Skip to main content
Advertisement
  • Loading metrics

TLR4 competence and mouse models of sublethal leptospirosis

  • Olifan Zewdie Abil ,

    Roles Data curation, Formal analysis, Investigation, Methodology, Writing – original draft

    ☯ Equal contributions

    Affiliation Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, Memphis, United States of America

  • Suman Kundu ,

    Roles Investigation, Methodology, Writing – original draft

    ☯ Equal contributions

    Affiliation Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, Memphis, United States of America

  • Leonardo Moura Midon,

    Roles Investigation, Methodology

    Affiliation Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, Memphis, United States of America

  • Maria Gomes-Solecki

    Roles Conceptualization, Data curation, Funding acquisition, Supervision, Writing – original draft, Writing – review & editing

    mgomesso@uthsc.edu

    Affiliation Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, Memphis, United States of America

Abstract

Mice are slowly being accepted as alternative models for investigation of leptospiral infection. The strain often used to analyze sublethal disease (C3H/HeJ) expresses a hyporesponsive tlr4 gene in its cells and thus the model is deemed immunocompromised. To help resolve this scientific concern we compared infection of mice expressing competent tlr4 (C3H/HeN, C57BL6) versus tlr4 hyporesponsive mice (C3H/HeJ) with Leptospira interrogans serovar Copenhageni strain Fiocruz L1-130 over a period of two weeks. We found that the two mouse strains with a functional tlr4 gene (C3H/HeN and C57BL/6) developed clinical and molecular signs of leptospirosis less pronounced but not significantly different than tlr4 hyporesponsive C3H/HeJ, as quantified by weight loss, survival curves, presence of Leptospira 16S rRNA in blood and urine and burden of viable spirochetes in kidney as compared to the respective uninfected controls. Analysis of serologic immune factors in the three strains revealed increased IgM and IgG3, and a general absence of inflammatory markers at two weeks post infection. Our data suggests that TLR4 function is not sufficient to cause susceptibility to leptospirosis. We conclude that C3H/HeN and C57BL/6 are appropriate mouse models of sublethal leptospirosis.

Author summary

We did a comparative study using mouse strains immunocompetent and hyporesponsive to tlr4. The data shows that tlr4 competent strains (C3H/HeN and C57BL/6) developed clinical and molecular signs of sublethal leptospirosis not much different than tlr4 hyporesponsive C3H/HeJ. Thus, competent recognition of L. interrogans serovar Copenhageni FioCruz factors by murine TLR4 does not determine susceptibility to leptospirosis.

Introduction

Leptospirosis, an often overlooked but resurging infectious disease caused by a spirochete, is a significant global health concern impacting millions of individuals worldwide. This disease carries a high mortality rate, resulting in approximately 65,000 deaths annually [1]. Furthermore, it poses a serious threat to animals of agricultural importance, leading to substantial economic losses, particularly in tropical and subtropical regions [2]. Although significant efforts have been made to formulate novel vaccination approaches that confer enduring immunity and safeguard against various serovars, our understanding of the specific immune factors contributing to host defense and disease progression remains limited [3].

Leptospirosis research is challenging due to the inconsistent outcomes observed in leptospiral infections involving animals and humans [2], and due to an abundance of high and low virulence Leptospira serovars [47]. Hamsters and guinea pigs have been widely used as small-animal models of acute disease, as they recapitulate the manifestations of severe disease in humans [8,9]. Rats have been used as a model for studying the severity of human leptospirosis as they become chronically infected and shed Leptospira in urine many months after infection [10]. However, the usage of these animals in research is limited in some parts of the world where the disease is endemic due to stringent animal regulations [11] and the scarcity of accessible reagents for routine experiments.

The outcomes of experimental leptospiral infection have been analyzed using various mouse models, including studies on lethal, sublethal, and chronic leptospirosis [1214]. For instance, C57BL/6 and BALB/c are more resilient to acute disease and have the potential to serve as models for persistent infection caused by Leptospira interrogans [13,14]. C3H/HeJ mice infected with L. interrogans develop disease that can be easily monitored through measurement of clinical scores. This strain produces valuable models of lethal [12,15,16] and sublethal disease [17,18], and has been used to study inflammatory signatures of infection [19], necroptosis [20], and immunity protection [21].Toll-like receptor (TLR) 4, which recognizes LPS, plays a central role in the control of leptospirosis [22,23]. One study described how leptospiral-LPS activates murine, but not human, TLR4 in cultured macrophages [24], and it is associated with resistance to infection [25]. C3H/HeJ mice have a single amino acid substitution (aa712, P to H) within the coding region of the tlr4 gene that makes this molecule hyporesponsive to the atypical Leptospira LPS [23,26]. Of note, humans, also believed to be susceptible to leptospirosis express a TLR4 molecule that does not sense the atypical Leptospira LPS [24]. Nevertheless, one consistent criticism regarding the use C3H/HeJ mice is that its hyporesponsive Toll-Like Receptor 4 (TLR4) [26] qualifies these mice as immunocompromised. To help resolve this valid scientific concern we did a study in which we compared infection with L. interrogans in mice expressing competent tlr4 (C57BL6, C3H/HeN) versus mice that are tlr4 hyporesponsive (C3H/HeJ). The goal of this study was to determine if the TLR4 competent strains can also be used as mouse models of sublethal leptospirosis.

