates equal competitiveness between incompatible and WT males, whereas values <1 indicate reduced competitiveness of wAlbB-Tw-Kao males relative to WT males.

Statistical analysis

All statistical analyses were performed using GraphPad Prism version 8.0 and R software version 4.1.0. Differences in viral titers between WT and wAlbB-infected mosquitoes were analyzed using the non-parametric Mann–Whitney U test. Mosquito lifespan data were evaluated using the log-rank (Mantel–Cox) test implemented in R [53]. Mating competitiveness was assessed by comparing egg hatch rates using paired t-tests. A p-value of less than 0.05 was considered statistically significant for all tests.

Generation and confirmation of wAlbB-transinfected Aedes aegypti line

To establish a Taiwan-derived Ae. aegypti line stably infected with Wolbachia, cytoplasm extracted from eggs of field-collected Ae. albopictus in Kaohsiung was microinjected into preblastoderm-stage Ae. aegypti embryos. Of the 1,120 embryos injected, 127 (11.3%) successfully hatched into F₀ larvae, of which 29 (2.6%) developed into adult females. Following oviposition, individual F₀ females were screened by PCR using both wAlbA- and wAlbB-specific primers. Two F₀ females were confirmed to be wAlbB-positive and wAlbA-negative, indicating successful transinfection without co-transfer of wAlbA (S1A Fig). These independent infected founder females were subsequently used to initiate the transinfected line. To assess infection stability, the presence of wAlbB was monitored across nine consecutive generations. Quantitative PCR analysis confirmed that 100% of offspring remained wAlbB-positive in each generation (S1B Fig), demonstrating complete maternal transmission and stable establishment of the wAlbB-Tw-Kao line.

To provide genome-level support for the identity of the Wolbachia strain introduced into the local Ae. aegypti line, we performed whole-genome sequencing on total genomic DNA extracted from infected mosquitoes. Assembly of the sequencing data yielded a Wolbachia draft genome comprising seven contigs (total approximately 1.6 Mb; GC 34.4%). These Wolbachia contigs showed strong collinearity with the reference wAlbB genome (CP031221.1) and only sparse similarity to wAlbA (CP101657.1) (Fig 1). BUSCO analysis indicated that over 96% of the expected single copy orthologs were recovered, supporting a high level of genome completeness. To further resolve its evolutionary placement and assess relatedness to previously described wAlbB variants, we conducted comparative genomic analyses including representative Wolbachia genomes from Supergroups A and B. Maximum-likelihood phylogenetic reconstruction based on concatenated single-copy core genes placed the wAlbB-Tw-Kao genome within the Supergroup B clade, clustering with characterized wAlbB strains (S2 Fig), and clearly separated it from Supergroup A lineages. Together, these findings confirm that the Wolbachia in the infected line corresponds to wAlbB, consistent with its origin from local Ae. albopictus.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 1. Genomic characterization of Wolbachia from transinfected Ae. aegypti.

(A) Circular representation of the de novo–assembled Wolbachia genome from transinfected Ae. aegypti. The genome consists of seven contigs, which were ordered and oriented based on conserved synteny with the wAlbB reference genome (accession no. CP031221.1) to facilitate visualization. Displayed features include predicted coding sequences (CDSs), tRNAs, rRNA operons, and guanine–cytosine (GC) content. (B) Dot plot comparison with wAlbA revealed minimal similarity. (C) Dot plot comparison with wAlbB showed strong collinearity, indicating close relatedness.

https://doi.org/10.1371/journal.pntd.0014222.g001

In addition, the presence of wAlbB in transinfected mosquitoes was further validated by immunofluorescence assays. As shown in Fig 2, Wolbachia signals were detected in the testis and ovaries of the wAlbB-infected local Ae. aegypti line. Collectively, these findings confirm the successful establishment of the transinfected line. The resulting Wolbachia-infected Taiwanese Ae. aegypti strain was designated as “wAlbB-Tw-Kao” and used in subsequent experiments.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 2. Presence of Wolbachia in the testes and ovaries of wAlbB-Tw-Kao Ae. aegypti line.

Immunofluorescence staining revealed the distribution of Wolbachia (green) in transinfected Ae. aegypti (A) testes and (B) ovaries. Testes and ovaries from six independent individuals per sex were analyzed across two independent experimental replicates. DNA was counterstained with DAPI (white), and the cytoskeleton was labeled with phalloidin (red). GSCs: germline stem cells, Spc: spermatocyte, Spt: spermatid, PMC: post-meiosis cell, Ger: germarium, Oo: oocyte, OoN: oocyte nucleus, NCsN: nurse cell nucleus, FCsN: follicle cell nucleus, PEC: primary egg chamber, SEC: secondary egg chamber. Scale bar: 50 μm. WT: wild-type local strain.

