https://orcid.org/0000-0003-3517-9824
Figures
Abstract
As one of the most aggressive disease vectors, the Asian tiger mosquito Aedes albopictus relies heavily on its olfactory system to search for food in the larval stage, locate hosts after eclosion, and identify suitable oviposition sites after blood feeding. In mosquitoes and other insects, the olfactory system detects environmental odors primarily through a diverse repertoire of odorant receptors (ORs), which require the highly conserved odorant receptor co-receptor (Orco) to function. While Orco’s role in enabling receptor function is well established, its cellular localization patterns, developmental expression dynamics, and system-wide impact on olfactory physiology and behavior remain understudied in Ae. albopictus. To address this knowledge gap, we leveraged the Q-system to systematically characterize Orco-expressing neurons across embryonic, larval, and adult stages of Ae. albopictus. Orco-expressing neurons were observed as early as in the embryonic stage and proliferated during larval development. Orco expression in adults spanned the olfactory sensory neurons (OSNs) of the antennae, labella, and maxillary palps in both male and female mosquitoes, consistent with its conserved peripheral distribution across various mosquito species. To further investigate the functional implications of Orco, we generated Orco knockout mutants and strikingly discovered that Orco knockout mutants displayed significant widespread downregulation of ORs, suggesting that Orco may influence ORs’ expression or stability. Electrophysiological recordings confirmed significantly attenuated responses to human volatiles in Orco mutants, and behavioral assays demonstrated a marked decline in blood-feeding efficiency and decrease of human preference in females. Together, these findings reveal dynamic organization of OSNs during mosquito development and uncover the critical role of Orco in maintaining the integrity and function of the olfactory system, providing insights which may inform novel, next-generation vector control strategies.
Author summary
The mosquito olfactory system detects environmental odors primarily through a diverse repertoire of odorant receptors (ORs), which require the highly conserved odorant receptor co-receptor (Orco) to function. While Orco’s role in enabling ORs’ function is well established, its cellular localization patterns, developmental dynamics, and system-wide impact on olfactory physiology and behavior remain understudied in Ae. albopictus. To address this knowledge gap, we leveraged the Q-system to systematically characterize Orco-expressing neurons across embryonic, larval, and adult stages of Ae. albopictus. We observed Orco-expressing neurons as early as in the embryonic stage and proliferated during larval development and found that Orco expression in adults spanned the olfactory sensory neurons (OSNs) of antennae, labella, and maxillary palps. To further investigate the functional implications of Orco, we generated Orco knockout mutants and strikingly discovered that Orco mutants displayed significant widespread down-regulation of ORs, suggesting Orco may influence OR expression or stability. Moreover, Orco mutants displayed significantly attenuated electrophysiological responses to human volatiles, marked decline in blood-feeding efficiency, and the preference of female mosquitoes for human hosts was significantly decreased. Together, these findings reveal dynamic organization of OSNs during mosquito development and uncover the critical role of Orco in maintaining the integrity and function of the olfactory system.
Citation: Yao H, Qi Q, Gou D, Liang S, Ferguson ST, Li M, et al. (2025) Unveiling the developmental dynamics and functional role of Odorant Receptor Co-receptor (Orco) in Aedes albopictus: A novel mechanism for regulating odorant receptor expression. PLoS Negl Trop Dis 19(11): e0013753. https://doi.org/10.1371/journal.pntd.0013753
Editor: Paul O. Mireji, Kenya Agricultural and Livestock Research Organization, KENYA
Received: May 28, 2025; Accepted: November 9, 2025; Published: November 26, 2025
Copyright: © 2025 Yao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its supporting information files.
Funding: This work was supported by the National Natural Science Foundation of China under Grants 82372289 and 82350410493 awarded to F.L. and S.T.F., respectively, and by Guizhou Education Department (Grant No. Qian Jiao Ji [2024] 54) and Guizhou Normal University (Grant No. QSXM [2022] B09) awarded to Z.Y., and the China Postdoctoral Science Foundation (2024M752152) to Q.Q. The funders of this study didn’t play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exists.
Introduction
The Asian tiger mosquito, Aedes albopictus, is a major vector of human disease, including dengue, chikungunya, Zika, and lymphatic filariasis, which poses significant risks to global public health [1,2]. Dengue fever is one of the most severe tropical diseases transmitted by Aedes mosquitoes with models placing estimates around 390 million cases every year [3] and 4 billion people at risk [4]. Importantly, Ae. albopictus has replaced Ae. aegypti as the primary vector of dengue virus in several countries, such as China and Japan, with its invasive range expanding at a far greater rate than Ae. aegypti due to its superior ability to compete for breeding sites [5,6]. In light of the growing public health threat posed by Ae. albopictus and its rapidly expanding geographic range, a comprehensive understanding of the olfactory system, an essential driver of host-seeking behavior, is critical for developing timely and effective vector management strategies.
Ae. albopictus rely on their olfactory system for essential behaviors such as host-seeking and oviposition. The primary olfactory appendages in mosquitoes include the antennae, maxillary palps, and labella. Along these appendages are small sensory hairs known as sensilla that house sensory neurons responsible for the detection of various chemical, thermal, and mechanical stimuli [7]. Within the chemosensory neurons, insects express one or more major classes of chemoreceptor: odorant receptors (ORs), ionotropic receptors (IRs), and gustatory receptors (GRs) [8–11]. Chief among these are the olfactory sensory neurons (OSNs) which are responsible for detecting volatile odorants and pheromones, such as those associated with human sweat, and guiding mosquitoes towards potential hosts [12,13]. Each of these neurons express one of many potential ORs which convey ligand-specificity, alongside a highly conserved obligate co-receptor (Orco) [14]. Together, these protein subunits form a heterotetrameric (1:3 OR:Orco) ligand-gated ion channel on the membrane of the OSN [15–18]. Upon ligand binding, the channel undergoes a conformation change that leads to the opening of the central pore, allowing the influx of ions that depolarize the neuron and generate an action potential [17]. This electrical signal is transmitted to the brain, where it is processed to guide behaviors such as host seeking and oviposition.
Among the various molecular components involved in ORs-mediated olfactory signal transduction, Orco is of central importance, and its conservation across diverse insect species highlights its essential contribution to the evolution and function of the insect olfactory system. Indeed, only certain species from the most basal insect order, Archaeognatha, appears to lack this essential gene [19]. Moreover, numerous studies across diverse insect lineages, including mosquitoes, have consistently demonstrated that the loss of Orco function dramatically impairs olfactory sensitivity and physiology, leading to aberrant behaviors. In Drosophila, Orco knockout significantly impairs olfactory responses to a broad range of general odorants and disrupts behavior in valence bioassays in larvae and adults [20]. In ants, both genetic knockout of Orco and pharmacological modulation of Orco protein significantly alter olfactory sensitivity to hydrocarbons and other important social chemical cues leading to the loss of social behaviors [21–23]. In mosquitoes, Orco knockout impairs the mosquitoes’ sensitivity to both human- and non-human-derived odor cues resulting in diminished attraction to human hosts and oviposition sites [24,25]. Taken together, these studies reinforce Orco’s central role in olfactory signaling and make it a prime target for developing vector control strategies.
In this study, we hypothesize that Orco plays a fundamental role in the development patterning of its peripheral olfactory system and the olfactory mechanisms underlying its host-seeking and blood-feeding behavior. To address this hypothesis, we performed a comprehensive characterization of Orco-expressing neurons across the developmental stages of Ae. albopictus mosquitoes. To elucidate the spatiotemporal expression patterns and function of Orco-expressing sensory neurons, we employed a combination of advanced genetic and electrophysiological techniques. Specifically, we used the Q system [26] to label Orco-expressing neurons via GFP, and integrated homology assisted CRISPR/Cas9 knockin (HACK) and PiggyBac transposon-mediated genomic integration to generate the AalbOrco-QF2 driver line and AalbQUAS-mCD8:GFP effector line. In addition, we used RNA-sequencing, electroantennography (EAG), and single sensillum recording (SSR) to assess the impact of Orco homozygous knockout, while behavioral assays were used to examine the effects on blood-feeding efficiency and host preference. This study demonstrated a novel role of Orco in regulating ORs transcription in mosquitoes and uncovered the dynamic organization of olfactory sensory neurons during Ae. albopictus development. These findings demonstrated the critical role of Orco in chemical perception and host-seeking behavior in Ae. albopictus, providing a theoretical foundation for developing novel olfaction-based mosquito control strategies.
