Skip to main content
Advertisement
  • Loading metrics

Toxoplasma gondii GRA3 activates interferon-stimulated genes and STAT6 by the cGAS-STING pathway to promote parasite proliferation

  • Minmin Wu ,

    Contributed equally to this work with: Minmin Wu, Peihao Wang, Ru Wang

    Roles Formal analysis, Funding acquisition, Investigation, Writing – original draft

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Department of Clinical Laboratory, The First Affiliated Hospital of Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Peihao Wang ,

    Contributed equally to this work with: Minmin Wu, Peihao Wang, Ru Wang

    Roles Data curation, Formal analysis, Investigation

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Ru Wang ,

    Contributed equally to this work with: Minmin Wu, Peihao Wang, Ru Wang

    Roles Data curation, Investigation

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Mengting Zhan,

    Roles Formal analysis, Methodology

    Affiliation Department of Anesthesiology, The First Affiliated Hospital of Anhui Medical University, Hefei, China

  • Jie Wang,

    Roles Data curation, Methodology

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Haijian Cai,

    Roles Formal analysis

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Lixia Zha,

    Roles Data curation, Methodology

    Affiliation Department of Anesthesiology, The First Affiliated Hospital of Anhui Medical University, Hefei, China

  • Nan Zhou,

    Roles Resources

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Qingli Luo,

    Roles Formal analysis

    Affiliation Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

  • Lijian Chen ,

    Roles Conceptualization, Funding acquisition, Supervision, Visualization

    chenlijian77@ahmu.edu.cn (LC); dujian@ahmu.edu.cn (JD)

    Affiliation Department of Anesthesiology, The First Affiliated Hospital of Anhui Medical University, Hefei, China

  • Jian Du

    Roles Conceptualization, Funding acquisition, Supervision, Writing – review & editing

    chenlijian77@ahmu.edu.cn (LC); dujian@ahmu.edu.cn (JD)

    Affiliations Department of Biochemistry and Molecular Biology, Research Center for Infectious Diseases, School of Basic Medical Sciences, Anhui Medical University, Hefei, China, Provincial Key Laboratory of Zoonoses of High Institutions in Anhui, Anhui Medical University, Hefei, China

Abstract

Toxoplasma gondii is an opportunistic protozoan parasite that can establish latent infections in humans, causing toxoplasmosis in immunocompromised individuals. Type I interferons (IFN-I), particularly IFN-β, are critical for controlling Toxoplasma gondii infection, but the parasite has evolved various strategies to manipulate the host immune response. Interferon regulatory factor 3 (IRF3) is a key transcription factor that regulates the expression of antiviral genes, including IFN-I and ISGs. Unlike IFN-β, IRF3-activated ISG56 can enhance T. gondii proliferation. Furthermore, STAT6 activation has also been reported to promote the proliferation of Toxoplasma gondii. In this study, we found that GRA3 is highly expressed in the less virulent ME49 strain. Furthermore, we discovered that GRA3 interacted with STING to activate the cGAS/STING pathway. This interaction promotes STING oligomerization and the nuclear translocation of phosphorylated-IRF3, which in turn enhances IFN-β production. GRA3 in ME49 tachyzoites promoted both IRF3-mediated ISG56 expression and STAT6 phosphorylation, thereby enhancing the proliferation of these less virulent parasites. Interestingly, GRA3 enhances parasite proliferation via a mechanism mediated by ISG56 and STAT6, rather than by IFN-β. This study highlights how less virulent strains modulate host immunity to promote T. gondii survival and replication, establish latent infections, and ultimately achieve widespread dissemination in humans.

Author summary

Toxoplasma gondii is a common parasite that can infect nearly all warm-blooded animals, including humans. While healthy individuals usually do not develop symptoms, those with weakened immune systems may suffer from severe disease. The host defends against T. gondii infection by producing key immune molecules such as IFN-β, but the parasite has evolved various strategies to manipulate host immune defenses to support its survival and replication. In this study, we focused on GRA3, a protein highly expressed in the less virulent ME49 strain. We found that GRA3 interacts with the host protein STING to activate the cGAS/STING signaling pathway, leading to increased production of ISG56, p-STAT6, and IFN-β. Interestingly, unlike IFN-β which helps suppress the parasite, ISG56 and p-STAT6 actually enhances T. gondii proliferation. Our findings reveal how T. gondii can finetune host immune responses to strike a balance between activation and evasion, facilitating the establishment of chronic and latent infection. Understanding this mechanism may help develop better treatments for infections caused by T. gondii.

Introduction

Toxoplasma gondii is an important zoonotic intracellular parasite that can infect almost all warm-blooded animals, including humans [1]. Approximately 30% of the global population is serologically positive with T. gondii. Healthy individuals infected with T. gondii are usually asymptomatic. However, in immunocompromised individuals, T. gondii infection can lead to severe toxoplasmosis, including toxoplasmic encephalitis, pneumonia, retinochoroiditis and even death [24].In pregnant women or developing fetuses, T. gondii infection can lead to miscarriage, stillbirth, and congenital defects or malformations of infants. Based on their virulence, T. gondii is primarily categorized into three clonal lineages: the highly virulent Type I strain (e.g., RH and GT1), the less virulent Type II strains (e.g., ME49 and PLK), and the avirulent Type III strains (e.g., CEP). Type II strains are prone to causing latent infections and are the most commonly associated with human infections [5,6]. T. gondii employ a variety of effector proteins to manipulate host cellular processes, allowing them to evade immune detection and sustain their replication within host cells. During infection, T. gondii activates several pathogen-associated molecular patterns (PAMPs) in host cells [7,8]. These PAMPs are recognized by pattern recognition receptors (PRRs) such as Toll-like receptors (TLRs), nucleotide-binding oligomerization domain (NOD)-like receptors, and cytosolic DNA sensors like cGAS [9,10].

cGMP-AMP synthase (cGAS) is a cytosolic sensor of double-stranded DNA (dsDNA) that can recognize exogenous dsDNA and abnormal host dsRNA [11]. cGAS produces cyclic GMP-AMP (cGAMP) as a secondary messenger. cGAMP binds to the stimulator of interferon genes (STING) located on the endoplasmic reticulum, leading to a conformational change and oligomerization of STING [12,13]. Upon activation, STING undergoes conformational changes and recruits TANK-binding kinase 1 (TBK1), which phosphorylates interferon regulatory factor 3 (IRF3) [14]. TBK1 is also recruited by STING to phosphorylate STAT6, leading to the homodimerization and nucleus translocation of STAT6. STAT6 dimer then binds to its target sites to initiate transcription [15].ROP16-mediated activation of STAT6 facilitate Type III Toxoplasma gondii growth and survival [16,17]. Additionally, Phosphorylated IRF3 translocates to the nucleus, where it initiates the transcription of type I interferons (IFNs) and interferon-stimulated genes (ISGs), including ISG56. [18,19]. ISGs are directly induced by IRF3, but the synthesized type I IFNs can enhance ISG induction. ISG56 has been reported as a mediator of negative-feedback regulation of virus-induced type I IFN responses and cellular antiviral defenses [20,21]. Recent studies have shown that infection with T. gondii activates IRF3, which in turn induces the transcription of ISG56. Contrary to expectations, this activation does not harm the parasite; instead, it enhances the proliferation of T. gondii. However, the specific parasite effector responsible for activating IRF3 and the detailed signaling pathway involved remain unknown [22,23].