https://doi.org/10.1371/journal.pntd.0014222.g002

Assessment of CI induced by the wAlbB-Tw-Kao line

To further characterize the effect of CI induced by the wAlbB-Tw-Kao strain, mating experiments were conducted in transparent acrylic cages. In all experimental groups, females successfully laid eggs (Fig 3A). However, in the test group consisting of 20 uninfected WT females crossed with 20 wAlbB-Tw-Kao males, the egg hatch rate was 0% (Fig 3B), indicating complete CI. In contrast, the reciprocal cross between wAlbB-Tw-Kao females and WT males yielded a hatch rate of 67.9 ± 6.8%. Control crosses between WT males and females and between wAlbB-Tw-Kao males and females produced hatch rates of 77.5 ± 3.1% and 63.1 ± 4.4%, respectively. These findings confirm that wAlbB-Tw-Kao males induce strong CI when mating with uninfected WT females.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 3. Cytoplasmic incompatibility (CI) analysis in the wAlbB-Tw-Kao Ae. aegypti line.

(A) Number of eggs laid and (B) egg hatch rate from reciprocal crosses between wild-type (WT) and wAlbB-Tw-Kao mosquitoes. Mating combinations included ♂WT × ♀WT, ♂WT × ♀wAlbB-Tw-Kao, ♂wAlbB-Tw-Kao × ♀WT, and ♂wAlbB-Tw-Kao × ♀wAlbB-Tw-Kao. Each data point represents the result from one independent biological replicate (n = 3), with 20 males and 20 females per mating combination in each replicate. Bars indicate the mean across experiments, and error bars represent the standard deviation. Statistical significance was determined using Student’s t-test. Exact P values are reported in the Results section.***p < 0.001; ns, not significant. WT: local wild-type strain from Kaohsiung.

https://doi.org/10.1371/journal.pntd.0014222.g003

Reduced replication of DENV and ZIKV in wAlbB-Tw-Kao Aedes aegypti line

To further assess whether the newly generated wAlbB-Tw-Kao mosquitoes exhibit viral suppression, virus inhibition assays were performed. Female mosquitoes were orally infected with either DENV-2 or ZIKV. At 5-, 10-, and 15-days PBM, midguts, salivary glands, and saliva were collected to evaluate viral titers, infection rates (IR), and transmission rates (TR). Viral titers were quantified using plaque assays.

Following oral infection with DENV-2 at a concentration of 2 × 10⁷ PFU/mL, the infection rate (IR) in wAlbB-Tw-Kao mosquitoes was reduced relative to WT at 5 days PBM (22.5% vs. 37.5%), with similar reductions observed at 10 and 15 days PBM (D10: 45.0% vs. 77.5%; D15: 42.5% vs. 75.0%; Fig 4A). These mosquitoes were also less capable of transmitting DENV-2, exhibiting lower transmission rates (TR) at 10 days PBM (WT: 35.0 ± 1.4%; wAlbB-Tw-Kao: 10.0 ± 2.5%; Fig 4A”) and at 15 days PBM (WT: 37.5 ± 4.0%; wAlbB-Tw-Kao: 12.5 ± 4.8%; Fig 4A”). Consistent with these reductions in IR and TR, wAlbB-Tw-Kao females exhibited a marked decrease in viral replication. At 10 days PBM, the median DENV-2 titer in the midgut was significantly lower in wAlbB-Tw-Kao mosquitoes than in WT controls (5.6 × 10³ vs. 2.6 × 10⁴ PFU/mL; p = 0.039, Mann–Whitney test). This reduction persisted through 15 days PBM (3.4 × 10³ vs. 2.5 × 10⁴ PFU/mL; p = 0.048). Comparable reductions were observed in salivary glands at 10 days PBM (190.5 vs. 1.2 × 10³ PFU/mL; p = 0.001) and 15 days PBM (270 vs. 1.2 × 10³ PFU/mL; p = 0.003). Low viral titers were also detected in the saliva of wAlbB-Tw-Kao mosquitoes at both 10 and 15 days PBM compared with WT counterparts (D10: 62.5 vs. 135.3 PFU/mL, p = 0.022; D15: 96.5 vs. 144 PFU/mL, p = 0.035; Fig 4A”).

Download:

• PNG
  larger image
• TIFF
  original image

Fig 4. Inhibition of dengue virus (DENV-2) and Zika virus (ZIKV) infection by the wAlbB-Tw-Kao mosquito line.