Materials and methods
Mosquito maintenance
Mosquito Ae. albopictus Foshan strain was a gift from Dr. Xiaoguang Chen at Southern Medical University, Guangzhou, China and reared as described [27]; and 5- to 7-day-old non-blood-fed females were used for all experiments. All mosquito lines were reared in environmental chambers at 27°C and 75% relative humidity under a 12:12 light-dark cycle and supplied with 10% sucrose water in the Shenzhen Bay Laboratory Insectary.
sgRNA design and production
The procedure for single guide RNA (sgRNA) synthesis followed previously described methods [28] with minor modifications. sgRNA were designed for high efficiency by searching the sense and antisense strands of the Orco gene (AALFPA_042885) for the presence of protospacer-adjacent motifs (PAMs) with the sequence of NGG using CHOPCHOP [29]. sgRNAs were synthesized using the EnGen sgRNA Synthesis Kit (New England Biolabs) according to the manufacturer’s protocol using 300 ng of purified DNA template. Following in vitro transcription, the sgRNAs were purified using the Monarch RNA Cleanup Kit (New England Biolabs) and diluted to 1000 ng/μl in nuclease-free water and stored in aliquots at −80 °C. Recombinant Cas9 protein from Streptococcus pyogenes was obtained commercially (TrueCut Cas9 Protein V2, Invitrogen by Thermo Fisher Scientific) and diluted to 1000 ng/ul in nuclease-free water and stored in aliquots at −80 °C.
CRISPR mediated microinjections
To generate the AalbOrco-QF2 driver line for the Q system, T2A-QF2-3xP3-DsRed element was inserted into the Orco coding region through CRISPR-mediated homologous recombination. The homologous template (donor plasmid) that contains T2A-QF2-3xP3-DsRed element, which was amplified from the ppk301-T2A-QF2 HDR plasmid (Addgene plasmid# 130667) [30], flanked by ~1kb homologous arms was constructed using NEBuilder HiFi DNA Assembly kit (New England Biolabs). The left homologous arm was amplified with primer pair of OrcoleftarmFwd(GACGGCCAGTCAGGGGCGCTTCAAGTTAATAATTAAAAAATAC) and OrcoleftarmRev(CTCTGCCCTCCGGACGGTAGGTGTCCAG). The right homologous arm was amplified with primer pair of OrcorightarmFwd (ATGTATCTTAACTCGGCTGCCCTGTTCC) and OrcorightarmRev (CAGCTATGACCGGCTCCGTGTGTAAGATCAC). The primer pair for comfirming the knockin element was AalbOrco-F (GCCGACGTGATGTTCTGCTCCTGGTTGCTG) and AalbOrco-R(ACTTGCACACACCACCACCATAGGGACACG). From the left homologous arm immediately preceding the T2A, 1 bp was removed to keep theT2A sequence in-frame. Red-eyed F1 mosquitoes were backcrossed for five generations and then crossed to the effector line to acquire progeny for Orco localization studies.
Embryonic collection and CRISPR microinjections were performed following the procedure described in Li et al [28]. Briefly, Aedes mosquitoes were blood-fed 4 days before egg collection. An ovicup filled with ddH2O and lined with filter paper was placed into a cage and female mosquitoes were allowed to lay eggs in the ovicup in the dark. After 30–60 min, the ovicup was taken out and unmelanized eggs were transferred onto a glass slide. The eggs were quickly aligned on a wet piece of filter paper. Aluminosilicate needles were pulled on a Sutter P-1000 needle puller and beveled using a KDG-03 beveler (Kewei, Wuhan). An Eppendorf Femtojet 4i was used for power injections under a compound microscope at 10 × magnification (E5, Soptop, Ningbo). About 10 eggs were injected each time immediately after fresh eggs were collected. The concentration of components used in the study was as follows; Cas9 protein at 300 ng/μl, sgRNA at 40 ng/μl, donor plasmid 300 ng/μl. After injection, eggs were placed in a cup filled with water and allowed to hatch and develop into adults. The first generation (G0) of injected adults were separated based on sex and crossed to 5X wild-type counterparts. Their offspring (F1) were manually screened for DsRed-derived red eye fluorescence using an Compound Fluorescent Microscope (DP74, Olympus, Japan). Red-eyed F1 males were individually backcrossed to 5- fold females to establish a stable mutant line. DNA extraction was performed using FastPure Gel DNA Extraction (Vazyme Biotech, Nanjing) protocols and genomic DNA templates for PCR analyses of all individuals were performed (after mating) to validate the fluorescence marker insertion using primers that cover DSB sites. PCR products were sequenced to confirm the accuracy of the genomic insertion. Heterozygous mutant lines were thereafter backcrossed to wild-type Ae. albopictus for at least five generations before self-crossing and the progenies were used for screening homozygous individuals according to their DsRed-derived red eye fluorescence intensity. Putative homozygous mutant individuals were mated to each other before being sacrificed for genomic DNA extraction and PCR analyses (as above) to confirm their homozygosity.
The effector line (QUAS-mCD8:GFP) was generated by the plasmid pBAC-ECFP-15xQUAS_TATA-mCD8-GFP-sv40 (Addgene #104878) [31] with a pBac helper plasmid. Similar to establishing the driver line, the first generation (G0) of injected adults were separated based on sex and crossed to 5-fold wild-type counterparts. Their offspring (F1) were manually screened for ECFP-derived cyan eye fluorescence. Single cyan-eyed F1 male was backcrossed for five generations to five wildt-ype females in order to establish a stable transgenic effector line which later would be used for crossing with the driver line.
Whole-Mount Imaging
Offspring resulting from crosses between the homozygous AalbOrco-QF2 driver line and the heterozygous AalbQUAS-mCD8:GFP effector line were screened for eye-specific expression of DsRed and ECFP. The anatomical method of mosquito eggs referred to Juhn and James (2012) [32]. The methods for fixing the sample and capturing confocal images referred to Ye et al (2022) [33]. Embryo, larval antennae as well as antennae, maxillary palps and proboscis from 4- to 6-d-old adults were dissected into 4% formaldehyde in PBST (0.1% Triton X-100 in phosphate-buffered saline) and fixed on ice for 30 min. Samples were thereafter washed 3X in PBST for 10 min each and directly transferred onto slides and mounted in Anti fluorescence quenching sealing solution (Beyotime). Confocal microscopy images at 1024 × 1024 pixel resolution were collected with the LSM980 system (Zeiss). Laser wavelength of 488 nm was used to detect green fluorescent protein (GFP).
Electrophysiology
Single sensillum recordings (SSR) were conducted as described in Liu et al [34]. Mutant and wild-type female mosquitoes 4 days after eclosion were anaesthetized on ice for 2–3 min and mounted on a microscope slide (76 × 26 mm). The antennae were fixed using a double-sided tape to a cover slip resting on a small ball of dental wax to facilitate manipulation. Once mounted, the specimen was placed under a microscope (Eclipse FN1, Japan) and the antenna viewed at a high magnification (1000×). Two tungsten microelectrodes were sharpened in 10% KNO2 at 10 V. The reference electrode, which was connected to ground, was inserted into the compound eye of the mosquito and the other was connected to the preamplifier (10 × , Syntech, Kirchzarten, Germany) and inserted into the shaft of an olfactory sensillum to complete the electrical circuit to extracellularly record ORN potentials [35]. Controlled manipulation of the electrodes was performed using a micromanipulator (Burleigh PCS-6000, CA). The preamplifier was connected to an analog-to-digital signal converter (IDAC-4, Syntech, Germany), which in turn was connected to a computer for signal recording and visualization in the software AutoSpike v5.1. Signals were recorded for 10 s starting 1 s before stimulation, and the action potentials were counted offline automatically with the AutoSpike software over a 500-ms period before and after stimulation. The spontaneous firing rates observed in the preceding 500 ms were subtracted from the total spike rates observed during the 500-ms stimulation, and counts were calculated in units of spikes/s.
