Advertisement

  • Loading metrics

Open Access

Peer-reviewed

Research Article

The nuclear basket nucleoporin MLP1 is required to maintain nuclear integrity, and mitotic fidelity in Trypanosoma brucei

  • Akila Yagoubat ,

    Roles Conceptualization, Investigation, Writing – original draft, Writing – review & editing

    akila.merahyagoubat@ijm.fr (AY); yvon.sterkers@umontpellier.fr (YS)

    Current affiliation: Université Paris Cité, CNRS, Institut Jacques Monod, Paris, France.

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Lucien Crobu,

    Roles Investigation

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Slavica Stanojcic,

    Roles Investigation

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Nada Kuk,

    Roles Investigation

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Amélie Sarrazin,

    Roles Investigation

    Affiliation Montpellier RIO Imaging Facility, Montpellier BIOCAMPUS, University of Montpellier, Arnaud de Villeneuve Campus Imaging Facility-Institut de Génétique Humaine-CNRS, Montpellier, France

    ⨯
  • Marie-Pierre Blanchard,

    Roles Investigation, Resources

    Affiliation Montpellier RIO Imaging Facility, Montpellier BIOCAMPUS, University of Montpellier, Arnaud de Villeneuve Campus Imaging Facility-Institut de Génétique Humaine-CNRS, Montpellier, France

    ⨯
  • Patrick Bastien,

    Roles Writing – original draft

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Maude F. Lévêque,

    Roles Writing – original draft

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
  • Laurence Berry,

    Roles Conceptualization, Investigation, Resources, Writing – original draft, Writing – review & editing

    Affiliation Laboratory of Pathogen and Host Immunity, CNRS, University of Montpellier, Montpellier, France

    ⨯
  • Yvon Sterkers

    Roles Conceptualization, Funding acquisition, Project administration, Supervision, Writing – original draft, Writing – review & editing

    akila.merahyagoubat@ijm.fr (AY); yvon.sterkers@umontpellier.fr (YS)

    Affiliation MiVEGEC, University of Montpellier, CNRS, IRD, CHU, Montpellier, France

    ⨯
?

This is an uncorrected proof.

Abstract

Trypanosoma brucei, a divergent eukaryote parasite, is responsible for neglected tropical diseases in humans and animals, specifically sleeping sickness or human African trypanosomiasis and nagana. Beyond its scientific significance, a comprehensive understanding of its biology has substantial medical and economical implications. Nuclear pore complexes (NPCs) are large multiprotein channels embedded in the nuclear envelope that regulate nucleocytoplasmic transport. In addition to this critical function, NPCs are involved in essential nuclear processes such as chromosome segregation, transcription, and cytokinesis. This study demonstrates that Myosin-like protein-1 (MLP1) localizes to the nuclear basket of NPCs in T. brucei. Silencing of TbMLP1 by RNA interference in T. brucei procyclic cells resulted in severe growth, significant impairment of messenger RNA export, disorganization of nuclear structure, and marked genomic instability. Flow cytometry and fluorescence in situ hybridization (FISH) analyses revealed abnormal DNA content and a reduction in disomic cells, alongside an increase in monosomic, trisomic, and polysomic cells, indicating intolerable aneuploidy detrimental to cell viability. Together, these findings demonstrate that TbMLP1 links NPC function to multiple key cellular pathways. This research provides new insights into the mechanisms that maintain nuclear architecture, preserve nuclear envelope morphology, ensure genome stability, and faithful chromosome segregation, and support appropriat kinetochore distribution and mitotic spindle organization.

Author summary

Trypanosoma brucei is the microscopic parasite responsible for sleeping sickness in humans and nagana in cattle. Understanding its fundamental biology may reveal vulnerabilities that could be targeted by future treatments. In this study, we investigated a protein called MLP1, located at nuclear pores—the gateways that that regulate the transport in and out of the nucleus.

Our findings indicate that MLP1 is crucial for the proper movement of messenger RNA, the maintenance of nuclear stability and the equitable distribution of chromosomes during cell division.

Overall, this reserach provides new insight into the basic biology of a parasite, Trypanosoma brucei, that remains a major health concern in various regions worldwide, illustrating how a single structural protein can impact multiple vital processes.

Citation: Yagoubat A, Crobu L, Stanojcic S, Kuk N, Sarrazin A, Blanchard M-P, et al. (2026) The nuclear basket nucleoporin MLP1 is required to maintain nuclear integrity, and mitotic fidelity in Trypanosoma brucei. PLoS Negl Trop Dis 20(6): e0013922. https://doi.org/10.1371/journal.pntd.0013922

Editor: Erica Silberstein, FDA: US Food and Drug Administration, UNITED STATES OF AMERICA

Received: January 7, 2026; Accepted: June 5, 2026; Published: June 22, 2026

Copyright: © 2026 Yagoubat et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All data are in the manuscript and/or supporting information files.

Funding: This work was supported by the “Agence Nationale de la Recherche” within the frame of the “Investissements d’avenir” program (ANR-11-LABX-0024-01 “PARAFRAP”; to YS and AY); the Centre National de la Recherche Scientifique (CNRS), the French Ministry of Research and the Centre Hospitalier Universitaire of Montpellier to YS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Trypanosoma brucei represents an unconventional eukaryotic model for biological studies. This protozoan parasite the causative agent of Human African Trypanosomiasis (HAT or sleeping sickness) and Animal African Trypanosomiasis (AAT or Nagana in animals) imposes a significant global burden on health and economic progress. T. brucei is a divergent unicellular eukaryote [1], that undergoes a closed mitosis during which the nuclear envelope remains intact, and the mitotic spindle is assembled intranuclearly like in yeast [2,3]. It also possesses very distinctivel and unusual features; Trypanosoma has two independent but coordinated cell cycles (nuclear and mitochondrial) [4]. The genome is organized in large unidirectional polycistronic units composed of tens or hundreds of functionally unrelated genes [5,6]. Transcription is mediated by RNA polymerase II, whereas theres is a near absence of promoters; gene expression regulation occurs mainly at the posttranscriptional level [7].

Nuclear pore complexes (NPCs) are macromolecular structures that perforate the nuclear envelope forming the unique sites of exchange between the cytoplasm and the nucleus. NPC is one of the largest protein complexes in eukaryotes; it is constituted by ~30 different proteins (in yeast and vertebrates). These structural protein units are called nucleoporins (NUPs) [8,9]. The detailed structure and folding of NPCs have been well established in Saccharomyces cerevisiae [10] and in mammals [11,12]. The NPC structure consists of a symmetrical part known as the core complex anchored in the nuclear envelope [8] and an asymmetrical composed of filaments emerging from the cytoplasmic and nuclear sides. While the cytoplasmic filaments emerge freely from the NPC, the nuclear filaments are attached to the nuclear envelope on the nuclear side to form the nuclear pore basket [13].

The general structure/folding of the NPCs are well conserved between yeast, vertebrates and plants [14] and even in more divergent eukaryotes like T. brucei [15]. In addition to their roles in nucleo-cytoplasmic transport, there is increasing evidence showing that NUPs play a pivotal role in maintaining nuclear organization and genome integrity (reviewed in [9]). For example, the spatial organization of other nuclear complexes such as the transcription export complex (TREX) [16], DNA repair machinery [17,18], cell cycle progression, and chromosome segregation during mitosis [19–21] and gene transcription (as reviewed in [22,23]).

One of the most important parts of the NPCs is the nuclear basket. The nuclear basket serves as a multifunctional platform for various nuclear processes [21,24]. It contributes to (i) the maintenance of the nuclear organization/stability [25], (ii) the control of telomere length and repair of DNA damage, and [26–30], (iii) the spatial regulation of the Spindle Assembly Checkpoint (SAC) [31–34]. Sequence homology searches failed to identify any clear NUPs homologs in trypanosomatid genomes indicating high sequence divergence. However, in 2009, 22 TbNUPs were identified using proteomic approaches followed by in situ tagging and localization in T. brucei [15]. Despite low primary sequence similarity, TbNUPs share secondary structural organization with NUPs from other model organisms [15,35] with the exception of the peripheral regions such as the nuclear basket which is more divergent [36–39]. The nuclear basket is mainly formed by TPR (translocated promoter region) proteins, which are encoded by multicopy genes in mammals. TPR homologs in fungi and trypanosomatids are named myosin-like proteins (MLP1 and MLP2). There is clear evidence that TbNUP92/TbMLP2 is implicated in chromosomal distribution and genome stability [37,40]. MLP1 “myosin like protein in Trypanosomatids seems to be specific to kinetoplastid at both genomic sequence and domain organization levels. In this work we have characterized NUP110/TbMLP1 in T. brucei. Our results show that TbMLP1 is localized to the nuclear pore basket throughout the cell cycle and that TbMLP1 is essential for cell survival and correct cell cycle progression in T. brucei. We demonstrated that TbMLP1 is required to maintain the integrity of the nuclear architecture, the nuclear envelope morphology, and cellular ploidy. Further, we propose that TbMLP1 is essential for the chromosome segregation process by facilitating correct kinetochore distribution and mitotic spindle organization.