Results

Weight loss, burden in blood, shedding in urine and survival after infection with L. interrogans serovar Copenhageni FioCruz.

Following experimental leptospiral infection (108 LiC), mice were monitored over a 15-day period. In C3H/HeJ, steady weight loss was observed beginning on day 6, reaching the lowest mean on day 9 (-14.9%), at which point mice recovered gradually (Fig 1A). C3H/HeN mice exhibited weight loss from day 1 reaching the lowest mean on day 7 (-11.9%) which was maintained until day 14 (Fig 1B). C57BL/6 mice experienced lower loss of weight throughout the 14 days, reaching the lowest mean (-7.4%) on day 6 (Fig 1C). The weight loss curves of the three infected mouse strains were statistically significant compared to their respective controls (p < 0.0001).

thumbnail
Fig 1. Weight loss and bacterial burden in blood and urine after infection.

Male C3H/HeJ, C3H/HeN and C57BL/6 mice (n = 7/group) were inoculated IP with 108 L. interrogans serovar Copenhageni strain FioCruz L1-130 (LiC) and with PBS as control. A-C) Body weight (% change) was recorded daily for 15 days post infection; D-E) Quantification of bacterial load in blood and urine by qPCR of the 16S rRNA gene. Data from two independent experiments is shown. For weight loss, statistics by Ordinary 2-Way ANOVA, p < 0.0001 for infected versus control C3H/HeJ, C3H/HeN and C57BL/6.

https://doi.org/10.1371/journal.pntd.0013163.g001

Quantitative PCR (qPCR) targeting the Leptospira 16S rRNA gene was performed to analyse the dissemination of Leptospira in blood and urine. Blood samples were collected on days 0, 1, 3, 6, 9, 12, and 14 post-inoculation to quantify the Leptospira burden. Peak Leptospira burdens in blood were observed on day 3 in C3H/HeJ mice (~3x104), whereas the peak burden occurred on day 1 in both C3H/HeN and C57BL/6 mice, ~ 6-9x103 (Fig 1D). Leptospira shedding in urine was also assessed using qPCR on alternate days. Shedding (Fig 1E) was detected at low levels (~102) during the first week post-infection and gradually increased in the second week with peaks on day 10 for C3H/HeN and C57BL/6 (~104), and on day 14 for C3H/HeJ (~106).

Regarding survival, none of the 9–10 week old mouse strains injected with 108LiC reached the LD50: 57.1% of C3H/HeJ, 71.4% of C3H/HeN and 85.7% C57BL/6 survived at 14 days post-infection in comparison with 100% survival in each of the control groups (Fig 2). Differences are not statistically significant.

thumbnail
Fig 2. Probability of survival.

Male C3H/HeJ, C3H/HeN and C57BL/6 mice (n = 7/group) were inoculated IP with 108 L. interrogans serovar Copenhageni strain FioCruz L1-130 (LiC) and with PBS as control. The percentage of mice that met endpoint criteria for euthanasia before and at the term of two independent experiments is shown. Statistics by Log-rank (Mantel-Cox) test, p = 0.1088.

https://doi.org/10.1371/journal.pntd.0013163.g002

Burden and viability of L. interrogans serovar Copenhageni FioCruz in kidney tissue

To assess renal colonization by L. interrogans, kidney tissues from infected mice were collected on day 15 post-infection and analyzed for the presence of live Leptospira under a dark field microscope and for DNA quantification using qPCR. The bacterial burden was ~ 7.3 × 10⁴ Leptospira per mg of kidney tissue in C3H/HeJ, ~ 4.1 × 10⁴ in C3H/HeN, and ~5.4 × 10⁴ in C57BL/6 infected mice (Fig 3A). Differences between infected and control groups are significant, p < 0.001. Additionally, the viability of Leptospira was assessed by culturing kidney tissues in EMJH medium at 30°C for 4 days, visualizing live motile Leptospira under a dark field microscope and quantifying spirochetes using qPCR. On day 4 of culture, the average number of spirochetes per 100 μL of EMJH culture was ~ 4.3x103 for C3H/HeJ, ~ 3.1 × 10³ for C3H/HeN, and ~2.2 × 10³ for C57BL/6 mice. Differences between infected and control groups are significant, p < 0.05 (Fig 3B).

thumbnail
Fig 3. Burden and viability of Leptospira in kidney.