Thirty-four compounds from different chemical classes were selected for electrophysiological recording of olfactory sensilla with various morphological shapes. Each compound was prepared in 100-fold dilution (v/v) with dimethyl sulfoxide (DMSO) or paraffin oil. For each dilution, a 10 μl portion was dispersed onto a filter paper strip (4 × 30 mm), which was then inserted into a Pasteur pipette to create the stimulus cartridge. A sample containing the solvent alone served as control. The airflow across the antennae was maintained constant at 20 ml/s throughout the experiment. Purified and humidified air was delivered to the preparation through a glass tube (10-mm inner diameter) perforated by a small hole 10 cm away from the end of the tube, into which the tip of the Pasteur pipette could be inserted. The stimulus was delivered to the sensilla by inserting the tip of the stimulus cartridge into this hole and diverting a portion of the air stream (0.5 l/min) to flow through the stimulus cartridge for 500 ms using a stimulus controller (Syntech, Germany). The distance between the end of the glass tube and the antennae was ≤ 1 cm. The number of spikes/s was obtained by averaging the results for each sensillum/compound combination.
The electroantennogram procedure followed previously described protocols [36] with minor modifications. Briefly, the head of an adult Ae. albopictus female was excised and mounted on an EAG platform equipped with two micromanipulators and a high-impedance AC/DC preamplifier (Syntech, Germany). Chlorinated silver wires in glass capillaries filled with 0.1% KCl and 0.5% polyvinylpyrrolidone were used for both reference and recording electrodes. One antenna with the tip cut was accommodated into the recording electrode. The airflow across the preparation was maintained constant at 20 ml/s to which a stimulus pulse of 2 ml/s was delivered for 500 ms. Any change in antennal deflection induced by the stimuli or control puffs was recorded for 10 s. All compounds were dissolved in DMSO or paraffin oil to make a test solution of 10-fold dilution. An aliquot (10 μl) of a tested compound was loaded onto a filter paper strip (4 × 30 mm), which was immediately inserted into a Pasteur pipette for evaporation. Solvent (paraffin oil) alone served as control. For each compound, EAG responses of 5–11 female mosquitoes were recorded. These recordings were analyzed using EAG software (EAG Version 2.7, Syntech). The EAG response (ΔmV) to each test stimulus was calculated by subtracting the value of the antennal response elicited by the solvent from that stimulated by the compound.
Chemicals
Compounds that were used in electrophysiological (EAG and SSR) recordings are listed in S1 Table.
Transcriptome analysis
Total RNA was extracted from dissected antennal samples from 4 to 7-day-old post-eclosion wild-type and AalbOrcoDsRed/DsRed mosquitoes (three biological replicates each, with each replicate containing 300 female mosquitoes’ antennae) by TRIZOL (Invitrogen, Carlsbad, CA, USA) according to manual instruction. mRNA was purified from total RNA using magnetic beads coated with Oligo (dT), purified mRNA was fragmented into small pieces with fragment buffer at appropriate temperature. These mRNA were used as templates to synthesize the first strand of cDNA with random hexamers. The second strand cDNA was synthesized by adding reaction buffer, dNTPs, DNA polymerase I and RNase H, and then was purified by AMPure XP beans. After end repair, A tail and ligation of the sequencing connector, screens were performed with AMPure XP beads. The final library was obtained after PCR amplification and purification. The final library was amplified with phi29 to make DNA nanoball (DNB) which had more than 300 copies of one molecular, DNBs were loaded into the patterned nanoarray and pair end 150 bases reads were generated on DNBSEQ-T7 platform at Tsingke Biotechnology Co., Ltd. Six transcriptomic libraries (three replicates for both wild-type and mutant mosquitoes) were made in this study. Based on the assembly results, Bowtie2 was used to map the clean reads of each sample to Unigene, and then RSEM was used to calculate the gene expression level of each sample. Blastn, Blastx, and Diamond were used to align Unigenes to NT (https://www.ncbi.nlm.nih.gov/nucleotide/), NR (https://www.ncbi.nlm.nih.gov/refseq/about/nonredundantproteins/), KOG (https://www.hsls.pitt.edu/obrc/index.php?page=URL1144075392), KEGG (https://www.genome.jp/kegg/), and Swiss-Prot database for annotation. All the genes annotated as odorant receptors, ionotropic receptors, gustatory receptors and their co-receptors were search out and analyzed by Prism 5 (GraphPad Software). Their relative expression levels were determined by FPKM (fragments per kilobase of transcript per million fragments mapped) counts.
Blood-feeding assay
Blood-feeding and host preference (below) assays were carried out as described in Wang et al [37] with minor modifications. The experimental subjects were wild-type and AalbOrcoDsRed/DsRed homozygous mutant Ae. albopictus. Each trial used 30–35 non-blood-fed, 3-day-old, mated adult females. These mosquitoes were starved for 12 hours prior to the experiment. A 20-minute blood-feeding assay was conducted using mice immobilized with adhesive tape and a funnel-shaped wire mesh cage, during which mosquitoes primarily fed on the mouse’s tail. The experiments were performed in 18 × 18 × 18 cm nylon mesh cages, with 3 replicates conducted for each mosquito strain. The number of blood-fed mosquitoes was determined by visual inspection as fed or unfed. The ratio of blood-fed mosquitoes was calculated using the following formula: blood-fed (%) = Nb/Nt, where Nb was the number of blood-fed mosquitoes and Nt was the total number of mosquitoes.
Host preference assay
The host preference assay was performed on wild-type and AalbOrcoDsRed/DsRed homozygous mutant Ae. albopictus. Each trial used 30–35 non-blood-fed, 3-day-old, mated adult females, which were fasted for 24 h prior to assay. Before testing, the mosquitoes were transferred to a two-choice olfactometer (20 x 20 x 32 cm) and allowed to acclimate for 30 min. The two ports of the olfactometer were respectively equipped with a human hand and a mouse. The participating volunteer (a 27-year-old female) had refrained from using any scented products for 48 hours prior to the experiment and had not washed her hands for 4 hours. The test mouse was immobilized adhesive tape and a funnel-shaped wire mesh cage. Fans were used to direct odors from the human hand and mouse, respectively, into the olfactometer toward female mosquitoes at an airflow speed of 0.5 m/s. The experiment lasted for 10 minutes, after which the number of female mosquitoes captured in the trap was counted and recorded. Host preference was expressed as the preference index = (Nh – Nm)/(Nh + Nm), where Nh was the number of mosquitoes probing human hand and Nm the number of mosquitoes probing mice. Six replications for each assay were performed.
Mosquito fecundity assay
Mated Female mosquitoes 3 days post-eclosion were blood-fed on mice. Two days after the blood meal, individual females were transferred into Drosophila culture tubes (1.2 cm in radius × 9.5 cm in height), each containing a filter paper strip (1 cm × 5 cm) moisturized with 2 mL of ddH₂O. Oviposition was allowed for four days, after which the number of eggs laid was counted. Following the egg count, the oviposition paper was returned to its original tube and submerged in ddH₂O. The number of hatched larvae was recorded daily. For both wild-type and AalbOrcoDsRed/DsRed lines, egg production and hatching rate were assessed for eight individual females per line.
Results
Targeted CRISPR knockin of AalbOrco
To first characterize the spatial expression patterns of Orco in Ae. albopictus (AalbOrco), we employed the binary expression Q system which enables precise visualization of gene expression through fluorescent signal reporting [26] and has been successfully implemented in Anopheles gambiae, Ae. aegypti and An. coluzzii [30,31,33]. This system crosses an AalbOrco promoter-QF2 (AalbOrco-QF2) driver line with a QUAS-GFP effector line to promote GFP expression in AalbOrco-expressing cells. Here, we generated the driver line using the homology-assisted CRISPR/Cas9 knock-in (HACK) method [38], targeting the fourth coding exon of AalbOrco by using guide RNA to insert an in-frame T2A-QF2-3xP3-DsRed cassette (Fig 1A, B). Successful integration was confirmed by genomic PCR amplification of the target locus (Fig 1C). Concurrently, we established the QUAS-GFP effector line using the piggyBac transposon system. This effector line carries the QUAS-mCD8:GFP-3xP3-ECFP effector cassette inserted into any TTAA site of the genome (Fig 1D). Virgin females of these two lines were then backcrossed for five generations to wild-type males to minimize genetic variability and establish stable transgenic mosquito lines, respectively. And we utilized eye-specific DsRed and ECFP fluorescent markers to screen transgenic larvae, respectively (Fig 1E, F).