Methods

Parasites in vitro culture

Procyclic forms of the T. brucei Lister 427 wild type were used as control strain and T. brucei Lister 427 29–13 co-expressing the T7 RNA polymerase and the tetracycline repressor was used to generate the TbMLP1 RNAi knockdown cell lines. To generate the strain co expressing the T7TR system and the Cas9, Tb Lister 427 29–13 (T7TR) was transfected with an episome coding for the SpCas9-HA and the puromycin resistance cassette [41]. The Tb427-T7TR-Cas9 was then used to generate RNAi and tagged cell lines. All cell lines were grown at 27°C in SDM-79 supplemented with 10% heat inactivated tetracycline free FBS, 7 µg.mL-1 hemin, 30 µg.mL-1 of hygromycin (InvivoGen) and 10 µg.mL-1 of geneticin (InvivoGen) for the Tb Lister 427 29–13 (T7TR) line in addition to 30 µg.mL-1 of puromycin (InvivoGen) for the strain expressing Cas9. To establish cell growth curves, every second day, cells were counted using a Denovix CellDrop 2 Channel Fluorescence and BrightField and diluted to 3x106 cells/mL.

MLP1 RNAi and tagging strains in T. brucei

All sequence analysis were performed using TriTrypDB [42,43], the integrated functional genomics resource for kinetoplastida; part of vEuPathDB, the eukaryotic pathogen vector and host bioinformatics resource center [44].

MLP1 RNAi in T. brucei.

The RNAi targeted sequence of MLP1 in T. brucei 427 (TbMLP1) were identified as described in ([45] and https://dag.compbio.dundee.ac.uk/RNAit/) and PCR-amplified from genomic DNA of T. brucei Lister 427 wild type cell line. For TbMlp1, the oligonucleotides primers used were 5’ GGGCCGCGGGGGAAGGTGCAATACAGGAA 3’ and 5’ GGGAAGCTTGTTGCGATGAAAACAAAGCA 3’. The PCR product was cloned into pGEM-Teasy (Promega). The target sequence from TbMLP1 was then subcloned into p2T7tiB vector using the restriction sites HindIII and SacII to generate TbMLP1 p2T7 RNAi vector. Prior to transfection, 10 mg of TbMLP1 p2T7 vector were linearized using NotI and purified using the Kit Wizard SV Gel and PCR Clean-Up System (Promega) following the productor instructions and heat-sterilized at 75°C for 10 min. Parasite transfections were performed as described previously [46], using the Amaxa Nucleofector 2b and X-001 programs. A total of 2.107 cells from exponential cell culture of the T. brucei Lister 427 29–13 (T7TR) cell line was used per transfection. Transfected cells were left to recover for 18-24h then selective pressure was added (5 µg.mL-1 of phleomycin). Induction of the RNAi cell lines was performed by addition of 3 µg.mL-1 of tetracycline.

In situ tagging in T. brucei.

In situ tagging in T. brucei wild type strains (without Cas9) was performed using the long primers PCR tagging strategy and the pMOTag4G vector as a template [47]. Primers used for in situ tagging of TbMLP1 were 5’ATGCGACTACTGCACGTCAACAAGCAACTTGTGGAGAGAGTCAAAACCAGTCGAACTGAAGGAGAATCCCAGTCCAGTGGTACCGGGCCCCCCCTCGAG3’ and 5’TACACGAATTGTCATACAACCTGACTAGCAGACGTAAGGCGCTACGAACCTTTACTGTGGTTCAAACAAAAATGGCGGCCGCTCTAGAACTAGTGGAT 3’. The primers contained homology regions of 80 bp. The linear PCR products containing the two-homology regions, the tag and a drug selection marker were amplified, purified and sterilized by ethanol precipitation. T. brucei Lister 427 procyclic stage cells were transfected by electroporation with 10µg of PCR product and allowed to recover. Protein localization was verified by immunofluorescence assay (IFA).

Gene tagging using CRISPR-Cas9 in Tb427-T7TR-Cas9.

For gene tagging coupled with the RNAi knockdown of MLP1 the cell line Tb427-T7TR-Cas9 was used. The TbMLP1 RNAi was generated as explained above and the tags were introduced using the PCR-based CRISPR-Cas9 strategy for which the sgRNA and the donor DNAs containing the tag and the selection marker were amplified and transfected as PCR products [46].

Gene tagging in TbMLP1 RNAi.

The localization of the following proteins were analyzed MLP1 (Tb427tmp.03.0810), TbNUP109 (Tb427tmp.01.7630), TbNUP98 (Tb427.03.3180), TbNUP-1(Tb427.02.4230) [36], KINF (Tb427.03.2020) [48,49], KKT2 (Tb427tmp.01.2290) [50]. All the primers for sgRNA and donor DNA were designed through the LeishGEdit website (www.leishgedit.net) [46]. The primers sequences are available in the S1 Table). 20 ng of circular pPoT vectors (pPOT-NeonG phléomycin and pPOT-HA hygromycin) were used as templates to amplify the donor DNAs for gene tagging. For PCR product amplification, 0.2 mM dNTPs, 2 µM each of gene-specific forward and reverse primers and 1-unit Phusion Polymerase (NEB) were mixed in 1 X Phusion reaction buffer, 50 µL total volume. PCR steps were 30 s at 98 °C followed by 35 cycles of 30 s at 98 °C, 30 s at 61 °C, 1min at 72 °C followed by a final elongation step for 10 min at 72 °C. Except the plasmid templates, similar PCR mix was used to amplify the sgRNAs. Final PCR products of donor DNAs and sgRNAs were purified using the Kit Wizard SV Gel and PCR Clean-Up System (Promega) and heat-sterilized at 75 °C for 10 min. Five µg of each donor DNA and 5 µg of the specific sgRNA were used for each transfection. Transfections were performed in the Amaxa Nucleofector using the X-001 program as described above and in [46]. After recovery tag integration was checked using PCR and immunofluorescence localization. Protein behaviors and localization were followed in non-induced or tetracycline induced TbMLP1 RNAi cells.

qRT PCR

To control the efficiency of mRNA reduction during the RNAi induction of TbMLP1 RNAi cells, quantitative RT-PCR was performed. T. brucei MLP1 non induced or tetracycline induced cells (total number of 2.107 cells) were harvested by centrifugation, then RNA was extracted using the RNeasy Mini kit (Qiagen) following the manufactures’ instructions. Collected RNAs were treated with DNase-TURBO (Ambion) for 30 min at 37 °C to digest residual DNA contamination then cDNAs were synthesized using the Super Script III cDNA Synthesis Kit (Invitogen). PCR reaction mixtures were composed according to the manufacturer’s protocol using the LightCycler-480 SYBR Green I master kit (Roche) for a final volume of 15µL. Reactions were carried out in a Roche Real-Time System using the following cycling conditions: 95 °C for 5 min, followed by 44 cycles at 95 °C for 10 s, 58 °C for 10s and 72 °C for 10 s. A reference gene, GPI8, was used to check RNA integrity (see list of primers in S1 Table).

Immunofluorescence and high-resolution imaging

Transfected cells were harvested and washed with PBS 1X twice, fixed with 4% paraformaldehyde at room temperature. Fixed cells were then washed with PBS 1X and diluted to obtain an appropriate cell density. Cells were adhered to glass slides coated with poly-L-lysine, then neutralized with 100 mM glycine and permeabilized with 0.2% Triton X-100 for 10 min. Slides were blocked 1 h with 1% bovine serum albumin (BSA) in PBS and then incubated with the corresponding primary antibodies diluted in PBS-BSA for 1 hour. Primary antibodies were visualized with the appropriate secondary antibodies conjugated with Alexa Fluor 488, Fluor 546 or ATTO (STED) Secondary Antibody Conjugates (anti-rabbit and anti-mouse secondaries for STED microscopy). DNA was stained with DAPI (Vector laboratories) or Hoechst 33342 (Thermo Scientific). Finally, slides were mounted with Gold Antifade Reagent (Thermo Fisher-Invitrogen). Cells were viewed by phase contrast, and fluorescence was visualized using appropriate filters on a Zeiss Axioplan 2 microscope with a 100 X objective. Digital images were captured using a Photometrics CoolSnap CCD camera (Roper Scientific) and processed with MetaView (Universal Imaging) or Digital images were captured using an ORCA-flash4.0 camera (Hamamatsu) and processed by ZEN software (Zeiss). Confocal and STED imaging was performed using a quad scanning STED microscope (Expert Line, Abberior Instruments, Germany) equipped with a PlanSuperApo 100 X/1.40 oil immersion objective (Olympus, Japan). For superresulution images, Abberior STAR-RED was excited at 640 nm with a dwell time of 10 µs and STED was performed at 775 nm. Images were collected in line accumulation mode (five lines accumulation). Fluorescence was detected using avalanche photo diodes and spectral detection (650–740 nm). The pinhole was set to 1.0 Airy unit and a pixel size of 20 nm was used for all acquisitions.