A) Kidney tissues were collected 2 weeks post-infection for qPCR analysis of the 16S rRNA gene; data from two independent experiments is shown; B) kidney was placed in culture to evaluate motility of L. interrogans under a dark field microscope on day 4, and qPCR was used to quantify Leptospira; data from one experiment is shown. Statistics by Mann-Whitney U test, *** p < 0.001 and * p < 0.05.

https://doi.org/10.1371/journal.pntd.0013163.g003

Inflammatory cytokines and signatures of fibrosis in kidney

To assess the upregulation of inflammatory cytokines critical for immune responses and fibrosis markers associated with kidney damage, kidney was collected from experimental mice on day 15 post-infection and processed for mRNA expression analysis of TNF-α, TGF- β1, IL-1β, IFN-γ, IL-6, IL-23, IL-17a, iNOS and ColA1 by RT-PCR using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the calibrator to normalize gene expression. Expression of TNF-α, IL-1β, IFN-γ, IL-6, IL-23, IL-17a were not different between infected and uninfected groups. The expression TGF- β1 mRNA, was upregulated in C3H/HeJ mice in comparison to uninfected control; however differences between the mouse strains were not significant (Fig 4A). In addition, mRNA of the fibrosis marker inducible Nitric Oxide Synthase (iNOS), was increased in C3H/HeJ, C3H/HeN and C57BL/6 in comparison to the respective controls; however differences between the mouse strains were not significant (Fig 4B). The mRNA expression of collagen A1 (ColA1) was elevated in both C3H/HeJ and C3H/HeN mice compared to the respective controls in contrast to C57BL/6, and differences between the mouse strains were significant (Fig 4C).

thumbnail
Fig 4. Inflammatory and fibrosis markers in kidney.

Kidney tissues collected 2 weeks post-infection were evaluated for mRNA expression analysis of 9 inflammatory markers by RT-PCR normalized against GAPDH. We show TGF-beta 1 (A), iNOS (B) and ColA1 (C) as these markers produced differences between the three mouse strains in two independent experiments. Statistics by Two-way ANOVA followed by Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.005, *** p < 0.0005, **** p < 0.0001.

https://doi.org/10.1371/journal.pntd.0013163.g004

Inflammatory markers circulating in serum

The concentration of chemokines CxCL1/KC/GRO-α, CxCL2/MIP-2, CCL5/RANTES and cytokines TNF-α, IL-1β, IFN-γ, IL-5, IL-6, IL-9, IL-10, IL-13, IL-17, IL-23 circulating in blood were measured in experimental animals on day 15 post-infection. Only one chemokine, CCL5/RANTES, was increased in infected C3H/HeJ in comparison to the respective uninfected control. None of the inflammatory markers tested were increased in serum from C3H/HeN or C57BL/6 two weeks post infection. Differences in CCL5/RANTES between C3H/HeJ and C3H/HeN, as well as C3H/HeJ and C57BL/6 were significant (Fig 5).

thumbnail
Fig 5. Inflammatory markers circulating in serum.

The concentration of 13 inflammatory markers was measured in serum from experimental mice collected 2 weeks post-infection. Shown is RANTES, the only chemokine detected. Data from one experiment is shown. Statistics by Two-way ANOVA followed by Tukey’s multiple comparisons test, *p < 0.05, ** p < 0.005, ***p < 0.0005.

https://doi.org/10.1371/journal.pntd.0013163.g005

Serological antibody responses

Terminal blood samples were collected 15 days post-infection to evaluate the levels of antibody production to L. interrogans (Fig 6). As expected, the three strains of infected mice produced increased levels of anti-Leptospira-specific IgM (Fig 6A) and total IgG (Fig 6B) compared to the respective uninfected controls; no differences were observed between the mouse strains. IgG isotyping produced the following results on d15 post-infection: IgG3 mirrored the total IgG profile for the three mouse strains (Fig 6C) and IgG1/IgG2a were not detected in infected C57BL/6 compared to the uninfected control (Fig 6D and 6E). IgG1 was increased in infected C3H/HeJ and C3H/HeN compared to the respective controls but differences between the C3H mouse strains were not significant (Fig 6D). IgG2a was only increased in infected C3H/HeN compared to the uninfected control, and differences between this strain and C3H/HeJ as well as C57BL/6 were significant (Fig 6E).

thumbnail
Fig 6. Antibody responses to Leptospira. L. interrogans serovar Copenhageni FioCruz specific IgM, IgG, IgG3, IgG1 and IgG2a were measured in serum from experimental mice by ELISA on day 15 post-infection.