Homology-assisted CRISPR knock-in strategy. The T2A-QF2-3xP3-DsRed element (2549-bp) was inserted into the fourth exon of AalbOrco via CRISPR-mediated homologous recombination. PCR validation utilized primers AalbOrco-F/AalbOrco-R and produced a 552-bp wild-type amplicon and a 3,071-bp mutant-specific product in homozygous individuals. (B) Primers AalbOrco-F and AalbOrco-R were designed to amplify the region outside the homology arm. This ensured allele-specific amplification, as the wild-type genome produced only the 552 bp fragment, while the knock-in allele generated the 3,071 bp band. (C) Agarose gel electrophoresis successfully confirmed knock-in integration in transgenic mosquitoes. The 3,071-bp band exclusively appeared in homozygous AalbOrcoDsRed/DsRed individuals, while wild-type controls showed only the 552-bp fragment. (D) The 15xQUAS-GFP cassette (5,447-bp) was inserted into random TTAA sites in the genome via PiggyBac system. (E) In AalbOrco-QF2 driver lines, DsRed fluorescence localized specifically to the eyes (scale bar: 300 μm), indicating functional promoter activity. (F) AalbQUAS-mCD8:GFP effector lines exhibited ECFP fluorescence in the eyes, demonstrating transposon-mediated cassette insertion (scale bar: 300 μm).
Expression of AalbOrco in the late embryo of Ae. albopictus
Mosquito embryogenesis undergoes three major developmental stages: the initial stage, characterized by limited bristle development and cellular division during germ band extension; the intermediate stage, marked by bristle formation, segmentation of the cephalic and thoracic regions, and the development of structures such as the respiratory siphon; and the final stage, where complete segmentation occurs and the chorion-breaking spike forms preparing for larval hatching [39]. While the mosquito egg remains understudies relative to other developmental stages, previous studies have demonstrated that certain chemical cues, such as those found in yeast, trigger embryo hatching, suggesting a potential chemosensory capacity of mosquito embryos [40]. To investigate the expression pattern of AalbOrco in the late embryo stage of Ae. albopictus, we dissected the embryo chorion with an insect pin and directly imaged the GFP-labeled sensory neurons in the cephalic region of the embryo. While no GFP-labelled tissues had been observed in the initial (12 hours post-egg laying) and intermediate (36 hours post-egg laying) stage of mosquito embryoes, we found Orco+ neurons in the cephalic section of late embryos (72 hours post-egg laying) in two prepared samples after multiple unsuccessful trials (Fig 2). Interestingly, one sample only display single Orco+ neuron (Fig 2A) while the other sample showed 3–4 GFP-labeled neurons (Fig 2B) in the antenna-like tissue, suggesting the heterogeneity of Orco exprepression during the development of olfactory sensory neuron. This result demonstrated the initial expression of Orco in the late embryonic stage of Ae. albopictus, providing support for the potential olfactory capacity in early development.
(A) & (B) Representative Orco-expressing neurons in the antenna-like tissue of the embryo at sample 1 (A) and sample 2 (B) 72 hours post-egg laying.
Expression pattern of AalbOrco in the larval antennae
Mosquito larvae possess a robust chemosensory capacity through a relatively simple olfactory system. To determine the spatial distribution of AalbOrco in the antennae of mosquito larvae, we systematically examined the progeny from crossing the AalbOrco-QF2 driver line (AalbOrco+/DsRed) with AalbQUAS-mCD8:GFP effector line. In these hybrids, GFP fluorescence specifically labeled neuronal dendrites, cell bodies, and axons in the larval sensory cone across all four instars (Fig 3A-D). High-resolution confocal imaging showed that the number of GFP-labelled ORNs increased during larval development (NL1 = 5.25 ± 1.40 (n = 8), NL2 = 7 ± 1.10 (n = 6), NL3 = 11 ± 0.89 (n = 6), NL4 = 11.93 ± 1.49 (n = 14); Fig 3E). Notably, the number of Orco-expressing neurons increased the most during the transition from 2nd to 3rd instar larva, which correlates with the considerable feeding needs and highly active food-searching behavior of 3rd instar larva.
(A - D) Maximum intensity projections of z-stack images showing GFP-labeled neurons in the antennae of 1-4 instar larvae. Scale bar: 20 μm. (E) Quantitative analysis of Orco+ neurons in 1-4 instar larvae. The number of Orco+ neurons increases with developmental stage, NL1 = 5.25 ± 1.40 (n = 8); NL2 = 7 ± 1.10 (n = 6); NL3 = 11 ± 0.89 (n = 6); NL4 = 11.93 ± 1.49 (n = 14).
Expression pattern of AalbOrco in adult mosquito Ae. albopictus
To systematically investigate the spatial and sex-specific expression pattern of AalbOrco in Ae. albopictus adults, progeny derived from crosses between parental driver and effector lines were used for the whole-mount examination. Transgenically driven GFP expression was robust in OSNs of antennae, labella and maxillary palps. Expression patterns in the adult antennae were sexually dimorphic: female mosquitoes exhibited strong labeling across all 13 antennal segments, while male individuals displayed restricted expression on only the distal two segments (Fig 4A, B). This sexually dimorphic pattern aligns with similar findings in An. gambiae [31]. AalbOrco expression in the labella of female (Fig 4C) was exclusively localized to OSNs with short dendrites associated with olfactory T2 sensilla as opposed to gustatory T1 sensilla, consistent with reports in Ae. aegypti [41] and An. coluzzii [42]. Despite pronounced morphological divergence in maxillary palp segmentation between female and male mosquitoes (males have four segments (Fig 4E) while females only have three (Fig 4D)), the GFP-labelled Orco-expressing neurons demonstrated striking conservation with two neurons housed in each capitate peg sensillum in both male and female maxillary palp, aligning with previous findings in both Ae. aegypti and An. coluzzii [41,42].
(A and B) Representative confocal z-stack of Orco-expressing neurons in the antenae of female (A) and male (B) mosquitoes which exhibits sexual dimorphism with Orco expressed in all 13 segments of the female antennae while only in the distal two segments of the male antennae. (C) A representative confocal z-stack of a whole-mount female labellum showing Orco is expressed in T2 sensilla but not T1 sensillum (highlighted by arrows; scale bars, 10 μm). (D and E) Representative confocal z-stack of Orco-expressing neurons in the capitate peg sensilla of maxillary palp of both female (D) and male (E) mosquito.
Orco knockout affects expression of receptors in Ae. albopictus
To investigate the impact of Orco mutations on tuning ORs expression in Ae. albopictus, we conducted transcriptomic analysis by antennal RNA-seq to compare expression of ORs tuning receptors in female wild-type and AalbOrcoDsRed/DsRed homozygous mutants. As described in this study, as the T2A-QF2-3xP3-DsRed element was inserted in an exon of Orco, which directly disrupted its normal function, we self-crossed the heterozygous AalbOrco+/DsRed Ae. albopictus and then obtained the homozygous AalbOrcoDsRed/DsRed mosquito based on the strength of fluoresence in the mosquito eye which was further confirmed by the sequencing results of genotyping. While a moderate reduction in egg laying and embryo hatching rate of individual female AalbOrcoDsRed/DsRed mosquito was observed (S1 Fig; S2 Table), we encountered no problem in maintaining the population of AalbOrcoDsRed/DsRed mosquito under laboratory condition.