Qualitiative immunoelectron microscopy: Immunogold labeling on Tokuyasu cryosections

For immunoelectron microscopy, GFP-tagged parasites were fixed with 4% paraformaldehyde in phosphate buffer at 4 °C. Cells were then incubated in 0.1% glycine in phosphate buffer, pelleted and embedded in 12% gelatin, cut in small blocks (< 1 mm) and infused 24 h in 2.3 M sucrose on a rotating wheel at 4°C. Gelatin blocks were mounted on specimen pins and frozen in liquid nitrogen. Cryo-sectioning was performed on a Leica UC7 cryo-ultramicrotome, 70 nm cryosections were picked-up in a 1:1 mixture of 2.3 M sucrose and 2% methylcellulose in water and stored at 4 °C. For on-grids immunodetection, grids were floated on PBS 2% gelatin 30 min. at 37 °C to remove methylcellulose/sucrose mixture, then blocked with 1% skin-fish gelatin (SFG, Sigma) in PBS for 5 min. Successive incubation steps were performed on drops as follows: 1) rabbit anti GFP (Abcam 6556) in 1% BSA, 2) Protein A-gold (UMC Utrecht) in PBS 1% BSA. Four 2 min washes in PBS 0.1% BSA were performed between steps. After Protein A, grids were washed four times 2 min. with PBS, fixed 5min in 1% glutaraldehyde in water then washed six times 2 min with distilled water. Grids were then incubated with 2% methylcellulose: 4% uranyl acetate 9:1 15 min on ice in the dark, picked up on a wire loop and air-dried. Observations and image acquisition were performed on a Jeol 1400 + transmission electron microscope on the Electron Microscopy Platform of the University of Montpellier (MEA; http://mea.edu.umontpellier.fr).

DNA content analysis

To determinate the DNA content in T. brucei control non induced cells or TbMLP1 knockdown cells, a propidium iodide (PI) staining method was used. Mid-log cells were harvested by centrifugation at 10,000 g, for 5 min at 4 °C; 2.107 cells were used for each sample. Cells were washed with PBS 1X, resuspended in 500 µL of ice-cold 70% methanol, vortexed 1 min and incubated at 4 °C maximum 10 days. After centrifugation, cells were resuspended in PBS1X and 0.1 mg. mL-1 RNAse A, placed 20 min at 37°C, centrifuged and incubated 10–30 min on ice with 2.5% PI and immediately analyzed on a NAVIOS Flow cytometer (Beckman Coulter). Bicolor flow cytometry to analyze DNA content with S phase cells detection was performed as described elsewhere [51]. To detect S phase cells, mid log growing cells were incubated 30 min with 150 μM IdU, collected by centrifugation and washed with 1x PBS. Cells were fixed at -20 °C with a mixture of ethanol and PBS 1X (7:3) and then washed with washing buffer (PBS 1X supplemented with 1% BSA) and DNA denatured with 2 N HCL. To detect incorporated IdU, cells were incubated with anti-BrdU antibody (diluted in washing buffer supplemented with 0.2% Tween-20) for 1h at room temperature then incubated for 1 h with anti-mouse secondary antibody conjugated with Alexa Fluor 488 at room temperature. Finally, cells were resuspended in PBS 1X supplemented with 10 μg. mL-1 Propidium Iodide and 10 μg. mL-1 RNAse A. Data were acquired on the fluorocytometer “Miltenyi MACS quant” and analyzed with FlowJo software

FISH and RNA FISH

T. brucei cells were fixed in 4% paraformaldehyde, air-dried on microscope immunofluorescence slides and dehydrated in serial ethanol baths (50–100%). Probes were labelled with tetramethyl-rhodamine-5-dUTP (Roche) by using the Nick Translation Mix (Roche). Hybridization was performed with a heat-denatured DNA probe under a sealed rubber frame at 94 °C for 2 min and then overnight at 37 °C. The hybridization solution contained 50% formamide, 10% dextran sulfate, 2 X SSPE, 250 mg. mL-1 salmon sperm DNA and 100 ng of labelled double strand DNA probe. After hybridization, slides were sequentially washed in 50% formamide-2 X SSC at 37 °C for 30 min, 2 X SSC at 50 °C for 10 min, 2 X SSC at 60 °C for 10 min, 4 X SSC at room temperature. Slides were finally mounted in Vectashield with DAPI and microscopically examined; more than 200 cells per condition were counted. After inhibition of TbMLP1 by RNAi, the number of copies of chromosome 1 was determined by using DNA probes targeting the alpha- and beta-tubulin genes [52] and chromosome 8 using the M5 ribosomal RNA probe [48]. RNA FISH was performed as described in [53]. Briefly, cells were harvested and washed once with PBS 1x, placed on a poly-lysine slide to adhere. Adhered cells are then fixed with PFA 4% for 30min at room temperature and then 10 min with 25mM NH4Cl and simultaneously permeabilized and blocked with saponin and BSA. Cells were pre-hybridized for 1 hour with: 2% BSA, 5X Denhartdt’s solution, 4X SSC, 5% dextran sulphate, 35% formamide, 0.5 g.L-1 tRNA, 10U/mL RNasin. Followed by overnight incubation with appropriate probe; 2 ng.L-1 of Cy3-d(T)20 RNA FISH probe diluted in pre-hybridization solution then washed twice with serial dilutions of SSC solution (4X SSC, 2X SSC and 1X SSC). Nuclei were visualized by adding Hoechst before slides mounting. Cells were viewed by phase contrast, and fluorescence was visualized using appropriate filters on an ORCA-flash4.0 camera (Hamamatsu) and processed by ZEN software (Zeiss).

DNA combing

Molecular DNA combing and statistical analyses of replication parameters in T. brucei Tb427 wild type cells were performed as described previously [54]. Asynchronous cell culture was grown to the density between 3–5 x 106 cells/mL and sequentially labelled with two modified nucleosides: 300 μM iodo-deoxyuridine (IdU, Sigma) and 300 μM chloro-deoxyuridine (CldU, Sigma) for 20 min each. Agarose plugs were prepared with a total of 1 x 108 cells resuspended in 100 μL of 1 × PBS with 1% low-melting agarose. Each plug was incubated twice in 2 mL of proteinase K buffer (10 mM Tris-Cl, pH 7.0, 100 mM EDTA, 1% N-lauryl-sarcosyl and 2 mg/mL proteinase K) for 24 hours at 45 °C. Agarose plugs were stained with YOYO-1 fluorescent dye (Molecular Probes), resuspended in 100 μl of TE50 buffer (10 mM Tris-Cl, pH 7.0, 50 mM EDTA), melted at 65 °C and digested overnight with 10u of β agarase (Sigma Aldrich) at 42 °C. After removal of agarose, the DNA was resuspended in 4 mL of 50 mM MES (2-(N-morpholino) ethanesulfonic acid, pH 5.7) and the DNA fibres were combed as described previously [55] on silanized coverslips prepared by Montpellier DNA combing facility (MDC, IGMM, Biocampus CNRS). Combed DNA and the modified nuclotides were detected with the following combination of the primary antibodies: anti-ssDNA antibody (clone 16–19, Merck Milipore), the mouse anti-IdU antibody (clone B44, Becton Dickinson) and rat anti-CldU antibody (clone BU1/75, Eurobio Scientific). The following secondary antibodies were used: goat anti-rat antibody coupled to Alexa Fluor 488 (Molecular Probes), goat anti-mouse IgG1 coupled to Alexa 546 (Molecular Probes), and goat anti-mouse IgG2a coupled to Alexa 647 (Molecular Probes). The image acquisition was done with a Zeiss Z1 equiped with a ORCA-Flash 4.0 digital CMOS camera (Hamamatsu) and controlled by MetaMorph (Roper Scientific). Statistical analyses of inter-origin distances and velocities of replication forks were performed using Prism 5.0 (GraphPad Software). Statistical significance of the distributions was assessed using the nonparametric Mann–Whitney two-tailed tests that do not assume Gaussian distribution.