As a key mediator of innate immunity, the cGAS-STING pathway plays a critical role in host defense against T. gondii [19,2428]. Toxoplasma gondii secretes numerous effector molecules into host cells, regulating the host immune response. For instance, the type I strain RH secretes the ROP18 kinase, which interacts with IRF3 and inhibits the cGAS-STING-TBK1 pathway, preventing the production of type I IFN and aiding the parasite in evading immune clearance [26]. In contrast, GRA15, a secreted effector from the ME49 strain, has been shown to enhance STING activation by interacting with TRAF proteins, enhancing cGAS/STING signaling and promoting stronger activation of the host immune response [19]. These contrasting strategies highlight the complex relationship between T. gondii and the cGAS/STING/IRF3 axis, where different strains either suppress or enhance the pathway depending on their unique effector protein.

GRA3 is a transmembrane protein associated with the parasitophorous vacuole membrane, localized to the vacuolar membrane and the cyst wall of T. gondii [29,30]. It has been reported to play a structural or organizational role in cyst development or maintenance and is one of the important secreted proteins that enhance the virulence of T. gondii [31,32]. Research indicates that GRA3 can inhibit MHC-I antigen presentation, allowing the parasite to evade recognition and clearance by CD8+ T cells [31,33]. This suggests that GRA3 may create a favorable environment for the persistent presence and replication of the parasite within host cell. The C-terminus of GRA3 contains a di-lysine “KKXX” endoplasmic reticulum (ER) retrieval motif, suggesting that GRA3 may be involved in regulating the function of the host’s endoplasmic reticulum [29,34]. STING is a key signaling molecule located in the ER. Some studies have proposed that GRA3 may promote the transcription of IFN-β, but the mechanisms and functions of GRA3 in IFN-β-dependent immune responses remain unclear. In our study, we found that GRA3 can interact with STING, activating the STING-TBK signaling pathway and inducing ISG56 expression and STAT6 phosphorylation, thereby promoting the replication of T. gondii during infection.

Materials and methods

Ethical statement

Female C57BL/6 mice aged 6–8 weeks were obtained from the Laboratory Animal Center of Anhui Medical University. The animals were housed under standard laboratory conditions, following the guidelines provided by the Chinese National Institute of Health for the care and use of laboratory animals. All experimental procedures involving animals were approved by the Institutional Review Board of the Institute of Biomedicine, Anhui Medical University (Approval No. LLSC20240031).

Cell, plasmids, siRNA and parasite strains

RAW264.7 (CL-0190) cells were generously provided by the Stem Cell Bank of the Chinese Academy of Sciences. The cells were cultured in DMEM (Biological Industries, Israel) with 10% FBS (Biological Industries, Israel) and 1% penicillin/streptomycin (Biological Industries, Israel). The open reading frame of T. gondii GRA3 (GenBank ID: XM_002366330.2) was amplified using RT-PCR on RNA extracted from ME49 tachyzoites and then subcloned into the pEGFP-C2 vector (BD Biosciences). ISG56-siRNA#1: GGUCAUGGAGAAUCUGCUU (sense), ISG56-siRNA#2: GCUAUGCAGUCGUAGCCUA (sense), and ISG56-siRNA#3: GGAAACAUCGCGUAGACAA (sense) were obtained from Viraltherapy Technologies, (Wuhan, China) for ISG56 knockdown, with a nonspecific siRNA used as a negative control. Type II ME49 strain was used for experiments, propagated in human foreskin fibroblast (HFF) cells, while the ME49Δgra3 strain was maintained in vitro under the same conditions as the wild-type ME49 strain.

Generation of GRA3 -deficient strain of type II ME49

All primers and plasmids utilized in this study are detailed in Table 1. GRA3-specific CRISPR plasmids were constructed by replacing the UPRT-targeting guide RNA in pSAG1:CAS9-U6 (Addgene plasmid #54467) with the relevant guide RNAs, employing the Q5 mutagenesis kit (New England Biolabs, Ipswich, MA, USA). The 5′ and 3′ homology arms of GRA3 were amplified from the genomic DNA of the Type II ME49 strain, while the DHFR sequence was amplified from pUPRT-DHFR-Ts. These homologous arms and the selectable markers DHFR*-Ts were then cloned into pUC19 using the ClonExpress MultiS One Step Cloning Kit (Vazyme Biotech, Nanjing, China). The gene-specific CRISPR plasmid and donor DNA fragments were subsequently electroporated into purified ME49 tachyzoites and selected using 1 μM pyrimethamine. Individual clones were isolated via limiting dilution into 96-well plate containing HFF cells. Positive clones were verified through PCR and Western blotting. Diagnostic PCRs (PCR1, PCR2, and PCR3) were performed to identify each clone, using the primers listed in Table 1.

thumbnail
Table 1. Primers for construction of GRA3-deficient ME49 strain.

https://doi.org/10.1371/journal.pntd.0014035.t001

Western blot analysis

Cell proteins were extracted using RIPA buffer (Beyotime, China) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, Beyotime, China) as a protease inhibitor. The lysates were separated on a 12% SDS-PAGE gel, and proteins were transferred to a PVDF membrane (Millipore, USA). The membranes were blocked with 5% skimmed milk in TBST for 1.5 hours at room temperature, followed by overnight incubation at 4 °C with primary antibodies: rabbit anti-STING (300415; ZENBIO, China), rabbit anti-p-STING (AF7416;affinity,China), rabbit anti-TBK1 (R380780; ZENBIO, China), rabbit anti-p-TBK1 (#5483; Cell Signaling, USA), rabbit anti-IRF3 (HY-P80504; MCE, China), rabbit anti-p-IRF3 (YP0438; immunoway, China), rabbit anti-ISG56 (23247–1; Proteintech, China), rabbit anti-STAT6(YM843; immunoway, China), rabbit anti-P-STAT6(310177; ZENBIO, China) and T. gondii GRA3 antibody sourced from Taopu (Shanghai). T. gondii profilin antibody was generously provided by Professor Yu Li from Anhui Medical University. After incubation with the appropriate HRP-conjugated secondary antibodies (Proteintech, China) for 1 hour, immunoreactivity was detected using the ECL blot detection system (Bio-Rad, Hercules, USA). Optical density for each band was analyzed with ImageJ software.

Immunoprecipitation assay

Cells co-transfected with the corresponding plasmids were lysed in lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM EGTA and 1% Triton X-100) containing Complete protease inhibitor (Roche Applied Science, Indianapolis, USA). RAW264.7 cells infected with ME49wt parasites or ME49Δgra3 parasites were lysed in a lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM EGTA and 1% Triton X-100) containing Complete protease inhibitors (Roche Applied Science, Indianapolis, USA). The supernatants were collected and incubated with Protein A/G plus-agarose (Pierce) previously bound to the corresponding antibody for 4 h at 4 °C. Subsequently, the immunoprecipitants were washed 3 times with pre-cooled 0.1% Triton X-100 in lysis buffer, and then washed 3 times with PBS. The bound proteins were analyzed western blot.

Immunofluorescence assays

The cells were seeded onto glass coverslips and fixed with 4% paraformaldehyde. They were then permeabilized with 0.1% Triton X-100 in PBS and blocked with 10% bovine serum albumin. The coverslips were incubated overnight at 4 °C with primary antibodies: mouse anti-SAG1 (BF54M; GeneTex, USA), rabbit anti-STING (E9X7F; CST, USA), and rabbit anti-IRF3 (HY-P80504; MCE, China). Afterward, they were treated with secondary antibodies conjugated to Rhodamine (goat anti-mouse IgG and goat anti-rabbit IgG) and FITC (goat anti-mouse IgG and goat anti-rabbit IgG) for 1 hour at 37 °C in the dark. DAPI was used for DNA visualization. Finally, the immunostained cells were analyzed using confocal laser microscopy (LSM880 + Airyscan, ZEISS, Germany), with three replicates from three biological experiments.