Wolbachia-transinfected Ae. aegypti (wAlbB-Tw-Kao) and Kaohsiung local wild-type (WT) mosquitoes were challenged with (A–A”) dengue virus serotype 2 (DENV-2, TW2015) or (B–B”) ZIKV. Midguts, salivary glands, and saliva were collected at 5, 10, and 15 days post-blood meal (PBM). Viral titers were quantified by plaque assay on BHK-21 cells. For each group (n = 40 mosquitoes), viral titers are shown as mean ± SD. Samples negative for virus detection were excluded from titer calculations. Infection rates (IR) are presented as the percentage of infected individuals (positive/tested) and indicated above each panel. Transmission rate (TR) was defined as the proportion of saliva-positive individuals among tested mosquitoes. Differences in viral titers between groups were analyzed using the Mann–Whitney rank-sum test. Exact P values are reported in the Results section. Statistical significance is indicated as follows: *p < 0.05; **p < 0.01.

https://doi.org/10.1371/journal.pntd.0014222.g004

In the ZIKV inhibition assay, reductions in IR and TR were similarly observed in wAlbB-Tw-Kao mosquitoes (Fig 4B–4B”). Although no significant reduction in viral titers was observed at 5 or 10 days PBM, a decrease in ZIKV titer was detected in the midguts of wAlbB-Tw-Kao females at 15 days PBM (1.4 × 10³ vs. 5.4 × 10³ PFU/mL; p = 0.03; Fig 4B). Reduced viral titers were also observed in the salivary glands (D10: 266.6 vs. 1.2 × 10³ PFU/mL, p = 0.049; D15: 550.5 vs. 2.2 × 10³ PFU/mL, p = 0.038; Fig 4B’) and saliva (50.0 vs. 133.8 PFU/mL, p = 0.001; Fig 4B”). These reductions in IR and TR were similar to those observed for DENV-2.

Insecticide susceptibility of wAlbB-Tw-Kao mosquitoes

To evaluate insecticide susceptibility in the newly established Wolbachia-infected line, we compared the wAlbB-Tw-Kao strain with the uninfected local WT strain across several pyrethroid compounds, including etofenprox, cypermethrin, and permethrin (Fig 5). In assays with etofenprox, both strains demonstrated moderate susceptibility at low concentrations, with comparable knockdown rates (65.0 ± 10.8% vs. 68.3 ± 11.8%) and mortality rates (65.3 ± 9.4% vs. 53.3 ± 2.4%) for wAlbB-Tw-Kao and WT, respectively. At higher concentrations, both groups exhibited complete susceptibility, with nearly 100% knockdown and mortality (p > 0.05, Mann–Whitney test). Both wAlbB-Tw-Kao and WT Ae. aegypti exhibited notable resistance to cypermethrin at both low (9.4 ppm) and high (150 ppm) concentrations, as indicated by reduced knockdown and mortality rates. For permethrin, both strains were highly susceptible regardless of concentration. In contrast, the laboratory reference Liverpool strain exhibited complete susceptibility (100% knockdown and mortality) across all tested insecticides and concentrations. Overall, no significant differences in insecticide susceptibility were detected between the wAlbB-Tw-Kao and WT strains across all tested compounds and concentrations (all comparisons, p > 0.05), indicating comparable resistance profiles.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 5. Susceptibility of Ae. aegypti line to three commonly used insecticides in space spray assays.

Female mosquitoes from three strains—the Kaohsiung local wild-type strain (WT), the Wolbachia-infected wAlbB-Tw-Kao line, and the insecticide-susceptible Liverpool laboratory strain (Lab)—were tested to evaluate knockdown and mortality responses. (A) Knockdown was assessed 30 min post-exposure and defined as the inability to fly, including both moribund and dead individuals. (B) Mortality was recorded 24 h after spraying. Each treatment consisted of three independent biological replicates, with 25 females per replicate. Data are presented as mean ± standard deviation (SD).

https://doi.org/10.1371/journal.pntd.0014222.g005

Mosquito fitness and mating behavior

For Wolbachia-based mosquito release strategies, both fitness and mating performance are key considerations. We assessed the fitness of the wAlbB-Tw-Kao strain using the Mann–Whitney U test, with reproductive parameters including the number of eggs laid, number of hatched larvae, and number of surviving adults, and compared these with those of the WT strain. WT females laid slightly more eggs than wAlbB-Tw-Kao females (84.7 ± 4.2 vs. 80.5 ± 2.2; p = 0.15; Fig 6A), while no significant differences were observed in the number of hatched larvae (78.7 ± 2.1 vs. 75.9 ± 2.1; p = 0.29) or adult emergence rates (71.1 ± 1.4 vs. 69.5 ± 1.9; p = 0.44). These results indicate that wAlbB-Tw females maintain normal reproductive capacity comparable to that of the WT strain.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 6. Reproductive fitness and insemination success of the wAlbB-Tw-Kao Ae. aegypti line.