Results

MLP1 localizes in the nuclear basket of NPCs

Subcellular localization of MLP1 in T. brucei was assessed by N- or C- terminal epitope tagging. In T. brucei procyclic forms (PCFs), TbMLP1 tagged at its N- (Fig 1A) and C-terminal ends (S1A Fig) was consistently found at the nuclear envelope throughout the cell cycle. High resolution STED microscopy further demonstrated the punctuated signal of MLP1 around the nuclear envelope (Fig 1B) and allowed the estimation of the average diameter of the nuclear basket surrounded by MLP1 molecules ∼ 99 nm (Fig 1C) as compared to ∼120 nm in vertebrates and ∼ 97 nm in yeast [56–58]. Qualitative immunoelectron microscopy of TbMLP1-GFP revealed a nucleocytoplasmic signal near the NPCs rather than a membrane labelling which is consistent with a nuclear basket position (Fig 1D). To gain insights into its precise localization compared to other NPC components, MLP1 was co-expressed with a tagged version of NUP109, a key NUP from the outer ring of the NPC. While the NUP109 localized at the cytoplasmic face of the NPC, MPL1 was found at the inner face of the nuclear envelope throughout the cell cycle (Fig 1E).

thumbnail
Download:
Fig 1. TbMLP1 is a nuclear basket protein localized at the nuclear envelope throughout the cell cycle.

(A) TbMLP1-NeonGreenn localization in T. brucei PCFs by immunofluorescence with anti-tag antobodies. DAPI was used to viusalise DNA. A mitotic cell is shown on the upper lane and an interphasic cell on the lower lane. Scale bar: 2µm. (B) MLP1 localisation was further investigated by 2D superresolution using an ABBERIOR STED superresolution Microscope. The first column shows the standard confocal image and the second the corresponding STED Image. (C) Diameter of Pores. Pore diameter measurement was done using FIJI. Data were obtained on >2 slides, > 20 nuclei and >100 pores per experiment. (D) Immunoelectron microscopy. TbMLP1-GFP was localized in the nucleoplasm beneath a nuclear pore. Gold particle (arrow). Scale bar: 100 nm. (E) TbMLP1-NeonGreenn co-expressed with NUP109-HAn in T. brucei PCFs. DAPI was used to visualize DNA (blue). A mitotic cell is shown on the upper lane and an interphasic cell on the lower lane. Scale bar: 2µm.

https://doi.org/10.1371/journal.pntd.0013922.g001

MLP1 is essential for cell survival and cell cycle progression

To investigate the function of TbMLP1 in T. brucei PCFs, we employed RNAi-mediated knockdown of MLP1 protein. TbMLP1 was fused with a halotag to monitor knockdown efficiency. At day two post induction (D2pi), only 12% of cells remained TbMLP1-HaloTag positive, while 48% were negative and 40% exibited very low labeling, as compared to 98% TbMLP1-HaloTag positive cells in non-induced (S1B Fig). These observations correlated with qRTPCR results which showed a 50% reduction to TbMLP1 mRNA levels at D2pi (S1C Fig). TbMLP1 depletion caused a significant growth defect (Fig 2A) suggesting that TbMLP1 is an essential protein in T. brucei PCF cells. To confirm the specificity of the proliferative phenotype we complemented the RNAi strain with either a recodonized version of TbMLP1 (tagged with HA, rTbMLP1-HA, or untagged) or with Lmex.MLP1 from Leishmania. The recodonized version rTbMLP1-HA localized correctly (S1D Fig) and the growth defect was restored to around 80% of the Non induced levels (Figs 2A, S1E, S1F). Expression of the Lmex.MLP1 protein also partially restored growth (> 50%) (Fig 2A). In T. brucei, both the nucleus and the condensed mitochondrial DNA (kinetoplast) are labelled with DAPI. Because mitosis is closed and the nuclear and mitochondrial cell cycles are independent yet coordinated [4], cell cycle progression can be monitored by assessing the number and position of DNA-containing organelles (i.e., nuclei (N) and kinetoplasts (K)). This principle is used to determine the Nucleus/Kinetoplast pattern (NK pattern) after DAPI staining. The NK pattern reflects the proportions of 1N1K, 1N2K, and 2N2K cells (normal configurations) as well as abnormal cells containing >2 K and/or >2 N in the population. Following induction of TbMLP1 RNAi, we observed a severe decrease in typical (1N1K, 1N2K) cells and a significant increase in atypical cells. These included cells with abnormal nuclei (1N1K: blurred nuclear boundaries, atypical nuclear extensions, enlarged nuclei, micronuclei, or nuclear peripheries displaying abnormal bulges or blebs) and cells with abnormal kinetoplast division, morphology, or positioning (1N2K and 2N2K*) (Fig 2B). Together, these data demonstrate that MLP1 is essential for cell progression in T. brucei.

thumbnail
Download:
Fig 2. TbMLP1 is essential for parasite survival and correct cell cycle progression.

(A) Growth curves comparing cell growth of non-induced and tetracycline induced parasites from day one to day six post induction of (i) TbMLP1 RNAi cell line (black lines), (ii) TbMLP1 RNAi complemented cell line with an HA tagged recodonized TbMLP1 version (Tb complementation) (Red lines), (iii) TbMLP1 RNAi complemented cell line with Lmex.MLP1 protein (Lmcomplementation) (lightblue lines). (B) NK pattern of non-induced TbMLP1 RNAi and induced cell lines. 1N*1K: cells with large, deformed nucleus boundaries and blebbing, 1N2K*: enlarged kinetoplast and nucleus, dividing kinetoplast does not segregate and almost fused with the nucleus, 2N*2K*: cells with defect in segregating the two-daughter nucleus and abnormal kinetoplast positioning. More than 200 cells, in two replicates were counted for each time point.

https://doi.org/10.1371/journal.pntd.0013922.g002

MLP1 is required to maintain nuclear envelope integrity

Analysis of the NK pattern in TbMLP1 depleted cells, revealed a pronounced increase of abnormal nuclear DAPI staining. We hypothesized that the absence of MLP1 might affect the NPCs and nuclear envelope architecture. To accurately assess NPCs distribution and nuclear envelope integrity, we followed the localization of two nucleoporins; in situ tagged NUP109 (from the outer ring) and NUP98 (an FG-NUP). In non-induced TbMLP1 RNAi cells, 97% of cells displayed correct NUP109-mNeonGreen positioning. Following TbMLP1 RNAi induction, only 70% and 35% of the cells showed proper localization at D2pi and D4pi, respectively (Fig 3A and 3C). Furthermore, after TbMLP1 induction, atypical cell phenotypes increased: 26% of cells exhibited undetectable NUP109-mNeonGreen signal, while 30% of cells showed DAPI spots surrounded by NUP109-GFP within the cytoplasm, at a distance from the nucleus, hereafter called micronuclei. Additionally, 5% of cells showed signal surrounding nuclear blebs and 5% displayed clustered NUP109 (Fig 3A and 3C). Similar results were obtained with NUP98 localization analyses (Fig 3B and 3D). These results suggest that MLP1 is required for the accurate positioning of other NUPs and the preservation of the nuclear envelope integrity.

thumbnail
Download:
Fig 3. TbMLP1 is required for nuclear pore complex integrity.

(A-B) Analysis of TbNUP109-NeonGreen and NUP98-NeonGreen localization patterns throughout the cell cycle in non-induced or induced TbMLP1 RNAi cell line (induced D2and D4pi). DAPI was used to visualize DNA (blue). Scal bar: 2 µm. (A) Selection of IFA images from TbNUP109-NeonGreen localization in induced TbMLP1 RNAi cells. From top to bottom: Induced cells present nuclei with diffuse abnormal extensions or invaginations (blebs), NUP clustering asymmetric nuclear size with micronucleus, cells with NUP109 signal almost undetectable. (B) Quantitative data: histograms representing the analysis of NUP109-NeonGreen localization pattern throughout the cell cycle in Non-induced or induced TbMLP1 RNAi cell line (induced D2 and D4), upon tetracycline induction: a decrease in correct NUP98-NeonGreen localization and an increase of atypical patterns (NUP clustering blebbing or absence of NUP98-NeonGreen labeling and cells with miconucleus) were observed. More than 200 cells, in two replicates were counted. (C-D) Idem from NUP98-NeonGreen localization (green) in Non-induced and induced TbMLP1 RNAi cells. More than 200 cells, in two replicates were counted.

https://doi.org/10.1371/journal.pntd.0013922.g003

The phenotypes observed regarding NE architecture are reminiscent of those observed after the depletion of TbNUP-1, a trypanosome lamin-like protein required for NPC positioning [36]. Interestingly, affinity isolation has previously showed that TbMLP1 interacts with TbNUP-1 [38]. We hypothesized that TbMLP1 might indirectly affect the nuclear envelope architecture through an effect on NUP-1 expression or localization. To test this hypothesis, we in situ tagged TbNUP-1 in TbMLP1 RNAi cell line and followed its expression and localization by IFA. In non induced cells, TbNUP-1-NeonGreen was correctly localized throughout the cell cycle (Fig 4A and 4B). After tetracycline induction, TbNUP1-NeonGreen localization and targeting to the nuclear envelope were compromised. By D4pi TbNUP-1 was correctly localized in only 28% of cells. It was mainly present in clusters, and some cells completely lost the NUP-1-NeonGreen signal. In addition heterogeneous expression levels were observed in induced cells suggesting that the defects observed at the level of nuclear envelope architecture and NPC positioning may be a consequence of defects in NUP-1 expression or positioning following TbMLP1 depletion.

thumbnail
Download:
Fig 4. TbMLP1 is required to maintain nuclear envelope integrity.