Quantitative real-time PCR

Total RNA was extracted, and reverse transcription to cDNA was performed using the PrimeScript RT Kit (AG, Guangzhou, China). Real-time qPCR was conducted with the SYBR Premix Ex Taq II Kit (AG, Guangzhou, China). Reactions were carried out on the Roche LC480II system, and Primer sequences used for qPCR were as follows: TgSAG1:forward 5′-GTGCCACGCTAACGATCAAG-3′ and reverse 5′-TGGAAACGTGACTGGCTGTT-3′; GRA3:forward 5′- ATGCCGAGTCGGATAAGGTG -3′ and reverse 5′- TTCAAACCAGGGCGATCTGT -3′;Ifnb:forward 5′-TCCAGCTCCAAGAAAGGACG -3′ and reverse 5′- CTTGGATGGCAAAGGCAGTG-3′; ISG56: forward 5′- GCTGAGATGGACTGTGAGGAAGG-3′ and reverse 5′- GGCGATAGGCTACGACTGCATAG -3′; GAPDH:forward 5′- AGGTCGGTGTGAACGGATTTG-3′ and reverse 5′- GGGGTCGTTGATGGCAACA -3′.

ELISA assays

RAW264.7, bone marrow-derived macrophages, and macrophages from mouse peritoneal exudate were infected with ME49wt and ME49Δgra3 strains and obtain the cell supernatants for 24 hours. Mouse was infected with ME49wt and ME49Δgra3 strains for 3 day and collected the serum. According to the ELISA kit instructions (CME0116-096, Beijing 4A Biotech Co., Ltd, China), assess the production of IFN-β in cell supernatants and mouse sera.

Replication assay

ME49wt and ME49Δgra3 strains were allowed to invade HFF monolayer cells for 1 hour in a 12-well plate. Afterward, cells were washed twice with PBS and cultured in normal culture medium. Twenty-four hours post-invasion, cells were fixed with 4% paraformaldehyde and subjected to Giemsa staining. The number of parasites in each parasitophorous vacuole (PV) - categorized as two, four, eight, > eight was counted in at least 100 PVs using a LEICA ICC50W microscope at 1000 × magnification. RAW264.7 monolayers was pre-treated with different concentrations of mouse anti-IFN-β (100 U,200U,500 U,1000 U,MCE, China) for 2 hour in a 12-well plate and then infected with an equal amount of ME49wt strain. Infected cells were prepared for immunoblotting and qPCR as described earlier. All strains were independently tested three, with each test including three internal replicates.

Plaque assays

Freshly harvested tachyzoites (1000 per strain) were added to six-well plates containing HFF monolayer cells. After 10 days of incubation at 37°C with 5% CO2, the monolayers were fixed and stained with 0.1% crystal violet. Plates were scanned to assess the number and relative size of plaques. All strains were independently tested three, with each test including three internal replicates.

Animal experimental design

Six- to eight-week-old BALB/c mice were used for all experiments. For the survival study, mice (n = 10 per group) were infected intraperitoneally (i.p.) with 1 × 10⁵ freshly egressed tachyzoites of ME49wt and ME49Δgra3. The survival of infected mice was monitored daily for 35 days. For serum collection, mice (n = 6 per group) were infected i.p. with 1 × 10⁵ freshly egressed tachyzoites of ME49wt and ME49Δgra3, and sera were obtained via tail vein sampling on Day 3 post-infection. All experiments were independently repeated three times.

Statistical analysis

Statistical analyses and graphics were conducted using GraphPad Prism 8.0 (GraphPad Software Inc., La Jolla, CA, USA). Two groups were compared using unpaired t-test, and three or more groups were compared using one-way analysis of variance. The value of P < 0.05 was considered statistically significant.

Result

GRA3 is highly expressed in the less-virulence ME49 strain compared to the highly virulent RH strain

The differential expression of GRA3 was analyzed between the highly virulent RH strain and the less virulent ME49 strain of Toxoplasma gondii. RT-qPCR and Western blot analyses revealed that significantly elevated GRA3 is expressed in the less virulent ME49 strain (Fig 1A1C). To explore the biological functions of GRA3 in this strain, we employed CRISPR/Cas9 genome editing to knock out the GRA3 gene. The corresponding CRISPR plasmid pSAG1-Cas9-U6-GRA3 and the homology template GRA3::DHFR were constructed and electroporated into ME49 tachyzoites (S1A Fig). PCR analysis confirmed successful integration of the DHFR coding sequence into the GRA3 locus (S1B Fig), and Western blot analysis demonstrated complete absence of of GRA3 protein in the ME49Δgra3 strain (S1C Fig). These findings validate the successful generation of the GRA3 knockout strain of Toxoplasma gondii ME49, enabling further investigation into the role of GRA3 in the host-pathogen interactions, virulence modulation, and regulation of intracellular signaling cascades.

thumbnail
Fig 1. GRA3 is highly expressed in the less-virulent ME49 strain compared to the high- virulent RH strain.

Fresh tachyzoites of RH and ME49 strains were collected, and protein and RNA were extracted respectively. (A-B) Western blotting detected GRA3 protein expression in RH and ME49 strains. (C) RT-qPCR analyzed GRA3 mRNA expression level in RH and ME49 strains. TgSAG1 was used as a loading control. Data were shown as the mean ± SD from three independent experiments. Statistical significance is indicated by **p < 0.01 and ***p < 0.001. Data were compared using unpaired t-test.

https://doi.org/10.1371/journal.pntd.0014035.g001

Toxoplasma gondii GRA3 enhances type I interferon (IFN-β) production

Previous studies have demonstrated that T. gondii infection activates the cGAS-STING-IRF3-IFN-β signaling axis via effector proteins secretion into host cells [19,26]. To investigate the specific role of GRA3 in IFN-β regulation, we performed comparative infections using ME49 wild-type (ME49wt) and ME49Δgra3 strains in murine macrophage line RAW264.7, mouse bone marrow-derived macrophages (BMDM), and peritoneal exudate macrophages (PEM). Quantitative analysis at 24 h post-infection revealed significantly diminished Ifnb transcription levels in ME49Δgra3-infected cells across all tested macrophage subsets (Fig 2A). ELISA quantification of culture supernatants further corroborated these findings, showing that infection with ME49Δgra3 led to a marked decrease in secreted IFN-β protein levels in RAW264.7 cells, and a slight reduction in BMDM and PEM cells (Fig 2B). To establish in vivo relevance, C57BL/6 mice were intraperitoneally inoculated with equal numbers of tachyzoites of each strain. Spleen tissues and serum samples collected at 72 h post-infection revealed the lower Ifnb transcription levels in the spleens and a decreased circulating IFN-β in the serum of Δgra3-infected mice compared to wild-type controls (Fig 2C and 2D). These data collectively establish GRA3 as a critical parasite determinant for host IFN-β responses during T. gondii infection.

thumbnail
Fig 2. Toxoplasma gondii GRA3 promotes IFN-β Expression.

