https://orcid.org/0000-0003-4714-1006
Figures
Abstract
Babanki virus (BBKV), an alphavirus belonging to the Western Equine Encephalitis antigenic complex, was first isolated from Mansonia africana mosquitoes in 1969 but remains poorly characterized. Transmitted to humans and animals through the bite of an infectious female mosquito, it is associated with febrile illness, rash, and arthritis, similarly to its close relative Sindbis virus. No specific treatment or vaccine is currently available. Here, we experimentally assessed the vector competence of mosquito species from tropical and temperate regions under ecologically relevant temperature conditions. Using a BBKV molecular clone, individual midguts, salivary glands, legs, and saliva samples were collected at different time points to assess infection, dissemination, and transmission dynamics in Aedes (Aedes albopictus from Nice and Réunion Island, and Aedes aegypti) and Culex (Culex pipiens molestus from Paris and Culex quinquefasciatus) mosquitoes. We show that BBKV efficiently infects and disseminates in all tested species, with Aedes mosquitoes exhibiting higher infection rates (>70%) compared to Culex species. Importantly, infectious viral particles were detected in mosquito saliva, confirming transmission potential. Viral replication persisted over time and was supported by both RNA quantification and infectious virus titration. Overall, our results show that multiple mosquito species from both temperate and tropical regions are competent vectors for BBKV, highlighting a significant emergence potential.
Author summary
Babanki virus (BBKV) is a non-characterized arbovirus identified in 1969 in Cameroon. BBKV is closely related to Sindbis virus which causes symptoms like febrile illness, rash, and arthritis in humans and animals. Both are alphaviruses within the Western Equine Encephalitis complex. BBKV is identified only in the African continent so far. Despite its potential to cause disease, no effective treatments are available. This study investigates the vector competence of various mosquito species from temperate and tropical regions, to transmit BBKV. After mosquitoes were fed an infectious blood meal, various organs were collected at different time points to assess the infection status, viral replication, and infectiousness. The results showed that BBKV infection occurred in all tested mosquito species and persisted over time, with viral particles detected in mosquito or that can potentially be transmitted to vertebrate hosts via mosquito saliva. These findings highlight the broad vector competence of mosquitoes from diverse climatic regions for BBKV, indicating its potential risk for emergence and outbreaks in different regions of the world. The study emphasizes the need for enhanced surveillance and preventive measures to mitigate the potential threat posed by this emerging virus.
Citation: Ban M, Geolier V, Perthame E, Ferquel E, Faye M, Diagne MM, et al. (2026) Vector competence of temperate and tropical mosquito species for Babanki virus. PLoS Negl Trop Dis 20(8): e0013051. https://doi.org/10.1371/journal.pntd.0013051
Editor: Abdallah M. Samy, Faculty of Science, Ain Shams University (ASU), EGYPT
Received: May 6, 2025; Accepted: July 19, 2026; Published: August 24, 2026
Copyright: © 2026 Ban et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All data are in the manuscript and/or Supporting information files.
Funding: MB received a doctoral fellowship from Calmette Yersin fund of the International Direction of Institut Pasteur and CAS-TWAS PhD President’s Fellowship Programme VC received some funding from Institut Pasteur DL received the following fundings: MOST National Key R&D Program of China (2018ZX10101004, 2021YFC2300201), National Natural Science Foundation of China (31870153), Ministry of Science and Technology of China (2020YFC0845900), CAS president’s international fellowship initiative (2020VBA0023), Shanghai Municipal Science and Technology Major Project (20431900402; 201409003400), Grants from National Science and Technology Major Project (2018ZX10101004003001). The funders did not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Alphaviruses are globally distributed, inhabiting all continents except Antarctica [1]. They are maintained in complex transmission cycles involving hematophagous arthropod vectors and a wide range of vertebrate hosts. Their host spectrum is remarkably broad, encompassing humans, non-human primates, horses, birds, amphibians, reptiles, rodents, pigs, marine mammals, and even salmonids. Based on their geographical distribution and associated clinical manifestations, alphaviruses are traditionally divided into Old World and New World groups [2]. New World alphaviruses, such as Venezuelan, Western, and Eastern equine encephalitis viruses, are primarily associated with encephalitic disease. In contrast, Old World alphaviruses,including Semliki Forest virus, Sindbis virus (SINV), Ross River virus (RRV), and Chikungunya virus (CHIKV),are generally associated with febrile and arthritogenic syndromes. Notably, SINV represents an exception to this dichotomy: although geographically restricted to the Old World, it phylogenetically clusters within the Western Equine Encephalitis (WEE) complex and can cause both encephalitic and arthritogenic disease [3,4].