Data from two independent experiments is shown. Statistics by Two-way ANOVA with uncorrected Fisher’s LSD test, * p < 0.05, *** p < 0.0005, **** p < 0.0001.

https://doi.org/10.1371/journal.pntd.0013163.g006

Discussion

We previously used the C3H/HeJ strain to develop a mouse model of experimental sublethal leptospirosis [17,27]. Since resistance to acute lethal infection with L. interrogans was associated with a functional tlr4 [25] and C3H/HeJ is hyporesponsive [26] to L. interrogans atypical LPS, there are valid concerns that this mouse model does not recapitulate a competent immune response to this spirochete. In this study, we did a side-by-side comparative analysis using three mouse strains (C3H/HeJ, C3H/HeN and C57BL/6). The two mouse strains with a functional tlr4 gene (C3H/HeN and C57BL/6) developed clinical and molecular signs of sublethal leptospirosis that were less pronounced but not significantly different than C3H/HeJ. Our data indicates that TLR4-competent C3H/HeN and C57BL/6 are appropriate mouse models of sublethal leptospirosis.

We found that weight loss differences between strains are more evident in C3H mice throughout the 15-day infection period (Fig 1). For a choice of animal models of disease, differences in weight loss in the C3H background produced clinical scores that may be easier to reproduce consistently. qPCR analysis of Leptospira 16S rRNA in blood, urine and kidney tissue showed no differences in the dynamics of L. interrogans dissemination between the three mouse strains, except for the load of Leptospira in blood which was higher in 9–10 week old C3H/HeJ (Figs 1 and 3). These data reproduce previous studies done using age/IP-dose matched C3H/HeJ [18] and C57BL/6 [28] mice.

There are numerous links between competent recognition of Leptospiral LPS by TLR4 and resistance to infection in mice [13,2225]. Our data shows that susceptibility to sublethal infection can be observed in 9–10 week old C3H/HeN and C57BL/6 mice, which express competent TLR4 (Figs 1 and 2). Nevertheless, our data also shows that C3H-HeJ, expressing a hyporesponsive tlr4, consistently produced larger metrics of disease progression. Of note, humans express a tlr4 molecule that does not sense the atypical Leptospira LPS [24]. One could therefore speculate that the C3H/HeJ mouse may recapitulate the human immune response to pathogenic Leptospira more closely than tlr4 competent mice. In another study we found that inoculation of potentially susceptible TLR4/MD-2 humanized transgenic mice with L. interrogans did not produce different measurements of disease progression or Leptospira dissemination than wildtype mice [28].This may have been related to the humanized transgenic mouse background being C57BL/6. Overall, the data suggests that although TLR4 plays a role in susceptibility to Leptospira infection, it is not the main determinant as other receptors in mammalian cells (ex. TLR2) likely compensate for deficient receptor binding.

We analysed mRNA expression of 9 inflammatory markers (TGF-β1, TNF-α, IL-1β, IFN-γ, IL-6, IL-23, IL-17a, iNOS and ColA1) in kidney of experimental mice at 15 days post infection (Fig 4). We found that C3H/HeJ had increased TGF-beta 1, iNOS and ColA1, C3H/HeN had increased iNOS and ColA1, and C57BL/6 has iNOS increased but not ColA1. When we compare the C3H/HeJ data with a previous study using age/IP-dose matched mice studies [18], normalized for markers tested in both studies, we find the iNOS and ColA1 data in agreement, but not TNF-α and IFN-γ. Similarly, when we compare the C57BL/6 data with a previous study using age/IP-dose matched mice [28] we find discrepancies in iNOS, ColA1 and TNF-α. These differences suggest that although expression markers of inflammation in kidney may be statistically different in the reported studies, it still raises a question of biological relevance and should be interpreted with caution.

Regarding inflammatory markers circulating in serum we tested for markers engaged in innate (CxCL1/KC/GRO-α, CxCL2/MIP-2, CCL5/RANTES, TNF-α, IL-1β) and adaptive Th1, Th2 and Th17 responses (IFN-γ, IL-5, IL-6, IL-9, IL-10, IL-13, IL-17, IL-23) and found that only CCL5/RANTES was increased in C3H/HeJ at day 15 post infection (Fig 5). CCL5/RANTES is a chemokine important for the recruitment of T cells, neutrophils and NK cells. In our previous studies using age/IP-dose matched C3H/HeJ, we found that CCL5/RANTES was increased in serum at 24h and 72h post sublethal infection [19]. Furthermore, CCL5/RANTES was found increased in kidney, spleen and blood of C57BL/6J mice at 72h post-infection with 108 L. interrogans serovar Manilae in a model of lethal leptospirosis [29]. Now looking at the human leptospirosis landscape on CCL5/RANTES, low levels of serologic CCL5/RANTES were found in patients with fatal leptospirosis [30] and CCL5/RANTES was the most increased chemokine found in serum of patients diagnosed with non-lethal leptospirosis associated with L. interrogans serovars Copenhageni and Icteroheamorrhagiae [31]. Overall, the data from Mus and Homo strongly suggests that CCL5/RANTES plays an important role in the immune response to L. interrogans infection. We will further characterize this chemokine in future analysis of inflammatory markers of lethal and sublethal leptospirosis.