(A-B) RAW264.7 cells, mouse BMDMs, PEMs were infected with ME49wt and ME49Δgra3 strains, respectively. At 24 hours post-infection, cells and cell supernatant were collected. (A) Ifnb mRNA expression was analyzed by RT-qPCR. GAPDH was used as a loading control. (B) IFN-β secretion in the supernatant was measured by ELISA. Data are shown as the mean ± SD from three independent experiments. Statistical significance is indicated by **p < 0.01 and ***p < 0.001. (C) C57BL/6 mice were infected with ME49wt and ME49Δgra3 strains, serum and spleens were collected, Ifnb mRNA levels in spleens were analyzed by qPCR, GAPDH was used as a loading control, and serum IFN-β levels were assessed by ELISA. (n = 6 each group). Data were shown as the mean ± SD. Statistical significance is indicated by **p < 0.01 and ***p < 0.001. Data were compared using one-way analysis of variance, followed by Tukey’s post-hoc multiple comparison test.

https://doi.org/10.1371/journal.pntd.0014035.g002

GRA3 interacts with STING to activate the STING-TBK1-IRF3 signaling pathway

The cGAS-STING signaling axis serves as the principal regulator of type I interferon production during pathogen infection [35]. To delineate GRA3’s regulatory role in this pathway, we overexpressed GRA3-GFP fusion protein in RAW264.7 macrophages. Western blot analysis revealed that GRA3 overexpression significantly enhanced the phosphorylation of STING, accompanied by the increase of its downstream effectors, TBK1 and IRF3 phosphorylation respectively (Fig 3A and 3B). Furthermore, immunofluorescence analysis demonstrated that an increase in STING oligomer formation and augmentation of p-IRF3 nuclear translocation in GRA3-overexpressing cells (Fig 3C and 3D). These findings establish GRA3 as a potent activator of STING signaling cascade components. To explore the interaction between GRA3 and STING, we overexpressed GRA3-FLAG in HEK293T cells and conducted co-immunoprecipitation (Co-IP) with anti-FLAG antibody. We then probed the cell lysates with antibodies against STING, the results showed that GRA3 specifically co-immunoprecipitated with STING (Fig 4A). To determine the interaction between Toxoplasma gondii GRA3 and STING in infected cells, we infected RAW264.7 cells were infected with ME49wt and ME49Δgra3 strains. Polyclonal anti-STING antibodies were used for immunoprecipitation of STING in the cell lysates. Western blotting showed that GRA3 was clearly detectable in STING immunoprecipitations from ME49wt-infected macrophages (Fig 4B). Subsequently, we overexpressed the GRA3-Flag in RAW264.7 cells and performed co-immunoprecipitation using anti-STING antibody. we analyzed the cell lysates with anti-phosphorylated-TBK1 and anti- phosphorylated-IRF3 antibodies. The results showed that STING specifically co-precipitated with GRA3 and that their interaction enhanced the phosphorylation of downstream TBK1 and IRF3 (Fig 4C). Therefore, Toxoplasma GRA3 interacted with STING to activate the STING-TBK1-IRF3 signaling pathway.

thumbnail
Fig 3. Overexpression of GRA3 activates the STING-TBK1-IRF3 signaling pathway.

RAW264.7 cells were transfected with pEGFP and pEGFP-C2-GRA3 plasmids. (A-B) After 24 hours of transfection, total cell proteins were extracted, and western blotting analysis was performed to assess the phosphorylation levels of STING, IRF3, and TBK1, with GFP-vector as the control. GAPDH was used as a loading control. (C) Immunofluorescence staining was performed to analyze STING oligomerization in cells transfected with pEGFP-C2-GRA3 plasmid, using pEGFP-transfected cells as control. STING (red), pEGFP-C2-GRA3 (green), and DAPI (blue) were visualized (Scale bar: 10 μm). (D) Immunofluorescence staining was used to assess p-IRF3 nuclear translocation in cells transfected with pEGFP-C2-GRA3 plasmid, with pEGFP-transfected cells as the control. P-IRF3 (red), pEGFP-C2-GRA3 (green), and DAPI (blue) were visualized (Scale bar: 10 μm). Data were shown as the mean ± SD from three independent experiments. Statistical significance is indicated by **p < 0.01. Data were compared using one-way analysis of variance.

https://doi.org/10.1371/journal.pntd.0014035.g003

thumbnail
Fig 4. GRA3 interacts with STING activate the STING-TBK1 signaling pathway.

(A) HEK293T cells were transfected with Flag or GRA3-Flag plasmids. After 24 hours, total cellular proteins were extracted for Co-IP analysis. Immunoprecipitation was performed using anti-Flag magnetic beads, and STING protein in the precipitates was detected with an anti-STING antibody. (B) RAW264.7 cells were infected with ME49wt or ME49Δgra3 strains (MOI = 3) for 8 hours. Total protein from infected cells was extracted for Co-IP analysis. The immunoprecipitate purified with STING antibody was detected using anti-GRA3 antibody. (C) RAW264.7 cells were transfected with Flag or GRA3-Flag plasmids. After 24 hours, total proteins were extracted for Co-IP. Immunoprecipitation was performed using an anti-STING antibody, and activation of downstream signaling was assessed by detecting p-TBK1 and p-IRF3 with specific antibodies.

https://doi.org/10.1371/journal.pntd.0014035.g004

ME49Δgra3 strain attenuates STING-TBK1-IRF3 pathway activation

We infected RAW264.7 cells with the ME49 strain and collected protein lysates at 2-, 6-, 12-, and 24-hours post-infection to analyze the activation of the STING-TBK1-IRF3 pathway. The results showed that phosphorylation levels of STING, TBK1, and IRF3 were markedly elevated at 24 hours after infection (S2A and S2B Fig). To investigate the role of endogenous GRA3 during Toxoplasma gondii infection, we infected macrophages for 24 hours with both the ME49wt and ME49Δgra3 strains. Western blot analysis demonstrated a marked reduction in STING phosphorylation in ME49Δgra3-infected cells compared to ME49wt-infected control. This attenuation extended to downstream signaling components, with TBK1 phosphorylation and IRF3 phosphorylation levels showing reductions respectively in ME49Δgra3-infected macrophages (Fig 5A and 5B). These findings were further supported by immunofluorescence assays, which showed a notable reduction in STING oligomerization and diminished nuclear translocation of phosphorylated IRF3 in ME49Δgra3-infected macrophages (Fig 5C and 5D). To confirm whether GRA3 activates TBK1 and IRF3 through STING, we pretreated macrophages with the STING inhibitor H-151 to suppress STING activity. RAW264.7 cells were treated with various concentrations of H-151 (0.5, 1, 2, 5, 10μM) for 24 h. CCK-8 assay revealed H-151 exhibited no significant cytotoxicity at concentrations of 1 μM or below (S2C Fig). Therefore, 1 μM H-151 was chosen for further experiments. As expected, H-151 (MCE, 1μM) abolished GRA3-mediated phosphorylation of both TBK1 and IRF3, establishing STING as the critical upstream mediator of GRA3’s immunostimulatory effects (Fig 5E). Taken together, these results demonstrated that GRA3 promoted activation of the cGAS-STING signaling pathway by interacting with STING, thereby facilitating the phosphorylation of downstream signaling molecules TBK1 and IRF3.

thumbnail
Fig 5. ME49Δgra3 strain attenuates STING-TBK1-IRF3 pathway activation.