Antennal RNA extracted from the wild-type and AalbOrcoDsRed/DsRed mosquitoes four day post eclosion was submitted for next-generation transcriptional profiling, and receptor transcript abundance was quantified with software FeatureCounts (S3 Table, “FPKM”). As expected, Orco expression is significantly reduced in AalbOrcoDsRed/DsRed mutants mosquitoes (Fig 5A, B). We found that the knockout of Orco leads to significantly reduced expression of many ORs tuning receptors (Fig 6A). The extremely modest number of residual Orco transcripts are most likely derived from the sequence in front of the double stranded break located in the fourth exon of the mutant mosquitos (Fig 5B). More importantly, the greatest reduction is seen for OR52, whose transcript in AalbOrcoDsRed/DsRed mutants is almost undetectable (Fig 5C). The transcript abundance of many other tuning receptors was also significantly diminished, with less than 20% of wild-type level expression, including: OR7a (1%), OR13a (5%), OR132 (6%), OR56a (8%), OR43 (8%), OR6 (8%), OR10 (17%), OR122 (17%), OR84 (18%) and OR111 (19%) (Fig 5C). In contrast, no significant differences were observed in the transcript abundance of IRs in the antennae of AalbOrcoDsRed/DsRed mosquito (Fig 5D). Interestingly, 2 Or transcripts, OR115 and OR85, exhibited upregulation, with significant increases of 87% and 60%, respectively, relative to wild-type controls (Fig 5F).
Heatmap showing the average antennal expression in FPKM for each of the Or genes in wild-type and AalbOrcoDsRed/DsRed mosquitoes. (B) Transcriptional level of Orco gene in wild-type and AalbOrcoDsRed/DsRed mosquitoes. (C) Top 20 most highly expressed Or genes in wild-type were significantly reduced in AalbOrcoDsRed/DsRed mosquitoes. (D) Expression in FPKM for detected IR tuning receptor and co-receptor genes in wild-type and AalbOrcoDsRed/DsRed mosquitoes. (E) Expression in FPKM for detected GR genes in wild-type and AalbOrcoDsRed/DsRed mosquitoes. (F) Expression of all the two upregulated Or tuning receptors genes in the AalbOrcoDsRed/DsRed mosquitoes. Mann-Whitney U test was applied in the statistical analysis, statistical significance is presented as P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), P < 0.0001(****) and P > 0.05 (ns).
(A) Representative EAG response traces of wild-type and AalbOrcoDsRed/DsRed mosquito to different odorants; (B) Comparison of EAG responses of wild-type and AalbOrcoDsRed/DsRed Ae. albopictus to 50 odorants in different chemical classes (n = 7). EAG responses (∆mV) for each odorant at a 10−1 dilution were normalized to the solvent control (Paraffin oil and DMSO were used as solvents. Indole and skatole were dissolved in DMSO, while the other 48 compounds were dissolved in Paraffin oil) by subtracting the solvent-induced EAG value. Mann-Whitney U test was applied in the statistical analysis, with P ≥ 0.05 indicating no significance (ns), and P < 0.05 (*) as significant difference.
Previous studies in Drosophila and mosquitoes have identified the expression of certain GRs in the antenna, such as the CO2-sensitive GRs in the ab1 sensillum of fly antenna [43] and GR33 in mosquito antenna [44]. In our study, we detected five GR transcripts of exceptionally low abundance in the antenna of both Orco homozygous mutants and wild-type mosquitoes, although these notably exhibited no significant difference between the two mosquito lines (Fig 5E).
Reduced antennal responses of Orco knockout mosquito to human volatiles
To investigate the impact of Orco knockout on the compound-evoked olfactory responses of Ae. albopictus, we performed comparative electroantennogram (EAG) recordings between wild-type and AalbOrcoDsRed/DsRed homozygous mutant mosquitoes with a chemically diverse odorant panel (50 compounds across 7 chemical categories) which were selected according to their potent electrophysiological effects in other mosquito species [25,45,46] (S1 Table). As expected, wild-type mosquitoes exhibited robust EAG responses across all of these chemical groups (Fig 6A). In contrast, EAG responses of AalbOrco mutant mosquito to most odorants, particularly those in the categories of alcohol, aldehydes, ketones, and esters, were dramatically reduced (Fig 6B; S4 Table). Of note, we also observed significantly reduced EAG responses to some compounds in the heterozygous AalbOrco+/DsRed mutants compared to the wild-type, which may result from the down-regulation of certain ORs induced by Orco knockout (S2 Fig). As expected, no significant differences were observed between AalbOrcoDsRed/DsRed and wild-type in response to three acids, valeric acid, hexanoic acid, and butanoic acid, which are often considered to be detected by IRs, suggesting the Orco/OR complex is not involved in the perception of these acidic compounds. These results provide strong evidence that Orco is necessary for olfactory chemosensation in Ae. albopictus.
Reduced neuronal responses in Orco mutant Ae. albopictus
Four morphological types of trichoid sensilla have been previously identified on the antennae of Ae. albopictus mosquitoes, namely long sharp tipped (LST), short sharp tipped (SST), short blunt tipped I (SBTI), and short blunt tipped II (SBTII) [47]. To investigate the effects of Orco knockout on chemical reception at the neuronal level, we performed SSR to compare the responses of four types of olfactory sensilla in wild-type and Orco mutants (AalbOrcoDsRed/DsRed) to a panel of 34 compounds in diverse chemical categories. We found in female wild-type Ae. albopictus, sensilla SST and SBTI exhibit broad neuronal responses to most compounds while LST and SBTII sensilla only respond to a limited number of chemicals (Fig 7A; S5 Table). However, in the AalbOrcoDsRed/DsRed mosquito, the trichoid sensilla, with the exception of SBTII, all exhibited loss of responsiveness to most compounds (Fig 7B; S5 Table).
(A) & (B) Heatmaps showing averaged neuronal responses to a panel of 34 odorants from individual sensilla randomly sampled across the antenna of wild-type (left) and AalbOrcoDsRed/DsRed (right) Ae. albopictus. (C) Representative response traces of SST and SBTI sensillum to selected chemical componds (diluted to 1% concentration in paraffin oil or DMSO). There were two neurons in most of the sensilla with large amplitude (blue traces) representing the response of ‘A’ neuron and small amplitude (red traces) representing the response of ‘B’ neuron. (D) Averaged female SST sensillum responses in wild-type and AalbOrcoDsRed/DsRed mosquitoes. Mann-Whitney U test suggested neuronal responses to selected compounds in Orco mutants were significantly reduced compared to the wild-type (n = 7). (E) Averaged female SBTI sensillum responses in wild-type and AalbOrcoDsRed/DsRed mosquitoes. Mann-Whitney U test suggested neuronal responses to fenchone and camphor in Orco mutants were significantly reduced than wild-type (n = 6). (F) Averaged female CP sensillum responses in the the maxillary palp of wild-type and AalbOrcoDsRed/DsRed mosquitoes. Mann-Whitney U test suggested neuronal responses to 1-octen-3-ol in Orco mutants were significantly reduced compared to the wild-type (n = 6), while no significant differences were observed in neuronal responses to CO2 between wild-type and Orco mutants (n = 6). Statistical significance was presented as P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), P < 0.0001 (****).
The ‘A’ neuron, as defined by its large spike amplitude, in SST (blue traces in Fig 7C) displayed strong responses to 2,6-dimethylpyrazine (124 ± 54 spikes/s), 4,5-dimethylthiazole (120 ± 72 spikes/s), acetophenone (88 ± 44 spikes/s), and 1-pentanol (82 ± 62 spikes/s). Meanwhile, SBTI was very sensitive to terpenoid volatiles fenchone (82 ± 20 spikes/s) and camphor (72 ± 26 spikes/s) (Fig 7C, left panel). Moreover, the background activity of sensory neurons in the sharp-tiped sensilla (SST and LST) were considerably diminished with very few residual spikes present (Fig 7C, right panel). However, we did observe extensive spontaneous activity in the SBTI of the Orco mutant mosquito. Most interestingly, the SBTII sensilla are found to respond robustly to aldehydes, such as octanal, nonanal and decanal, in both wild-type and Orco mutant. The simple interpretation is that Orco is not involved in the sensation of aldehyde compounds in the SBTII sensillum of Ae. albopictus. Quantitative analysis on the neuronal response of Orco mutant mosquito revealed significant attenuation in SST sensitivity to 2,6-dimethylpyrazine, 4,5-dimethylthiazole, acetophenone, and 1-pentanol (Fig 7D). In addition, SBTI also exhibited significantly diminished responses to fenchone and camphor (Fig 7E). These results demonstrate that Orco-expressing neurons housed in most trichoid sensilla are actively involved in the detection of a wide range of compounds.