(A) Reproductive output of wAlbB-Tw-Kao females (F8 ~ F9) compared with wild-type (WT) females from a local Ae. aegypti field strain in Kaohsiung, measured by the number of eggs laid, eggs hatched, and adult emergence. (B) Insemination success of wAlbB-Tw-Kao males assessed across four mating combinations with WT and wAlbB-Tw-Kao females under non-competitive conditions. Successful insemination was determined by dissecting the spermathecae of female mosquitoes under a stereomicroscope to confirm the presence of sperm. For both (A) and (B), data represent three independent biological replicates with 20 females per replicate (total n = 60 per group) and are presented as mean ± standard deviation (SD). Statistical significance was evaluated using the Mann–Whitney test (A) and Fisher’s exact test (B). ns, not significant.

https://doi.org/10.1371/journal.pntd.0014222.g006

To further evaluate whether Wolbachia infection affects male insemination success, we mated wAlbB-Tw-Kao males with virgin females and used the presence of sperm in the spermathecae as an indicator of successful insemination (Fig 6B). Across four mating combinations, insemination rates ranged from 80% to 88%, with no significant differences compared with the WT control cross (83.3 ± 5.1%; p > 0.05). These findings suggest that wAlbB-Tw-Kao males exhibit insemination rates comparable to those of WT males under non-competitive conditions.

Mosquito longevity assessment

The lifespan of Wolbachia-infected mosquitoes is a critical factor in determining release frequency for population suppression strategies. To assess this, we compared the longevity of male and female wAlbB-Tw-Kao mosquitoes with that of WT Ae. aegypti. Each longevity assay was initiated with 20 adult mosquitoes and conducted under controlled laboratory conditions (S3A Fig). Based on log-rank tests, no significant differences in lifespan were observed between wAlbB-Tw-Kao and WT strains for males (p = 0.62, 0.49, and 0.45; three replicates) or females (p = 0.33, 0.72, and 0.44; three replicates).

To evaluate mosquito survival under more naturalistic conditions, additional longevity experiments were conducted in semi-field enclosures (S3B Fig). Statistical analyses revealed no significant differences in male survival between WT and wAlbB-Tw-Kao strains (p = 0.28, 0.38, and 0.66; three replicates, log-rank test). Similarly, no significant differences were detected in female survival (p = 0.28, 0.52, and 0.44). These findings indicate that Wolbachia infection does not negatively affect the lifespan of Ae. aegypti males or females.

Mating competitiveness of wAlbB-Tw-Kao males

To quantify the relative mating performance of wAlbB-Tw-Kao males under competitive conditions, laboratory cage assays were conducted using varying release ratios of uninfected females (♀WT), uninfected males (♂WT), and wAlbB-Tw-Kao males (♂wAlbB-Tw-Kao). Hatch rates declined in a ratio-dependent manner as the proportion of wAlbB-Tw-Kao males increased (Fig 7A). Mean egg hatch rates (± SD) across four biological replicates were 65.7 ± 11.6%, 49.3 ± 16.6%, 20.9 ± 5.8%, 14.6 ± 5.5%, and 11.2 ± 4.2% for release ratios of 1:1:0, 1:1:1, 1:1:3, 1:1:5, and 1:1:10, respectively. Compared with the fully compatible control (1:1:0), hatch rates were significantly reduced at release ratios of 1:1:3, 1:1:5, and 1:1:10 (all p < 0.001), whereas the reduction at 1:1:1 was not significant. To estimate male mating competitiveness, the Fried competitiveness index (C) was calculated for each release ratio, assuming complete incompatibility (0% hatch) in incompatible matings (Fig 7B). Across overflooding ratios of 1:1:3, 1:1:5, and 1:1:10, mean C values ranged from 0.58 to 0.76, indicating that wAlbB-Tw-Kao males exhibited approximately 60–75% of the mating competitiveness of WT males under laboratory conditions. Greater variability was observed at the 1:1:1 ratio, likely reflecting stochastic mating dynamics at lower release ratios. Collectively, these results demonstrate that wAlbB-Tw-Kao males induce strong cytoplasmic incompatibility under competitive mating conditions, although their relative mating competitiveness is moderately reduced compared to WT males.

Download:

• PNG
  larger image
• TIFF
  original image

Fig 7. Mating competitiveness of wAlbB-Tw-Kao males under laboratory cage conditions.

Laboratory cage experiments were conducted with fixed numbers of uninfected females (♀WT) and uninfected males (♂WT), with increasing numbers of wAlbB-Tw-Kao males (♂wAlbB-Tw-Kao) to generate the indicated release ratios. (A) Egg hatch rates (%) observed under each mating ratio. Values represent mean ± SD from four independent biological replicates (n = 4; 10 females per replicate). (B) Fried competitiveness index (C) calculated for each release ratio. The dashed horizontal line indicates C = 1 (equal competitiveness between wAlbB-Tw-Kao and WT males). Values are shown as mean ± SD across replicates. Exact P values are reported in the Results section. Statistical significance is indicated by asterisks: ***p < 0.001.

https://doi.org/10.1371/journal.pntd.0014222.g007