RAW264.7 cells were infected with ME49wt and ME49Δgra3 strains for 24 hours, (A-B) total protein was extracted from the infected cells, and the phosphorylation levels of STING, IRF3, and TBK1 were analyzed by western blotting. (C-D) Immunofluorescence staining analyzed (C) STING oligomerization and (D) nuclear translocation of p-IRF3. (E-F) RAW264.7 cells were pretreated with the STING inhibitor H-151 (MCE, 1μM) and then infected with ME49wt and ME49Δgra3 strains for 24 hours. Western blotting analyzed the phosphorylation levels of IRF3 and TBK1. Data were presented as the mean ± SD from three independent experiments. Statistical significance is indicated by *p < 0.05, **p < 0.01 and ***p < 0.001. Data were compared using one-way analysis of variance.

https://doi.org/10.1371/journal.pntd.0014035.g005

GRA3 activates the STING-STAT6 signaling pathway and ME49Δgra3 strain reduces the phosphorylation of STAT6

Previous studies have established that ROP16 increases growth and survival type III T. gondii by phosphorylating STAT6 [16,17], and STING has been implicated in the activation of STAT6 [15]. Our findings demonstrate that GRA3 interacts with STING and activates its downstream signaling. To investigate whether GRA3 similarly modulates STAT6 phosphorylation in a STING-dependent manner, we infected macrophages with ME49wt and ME49Δgra3 strains for 24 h. Western blot analysis revealed a pronounced reduction in STAT6 phosphorylation in ME49Δgra3-infected cells compared to ME49wt-infected controls (Fig 6A and 6B). To determine whether this regulation requires functional STING, macrophages were pretreated with the STING inhibitor H-151 (1 μM, MCE). Notably, H-151 pretreatment abolished the GRA3-mediated enhancement of STAT6 phosphorylation and T. gondii profilin expression (Fig 6C and 6D). Treatment with the STAT6 phosphorylation inhibitor AS1517499 (100 nM, MCE) suppressed GRA3-induced STAT6 activation and T. gondii profilin expression (Fig 6E and 6F). Furthermore, intracellular replication assays demonstrated that AS1517499 attenuated GRA3-mediated enhancement of parasite proliferation (Fig 6G). Taken together, GRA3-mediated activation of STING promotes STAT6 phosphorylation, leading to enhanced proliferation of T. gondii.

thumbnail
Fig 6. The ME49Δgra3 strain reduces STAT6 phosphorylation in a STING‑dependent manner.

(A, B) RAW264.7 cells were infected with ME49wt or ME49Δgra3 for 24 h. Cell lysates were analyzed by Western blot for total STAT6 and phospho‑STAT6 (p‑STAT6). (C, D) Cells were pretreated with the STING inhibitor H‑151 (1 μM, MCE) for 1 h before infection with the indicated strains for 24 h, followed by Western blot analysis of STAT6, p‑STAT6 and profilin. (E, F) Cells were pretreated with the AS1517499 (100 nM, MCE) for 1 h before infection with the indicated strains for 24 h, followed by Western blot analysis of STAT6, p‑STAT6 and profilin. (G) Following the same pretreatment and infection protocol, intracellular parasite replication was assessed by examining at least 200 vacuoles and categorizing them based on the number of parasites per vacuole (2, 4, 8, or >8). Data were presented as the mean ± SD from three independent experiments. Statistical significance is indicated by *p < 0.05, **p < 0.01 and ***p < 0.001. Data were compared using one-way analysis of variance.

https://doi.org/10.1371/journal.pntd.0014035.g006

GRA3 promotes proliferation of the less virulent parasites

To define the functional role of GRA3 in Toxoplasma gondii proliferation, we compared the intracellular replication efficiency between the ME49wt and ME49Δgra3 strain. Plaque assays performed on HFF monolayers revealed that at 10 days post-infection, Δgra3 parasites exhibited fewer plaques and smaller size of plaques (Fig 7A and 7B). This proliferation defect was further confirmed by Giemsa staining, which revealed a higher proportion of parasitophorous vacuoles containing four or more tachyzoites in ME49wt-infected cells compared with ME49Δgra3-infected cells (Fig 6C). Consistent with these findings, western blot analysis demonstrated significantly decreased profilin expression in ME49Δgra3-infected cells compared to ME49wt-infected control (Fig 7D and 7E). To assess virulence in vivo, C57BL/6 mice were intraperitoneally infected with both strains, survival analysis revealed that significantly prolonged survival in mice infected with the ME49Δgra3 strain compared to ME49wt-infected controls (Fig 7F). All these data confirmed that GRA3 promoted proliferation of ME49 parasites in vitro and in vivo.

thumbnail
Fig 7. GRA3 promotes the proliferation of ME49 strains.

(A-C) HFF cells were infected with equal numbers of ME49wt or ME49Δgra3 strains. (A-B) A plaque assay was performed at 10 days post-infection to compare the growth of ME49wt and ME49Δgra3 parasites. Data were compared using unpaired t-test. (C) At 24 hours post-infection, at least 200 vacuoles were examined to determine the number of vacuoles containing 2, 4, 8, or >8 parasites. (D-E) Equal numbers of ME49wt or ME49Δgra3 parasites were used to infect HFF and RAW264.7 cells. Total was collected at 24 hours post-infection, and T. gondii profilin protein was detected by western blot, with GAPDH as a loading control. Data were shown as the mean ± SD from three independent experiments. Statistical significance is indicated by *p < 0.05, **p < 0.01 and ***p < 0.001. Data were compared using unpaired t-test. (F) C57BL/6 mice were intraperitoneally infected with 1 × 10⁵ ME49wt or ME49Δgra3 parasites. The survival rate of mice was monitored over 35 days (n = 10 per group). ** p < 0.01, Gehan-Breslow-Wilcoxon test. All experiments were independently repeated three times.

https://doi.org/10.1371/journal.pntd.0014035.g007

GRA3 enhances the proliferation of less virulent parasites via a mechanism mediated by ISG56, rather than by IFN-β

Although IFN-β is typically associated with defense against intracellular pathogens, emerging evidence indicates that it could facilitate the persistence and dissemination of specific pathogens, such as Listeria monocytogenes and Mycobacterium tuberculosis [36,37]. To further evaluate the effect of IFN-β on T. gondii proliferation, we pretreated macrophages with different concentrations of IFN-β and assessed T. gondii replication using western blotting. The results demonstrated a significant decrease in tachyzoite proliferation in IFN-β-pretreated cells compared to untreated controls (Fig 8A and 8B). This suggested that GRA3 activated STING-TBK1-IRF3 to promote intracellular parasites proliferation through other mechanisms but not IFN-β. Previous study found that IRF3, as a key component of the cGAS-STING-TBK1-IRF3 signaling pathway, promotes T. gondii proliferation [22,23]. Therefore, we speculated that the Toxoplasma GRA3-induced parasite proliferation might be mediated through ISG56 in the cGAS-STING-TBK1-IRF3 pathway. As expected, overexpression of pEGFP-C2-GRA3 plasmid significantly enhanced ISG56 expression (Fig 8C8E). Consistently, we observed significantly decreased ISG56 expression in ME49Δgra3-infected cells compared to ME49wt-infected control (Fig 8F8H). Next, we used H-151, a STING-specific inhibitor, and found that STING inhibition reduced GRA3-induced ISG56 expression, which was accompanied by decreased T. gondii profilin expression (Fig 8I and 8J). To further validate the role of ISG56 in T. gondii proliferation, we used siRNA to knock down its expression. Western blot analysis confirmed the efficiency of ISG56 siRNA (Fig 8K). Notably, silencing ISG56 suppressed the expression of the parasite’s profilin protein (Fig 8L and 8M). Intracellular replication assays demonstrated that silencing ISG56 attenuated GRA3-mediated enhancement of parasite proliferation (Fig 8N). Taken together, all these results demonstrated that GRA3 interacted with STING to activate the cGAS–STING pathway, thereby promoting IRF3-mediated ISG56 expression and facilitating intracellular proliferation of T. gondii.

thumbnail
Fig 8. GRA3 enhances the proliferation of less virulent parasites via a mechanism mediated by ISG56, rather than IFN-β.