Babanki virus (BBKV), a member of the WEE complex, is closely related to SINV [5]. Like other members of the Togaviridae family, BBKV is an enveloped virus with an icosahedral capsid and a positive-sense single-stranded RNA genome of approximately 11.7 kb encoding structural and non-structural proteins [6]. Multiple lines of evidence highlight its close evolutionary relationship with SINV. The BBKV Y-251 strain differs from the SINV prototype AR339 by only a limited number of amino acid substitutions and clusters within the African genotype I lineage of SINV, alongside isolates from South Africa and Uganda [7]. Consistently, recent sequence comparisons revealed very high nucleotide identity (up to 99.2%) between SINV isolates and BBKV strains [7,8]. Based on full genome analyses, BBKV has therefore been classified as a subtype of SINV within the WEE antigenic complex [9], underscoring their strong phylogenetic and evolutionary proximity.
Consistent with this genetic relatedness, BBKV also exhibits a broad ecological distribution. The virus was first isolated in 1969 from a pool of 55 adult Mansonia africana mosquitoes collected using human bait near Raphia palm trees in the Bambalang and Babanki regions of Cameroon [8], and subsequently amplified through intracerebral inoculation in newborn mice (Arbovirus Catalogue, Center for Disease Control - ArboCat, CDC). Since then, BBKV has been detected in multiple mosquito genera, including Anopheles, Aedes, Culex, Eretmapodites, Coquillettidia, and Mansonia, across sub-Saharan Africa and Madagascar [9–14]. In addition to entomological findings, BBKV has been isolated from humans in Senegal, Cameroon, Madagascar, and the Central African Republic [7,9], and neutralizing antibodies have recently been detected in bats in Uganda, further supporting its circulation in diverse vertebrate hosts [15]. Clinically, BBKV infection has been associated with febrile illness accompanied by rash and arthralgia [12]. Its detection across a wide geographic range, from West to East Africa, and its reported association with both mosquito and tick vectors (ArboCat, CDC), further highlight its potential for geographic expansion and emergence.
Despite this documented circulation across multiple vectors and hosts, the transmission dynamics and vector competence of BBKV remain poorly characterized. This represents a critical gap, particularly given its close phylogenetic relationship with SINV and its broad ecological distribution. Understanding its ability to infect, disseminate within, and be transmitted by mosquito vectors is essential for evaluating its emergence potential.
To address this, we assessed the vector competence of multiple Aedes and Culex species originating from both tropical and temperate regions, maintained under temperature conditions reflecting their natural environments. By comparing their ability to become infected, support viral dissemination, and transmit infectious particles, we aimed to determine whether BBKV can be efficiently transmitted across diverse ecological settings and to identify the most competent vector species within each climatic context.
Methods
Ethics statement
The blood meal feeding on living animals is approved by the ethics committee of Institut Pasteur C2EA n°89 under the agreement 2014-0068.
Cells.
VeroE6 cells (African green monkey epithelial cells) were maintained in culture with Dulbecco’s Modified Eagle Medium (DMEM) 1X + GlutaMAX (ref. 3166-021, Life Technologies) supplemented with 10% of heat-inactivated fetal bovine serum (FBS) (ref. A15-701, lot A70108-2369, PAA) and 1% of Penicillin-Streptomycin (P/S) (ref. 15140-122, Life Technologies) at 37°C with 5% CO2. C6/36 Ae. albopictus cells were cultured in Leibovitz’s L15 medium 1X (ref. 11415-049, Life Technologies) with 10% FBS and 1% P/S at 28°C without CO2.