(A) IFA images from NUP1-NeonGreen localization (green) in non-induced and induced TbMLP1 RNAi cells. DAPI was used to visualize DNA (blue). NUP1-NG showed punctuated localization around the nuclear envelope in non-induced cells. Induced cells presented nuclei with diffuse abnormal extensions or invaginations (blebs), NUP clustering, asymmetric nuclear size with micronucleus, cells with NUP-1 signal almost undetectable. Bar: 2µm. (B) NUP1-NeonGreen localization pattern throughout the cell cycle in non-induced or induced TbMLP1 RNAi cell line (D2 and D4). Upon tetracycline induction a decrease in correct NUP1-NeonGreen localization around the nuclear envelope and an increase of atypical patterns (NUP clustering blebbing or absence of NUP-1-NG labeling and cells with miconuclei) were observed. More than 200 cells, in two replicates were counted. (C-D) RNA FISH analysis performed on TbMLP1 RNAi cells quantifying the RNA distibution and accumulation in non induced and induced cells at Day 2 and 4 post induction. (C) Representative microscopic fields (Non induced top line and induced bottom line). (D) Histograms presenting the quantititative data. More than 200 cells per condition were counted.

https://doi.org/10.1371/journal.pntd.0013922.g004

MLP1 plays an important role in mRNA transport through NPCs

A canonical role described for nuclear basket proteins from other organisms is the regulation of nucleocytoplasmic transport of RNA through NPCs. Indeed, in yeast, MLP1 is involved in the retention of unspliced mRNAs in the nucleus via a direct interaction with the 5’ splice site [59]. Furthermore, in yeast, MLP1 and MLP2 are also involved in a negative regulatory mechanism of specific genes in response to mRNA export abnormalities [60]. To verify the involvement of TbMLP1 in RNA transport, we performed RNA FISH experiments using a polyA probe. In non induced TbMLP1 RNAi cell lines, polyA signal was homogenous in around 100% of the labeled cells (Fig 4C); following RNAi induction, only 30% of labeled cells retained this homogenous distribution, while the remaining cells showed intense nuclear staining corresponding to intranuclear accumulation of mRNAs (Fig 4D). These findings suggest that, similar to its ortholog in yeast, TbMLP1 is involved in mRNA transport.

MLP1 is required to maintain genome integrity and ploidy stability

Next, we wanted to determine if MLP1 displays other non-canonical functions in addition to cell cycle progression and mRNA transport. We analyzed DNA content using propidium iodide staining and performed two-color flow cytometry analysis. We observed a reduction of cells in S and in G2/M phases alongside an increase of cells in G0G1 and an increase of cells with abnormal DNA content (>2C) (Fig 5A). To explore the population with a DNA content > 2C, we determined the copy numbers of chromosome 1 and chromosome 8 using FISH analysis. First, we validated these two probes on control cell lines, which appeared to be > 90% disomic in T. brucei. In the TbMLP1 RNAi induced cell line, aneupmoidy was observed (Fig 5B). The estimated copy number of chromosome 1 in interphasic cells (1N1K) shifted over time; disomic cells decreased down to 28% at D4pi, coupled with an increase in aneuploid cells mainly trisomic (~30%) and monosomic (16%) (Fig 5C). We observed the same trend with the chromosome 8 probe (Fig 5D). Overall, depletion of TbMLP1 led to mosaic aneuploidy in T. brucei.

thumbnail
Download:
Fig 5. TbMLP1 depletion affects DNA contents and genome stability in T. brucei.

(A) DNA contents analysis by propidium iodide staining (left panels) and two-color flow cytometry (right panels) of TbMLP1 RNAi non-induced cells and induced D2 and D4. The results in the table present the mean percentage of cells in the different cell cycle phases from replicates; representative dot plots from a single expirent are presented. NI and negative control cells were used to draw gates to discriminate between the different cell phases: subG1, G0G1, S, G2/M and >G2. Cells in G2/M have twice as more DNA content (2C) than cells in G1 (1C). Cells in S phase S are IdU positive and have an intermediate DNA content. (B) Representatitive FISH images performed on TbMLP1 RNAi cell line using chromosome 1 specific probe. (C-D) Quantitative data of FISH analyses, chromosome copy number and patterns were evaluated in intephasic 1N1K cells using chromosone 1 specific probe (C) and chromosome 8 specific probe (D). The number of chromosome homologs were counted in more than 200 nuclei, in two replicates. (E) FISH analysis on dividing cells. Representative images top line and quantitative data. More than 100 dividing nuclei were analyzed.

https://doi.org/10.1371/journal.pntd.0013922.g005

FISH also allowed us to analyse dividing (2N2K) cells, where we observed that asymmetrical divisions containing an odd number of homologs were increased in TbMLP1 depleted parasites (Fig 5E). Asymmetrical divisions containing an even number of homologs are typically observed when there is a segregation defect [61]. Conversely, an odd number of homologs in the dividing nuclei may suggest a replication defect preceding defective segregation. We therefore decided to investigate the role of MLP1 in the DNA replication process. We followed DNA replication dynamics after MLP1 depletion using the DNA molecular combing technique. Representative bidirectional replication forks used for this analysis are shown in S2A Fig. We compared the replication fork velocities in T. brucei before and three days post induction. The analysis showed that there is no significant difference in the replication fork velocities (S2B Fig). We also performed an analysis of inter-origin distances (IODs), which showed that there is no statistically significant change in IODs following knockdown of TbMLP1 (S2C Fig). Our data suggest that the TbMLP1 protein is not involved in the regulation of DNA replication, since the dynamics of this process were not affected in TbMLP1 depleted cells.

MLP1 is required for correct chromosome segregation and spindle assembly

After confirming that MLP1 was not involved in the replication process, we turned our attention to chromosome segregation, a potential mechanism that could explain the high rate (80%) of asymmetrical division in TbMLP1-depleted cells. To address this, we assessed the localization of kinetoplastid kinetochore 2 (KKT2) protein during cell division [50]. We analyzed the positioning of KKT2 in cells undergoing normal mitosis (1N2K, 2N2K). In normal cells, KKT2 dots align to form the metaphase plate and then move to the cell poles during anaphase and telophase [50]. In 80% of non-induced TbMLP1 RNAi cells, KKT2-NeonGreen was visible and its localization followed normal cell cycle kinetics. However, from D2pi to D4pi, the percentage of cells with correctly positioned KKT2-mNeonGreen decreased from 80% to 40%. The KKT2-NeonGreen signal became barely detectable and showed a scattered distribution between the daughter nuclei, suggesting the presence of lagging kinetochores [50] (Fig 6A, 6B).

thumbnail
Download:
Fig 6. TbMLP1 is required for correct kinetochore distribution during mitosis and for correct mitotic spindle’s network assembly.

(A-B) Selection of IFA images from TbKKT2-NeonGreen (KKT-NG) localization in TbMLP1 non induced (NI) and induced RNAi cell line. TbKKT2 is visualized using an anti-NeonGreen anti body (green) and DNA visualized with DAPI (blue). Bar 2µm. (C) Quantitative data of the analysis of TbKKT2-NG localization in dividing cells (1N2K, 2N2K) of NI or induced cell TbMLP1 RNAi cell line (induced D2 and D4). Upon tetracycline induction a decrease in normal TbKKT2 distribution (green) and an increase in abnormal positioning (black) were observed. More than 100 dividing cells were counted for each time point. (D-E) Selection of IFA images from KIN-F-NeonGreen (KIN-F-NG) localization in TbMLP1 non induced RNAi cell line. KINF was visualized using an anti-Neongreen antibody (green) and DNA with DAPI (blue) correct localization was observed following the cell cycle kinetics. (F) Quantitative data of the analysis of KIN-F-NG localization in dividing cells (1N2K, 2N2K) of non-induced or induced TbMLP1 RNAi cell line (induced D2 and D4). KIN-F-NG labeling was classified into detectable and normal localization (Green) or indetectable and abnormal localization (Black). KIN-F-NG showed abnormal localization pattern and almost a total absence. More than 100 dividing cells were counted for each time point.

https://doi.org/10.1371/journal.pntd.0013922.g006

Since TbMLP1 depletion affects KKT distribution, we next investigated mitotic spindle formation and regulation. Of note, T. brucei undergoes a closed mitosis with the mitotic spindle assembled within the nucleus [62]. We followed spindle behavior in TbMLP1 depleted cells using the cellular localization of a Spindle Associated Proteins (SAP)/ orphan kinesin named KIN-F [48,49] (Tb927.3.2020). In the non-induced TbMLP1 RNAi cell line, > 80% of dividing cells (1N2K and 2N2K) showed a detectable KIN-F-NeonGreen signal highlighting the mitotic spindle (Fig 6C). At D4pi, 59% of dividing cells displayed either a very low KIN-F-NeonGreen signal or no discernable mitotic spindle shape (Fig 6C and 6D). These results suggest that in addition to the defects in KKT2 distribution, TbMLP1 depletion also affects the proper formation or organization of the mitotic spindle in T. brucei. These phenotypes are reminiscent of those observed for some proteins important for chromosome segregation and spindle formation such as the RHO-like TbRHP protein [63] and Tousled-like kinase (TLK1) [64].