(A-B) RAW264.7 cells were pretreated with different concentrations of IFN-β and then infected with an equal amount of ME49wt strain. Protein was collected, and profilin expression was analyzed by western blotting. (C-D) RAW264.7 cells were transfected with pEGFP or pEGFP-C2-GRA3 plasmids, and Western blotting analyzed ISG56 protein. (E) RAW264.7 cells were transfected with pEGFP or pEGFP-C2-GRA3 plasmids, and ISG56 mRNA expression was analyzed by RT-qPCR. GAPDH was used as a loading control. (F-G) RAW264.7 cells were infected with equal numbers of ME49wt and ME49Δgra3 strains, Western blotting analyzed ISG56 expression. (H) RAW264.7 cells were infected with equal numbers of ME49wt and ME49Δgra3 strains, and ISG56 mRNA expression was analyzed by RT-qPCR. GAPDH was used as a loading control. (I-J) RAW264.7 cells were pretreated with the STING inhibitor H-151 (MCE, 1μM) and then infected with ME49wt and ME49Δgra3 strains for 24 hours, Western blotting was performed to evaluate ISG56, IFN-β and T. gondii profilin protein expression. (K) Western blot confirmed that ISG56 were successfully interfered. GAPDH was used as a loading control. (L-M) Western blotting analyzed the influence of ISG56 knockdown on parasite proliferation. GAPDH was used as a loading control. (N) ISG56-knockdown cells were infected with the indicated strains for 24 h. At least 200 vacuoles were examined, and the number of parasites per vacuole was categorized as 2, 4, 8, or >8. Data were shown as the mean ± SD from three independent experiments. Statistical significance is indicated by* P < 0.05, **p < 0.01, ***p < 0.001 and ns: not significant. Data were compared using one-way analysis of variance.

https://doi.org/10.1371/journal.pntd.0014035.g008

Discussion

Type I (α, β, and λ) and Type II (γ) interferons are crucial in upregulating the host’s defense mechanisms to control microbial pathogens [38,39]. Among these, Type I interferons (IFN-I) exhibit the greatest diversity, consisting of over 20 family members, including subtypes of IFN-β and IFN-α. Nearly all cells can produce IFN-I in response to pathogenic challenges [25]. Type II interferons (IFN-II), primarily composed of IFN-γ, are mainly produced by activated T cells and natural killer (NK) cells [40]. While IFN-γ has long been recognized as a key immune effector against Toxoplasma gondii infection, recent studies have also revealed that IFN-β plays a critical role in controlling T. gondii, underscoring the complexity of interferon responses during parasitic infection [25,41]. T. gondii, a widely prevalent intracellular parasite, has developed intricate mechanisms to manipulate host immune responses, allowing it to survive and replicate within host cells, ultimately establishing chronic latent infections. The cGAS-STING pathway plays a pivotal role in the host’s innate immune defense against intracellular pathogens [24,42]. cGAS acts as a sensor for cytosolic double-stranded DNA (dsDNA), triggering the activation of STING, which leads to the production of Type I interferons (IFN-I) and other immune-modulatory factors [43,44].

T. gondii infection has been shown to activate the cGAS-STING signaling pathway, leading to the production of IFN-I[27]. Beyond cGAS signaling, studies suggest that T. gondii regulates the IFN-I pathway through the secretion of genotype-specific effector proteins, allowing the parasite to either enhance or evade innate immune responses. For instance, rhoptry protein ROP18 directly binds to IRF3, preventing its nuclear translocation, which in turn reduces IFN-β expression [26]. In contrast, dense granule protein GRA15II promotes STING polyubiquitination and oligomerization in a TRAF-dependent manner, thereby enhancing the host cGAS/STING pathway and preventing T. gondii infection [19]. Meanwhile, ROP16II inhibits cGAS signaling by blocking K63-linked ubiquitination of STING, leading to a reduction in IFN-I signaling [27]. These different effector proteins employ diverse strategies to manipulate the host cGAS/STING pathway, evading immune surveillance and thereby facilitating Toxoplasma survival.

GRA3 was highly expressed in the less virulent ME49 strain, highlighting its potential role in the immune modulation of this strain. Our findings revealed that the ME49Δgra3 strain resulted in significantly reduced IFN-β expression and secretion across various macrophages, suggesting that GRA3 may be involved in regulating the cGAS/STING signaling pathway. GRA3, a secreted dense granule protein of T. gondii, is associated with endoplasmic reticulum (ER) function. Given that STING, a key immune regulatory protein, is localized to the ER, it is plausible that GRA3 may interact with STING to modulate host immune responses. Co-IP results demonstrated that GRA3 interacted with STING, enhancing its phosphorylation and the activity of downstream signaling molecules TBK1 and IRF3. Immunofluorescence results indicated that GRA3 promoted STING oligomerization and facilitated the translocation of p-IRF3 from the cytosol to the nucleus. Proliferation assays demonstrated that the replication ability of the GRA3-deficient strain was significantly impaired, indicating that Toxoplasma GRA3 promotes parasite proliferation. However, GRA3 enhanced activation of the cGAS-STING signaling pathway and the subsequent upregulation of IFN-β, which appears to inhibit T. gondii proliferation. Therefore, one possible explanation for this apparent contradiction is that GRA3 activated cGAS/STING pathway may also induce the expression of certain host genes that facilitate parasite proliferation, but not necessarily through IFN-β.

STING activation leads to the recruitment of STAT6. Subsequently, STING also recruits TBK1, which phosphorylates STAT6 and triggers its homodimerization and nuclear translocation [15]. The STAT6 dimer then binds to target sites to initiate transcription. Previous studies have shown that ROP16-mediated activation of STAT6 suppresses reactive oxygen species (ROS) production, thereby facilitating Type III Toxoplasma gondii growth and survival [16,17]. In addition, ROP16 promotes alternative (M2) macrophage polarization and upregulates Arginase-1, which reduces nitric oxide (NO) production and shifts the host immune environment toward an anti-inflammatory state [45]. Collectively, these changes create a more permissive intracellular niche that further supports parasite replication and survival. In our study, we observed that GRA3 upregulates STAT6 phosphorylation in host cells. Conversely, inhibition of STING downregulated p-STAT6 levels and suppressed parasite proliferation. Type I interferons (IFN-I) enhance the host cell’s ability to combat pathogens by inducing the transcription of approximately 300 interferon-stimulated genes (ISGs) through autocrine or paracrine signaling [20,46]. Although IFN-I plays a critical role in antiviral defense, its production must be tightly regulated to prevent excessive and harmful immune responses. Interestingly, during the evaluation of the antiviral activities of more than 350 human ISGs, 25 genes were identified as enhancing the infectivity of certain viruses [47]. The expression of many of these genes is strongly dependent on the TBK1/IRF3 signaling pathway. Among them, ISG56 has been reported to participate in the negative feedback regulation of IFN-I production and antiviral responses [20].Recent studies have revealed that ISG56 can be activated not only during viral infection but also in parasitic infections [22,23]. The cGAS-STING signaling pathway exhibits a double-edged role during T. gondii infection. On one hand, it induces the production of type I interferons, such as IFN-α and IFN-β, thereby activating the host’s innate immune response to restrict parasite invasion. On the other hand, IRF3 has been shown to inhibit IFN-γ–mediated restriction of intracellular pathogens in macrophages independently of IFNAR signaling [48], suggesting that normal IRF3 activity may attenuate host IFN-γ–dependent defenses and indirectly provide a favorable environment for pathogen survival. Furthermore, Majumdar and colleagues demonstrated that the STING-IRF3-IDO1 signaling pathway promotes T. gondii replication [23]. Therefore, ISG56 does not harm the parasite, instead, it appears to facilitate the proliferation of T. gondii more effectively. In our study, we observed that GRA3 upregulates the expression of ISG56 in host cells. Inhibition of STING not only downregulates ISG56 expression but also significantly suppresses Toxoplasma gondii proliferation. Moreover, knockdown of ISG56 also markedly reduces parasite replication, suggesting that GRA3 can promote T. gondii proliferation in host cells by activating ISG56.