While innate immune responses are the main immunological pathway for eliminating Leptospira, the humoral immune response plays a vital role in effectively eradicating the bacteria and expelling it from the host [32]. Our present observations (Fig 6) revealed that LiC infection led to an increase of Leptospira-specific IgM, IgG antibodies in the blood of the three mouse strains, which was expected [17,25,33,34]. IgG isotyping produced some interesting results for IgG3 and IgG1. IgG3, which is T-cell independent, was significantly increased in the three mouse strains and explains high total IgG for C57BL/6 in our study. Two weeks after infection, IgG1 was extremely low in C57BL/6, as observed by others [34], and significantly higher in C3H/HeJ and C3H/HeN. The production of IgG1 antibody in C3H mice suggests a Th2-biased engagement of the immune response at two weeks post infection, as shown in our previous studies in C3H/HeJ [17].

In conclusion, our data shows that C3H/HeN and C57BL/6 mice, both TLR4 competent strains, can be used to recapitulate sublethal leptospirosis as they produce unambiguous differences in clinical and molecular measurements of disease progression, Leptospira dissemination to tissues, colonization of kidney by live spirochetes and shedding in urine. Thus, competent recognition of L. interrogans serovar Copenhageni FioCruz factors by murine TLR4 does not determine susceptibility to disease. Each mouse strain has characteristics that can be leveraged in pursuit of knowledge on immunity and host response to pathogenic Leptospira species.

Materials and methods

Ethics Statement

All experiments with animals were performed in compliance with the University of Tennessee Health Science Center (UTHSC) Institutional Animal Care and Use Committee (IACUC), Protocol no. 22–0362.

Animals

Age matched 9–10 weeks, male C3H/HeJ, C3H/HeN, C57BL/6 mice were used. C3H/HeJ animals were purchased from The Jackson Laboratory (Bar Harbor); C3H/HeN and C57BL/6 were purchased from Charles River (Wilmington, MA) and maintained in specific pathogen-free at the Laboratory Animal Care Unit of the University of Tennessee Health Science Centre, with unrestricted access to food and water. Male mice were used because they are more susceptible to leptospirosis. Two independent experiments were done: the first was comprised of 6 groups of mice with 3 animals per group; the second, was comprised of 6 groups of mice with 4 animals per group; data from both experiments were combined for analysis.

Bacterial strains and culture

L. interrogans serovar Copenhageni strain Fiocruz L1-130 (henceforth LiC), frozen in -80°C, was passaged in hamster. Their kidneys were harvested and cultivated in 4mL of Hornsby-Alt-Nally (HAN) media [35] with 100 μg/mL 5-fluorouracil (MP Chemicals, CA) at 29°C for better growth. Passage 2 was done in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium supplemented with Difco Leptospira enrichment EMJH (Becton, MD) at 28–30°C. EMJH culture passage 2 was allowed to reach the log phase of growth, pelleted by centrifugation at 3,000 × g for 5 min, and washed and resuspended in sterile 1 × phosphate-buffered saline (PBS) (Thermo Fisher Scientific). Next, the cells were used to infect the animals after counted under a dark-field microscope (Zeiss USA, Hawthorne, NY) using a Petroff- Hausser chamber as previously described [27]. We found that recovering -80C frozen Leptospira in HAN media before passage in EMJH allowed for faster recovery of the culture.

Animal infection and collection of specimens

Mice were inoculated with 1 × 108 LiC in 200 μL of endotoxin-free 1 × PBS intraperitoneally (i.p.). Control mice were inoculated with the same volume of endotoxin-free 1 × PBS. Survival and body weight loss were monitored for 15 consecutive days post-infection. Mice were euthanized 15 days post-infection or when they reached the humane endpoint criteria (20% body weight loss). Blood, urine, and kidney were collected for further analysis. Immediately after the mice were restrained, the bladder was massaged, and Eppendorf tubes were used to collect the excreted urine.

Bacterial quantification

The NucleoSpin tissue kit (Clontech, Mountain View, CA) was used to purify genomic DNA from kidney, blood and urine following the manufacturer’s protocol, and the purified DNA was then stored at −20°C for further analysis. To quantify Leptospira, quantitative polymerase chain reaction (qPCR) was performed using Leptospira 16S rRNA primers (Forward: CCCGCGTCCGATTAG and Reverse: TCCATTGTGGCCGAACAC) and a TAMRA probe (CTCACCAAGGCGACGATCGGTAGC) obtained from Eurofins (Huntsville, AL). The results were reported as the number of Leptospira genome equivalents. The qPCR mixture consisted of 25 μM of each primer, 250 nM of the specific probe, and 2 μL of DNA sample, with a total volume of 20 μL. Duplicate reactions were performed. The amplification protocol included an initial step of 10 min at 95°C, followed by 40 cycles of amplification (15 s at 95°C and 1 min at 60°C). The analysis was conducted using the comparative threshold cycle (CT) method. A negative result was determined if no amplification occurred.