Discussion

We have characterized the protein TbMLP1 as a nuclear basket component of the NPC in Trypanosoma brucei and demonstrated that its depletion disrupts multiple essential processes. This work combines high-resolution microscopy, immunoelectron microscopy, functional genetics, chromosome-level ploidy measurements, and mRNA distribution analyses to build a coherent mechanistic model. The convergence of results from multiple approaches —RNAi, complementation, FISH, flow cytometry, and protein localization—provides strong evidence that TbMLP1 is essential for parasite viability and plays a central role in cell cycle progression. Depletion of TbMLP1 caused the accumulation of messenger RNA within the nucleus, nuclear envelope defects, perturbation of kinetochore positioning (KKT2) and mitotic spindle organization (KIN-F) and widespread chromosome segregation errors.

In different model organisms, several NUPs, particularly those forming the nuclear basket, are involved in a wide range of nuclear processes such as nuclear organization and genome integrity [9], cell cycle progression and chromosome segregation ([19–21] and reviewed in [22,23]). In a previous study, we showed that RNAi-mediated depletion of TbMLP2 results in a surprisingly mild phenotype despite its clear involvement in chromosome segregation [40]. Although TbMLP1 and TbMLP2 are both trypanosomatid homologs of nuclear basket proteins and share an overall coiled-coil architecture, they differ markedly in their subnuclear localization and in the functional consequences of their depletion, revealing a clear specialization of roles in T. brucei. TbMLP2 does not constitutively associate with the nuclear basket throughout the cell cycle but instead displays a highly dynamic localization pattern. During interphase, TbMLP2 is predominantly intranuclear, with exclusion from the nucleolus, and upon entry into mitosis it relocalizes to the spindle poles, where it contributes to proper chromosome distribution [37,40]. In contrast to TbMLP1, TbMLP2 depletion causes disrupted chromosomal distribution and a well-tolerated aneuploidy, without significant effects on cell viability. Cells accumulate intermediate DNA contents between 2C and 4C and progressively exhibit increased tri-, tetra-, or pentasomies, yet continue to proliferate normally. These features argue against TbMLP2 representing the direct counterpart in T. brucei of opisthokont Mlp2/Tpr proteins and instead support its classification as a lineage-specific, functionally specialized protein with roles linked primarily to mitotic spindle and kinetochore dynamics. Multiple lines of evidences from immunofluorescence, interactome, and co‑purification datasets support at least a transient interaction between TbMLP1 and TbMLP2 [37–40].

TbMLP1 stands out as an essential factor whose depletion triggers severe nuclear defects humpring cell viability. TbMLP1 silencing leads to strong growth impairment, disruption of mRNA export with intranuclear accumulation of poly(A) RNA, and major alterations to nuclear morphology, including blebs, micronuclei, and mispositioned NUPs. TbMLP1 is also indispensable for ploidy stability, as its loss induces severe, non-tolerated aneuploidy characterized by both chromosome loss and gain (monosomies, trisomies, polysomies). These defects are accompanied by dramatic abnormalities in kinetochore positioning (KKT2) and mitotic spindle organization (KIN-F), consistent with a central role in nuclear integrity and mitotic fidelity. Unlike TbMLP2 depletion, TbMLP1 RNAi-mediated knockdown profoundly affects cell-cycle progression, with reduced S and G2/M populations and accumulation of cells in G1 and>2C states, reflecting a global collapse of cell-cycle control.

Thus, although both MLPs contribute to faithful chromosome segregation, TbMLP2 functions primarily as a non-essential mitotic factor whose loss perturbs chromosome distribution without compromising viability, whereas TbMLP1 is a core nuclear basket component essential for nuclear stability, mRNA export, spindle assembly, and the maintenance of ploidy. This comparison highlights the marked functional divergence between these two proteins and underscores the critical multifunctionality of TbMLP1 in the nuclear architecture and physiology of T. brucei. The observed phenotypes in TbMLP1 depleted cells—aberrant nuclear envelope morphology, micronuclei formation, and chromosome mis-segregation—resemble defects reported in other systems when nuclear basket components are impaired [65–70]. Thus, TbMLP1 emerges as a conserved functional counterpart of Tpr/mlp proteins in opisthokonts [19–21], linking NPC structure to both nuclear architecture and segregation fidelity in kinetoplastids.

TbMLP1 inhibition elicits pleiotropic defects, some of which are likely indirect, as illustrated by the impairment of mRNA export. In T. brucei, mRNA export fundamentally differs from the opisthokont paradigm: rather than relying on ATP-dependent remodeling by the TREX-2/Dbp5 machinery at the cytoplasmic face of the nuclear pore, export is mediated by the Mex67/Mtr2 receptor and driven primarily by the Ran-GTP/Ran-GDP gradient at a structurally asymmetric nuclear pore complex [39]. In this context, the mRNA export defect observed upon TbMLP1 depletion is more plausibly a downstream consequence of disrupted nuclear architecture and nuclear pore organization. This view is supported by the mislocalization or loss of multiple nucleoporins (including NUP98, NUP109) and NUP1, indicating widespread perturbation of nuclear envelopes and pore integrity rather than a direct, dedicated role for TbMLP1 in the mRNA export machinery.

Although our experiments were performed in the procyclic stage, the fundamental processes affected—mRNA transport, nuclear envelope integrity, kinetochore positioning, and chromosome segregation—are core cellular functions likely conserved across life-cycle stages and potentially in related parasites. Combined with the rescue obtained using Leishmania MLP1, our findings suggest that the role of MLP1 is broadly conserved within trypanosomatids despite strong sequence divergence. The essential nature of TbMLP1 and its involvement in multiple core pathways highlight the nuclear basket as a potential vulnerability. While further work is required in bloodstream forms and in infection models, nuclear basket components may represent novel points of therapeutic intervention by targeting nuclear integrity rather than metabolic pathways.

Supporting information

S1 Fig. MLP1 sub-localization in T. brucei.

(A) TbMLP1-HAc localization in T. brucei PCF using and anti-HA antibody (Green). DAPI was used to visualize DNA (blue). Mitotic cells (upper lane), interphasic cells (lower lane). Bar: 5 mm. Fluorescence was visualized using a Zeiss Z2 microscope and acquired as series of Z-axes. (B) TbMLP1-HaloTag labeling in non-induced RNAi parasites (NI) and two days post tetracycline induction (Ind). The signal was detected using an immunofluorescence assay. TbMLP1-HaloTag labeling was classified into three categories; positive signal (MLP1+), weak signal (wk) and negative signal (MLP1-). In these representative fields, all non induced NI cells are MLP1 + , except for one cell displaying a weak signal. After 2 days of induction, all three categories become visible; with the vast majority of cells (88%) exihibiting either a negative or weak MLP1 signal and 12% remaining MLP1 positive. (C) qRTPCR results performed on cDNAs prepared from TbMLP1 RNAi cell line either non-induced (NI) or induced two days with tetracycline (ind), using primers specific to TbMLP1 and, as a control, primers specific to the housekeeping gene GPI8. (D) TbMLP1-HA recodonized version (rTbMLP1-HA) localization in TbMLP1 RNAi cell line visualized with an anti-HA antibody (Red). DAPI was used to visualize DNA (blue). interphasic cells (upper lane), mitotic cells (lower lane).

https://doi.org/10.1371/journal.pntd.0013922.s001

(TIF)

S2 Fig. Single-molecule analysis of velocity of replication forks and inter-origin distances (IOD) in TbMLP1 parasites using DNA molecular combing.

(A) Representative bidirectional replication forks from TbMLP1 RNAi non-induced (NI) or tetracycline induced (Ind D3) taken from different microscopic fields, artificially assembled and centred on the position of the presumed origins. Red tracks: IdU, green tracks: CldU. Scale bar: 50 kb. (B) Comparative analysis of the velocity of replication forks in TbMLP1 RNAi non-induced (NI) or tetracycline induced (Ind D3). (C) Comparative analysis of the IOD in TbMLP1 RNAi non-induced (NI) or tetracycline induced (Ind D3). p values were calculated using two-tailed Mann-Whitney test (p < 0.05 was taken as significant).

https://doi.org/10.1371/journal.pntd.0013922.s002

(TIF)

S1 Table. List of primers used for MLP1 characterization.

https://doi.org/10.1371/journal.pntd.0013922.s003

(XLSX)

Acknowledgments

We are deeply indebted to TritrypDB and vEupathDB without which our research would be merely impossible. We acknowledge Marjorie Drac from the Montpellier DNA Combing Facility for providing silanized cover slips. We also acknowledge the MRI platform fo its role in microscopy and flow cytometry acquisitions and analysis.