Collectively, our findings suggest that GRA3-driven activation of the cGAS–STING pathway during infection induces ISG56, p-STAT6, and IFN-β, thereby establishing a regulatory balance between host defense and immune tolerance. This balance, mediated by STING-TBK1-dependent expression of ISG56 and p-STAT6, may dampen excessive type I IFN responses, thereby maintaining an intracellular environment that is more conducive to its survival and replication. In this way, ISG56 and STAT6 serves as a molecular switch that prevents overactivation of the host immune response while inadvertently promoting T. gondii proliferation. This establishes a dynamic balance between immune activation and immune evasion, promoting moderate replication of the parasite and enabling long-term latent infection of the less-virulent T. gondii strain within the host (Fig 9). In conclusion, these studies demonstrate that Toxoplasma gondii GRA3 can interact with STING, activating TBK1and IRF3. This interaction promotes IRF3-mediated transcription of ISG56 along with phosphorylation of STAT6, ultimately facilitating T. gondii proliferation. This regulatory mechanism allows the parasite to establish chronic infection without being fully suppressed by the host immune system. These findings not only highlight the crucial role of GRA3 as an immune modulatory effector molecule but also offer potential therapeutic targets to disrupt the parasite’s manipulation of host defenses.

thumbnail
Fig 9. Schematic diagram of GRA3 promoting Toxoplasma gondii proliferation through the STING-TBK1 pathway.

By engaging host STING, the Toxoplasma gondii protein GRA3 activates TBK1 and IRF3, thereby inducing STAT6 phosphorylation and IRF3-mediated expression of IFN-β and ISG56. This regulated immune activation prevents excessive parasite proliferation, thus facilitating the establishment of a stable chronic infection within the host.

https://doi.org/10.1371/journal.pntd.0014035.g009

Supporting information

S1 Fig. Construction of the ME49Δgra3 strain of Toxoplasma gondii by using CRISPR-Cas9 technology.

(A) Schematic of the CRISPR/CAS9 strategy to insert pyrimethamine-resistant DHFR (DHFR*) into the GRA3 sequence, followed by PCR identification of a single clone. (B) PCR validation of the ME49Δgra3 strain. PCR1 and PCR2 confirm the 5’ and 3’ integration of the selection marker, while PCR3 verifies successful deletion of the GRA3 gene. ME49wt strain was used as a control. (C) Western blot analysis to detect GRA3 expression in ME49wt and ME49Δgra3 strains, with T. gondii actin as a loading control. Data were compared using unpaired t-test.

https://doi.org/10.1371/journal.pntd.0014035.s001

(TIF)

S2 Fig. ME49 activate the STING–TBK1–IRF3 pathway in RAW264.7 cells.

(A-B) RAW264.7 cells were infected with ME49 strain and harvested at the indicated time points (2, 6, 12, and 24 h post-infection). Phosphorylation levels of STING, TBK1, and IRF3 were analyzed by Western blot. (C) RAW264.7 cells were treated with different concentrations of H-151, and cell viability was assessed by the CCK-8 assay. Data were presented as the mean ± SD from three independent experiments. Statistical significance is indicated by ***p < 0.001 and ns: not significant. Data were compared using one-way analysis of variance.

https://doi.org/10.1371/journal.pntd.0014035.s002

(TIF)

S2 Data. Excel file containing the raw numerical data used to generate all Figs.

https://doi.org/10.1371/journal.pntd.0014035.s004

(XLSX)