Viral sequence.
The full length ARY168 11 724 bp DNA sequence was generated from a virus isolated from Cx. decens mosquito species (Yaoundé, Cameroon 1970] by Institut Pasteur of Dakar.
Mapping of ARY168 sequence.
Snapgene software was used to find open reading frames (ORF). Non-structural and structural proteins were determined based on the sequence alignment analyses with annotated reference sequences (BBKV HM147984.1 and SINV NC_001547.1) on Ugene.
Identification of predicted E. coli promoter sequences within BBKV genome ARY168.
The Neutral Network Promoter Prediction (NNPP) from the Berkeley Drosophila Genome Project (https://www.fruitfly.org/seq_tools/promoter.html) was used to identify predicted E. coli promotors (ECPs) sequences for cryptic expression of viral protein.
Add-ons.
A T7 promotor sequence was added at the 5’ UTR. A termination sequence including a hepatitis delta virus (HDV) antigenomic ribozyme and a simian virus (SV 40) polyadenylation signal (pA) (SV40pA) was placed at the 3’ UTR.
Fragmentation.
Mutated added-on BBKV sequence was divided into 4 fragments with a pace of approximately 3.000 nt framed by unique restriction sites.
Plasmid.
High copy number plasmid with ampicillin resistance gene pUC18 was chose for cloning. The initial multiple cloning site (MCS) of pUC18 was changed to ClaI-SpeI-PsiI-XhoI and NotI (32 nt) to a final pUC18_MSC_BBKV plasmid. To this aim, small oligos were hybridized at 95°C for 5 min and then cooled to room temperature. After purification, hybridized DNA was ligated to the open pUC18 plasmid with T4 ligase (ref. M0202, NEB).
Cloning.
The 4 synthetics genes were cloned into the pUC18_MSC_BBKV using both T4 ligase (ref. M020, NEB) or the recombinases In-Fusion HD Cloning Kit (ref. 638910, Takara)/Ezmax One-Step Cloning Kit (ref. 24303-2, Tolobio) strategies. Cloned plasmids were transformed into Top10 or JM110 competent bacteria. Mini cultures with DNA extraction were performed prior to maxi cultures and DNA extraction. Molecular clone was double checked by digestion restriction and by sequencing with BioSun company (China).
In vitro transcription.
Full length BBKV molecular clone DNA was linearized with NotI. After extraction with phenol-chloroform, Linear DNA was precipitated with ethanol and dissolved in RNAse free water. The in vitro transcription was achieved using mMESSAGE mMACHINE T7 (ref. AM1344, Invitrogen) kit following the manufacturer’s instructions. The transcript mRNA was precipitated by LiCl solution. RNA transcript was checked by electrophoresis and quantified.
Electroporation.
10 μg of full-length in vitro transcribed BBKV mRNA was electroporated into VeroE6 cells using the GenePulser XCell electroporation system (Bio-Rad) with 4 mm cuvettes and the following setting: 270V, 975 μF, ∞ Ω, 4 mm, 1 pulse. Cells were incubated at 37°C with 5% CO2 in a BSL-3 facility. After 4 hours post-electroporation, the cell's supernatant was removed and replaced with 2% FBS fresh cells media. The culture supernatant was collected 30h post electroporation when cytopathic effect (CPE) was observed, clarified by centrifugation, and re-amplified by infection of fresh VeroE6 or C6/36 cells. Cultured supernatant was harvested when CPE were present around 30 hours post amplification), clarified by centrifugation, aliquoted and stored at -80°C.
Titration by plaque assay.