References

  1. 1. Baldauf SL. The deep roots of eukaryotes. Science. 2003;300(5626):1703–6. pmid:12805537
  2. 2. Aoki K, Hayashi H, Furuya K, Sato M, Takagi T, Osumi M, et al. Breakage of the nuclear envelope by an extending mitotic nucleus occurs during anaphase in Schizosaccharomyces japonicus. Genes Cells. 2011;16(9):911–26. pmid:21733045
  3. 3. Yam C, He Y, Zhang D, Chiam K-H, Oliferenko S. Divergent strategies for controlling the nuclear membrane satisfy geometric constraints during nuclear division. Curr Biol. 2011;21(15):1314–9. pmid:21802294
  4. 4. Ploubidou A, Robinson DR, Docherty RC, Ogbadoyi EO, Gull K. Evidence for novel cell cycle checkpoints in trypanosomes: kinetoplast segregation and cytokinesis in the absence of mitosis. J Cell Sci. 1999;112 (Pt 24):4641–50. pmid:10574712
  5. 5. Berriman M, Ghedin E, Hertz-Fowler C, Blandin G, Renauld H, Bartholomeu DC, et al. The genome of the African trypanosome Trypanosoma brucei. Science. 2005;309(5733):416–22. pmid:16020726
  6. 6. Kolev NG, Franklin JB, Carmi S, Shi H, Michaeli S, Tschudi C. The transcriptome of the human pathogen Trypanosoma brucei at single-nucleotide resolution. PLoS Pathog. 2010;6(9):e1001090. pmid:20838601
  7. 7. Clayton CE. Life without transcriptional control? From fly to man and back again. EMBO J. 2002;21:1881–8.
  8. 8. Wente SR. Gatekeepers of the nucleus. Science. 2000;288(5470):1374–7. pmid:10827939
  9. 9. Hampoelz B, Andres-Pons A, Kastritis P, Beck M. Structure and Assembly of the Nuclear Pore Complex. Annu Rev Biophys. 2019;48:515–36. pmid:30943044
  10. 10. Rout MP, Aitchison JD, Suprapto A, Hjertaas K, Zhao Y, Chait BT. The yeast nuclear pore complex: composition, architecture, and transport mechanism. J Cell Biol. 2000;148(4):635–51. pmid:10684247
  11. 11. Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT, Matunis MJ. Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol. 2002;158(5):915–27. pmid:12196509
  12. 12. Vasu SK, Forbes DJ. Nuclear pores and nuclear assembly. Curr Opin Cell Biol. 2001;13(3):363–75. pmid:11343909
  13. 13. Krull S, Dörries J, Boysen B, Reidenbach S, Magnius L, Norder H, et al. Protein Tpr is required for establishing nuclear pore-associated zones of heterochromatin exclusion. EMBO J. 2010;29(10):1659–73. pmid:20407419
  14. 14. Neumann N, Lundin D, Poole AM. Comparative genomic evidence for a complete nuclear pore complex in the last eukaryotic common ancestor. PLoS One. 2010;5(10):e13241. pmid:20949036
  15. 15. DeGrasse JA, DuBois KN, Devos D, Siegel TN, Sali A, Field MC, et al. Evidence for a shared nuclear pore complex architecture that is conserved from the last common eukaryotic ancestor. Mol Cell Proteomics. 2009;8(9):2119–30. pmid:19525551
  16. 16. Sood V, Brickner JH. Nuclear pore interactions with the genome. Curr Opin Genet Dev. 2014;25:43–9. pmid:24480294
  17. 17. Khadaroo B, Teixeira MT, Luciano P, Eckert-Boulet N, Germann SM, Simon MN, et al. The DNA damage response at eroded telomeres and tethering to the nuclear pore complex. Nat Cell Biol. 2009;11(8):980–7. pmid:19597487
  18. 18. Nagai S, Dubrana K, Tsai-Pflugfelder M, Davidson MB, Roberts TM, Brown GW, et al. Functional targeting of DNA damage to a nuclear pore-associated SUMO-dependent ubiquitin ligase. Science. 2008;322(5901):597–602. pmid:18948542
  19. 19. Niepel M, Molloy KR, Williams R, Farr JC, Meinema AC, Vecchietti N, et al. The nuclear basket proteins Mlp1p and Mlp2p are part of a dynamic interactome including Esc1p and the proteasome. Mol Biol Cell. 2013;24(24):3920–38. pmid:24152732
  20. 20. Albert S, Schaffer M, Beck F, Mosalaganti S, Asano S, Thomas HF, et al. Proteasomes tether to two distinct sites at the nuclear pore complex. Proc Natl Acad Sci U S A. 2017;114(52):13726–31. pmid:29229809
  21. 21. Beck M, Hurt E. The nuclear pore complex: understanding its function through structural insight. Nat Rev Mol Cell Biol. 2017;18(2):73–89. pmid:27999437
  22. 22. Casolari JM, Brown CR, Komili S, West J, Hieronymus H, Silver PA. Genome-wide localization of the nuclear transport machinery couples transcriptional status and nuclear organization. Cell. 2004;117(4):427–39. pmid:15137937
  23. 23. Eftekharzadeh B, Daigle JG, Kapinos LE, Coyne A, Schiantarelli J, Carlomagno Y, et al. Tau protein disrupts nucleocytoplasmic transport in Alzheimer’s disease. Neuron. 2018;99:925-940.e7.
  24. 24. Rempel IL, Steen A, Veenhoff LM. Poor old pores-The challenge of making and maintaining nuclear pore complexes in aging. FEBS J. 2020;287(6):1058–75. pmid:31912972
  25. 25. Niepel M, Strambio-de-Castillia C, Fasolo J, Chait BT, Rout MP. The nuclear pore complex-associated protein, Mlp2p, binds to the yeast spindle pole body and promotes its efficient assembly. J Cell Biol. 2005;170(2):225–35. pmid:16027220
  26. 26. Galy V, Olivo-Marin JC, Scherthan H, Doye V, Rascalou N, Nehrbass U. Nuclear pore complexes in the organization of silent telomeric chromatin. Nature. 2000;403(6765):108–12. pmid:10638763
  27. 27. Gotta M, Laroche T, Formenton A, Maillet L, Scherthan H, Gasser SM. The clustering of telomeres and colocalization with Rap1, Sir3, and Sir4 proteins in wild-type Saccharomyces cerevisiae. J Cell Biol. 1996;134(6):1349–63. pmid:8830766
  28. 28. Hediger F, Dubrana K, Gasser SM. Myosin-like proteins 1 and 2 are not required for silencing or telomere anchoring, but act in the Tel1 pathway of telomere length control. J Struct Biol. 2002;140(1–3):79–91. pmid:12490156
  29. 29. Loeillet S, Palancade B, Cartron M, Thierry A, Richard G-F, Dujon B, et al. Genetic network interactions among replication, repair and nuclear pore deficiencies in yeast. DNA Repair (Amst). 2005;4(4):459–68. pmid:15725626
  30. 30. Taddei A, Schober H, Gasser SM. The budding yeast nucleus. Cold Spring Harb Perspect Biol. 2010;2(8):a000612. pmid:20554704
  31. 31. Rodríguez-Navarro S, Fischer T, Luo M-J, Antúnez O, Brettschneider S, Lechner J, et al. Sus1, a functional component of the SAGA histone acetylase complex and the nuclear pore-associated mRNA export machinery. Cell. 2004;116(1):75–86. pmid:14718168
  32. 32. Lee SH, Sterling H, Burlingame A, McCormick F. Tpr directly binds to Mad1 and Mad2 and is important for the Mad1-Mad2-mediated mitotic spindle checkpoint. Genes Dev. 2008;22(21):2926–31. pmid:18981471
  33. 33. Lince-Faria M, Maffini S, Orr B, Ding Y, Cláudia F, Sunkel CE, et al. Spatiotemporal control of mitosis by the conserved spindle matrix protein Megator. J Cell Biol. 2009;184(5):647–57. pmid:19273613
  34. 34. Salas-Pino S, Gallardo P, Barrales RR, Braun S, Daga RR. The fission yeast nucleoporin Alm1 is required for proteasomal degradation of kinetochore components. J Cell Biol. 2017;216(11):3591–608. pmid:28974540
  35. 35. Field MC, Rout MP. Pore timing: the evolutionary origins of the nucleus and nuclear pore complex. F1000Res. 2019;8:F1000 Faculty Rev-369. pmid:31001417
  36. 36. DuBois KN, Alsford S, Holden JM, Buisson J, Swiderski M, Bart J-M, et al. NUP-1 Is a large coiled-coil nucleoskeletal protein in trypanosomes with lamin-like functions. PLoS Biol. 2012;10(3):e1001287. pmid:22479148