References

  1. 1. Dubey JP. History of the discovery of the life cycle of Toxoplasma gondii. Int J Parasitol. 2009;39(8):877–82. pmid:19630138
  2. 2. Montoya JG, Liesenfeld O. Toxoplasmosis. The Lancet. 2004;363:1965–76.
  3. 3. Robert-Gangneux F, Dardé M-L. Epidemiology of and diagnostic strategies for toxoplasmosis. Clin Microbiol Rev. 2012;25(2):264–96. pmid:22491772
  4. 4. Hill D, Dubey JP. Toxoplasma gondii: transmission, diagnosis and prevention. Clin Microbiol Infect. 2002;8(6):634–40.
  5. 5. Howe DK, Sibley LD. Toxoplasma gondii comprises three clonal lineages: correlation of parasite genotype with human disease. J Infect Dis. 1995;172:1561–6.
  6. 6. Saeij JPJ, Boyle JP, Boothroyd JC. Differences among the three major strains of Toxoplasma gondii and their specific interactions with the infected host. Trends Parasitol. 2005;21(10):476–81. pmid:16098810
  7. 7. Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell. 2010;140(6):805–20. pmid:20303872
  8. 8. Yarovinsky F. Innate immunity to Toxoplasma gondii infection. Nat Rev Immunol. 2014;14(2):109–21. pmid:24457485
  9. 9. Kawai T, Akira S. TLR signaling. Semin Immunol. 2007;19(1):24–32.
  10. 10. Yoneyama M, Fujita T. Function of RIG-I-like receptors in antiviral innate immunity. J Biol Chem. 2007;282(21):15315–8. pmid:17395582
  11. 11. Cai X, Chiu Y-H, Chen ZJ. The cGAS-cGAMP-STING pathway of cytosolic DNA sensing and signaling. Mol Cell. 2014;54(2):289–96. pmid:24766893
  12. 12. Sun L, Wu J, Du F, Chen X, Chen ZJ. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 2013;339(6121):786–91. pmid:23258413
  13. 13. Tao J, Zhou X, Jiang Z. cGAS-cGAMP-STING: the three musketeers of cytosolic DNA sensing and signaling. IUBMB Life. 2016;68(11):858–70. pmid:27706894
  14. 14. Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, et al. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol. 2003;4(5):491–6. pmid:12692549
  15. 15. Chen H, Sun H, You F, Sun W, Zhou X, Chen L, et al. Activation of STAT6 by STING is critical for antiviral innate immunity. Cell. 2011;147(2):436–46. pmid:22000020
  16. 16. Kochanowsky JA, Thomas KK, Koshy AA. ROP16-mediated activation of STAT6 suppresses host cell reactive oxygen species production, facilitating type III Toxoplasma gondii growth and survival. #N/A. 2021;12.
  17. 17. Denkers EY, Kochanowsky JA, Chandrasekaran S, Sanchez JR, Thomas KK, Koshy AA. ROP16-mediated activation of STAT6 enhances cyst development of type III Toxoplasma gondii in neurons. PLoS Path. 2023;19.
  18. 18. Panne D, McWhirter SM, Maniatis T, Harrison SC. Interferon regulatory factor 3 is regulated by a dual phosphorylation-dependent switch. J Biol Chem. 2007;282(31):22816–22. pmid:17526488
  19. 19. Wang P, Li S, Zhao Y, Zhang B, Li Y, Liu S, et al. The GRA15 protein from Toxoplasma gondii enhances host defense responses by activating the interferon stimulator STING. J Biol Chem. 2019;294(45):16494–508. pmid:31416833
  20. 20. Li Y, Li C, Xue P, Zhong B, Mao A-P, Ran Y, et al. ISG56 is a negative-feedback regulator of virus-triggered signaling and cellular antiviral response. Proc Natl Acad Sci U S A. 2009;106(19):7945–50. pmid:19416887
  21. 21. Fensterl V, Sen GC. The ISG56/IFIT1 gene family. J Interferon Cytokine Res. 2011;31(1):71–8. pmid:20950130
  22. 22. Gao F-F, Quan J-H, Choi I-W, Lee Y-J, Jang S-G, Yuk J-M, et al. FAF1 downregulation by Toxoplasma gondii enables host IRF3 mobilization and promotes parasite growth. J Cell Mol Med. 2021;25(19):9460–72. pmid:34464509
  23. 23. Majumdar T, Sharma S, Kumar M, Hussain MA, Chauhan N, Kalia I, et al. Tryptophan-kynurenine pathway attenuates β-catenin-dependent pro-parasitic role of STING-TICAM2-IRF3-IDO1 signalosome in Toxoplasma gondii infection. Cell Death Dis. 2019;10(3):161. pmid:30770800
  24. 24. Matta SK, Olias P, Huang Z, Wang Q, Park E, Yokoyama WM, et al. Toxoplasma gondii effector TgIST blocks type I interferon signaling to promote infection. Proc Natl Acad Sci U S A. 2019;116(35):17480–91. pmid:31413201
  25. 25. Song L, Wang R, Cao Y, Yu L. Mutual regulations between Toxoplasma gondii and type I interferon. Front Immunol. 2024;15:1428232. pmid:39040112
  26. 26. Chen M, Yao L, Zhou L, Yang P, Zou W, Xu L, et al. Toxoplasma gondii ROP18I inhibits host innate immunity through cGAS-STING signaling. FASEB J. 2022;36(2):e22171. pmid:35084749
  27. 27. Jin Q-W, Yu T, Pan M, Fan Y-M, Huang S-Y. ROP16 of Toxoplasma gondii inhibits innate immunity by triggering cGAS-STING pathway inactivity through the polyubiquitination of STING. #N/A. 2023;12.
  28. 28. Hu Z, Zhang Y, Xie Y, Yang J, Tang H, Fan B, et al. The Toxoplasma effector GRA4 hijacks host TBK1 to oppositely regulate anti‐T. gondii immunity and tumor immunotherapy. #N/A. 2024;11.
  29. 29. Henriquez FL, Nickdel MB, McLeod R, Lyons RE, Lyons K, Dubremetz JF, et al. Toxoplasma gondii dense granule protein 3 (GRA3) is a type I transmembrane protein that possesses a cytoplasmic dilysine (KKXX) endoplasmic reticulum (ER) retrieval motif. Parasitology. 2005;131(Pt 2):169–79. pmid:16149193
  30. 30. Fox BA, Guevara RB, Rommereim LM, Falla A, Bellini V, Pètre G, et al. Toxoplasma gondii parasitophorous vacuole membrane-associated dense granule proteins orchestrate chronic infection and GRA12 underpins resistance to host gamma interferon. mBio. 2019;10(4):e00589-19. pmid:31266861
  31. 31. Mani R, Abdelaziz MH, Ochiai E, Sa Q, Fox BA, Bzik DJ, et al. Dense granule protein 3 of Toxoplasma gondii plays a crucial role in the capability of the tissue cysts of the parasite to persist in the presence of anti-cyst CD8+ T cells during the chronic stage of infection. Front Immunol. 2023;14:1272221. pmid:37868957
  32. 32. Obed C, Wu M, Chen Y, An R, Cai H, Luo Q, et al. Toxoplasma gondii dense granule protein 3 promotes endoplasmic reticulum stress-induced apoptosis by activating the PERK pathway. Parasit Vectors. 2022;15(1):276. pmid:35918751
  33. 33. Rommereim LM, Fox BA, Butler KL, Cantillana V, Taylor GA, Bzik DJ. Rhoptry and dense granule secreted effectors regulate CD8+ T cell recognition of Toxoplasma gondii infected host cells. Front Immunol. 2019;10:2104. pmid:31555296
  34. 34. Craver MPJ, Knoll LJ. Increased efficiency of homologous recombination in Toxoplasma gondii dense granule protein 3 demonstrates that GRA3 is not necessary in cell culture but does contribute to virulence. Mol Biochem Parasitol. 2007;153(2):149–57. pmid:17418907
  35. 35. Liu S, Cai X, Wu J, Cong Q, Chen X, Li T, et al. Phosphorylation of innate immune adaptor proteins MAVS, STING, and TRIF induces IRF3 activation. Science. 2015;347(6227):aaa2630. pmid:25636800
  36. 36. O’Connell RM, Saha SK, Vaidya SA, Bruhn KW, Miranda GA, Zarnegar B, et al. Type I interferon production enhances susceptibility to Listeria monocytogenes infection. J Exp Med. 2004;200(4):437–45. pmid:15302901
  37. 37. Manca C, Tsenova L, Bergtold A, Freeman S, Tovey M, Musser JM, et al. Virulence of a Mycobacterium tuberculosis clinical isolate in mice is determined by failure to induce Th1 type immunity and is associated with induction of IFN-alpha /beta. Proc Natl Acad Sci U S A. 2001;98(10):5752–7. pmid:11320211
  38. 38. MacMicking JD. Interferon-inducible effector mechanisms in cell-autonomous immunity. Nat Rev Immunol. 2012;12(5):367–82. pmid:22531325
  39. 39. McNab F, Mayer-Barber K, Sher A, Wack A, O’Garra A. Type I interferons in infectious disease. #N/A. 2015;15:87–103.
  40. 40. Gazzinelli RT, Oswald IP, James SL, Sher A. IL-10 inhibits parasite killing and nitrogen oxide production by IFN-gamma-activated macrophages. J Immunol. 1992;148(0):1792–6.
  41. 41. Nathan CF, Murray HW, Wiebe ME, Rubin BY. Identification of interferon-gamma as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. J Exp Med. 1983;158(3):670–89. pmid:6411853
  42. 42. Cheng Z, Dai T, He X, Zhang Z, Xie F, Wang S, et al. The interactions between cGAS-STING pathway and pathogens. Signal Transduct Target Ther. 2020;5(1):91. pmid:32532954
  43. 43. Seok JK, Kim M, Kang HC, Cho Y-Y, Lee HS, Lee JY. Beyond DNA sensing: expanding the role of cGAS/STING in immunity and diseases. Arch Pharm Res. 2023;46(6):500–34. pmid:37354378
  44. 44. Ablasser A, Goldeck M, Cavlar T, Deimling T, Witte G, Röhl I, et al. cGAS produces a 2’-5’-linked cyclic dinucleotide second messenger that activates STING. Nature. 2013;498(7454):380–4. pmid:23722158
  45. 45. Butcher BA, Fox BA, Rommereim LM, Kim SG, Maurer KJ, Yarovinsky F, et al. Toxoplasma gondii rhoptry kinase ROP16 activates STAT3 and STAT6 resulting in cytokine inhibition and arginase-1-dependent growth control. PLoS Pathog. 2011;7(9):e1002236. pmid:21931552
  46. 46. Xu L, Wang W, Li Y, Zhou X, Yin Y, Wang Y, et al. RIG-I is a key antiviral interferon-stimulated gene against hepatitis E virus regardless of interferon production. Hepatology. 2017;65(6):1823–39. pmid:28195391
  47. 47. Schoggins JW, MacDuff DA, Imanaka N, Gainey MD, Shrestha B, Eitson JL, et al. Pan-viral specificity of IFN-induced genes reveals new roles for cGAS in innate immunity. Nature. 2014;505(7485):691–5. pmid:24284630
  48. 48. Maciag K, Raychowdhury R, Smith K, Schneider AM, Coers J, Mumbach MR, et al. IRF3 inhibits IFN-γ-mediated restriction of intracellular pathogens in macrophages independently of IFNAR. J Leukoc Biol. 2022;112(2):257–71. pmid:34826345