Furthermore, we examined the odor-evoked responses of capitate peg (CP) sensilla which house three neurons, A neurons showing large spikes and B/C neurons displaying small spikes, on the maxillary palps of both wild-type and Orco mutant Ae. albopictus. The GR-expressing A neurons are responsible for detecting CO2 while the B/C neurons expressing the Orco/OR complex are extremly sensitive to one human sweat component: 1-octen-3-ol [24,48,49]. Our results revealed that in wild-type mosquitoes, the B/C neurons in CP sensilla of Ae. albopictus exhibited significantly higher responses to 1-octen-3-ol (47 ± 10 spikes/s) compared to Orco mutants, where the response to 1-octen-3-ol was almost completely abolished (Fig 7F). In contrast, the CO2-detecting A neuron remained unaffected with both wild-type and Orco mutant mosquito displaying robust CO2-induced responses (Fig 7F).
Impact of Orco knockout on the behavioral responses of mosquitoes
To further investigate the impact of AalbOrcoDsRed/DsRed mutation on blood-feeding and host preference, we conducted blood-feeding assays using mice as the blood source. We observed a significant decline in the proportion of successful blood-feeding in AalbOrcoDsRed/DsRed mutants compared to the wild-type mosquitoes (P < 0.05) (Fig 8A, B; S6 Table). In addition, a two-choice valence assay between volatile odors emitted from a human hand and that of a mouse was utilized to evaluate host preference of both wild-type and Orco knockout mosquitoes. As expected, wild-type mosquitoes displayed considerable preference towards the human hand. By contrast, host preference towards humans decreased in AalbOrcoDsRed/DsRed mutant mosquitoes (P < 0.0001) which instead showed a slight preference to the mice in our study (Fig 8C, D; S6 Table). Taken together, these findings make Orco a prime target for vector control strategies aimed at disrupting blood feeding and host preference in Ae. albopictus.
(A) Schematic picture of setting of blood-feeding assay. (B) Comparison of feeding success between AalbOrcoDsRed/DsRed and wild-type mosquitoes. The successful blood-feeding rate of the AalbOrcoDsRed/DsRed mosquito was significantly lower than that of wild-type mosquitoes on mice (P < 0.05). (C) Schematic picture of setting of two-choice host preference assay. (D) Comparison of host preference between AalbOrcoDsRed/DsRed and wild-type mosquitoes. AalbOrcoDsRed/DsRed mutant mosquitoes showed reduced preference for human hand (P < 0.0001). Statistical analysis was done using GraphPad Prism 5. Data are presented as mean ± s.e.m. Mann-Whitney U test was used to compare two sets of data with the significance set to a P-value < 0.05.
Discussion
The emergence and global spread of the Asian tiger mosquito Ae. albopictus as a dominant arboviral vector represents a growing threat to public health, particularly given its expanding ecological range and capacity to transmit deadly diseases [1,2,8,50]. Despite the critical role of olfaction in the mosquito’s ability to locate hosts and reproduce, fundamental questions remain about how the olfactory system develops and functions in this species. In this study, we provide a systematic and comprehensive analysis of Orco expression, function, and regulatory impact across the life stages of Ae. albopictus, revealing an unexpectedly dynamic olfactory architecture and underscoring Orco’s multifaceted role in olfactory development, transcriptional regulation, and behavior.
Our study establishes that Orco-expressing OSNs are present as early as the embryonic stage and expand throughout larval development, suggesting an early onset of olfactory capability that may contribute to environmental sensing, egg hatching, and larval foraging [40]. Here, we observed an average of 11 Orco+ neurons in the third and fourth instar larval antenna, which is consistent with what has been reported in other mosquito species. For instance, the sensory cone in the larval antennae of Ae. aegypti, An. coluzzii, and An. gambiae (previously known as the “M” and “S” forms of the An. gambiae species complex) [51] have all been reported to innervate 12–13 typical bipolar neurons that express Orco/OR complex and display robust chemosensory capacity [52–55]. Compared to several hundred Orco+ neurons in the antenna of adult mosquitoes, the modest number of ORNs in the larval antenna may mirror the relatively less complex chemical environment of their aquatic habitat—characterized by a limited diversity of volatile chemical cues and a primary reliance on water-soluble or non-volatile compounds—along with the correspondingly narrower behavioral repertoire required for larval survival (e.g., foraging, habitat navigation, and predator avoidance).
Functionally, Orco mutants exhibited a profound deficit in olfactory physiology. EAG and SSR demonstrated sharply reduced responses across multiple classes of odorants, including key human-derived volatiles such as 1-octen-3-ol and other aldehydes and ketones [13]. Indeed, the neuronal responses of most of the trichoid sensilla investigated in this study were almost completely abolished after Orco knockout. These deficits were sensory-specific, with GR- and IR-mediated responses largely preserved, reinforcing the selectivity of the Orco/OR pathway and corroborating earlier findings in Anopheles and Aedes species [24,25]. Behavioral assays further confirmed that Orco disruption abolishes host preference and significantly reduces blood-feeding success, firmly establishing Orco as a central node linking molecular, cellular, and behavioral levels of mosquito olfaction.
Curiously, we also observed abundant residual spikes in the sensilla of Orco mutants, particularly in the SBTI sensilla, which displayed a very high frequency of spontaneous sensory neuron activity. Our best explanation for these residual spikes comes from recent studies reporting non-canonical co-expression of chemoreceptor co-receptors (e.g., Orco, Ir25a, Ir8a and Ir76b) and/or tuning receptors in the olfactory sensory neurons of both Drosophila and mosquitoes [9–11,56,57]. The extensive presence of residual spikes in the SBTI sensillum of Orco mutant mosquito may therefore be the result of the co-expression of both Orco/OR and Irco/IR in the same neurons, which could potentially still be partially functional even though the Orco/OR complex has been disrupted. Future studies on olfactory receptor organization at a single cell level in Ae. albopictus would give us a more definitive explanation of these residual spikes displayed after knocking out the Orco gene.
Beyond anatomical remodeling and physiology, our transcriptomic analysis revealed that Orco knockout in Ae. albopictus led to widespread downregulation and targeted upregulation of many tuning ORs, implicating Orco not only in OSN signaling but also in the maintenance of ORs gene expression. These findings align with evidence suggesting a dual role for Orco in the transcriptional regulation of tuning ORs in D. melanogaster and H. armigera [58,59]. Together with a more recent study in Ae. aegypti [60], our results demonstrate that this dual regulatory role of Orco is conserved in mosquitoes, extending the functional landscape of Orco beyond its canonical role as merely a co-receptor [14,15]. The reduction in ORs transcript levels suggests that Orco may influence receptor stability, trafficking, or transcriptional feedback, an area ripe for further investigation.
Conclusions
Taken together, this work provides the most detailed spatiotemporal characterization of Orco expression and function to date in a non-model mosquito species and establishes a new platform for studying olfactory system development. By integrating genetic tools (Q-system, HACK), transcriptomics, neurophysiology, and behavior, we demonstrate that Orco serves not only as a co-receptor but as a transcriptional stabilizer in Ae. albopictus. These findings provide a theoretical foundation for translational strategies aimed at disrupting mosquito host-seeking behaviors via genetic or chemical interference with Orco function. Given the expanding public health burden of Ae. albopictus and the increasing resistance to traditional insecticides, Orco and its associated pathways represent compelling targets for next-generation vector control.
Supporting information
S1 Fig. Comparison of the fecundity between the wild-type and AalbOrcoDsRed/DsRed.
(A) Egg laying of individual female wild-type and AalbOrcoDsRed/DsRed mosquito (n = 8). The number of eggs laid by AalbOrcoDsRed/DsRed was lower than that of the wild-type. (B) Hatching rate of eggs laid by wild-type and AalbOrcoDsRed/DsRed mosquito (n = 8). The hatching rate of eggs laid by AalbOrcoDsRed/DsRed mosquito was lower than that of the wild-type. Mann-Whitney U test was applied in the statistical analysis, statistical significance is presented as P < 0.05 (*), P < 0.01 (**), P < 0.001 (***), and P > 0.05 (ns).
https://doi.org/10.1371/journal.pntd.0013753.s001
(TIF)
S2 Fig. EAG responses of wild-type and AalbOrco+/DsRed Ae. albopictus to a broad panel of human odorants.