Measurement of Leptospira-specific antibody

Leptospira-specific antibody levels were measured using the enzyme-linked immunosorbent assay (ELISA). The process of preparing a leptospiral extract for LiC was followed as described [36]. Briefly, LiC was cultured in EMJH media until it reached optimal cell density. The bacterial cells were then separated by centrifugation to form a pellet. This pellet was subjected to incubation with BugBuster solution (1mL) at room temperature in a shaker (100 rpm) for 20 min and mixed thoroughly by vortexing. The resulting mixture was stored at -20°C. The whole cell extract of Leptospira was appropriately diluted in a sodium carbonate coating buffer with a concentration of 1X. A 96-well flat-bottom ELISA microtiter plate (Nunc-eBioscience) was coated overnight at 4oC with 100 µL 1X sodium carbonate coating buffer whole-cell extract of Leptospira (107–108 bacteria per well). After overnight incubation, the ELISA plate was washed with 1X PBST. The plate was blocked by a blocking buffer (100 µL/well) containing 1% BSA, followed by incubation for 1 h at 37oC. After washing, serum samples (1:100) was added, and the plate was incubated for 1 h at 37oC. The unbound primary antibody was removed by vigorous washing. Next, anti-mouse secondary antibodies for IgM IgG, IgG3, IgG1 or IgG2a (all from Cell signaling technology, CST) conjugated with horseradish peroxidase was added, which was incubated for 30 min, followed by standard color development using TMB Sureblue. Absorbance measurement was carried out at OD 450 nm using Molecular Devices Spetramax.

Expression of inflammatory and fibrosis markers

Total RNA was extracted using the RNeasy Mini Kit (QIAGEN) from kidney according to the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from the extracted RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The resulting first-strand cDNA served as the template for reverse transcription PCR (RT-qPCR), which was performed on a QuantStudio 3 Real-Time PCR (Applied Biosystems) using the PowerTrack SYBR Green Master Mix (Applied Biosystems). Each RT-qPCR reaction (10 μL total volume) included the cDNA template and specific primers. The cycling conditions were as follows: an initial step at 50°C for 2 minutes, followed by denaturation at 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 sec for denaturation, and 60°C for 1 min for annealing/extension. A melt curve analysis was conducted at the end of the amplification to confirm the specificity of the PCR products. Relative gene expression levels across samples were quantified by the double delta Ct (2-∆∆Ct) method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the endogenous reference control. The primer sequences used are listed in S1 Table in the Source Data file.

Measurement of chemokines and cytokines in blood

Serum from experimental mice was derived from blood collected after euthanasia on day 15 post-infection and frozen at -80C. Analysis of circulating chemokines and cytokines was done using ProcartaPlex Multiplex Immunoassay (eBioscience) according to the manufacturer’s instructions. The data were acquired using a Luminex 200 reader. The concentrations of each inflammatory marker were determined based on a standard curve.

Statistical analysis

For the exploratory animal research described in this study, we used the “resource equation” approach to calculate sample size. Based on this approach, the acceptable range of degrees of freedom (DF) for the error term in an analysis of variance (ANOVA) is between 10–20 animals [37]. This method allows for determination of the minimum number of animals to produce significant results. We used GraphPad Prism 10 software. For analysis of weight loss (Fig 1) we used Ordinary 2-Way ANOVA; for survival (Fig 2) we used Mantel-Cox Log rank test; for burden and viability of LiC (Fig 3) we used Mann-Whitney U test; for analysis of inflammatory markers (Figs 4, and 5) we used Two-way ANOVA with Tukey’s multiple comparison test; for analysis of antibody class and IgG isotypes (Fig 6) we used Two-Way ANOVA with uncorrected Fisher’s LSD.