  37. 37. Holden JM, Koreny L, Obado S, Ratushny AV, Chen W-M, Chiang J-H, et al. Nuclear pore complex evolution: a trypanosome Mlp analogue functions in chromosomal segregation but lacks transcriptional barrier activity. Mol Biol Cell. 2014;25(9):1421–36. pmid:24600046
  38. 38. Obado SO, Brillantes M, Uryu K, Zhang W, Ketaren NE, Chait BT, et al. Interactome Mapping Reveals the Evolutionary History of the Nuclear Pore Complex. PLoS Biol. 2016;14(2):e1002365. pmid:26891179
  39. 39. Gabiatti BP, Krenzer J, Braune S, Krüger T, Zoltner M, Kramer S. Detailed characterisation of the trypanosome nuclear pore architecture reveals conserved asymmetrical functional hubs that drive mRNA export. PLoS Biol. 2025;23(2):e3003024. pmid:39899609
  40. 40. Morelle C, Sterkers Y, Crobu L, MBang-Benet D-E, Kuk N, Portalès P, et al. The nucleoporin Mlp2 is involved in chromosomal distribution during mitosis in trypanosomatids. Nucleic Acids Res. 2015;43(8):4013–27. pmid:25690889
  41. 41. Vasquez J-J, Wedel C, Cosentino RO, Siegel TN. Exploiting CRISPR-Cas9 technology to investigate individual histone modifications. Nucleic Acids Res. 2018;46(18):e106. pmid:29912461
  42. 42. Shanmugasundram A, Starns D, Böhme U, Amos B, Wilkinson PA, Harb OS, et al. TriTrypDB: An integrated functional genomics resource for kinetoplastida. PLoS Negl Trop Dis. 2023;17(1):e0011058. pmid:36656904
  43. 43. Aslett M, Aurrecoechea C, Berriman M, Brestelli J, Brunk BP, Carrington M, et al. TriTrypDB: a functional genomic resource for the Trypanosomatidae. Nucleic Acids Res. 2010;38(Database issue):D457-62. pmid:19843604
  44. 44. Amos B, Aurrecoechea C, Barba M, Barreto A, Basenko EY, Bażant W, et al. VEuPathDB: the eukaryotic pathogen, vector and host bioinformatics resource center. Nucleic Acids Res. 2022;50(D1):D898–911. pmid:34718728
  45. 45. Redmond S, Vadivelu J, Field MC. RNAit: an automated web-based tool for the selection of RNAi targets in Trypanosoma brucei. Mol Biochem Parasitol. 2003;128(1):115–8. pmid:12706807
  46. 46. Beneke T, Madden R, Makin L, Valli J, Sunter J, Gluenz E. A CRISPR Cas9 high-throughput genome editing toolkit for kinetoplastids. R Soc Open Sci. 2017;4(5):170095. pmid:28573017
  47. 47. Oberholzer M, Morand S, Kunz S, Seebeck T. A vector series for rapid PCR-mediated C-terminal in situ tagging of Trypanosoma brucei genes. Mol Biochem Parasitol. 2006;145(1):117–20. pmid:16269191
  48. 48. Zhou Q, Lee KJ, Kurasawa Y, Hu H, An T, Li Z. Faithful chromosome segregation in Trypanosoma brucei requires a cohort of divergent spindle-associated proteins with distinct functions. Nucleic Acids Res. 2018;46(16):8216–31. pmid:29931198
  49. 49. Halliday C, Billington K, Wang Z, Madden R, Dean S, Sunter JD, et al. Cellular landmarks of Trypanosoma brucei and Leishmania mexicana. Mol Biochem Parasitol. 2019;230:24–36. pmid:30550896
  50. 50. Akiyoshi B, Gull K. Discovery of unconventional kinetochores in kinetoplastids. Cell. 2014;156(6):1247–58. pmid:24582333
  51. 51. Damasceno JD, Reis-Cunha J, Crouch K, Beraldi D, Lapsley C, Tosi LRO, et al. Conditional knockout of RAD51-related genes in Leishmania major reveals a critical role for homologous recombination during genome replication. PLoS Genet. 2020;16(7):e1008828. pmid:32609721
  52. 52. Bessat M, Ersfeld K. Functional characterization of cohesin SMC3 and separase and their roles in the segregation of large and minichromosomes in Trypanosoma brucei. Mol Microbiol. 2009;71(6):1371–85. pmid:19183276
  53. 53. Cassola A, De Gaudenzi JG, Frasch AC. Recruitment of mRNAs to cytoplasmic ribonucleoprotein granules in trypanosomes. Mol Microbiol. 2007;65(3):655–70. pmid:17635187
  54. 54. Stanojcic S, Sollelis L, Kuk N, Crobu L, Balard Y, Schwob E, et al. Single-molecule analysis of DNA replication reveals novel features in the divergent eukaryotes Leishmania and Trypanosoma brucei versus mammalian cells. Sci Rep. 2016;6:23142. pmid:26976742
  55. 55. Michalet X, Ekong R, Fougerousse F, Rousseaux S, Schurra C, Hornigold N, et al. Dynamic molecular combing: stretching the whole human genome for high-resolution studies. Science. 1997;277(5331):1518–23. pmid:9278517
  56. 56. Davis LI. The nuclear pore complex. Annu Rev Biochem. 1995;64:865–96. pmid:7574503
  57. 57. Wente SR, Rout MP. The nuclear pore complex and nuclear transport. Cold Spring Harb Perspect Biol. 2010;2(10):a000562. pmid:20630994
  58. 58. Winey M, Yarar D, Giddings TH Jr, Mastronarde DN. Nuclear pore complex number and distribution throughout the Saccharomyces cerevisiae cell cycle by three-dimensional reconstruction from electron micrographs of nuclear envelopes. Mol Biol Cell. 1997;8(11):2119–32. pmid:9362057
  59. 59. Galy V, Gadal O, Fromont-Racine M, Romano A, Jacquier A, Nehrbass U. Nuclear retention of unspliced mRNAs in yeast is mediated by perinuclear Mlp1. Cell. 2004;116(1):63–73. pmid:14718167
  60. 60. Vinciguerra P, Iglesias N, Camblong J, Zenklusen D, Stutz F. Perinuclear Mlp proteins downregulate gene expression in response to a defect in mRNA export. EMBO J. 2005;24(4):813–23. pmid:15692572
  61. 61. Ersfeld K, Gull K. Partitioning of large and minichromosomes in Trypanosoma brucei. Science. 1997;276(5312):611–4. pmid:9110983
  62. 62. Ogbadoyi E, Ersfeld K, Robinson D, Sherwin T, Gull K. Architecture of the Trypanosoma brucei nucleus during interphase and mitosis. Chromosoma. 2000;108(8):501–13. pmid:10794572
  63. 63. Abbasi K, DuBois KN, Leung KF, Dacks JB, Field MC. A novel Rho-like protein TbRHP is involved in spindle formation and mitosis in trypanosomes. PLoS One. 2011;6(11):e26890. pmid:22096505
  64. 64. Li Z, Gourguechon S, Wang CC. Tousled-like kinase in a microbial eukaryote regulates spindle assembly and S-phase progression by interacting with Aurora kinase and chromatin assembly factors. J Cell Sci. 2007;120(Pt 21):3883–94. pmid:17940067
  65. 65. Fenech M, Kirsch-Volders M, Natarajan AT, Surralles J, Crott JW, Parry J, et al. Molecular mechanisms of micronucleus, nucleoplasmic bridge and nuclear bud formation in mammalian and human cells. Mutagenesis. 2011;26(1):125–32. pmid:21164193
  66. 66. Crasta K, Ganem NJ, Dagher R, Lantermann AB, Ivanova EV, Pan Y, et al. DNA breaks and chromosome pulverization from errors in mitosis. Nature. 2012;482(7383):53–8. pmid:22258507
  67. 67. Maciejowski J, Li Y, Bosco N, Campbell PF, de Lange T. Chromothripsis and kataegis induced by telomere crisis. Cell. 2015;163:1641–54.
  68. 68. Ly P, Teitz LS, Kim DH, Shoshani O, Skaletsky H, Fachinetti D, et al. Selective Y centromere inactivation triggers chromosome shattering in micronuclei and repair by non-homologous end joining. Nat Cell Biol. 2017;19(1):68–75. pmid:27918550
  69. 69. Liu S, Kwon M, Mannino M, Yang N, Renda F, Khodjakov A, et al. Nuclear envelope assembly defects link mitotic errors to chromothripsis. Nature. 2018;561(7724):551–5. pmid:30232450
  70. 70. Liu S, Pellman D. The coordination of nuclear envelope assembly and chromosome segregation in metazoans. Nucleus. 2020;11(1):35–52. pmid:32208955