Comparison of EAG responses of wild-type and AalbOrco+/DsRed Ae. albopictus to 50 odorants in different chemical classes (n = 8). EAG responses (∆mV) for each odorant at a 10−1 dilution were normalized to the solvent control (Paraffin oil and DMSO were used as solvents. Indole and skatole were dissolved in DMSO, while the other 48 compounds were dissolved in Paraffin oil.) by subtracting the solvent-induced EAG value. Mann-Whitney U test was applied in the statistical analysis, with P ≥ 0.05 indicating no significance (ns), and P < 0.05 (*) as significant differences.
https://doi.org/10.1371/journal.pntd.0013753.s002
(TIF)
S1 Table. Odorants lists used in electrophysiological recordings.
Chemical information of odorants, such as CAS number, purity, and company, was included.
https://doi.org/10.1371/journal.pntd.0013753.s003
(PDF)
S2 Table. Source data for fecundity assay of both wild-type and AalbOrcoDsRed/DsRed female mosquito.
https://doi.org/10.1371/journal.pntd.0013753.s004
(XLSX)
S3 Table. Source data for the transcript abundance (FPKM counts) of chemosensory genes in both wild-type and AalbOrcoDsRed/DsRed female mosquito antennae.
https://doi.org/10.1371/journal.pntd.0013753.s005
(XLSX)
S4 Table. Source data for EAG responses on both wild-type and AalbOrcoDsRed/DsRed female mosquito antennae.
https://doi.org/10.1371/journal.pntd.0013753.s006
(XLSX)
S5 Table. Source data for SSR recordings on both wild-type and AalbOrcoDsRed/DsRed female mosquito antennae.
https://doi.org/10.1371/journal.pntd.0013753.s007
(XLSX)
S6 Table. Source data for behavioral assays on both wild-type and AalbOrcoDsRed/DsRed female mosquito antennae.
https://doi.org/10.1371/journal.pntd.0013753.s008
(XLSX)
Acknowledgments
We thank the Biosafety Level 2 (BSL-2) and Animal Biosafety Level 2 (ABSL-2) Laboratories of the Institute of Infectious Diseases, Shenzhen Bay Laboratory, for their support and assistance during this research.
References
- 1. Benelli G, Wilke ABB, Beier JC. Aedes albopictus (Asian Tiger Mosquito). Trends Parasitol. 2020;36(11):942–3. pmid:32037135
- 2. Battaglia V, Agostini V, Moroni E, Colombo G, Lombardo G, Rambaldi Migliore N, et al. The worldwide spread of Aedes albopictus: New insights from mitogenomes. Front Genet. 2022;13:931163. pmid:36092930
- 3. Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013;496(7446):504–7. pmid:23563266
- 4. Brady OJ, Gething PW, Bhatt S, Messina JP, Brownstein JS, Hoen AG, et al. Refining the global spatial limits of dengue virus transmission by evidence-based consensus. PLoS Negl Trop Dis. 2012;6(8):e1760. pmid:22880140
- 5. Gratz NG. Critical review of the vector status of Aedes albopictus. Med Vet Entomol. 2004;18(3):215–27. pmid:15347388
- 6. Nie P, Feng J. Niche and Range Shifts of Aedes aegypti and Ae. albopictus Suggest That the Latecomer Shows a Greater Invasiveness. Insects. 2023;14(10):810. pmid:37887822
- 7. Sutcliffe JF. Sensory bases of attractancy: morphology of mosquito olfactory sensilla-- a review. J Am Mosq Control Assoc. 1994;10(2 Pt 2):309–15. pmid:8965084
- 8.
Pask G, Ray A. Insect olfactory receptors: an interface between chemistry and biology. Cambridge: Academic; 2016. p. 101–22.
- 9. McLaughlin CN, Brbić M, Xie Q, Li T, Horns F, Kolluru SS, et al. Single-cell transcriptomes of developing and adult olfactory receptor neurons in Drosophila. Elife. 2021;10:e63856. pmid:33555999
- 10. Task D, Lin C-C, Vulpe A, Afify A, Ballou S, Brbic M, et al. Chemoreceptor co-expression in Drosophila melanogaster olfactory neurons. Elife. 2022;11:e72599. pmid:35442190
- 11. Herre M, Goldman OV, Lu T-C, Caballero-Vidal G, Qi Y, Gilbert ZN, et al. Non-canonical odor coding in the mosquito. Cell. 2022;185(17):3104–3123.e28. pmid:35985288
- 12. Bohbot JD, Lu T, Zwiebel LJ. Molecular regulation of olfaction in mosquitoes. Adv Insect Physiol. 2010;(2):17–38.
- 13. Zung JL, McBride CS. Sebaceous origins of human odor. Curr Biol. 2025;35(8):R303–13. pmid:40262540
- 14. Benton R, Sachse S, Michnick SW, Vosshall LB. Atypical membrane topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS Biol. 2006;4(2):e20. pmid:16402857
- 15. Butterwick JA, Del Mármol J, Kim KH, Kahlson MA, Rogow JA, Walz T, et al. Cryo-EM structure of the insect olfactory receptor Orco. Nature. 2018;560(7719):447–52. pmid:30111839
- 16. Del Mármol J, Yedlin MA, Ruta V. The structural basis of odorant recognition in insect olfactory receptors. Nature. 2021;597(7874):126–31. pmid:34349260
- 17. Wang Y, Qiu L, Wang B, Guan Z, Dong Z, Zhang J, et al. Structural basis for odorant recognition of the insect odorant receptor OR-Orco heterocomplex. Science. 2024;384(6703):1453–60. pmid:38870272
- 18. Zhao J, Chen AQ, Ryu J, Del Mármol J. Structural basis of odor sensing by insect heteromeric odorant receptors. Science. 2024;384(6703):1460–7. pmid:38870275
- 19. Brand P, Robertson HM, Lin W, Pothula R, Klingeman WE, Jurat-Fuentes JL, et al. The origin of the odorant receptor gene family in insects. Elife. 2018;7:e38340. pmid:30063003
- 20. Larsson MC, Domingos AI, Jones WD, Chiappe ME, Amrein H, Vosshall LB. Or83b encodes a broadly expressed odorant receptor essential for Drosophila olfaction. Neuron. 2004;43(5):703–14. pmid:15339651
- 21. Trible W, Olivos-Cisneros L, McKenzie SK, Saragosti J, Chang N-C, Matthews BJ, et al. orco Mutagenesis Causes Loss of Antennal Lobe Glomeruli and Impaired Social Behavior in Ants. Cell. 2017;170(4):727-735.e10. pmid:28802042
- 22. Yan H, Opachaloemphan C, Mancini G, Yang H, Gallitto M, Mlejnek J, et al. An Engineered orco Mutation Produces Aberrant Social Behavior and Defective Neural Development in Ants. Cell. 2017;170(4):736-747.e9. pmid:28802043
- 23. Ferguson ST, Park KY, Ruff AA, Bakis I, Zwiebel LJ. Odor coding of nestmate recognition in the eusocial ant Camponotus floridanus. J Exp Biol. 2020;223(Pt 2):jeb215400. pmid:31900348
- 24. DeGennaro M, McBride CS, Seeholzer L, Nakagawa T, Dennis EJ, Goldman C, et al. orco mutant mosquitoes lose strong preference for humans and are not repelled by volatile DEET. Nature. 2013;498(7455):487–91. pmid:23719379
- 25. Sun H, Liu F, Ye Z, Baker A, Zwiebel LJ. Mutagenesis of the orco odorant receptor co-receptor impairs olfactory function in the malaria vector Anopheles coluzzii. Insect Biochem Mol Biol. 2020;127:103497. pmid:33188923
- 26. Potter CJ, Tasic B, Russler EV, Liang L, Luo L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 2010;141(3):536–48. pmid:20434990
- 27. Gamez S, Antoshechkin I, Mendez-Sanchez SC, Akbari OS. The Developmental Transcriptome of Aedes albopictus, a Major Worldwide Human Disease Vector. G3 (Bethesda). 2020;10(3):1051–62. pmid:31964684
- 28. Li M, Bui M, Yang T, Bowman CS, White BJ, Akbari OS. Germline Cas9 expression yields highly efficient genome engineering in a major worldwide disease vector, Aedes aegypti. Proc Natl Acad Sci U S A. 2017;114(49):E10540–9. pmid:29138316
- 29. Labun K, Montague TG, Krause M, Torres Cleuren YN, Tjeldnes H, Valen E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res. 2019;47(W1):W171–4. pmid:31106371
- 30. Matthews BJ, Younger MA, Vosshall LB. The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti. Elife. 2019;8:e43963. pmid:31112133
- 31. Riabinina O, Task D, Marr E, Lin C-C, Alford R, O’Brochta DA, et al. Organization of olfactory centres in the malaria mosquito Anopheles gambiae. Nat Commun. 2016;7:13010. pmid:27694947
- 32. Juhn J, James AA. Hybridization in situ of salivary glands, ovaries, and embryos of vector mosquitoes. J Vis Exp. 2012;(64):3709. pmid:22781778
- 33. Ye Z, Liu F, Sun H, Ferguson ST, Baker A, Ochieng SA, et al. Discrete roles of Ir76b ionotropic coreceptor impact olfaction, blood feeding, and mating in the malaria vector mosquito Anopheles coluzzii. Proc Natl Acad Sci U S A. 2022;119(23):e2112385119. pmid:35648836
- 34. Liu F, Chen L, Appel AG, Liu N. Olfactory responses of the antennal trichoid sensilla to chemical repellents in the mosquito, Culex quinquefasciatus. J Insect Physiol. 2013;59(11):1169–77. pmid:24035746
- 35. Den Otter CJ, Behan M, Maes FW. Single cell responses in female Pieris brassicae (Lepidoptera: Pieridae) to plant volatiles and conspecific egg odours. J Insect Physiol. 1980;26(7):465–72.