Supporting information

S1 Table. Excel file containing the source data used in all figures, and S1 Table containing a list of primers for inflammatory and fibrosis markers.

https://doi.org/10.1371/journal.pntd.0013163.s001

(XLSX)

References

  1. 1. Costa F, Hagan JE, Calcagno J, Kane M, Torgerson P, Martinez-Silveira MS, et al. Global Morbidity and Mortality of Leptospirosis: A Systematic Review. PLoS Negl Trop Dis. 2015;9(9):e0003898. pmid:26379143
  2. 2. Haake DA, Levett PN. Leptospirosis in humans. Curr Top Microbiol Immunol. 2015;387:65–97. pmid:25388133
  3. 3. McBride AJ, Athanazio DA, Reis MG, Ko AI. Leptospirosis. Current Opinion in Infectious Diseases. 2005;18(5):376–86.
  4. 4. Silva EF, Santos CS, Athanazio DA, Seyffert N, Seixas FK, Cerqueira GM, et al. Characterization of virulence of Leptospira isolates in a hamster model. Vaccine. 2008;26(31):3892–6. pmid:18547690
  5. 5. Lehmann JS, Matthias MA, Vinetz JM, Fouts DE. Leptospiral pathogenomics. Pathogens. 2014;3(2):280–308. pmid:25437801
  6. 6. Philip N, Jani J, Azhari NN, Sekawi Z, Neela VK. In vivo and in silico Virulence Analysis of Leptospira Species Isolated From Environments and Rodents in Leptospirosis Outbreak Areas in Malaysia. Front Microbiol. 2021;12:753328. pmid:34803975
  7. 7. Giraud-Gatineau A, Nieves C, Harrison LB, Benaroudj N, Veyrier FJ, Picardeau M. Evolutionary insights into the emergence of virulent Leptospira spirochetes. PLoS Pathog. 2024;20(7):e1012161. pmid:39018329
  8. 8. van den Ingh TS, Hartman EG. Pathology of acute Leptospira interrogans serotype icterohaemorrhagiae infection in the Syrian hamster. Vet Microbiol. 1986;12(4):367–76. pmid:3538643
  9. 9. Miyahara S, Saito M, Kanemaru T, Villanueva SYAM, Gloriani NG, Yoshida S. Destruction of the hepatocyte junction by intercellular invasion of Leptospira causes jaundice in a hamster model of Weil’s disease. Int J Exp Pathol. 2014;95(4):271–81. pmid:24945433
  10. 10. Bonilla-Santiago R, Nally JE. Rat model of chronic leptospirosis. Curr Protoc Microbiol. 2011;Chapter 12:Unit 12E.3. pmid:21400676
  11. 11. Gomes-Solecki M, Santecchia I, Werts C. Animal Models of Leptospirosis: Of Mice and Hamsters. Front Immunol. 2017;8:58. pmid:28270811
  12. 12. Nally JE, Fishbein MC, Blanco DR, Lovett MA. Lethal infection of C3H/HeJ and C3H/SCID mice with an isolate of Leptospira interrogans serovar copenhageni. Infect Immun. 2005;73(10):7014–7. pmid:16177383
  13. 13. Santos CS, Macedo JO, Bandeira M, Chagas-Junior AD, McBride AJA, McBride FWC, et al. Different outcomes of experimental leptospiral infection in mouse strains with distinct genotypes. J Med Microbiol. 2010;59(Pt 9):1101–6. pmid:20558584
  14. 14. Ratet G, Veyrier FJ, Fanton d’Andon M, Kammerscheit X, Nicola M-A, Picardeau M, et al. Live imaging of bioluminescent leptospira interrogans in mice reveals renal colonization as a stealth escape from the blood defenses and antibiotics. PLoS Negl Trop Dis. 2014;8(12):e3359. pmid:25474719
  15. 15. Pereira MM, Andrade J, Marchevsky RS, Ribeiro dos Santos R. Morphological characterization of lung and kidney lesions in C3H/HeJ mice infected with Leptospira interrogans serovar icterohaemorrhagiae: defect of CD4+ and CD8+ T-cells are prognosticators of the disease progression. Exp Toxicol Pathol. 1998;50(3):191–8. pmid:9681649
  16. 16. Viriyakosol S, Matthias MA, Swancutt MA, Kirkland TN, Vinetz JM. Toll-like receptor 4 protects against lethal Leptospira interrogans serovar icterohaemorrhagiae infection and contributes to in vivo control of leptospiral burden. Infect Immun. 2006;74(2):887–95. pmid:16428731
  17. 17. Richer L, Potula H-H, Melo R, Vieira A, Gomes-Solecki M. Mouse model for sublethal Leptospira interrogans infection. Infect Immun. 2015;83(12):4693–700. pmid:26416909
  18. 18. Nair N, Guedes MS, Werts C, Gomes-Solecki M. The route of infection with Leptospira interrogans serovar Copenhageni affects the kinetics of bacterial dissemination and kidney colonization. PLoS Negl Trop Dis. 2020;14(1):e0007950. pmid:31905198
  19. 19. Shetty A, Kundu S, Gomes-Solecki M. Inflammatory Signatures of Pathogenic and Non-Pathogenic Leptospira Infection in Susceptible C3H-HeJ Mice. Front Cell Infect Microbiol. 2021;11:677999. pmid:34249775
  20. 20. Kundu S, Shetty A, Gomes-Solecki M. Necroptosis Contributes to Persistent Inflammation During Acute Leptospirosis. Front Immunol. 2022;13:810834. pmid:35392072
  21. 21. Kundu S, Shetty A, Gomes-Solecki M. Exposure to live saprophytic Leptospira before challenge with a pathogenic serovar prevents severe leptospirosis and promotes kidney homeostasis. Elife. 2024;13:RP96470. pmid:39527098
  22. 22. Werts C, Tapping RI, Mathison JC, Chuang TH, Kravchenko V, Saint Girons I, et al. Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol. 2001;2(4):346–52. pmid:11276206
  23. 23. Que-Gewirth NLS, Ribeiro AA, Kalb SR, Cotter RJ, Bulach DM, Adler B, et al. A methylated phosphate group and four amide-linked acyl chains in leptospira interrogans lipid A. The membrane anchor of an unusual lipopolysaccharide that activates TLR2. J Biol Chem. 2004;279(24):25420–9. pmid:15044492
  24. 24. Nahori M-A, Fournié-Amazouz E, Que-Gewirth NS, Balloy V, Chignard M, Raetz CRH, et al. Differential TLR recognition of leptospiral lipid A and lipopolysaccharide in murine and human cells. J Immunol. 2005;175(9):6022–31. pmid:16237097
  25. 25. Chassin C, Picardeau M, Goujon J-M, Bourhy P, Quellard N, Darche S, et al. TLR4- and TLR2-mediated B cell responses control the clearance of the bacterial pathogen, Leptospira interrogans. J Immunol. 2009;183(4):2669–77. pmid:19635914
  26. 26. Qureshi ST, Larivière L, Leveque G, Clermont S, Moore KJ, Gros P, et al. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J Exp Med. 1999;189(4):615–25. pmid:9989976
  27. 27. Nair N, Gomes-Solecki M. A Mouse Model of Sublethal Leptospirosis: Protocols for Infection with Leptospira Through Natural Transmission Routes, for Monitoring Clinical and Molecular Scores of Disease, and for Evaluation of the Host Immune Response. Curr Protoc Microbiol. 2020;59(1):e127. pmid:33141517
  28. 28. Nair N, Guedes MS, Hajjar AM, Werts C, Gomes-Solecki M. Role of TLR4 in Persistent Leptospira interrogans Infection: A Comparative In Vivo Study in Mice. Front Immunol. 2021;11:572999. pmid:33519799
  29. 29. Papadopoulos S, Hardy D, Vernel-Pauillac F, Tichit M, Boneca IG, Werts C. Myocarditis and neutrophil-mediated vascular leakage but not cytokine storm associated with fatal murine leptospirosis. EBioMedicine. 2025;112:105571. pmid:39889371
  30. 30. Lindow JC, Wunder Jr EA, Popper SJ, Min J-N, Mannam P, Srivastava A, et al. Cathelicidin Insufficiency in Patients with Fatal Leptospirosis. PLoS Pathog. 2016;12(11):e1005943. pmid:27812211
  31. 31. Mariano IH de M, Blanco RM, de Souza CE, de Freitas GS, Ho PL, Martins EAL, et al. Chemokine profile in the serum of patients with leptospirosis. Front Cell Infect Microbiol. 2024;14:1484291. pmid:39534703
  32. 32. Vernel-Pauillac F, Werts C. Recent findings related to immune responses against leptospirosis and novel strategies to prevent infection. Microbes Infect. 2018;20(9–10):578–88. pmid:29452258
  33. 33. Krangvichian P, Nakornpakdee Y, Sangjun N, Komanee P, Techawiwattanaboon T, Patarakul K. Sublethal infection of C3H/HeNJ against Leptospira interrogans serovar Pomona. Acta Trop. 2023;238:106701. pmid:36216095
  34. 34. Vernel-Pauillac F, Murray GL, Adler B, Boneca IG, Werts C. Anti-Leptospira immunoglobulin profiling in mice reveals strain specific IgG and persistent IgM responses associated with virulence and renal colonization. PLoS Negl Trop Dis. 2021;15(3):e0008970. pmid:33705392
  35. 35. Hornsby RL, Alt DP, Nally JE. Isolation and propagation of leptospires at 37 °C directly from the mammalian host. Sci Rep. 2020;10(1):9620. pmid:32541841
  36. 36. Fortes-Gabriel E, Guedes MS, Shetty A, Gomes CK, Carreira T, Vieira ML, et al. Enzyme immunoassays (EIA) for serodiagnosis of human leptospirosis: specific IgG3/IgG1 isotyping may further inform diagnosis of acute disease. PLoS Negl Trop Dis. 2022;16(2):e0010241. pmid:35196321
  37. 37. Arifin WN, Zahiruddin WM. Sample Size Calculation in Animal Studies Using Resource Equation Approach. Malays J Med Sci. 2017;24(5):101–5. pmid:29386977