- 36. Pelletier J, Guidolin A, Syed Z, Cornel AJ, Leal WS. Knockdown of a mosquito odorant-binding protein involved in the sensitive detection of oviposition attractants. J Chem Ecol. 2010;36(3):245–8. pmid:20191395
- 37. Wang Y, He X, Qiao L, Yu Z, Chen B, He Z. CRISPR/Cas9 mediates efficient site-specific mutagenesis of the odorant receptor co-receptor (Orco) in the malaria vector Anopheles sinensis. Pest Manag Sci. 2022;78(8):3294–304. pmid:35484862
- 38. Lin C-C, Potter CJ. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 2016;203(4):1613–28. pmid:27334272
- 39. Mundim-Pombo APM, de Carvalho HJC, Rodrigues Ribeiro R, León M, Maria DA, Miglino MA. Aedes aegypti: egg morphology and embryonic development. Parasit Vectors. 2021;14(1):531. pmid:34645492
- 40. Ng SH, Zhang H, Goh FG, Ng L-C, Ji L, Cai Y. Induced Hatching of Quiescent Aedes aegypti (Diptera: Culicidae) Eggs by Labile Glutathione-Stabilizable Compounds From Yeast Extract. J Med Entomol. 2021;58(2):956–60. pmid:33710312
- 41. Melo ACA, Rützler M, Pitts RJ, Zwiebel LJ. Identification of a chemosensory receptor from the yellow fever mosquito, Aedes aegypti, that is highly conserved and expressed in olfactory and gustatory organs. Chem Senses. 2004;29(5):403–10. pmid:15201207
- 42. Saveer AM, Pitts RJ, Ferguson ST, Zwiebel LJ. Characterization of Chemosensory Responses on the Labellum of the Malaria Vector Mosquito, Anopheles coluzzii. Sci Rep. 2018;8(1):5656. pmid:29618749
- 43. Jones WD, Cayirlioglu P, Kadow IG, Vosshall LB. Two chemosensory receptors together mediate carbon dioxide detection in Drosophila. Nature. 2007;445(7123):86–90. pmid:17167414
- 44. Pitts RJ, Rinker DC, Jones PL, Rokas A, Zwiebel LJ. Transcriptome profiling of chemosensory appendages in the malaria vector Anopheles gambiae reveals tissue- and sex-specific signatures of odor coding. BMC Genomics. 2011;12:271. pmid:21619637
- 45. Chen Z, Liu F, Liu N. Human Odour Coding in the Yellow Fever Mosquito, Aedes aegypti. Sci Rep. 2019;9(1):13336. pmid:31527631
- 46. Syed Z, Leal WS. Acute olfactory response of Culex mosquitoes to a human- and bird-derived attractant. Proc Natl Acad Sci U S A. 2009;106(44):18803–8. pmid:19858490
- 47. Seenivasagan T, Sharma KR, Shrivastava A, Parashar BD, Pant SC, Prakash S. Surface morphology and morphometric analysis of sensilla of Asian tiger mosquito, Aedes albopictus (Skuse): an SEM investigation. J Vector Borne Dis. 2009;46(2):125–35. pmid:19502692
- 48. Liu F, Ye Z, Baker A, Sun H, Zwiebel LJ. Gene editing reveals obligate and modulatory components of the CO2 receptor complex in the malaria vector mosquito, Anopheles coluzzii. Insect Biochem Mol Biol. 2020;127:103470. pmid:32966873
- 49. Syed Z, Leal WS. Maxillary palps are broad spectrum odorant detectors in Culex quinquefasciatus. Chem Senses. 2007;32(8):727–38. pmid:17569743
- 50. Nakase T, Giovanetti M, Obolski U, Lourenço J. Population at risk of dengue virus transmission has increased due to coupled climate factors and population growth. Commun Earth Environ. 2024;5(1).
- 51. Coetzee M, Hunt RH, Wilkerson R, Della Torre A, Coulibaly MB, Besansky NJ. Anopheles coluzzii and Anopheles amharicus, new members of the Anopheles gambiae complex. Zootaxa. 2013;3619:246–74. pmid:26131476
- 52. Zacharuk RY, Yin LR, Blue SG. Fine structure of the antenna and its sensory cone in larvae of Aedes aegypti (L.). J Morphol. 1971;135(3):273–97. pmid:5126255
- 53. Sun H, Liu F, Baker AP, Honegger HW, Raiser G, Zwiebel LJ. Neuronal odor coding in the larval sensory cone of Anopheles coluzzii: Complex responses from a simple system. Cell Rep. 2021;36(7):109555. pmid:34407405
- 54. Liu C, Pitts RJ, Bohbot JD, Jones PL, Wang G, Zwiebel LJ. Distinct olfactory signaling mechanisms in the malaria vector mosquito Anopheles gambiae. PLoS Biol. 2010;8(8):e1000467. pmid:20824161
- 55. Xia Y, Wang G, Buscariollo D, Pitts RJ, Wenger H, Zwiebel LJ. The molecular and cellular basis of olfactory-driven behavior in Anopheles gambiae larvae. Proc Natl Acad Sci U S A. 2008;105(17):6433–8. pmid:18427108
- 56. Adavi ED, Dos Anjos VL, Kotb S, Metz HC, Tian D, Zhao Z, et al. Olfactory receptor coexpression and co-option in the dengue mosquito. bioRxiv. 2024;2024.08.21.608847. pmid:39229077
- 57. Goldman OV, DeFoe AE, Qi Y, Jiao Y, Weng S-C, Wick B, et al. et al. Mosquito Cell Atlas: A single-nucleus transcriptomic atlas of the adult Aedes aegypti mosquito. bioRxiv. 2025;2025.02.25.639765. pmid:40060408
- 58. Long T, Mohapatra P, Ballou S, Menuz K. Odorant receptor co-receptors affect expression of tuning receptors in Drosophila. Front Cell Neurosci. 2024;18:1390557. pmid:38832356
- 59. Fan X-B, Mo B-T, Li G-C, Huang L-Q, Guo H, Gong X-L, et al. Mutagenesis of the odorant receptor co-receptor (Orco) reveals severe olfactory defects in the crop pest moth Helicoverpa armigera. BMC Biol. 2022;20(1):214. pmid:36175945
- 60. Cooke MM, Chembars MS 2nd, Pitts RJ. The Dysregulation of Tuning Receptors and Transcription Factors in the Antennae of Orco and Ir8a Mutants in Aedes aegypti Suggests a Chemoreceptor Regulatory Mechanism Involving the MMB/dREAM Complex. Insects. 2025;16(6):638. pmid:40559068