The produced virus was 10-fold diluted until 10-10. VeroE6 cells at 90% confluence were infected with 200 μL of virus dilutions in DMEM supplemented with 2% of FBS in the BSL-3 environment. After 1 hour, the inoculum was removed and replaced with 2% final concentration carboxymethyl cellulose (CMC) with DMEM and 2% FBS 1% P/S media. After 24 hours at 37°C with 5% CO2, cells were washed from the CMC polymer mix with PBS and fixed with a 4% PFA solution during 30 min. After washing the PFA with PBS, the plate was stained with crystal violet 0.1% solution. Plaque per dilution were counted to compute the viral titer that is expressed as plaque forming unit per ml (pfu/ml). Viral stocks were generated from the molecular clone in both insect and mammalian cells. The stock produced in insect cells was selected for the experiments, based on previous findings showing that SINV produced in insect cells is more infectious for mosquitoes [16].
Antibodies.
Noncommercial mouse polyclonal antibodies against SINV were used as primary antibodies. Mouse polyclonal antibodies against Ae. aegypti, Ae. albopictus and Cx. pipiens salivary glands proteins were used as primary antibodies.
Calnexin polyclonal antibody purified from rabbit serum (ADI-SPA-865, Enzo Life Sciences) was used as a primary antibody to detect housekeeping genes in mammals.
Both Goat anti-Mouse IgG (H + L) HRP conjugated (Cat#172-6516 Bio-Rad) and Goat anti- Rabbit (Cat#172-6515 Bio-Rad) were used as a secondary antibody for chemiluminescence. For fluorescent microscopy, Alexa Fluor 488 AffiniPure Goat anti-mousse IgG (H + L) Jackson ImmunoResearch (ref. 115-545-003) was used.
Mosquitoes strain.
Aedes aegypti (PAEA) strain is a laboratory colony (more than 400 lab- generations) isolated in 1960 in French Polynesia. Aedes albopictus Nice strain was collected in Nice, South of France in 2011. Aedes albopictus Saint-Benoît strain was collected in Saint-Benoît, Réunion Island in the Pacific Ocean in 2012. Culex pipiens molestus Paris strain was collected in Paris in 2017. For the remainder of the manuscript, this population will be referred to as Cx. pipiens Paris. Culex quinquefasciatus (Slab strain) was kindly donated by Mylène Weill from the Institute of Evolution Sciences of Montpellier (ISEM) (University of Montpellier, CNRS, IRD, EPHE, CIRAD, INRAP).
Mosquito breeding.
From the egg to the female adult for blood meal, it takes around 4 weeks. Every stage of the mosquito development takes place in a room at 27°C, 70% of relative humidity with a 12-hour photoperiodicity. Aedes eggs are stored on dry blotting forest green paper up to 3 months whereas Culex eggs cannot be stored. Mosquito eggs are put in 2 L of non-limestone water with cats and fish dry food. Depending on the species, dry brewer’s yeast can be added to boost the development. Larvae from stage 1 to 3 are reared in the same condition in netted- covered flat bucket. Pupae are sorted and placed in a netted cage before emergence. Adult male emergence happens few days before the female one. Adult mosquitoes are fed ad libitum on 10% sucrose solution. Two blood meals at 3 days apart are necessary for the females to lay eggs on water (Culex) or blotting paper (Aedes). For this purpose, mice are anesthetized with an injectable solution of ketamine/xylazine mix and ventral sided placed on the top of the netted cage for 20 min.
Exposure to infectious blood meals.
Week-old female mosquitoes were sorted and starved 24 hours prior to the infectious blood meal. On the infection’s day, fresh rabbit blood was collected on pre-heparinized 15 mL tubes and washed 3 times with PBS. The infectious blood meal was constituted in the BSL-3 facility and consists in one third of viral suspension (final concentration of 1.108 PFU/mL), two thirds of rabbit erythrocytes and adenosine triphosphate (ATP) as a phagostimulant to a final concentration of 10 mM. Aedes species were allowed to feed for 20 minutes through a collagen membrane (Ae. aegypti) or swine intestine (Ae. albopictus) covering electric feeders maintained at 37°C (Hemotek system). Culex species were allowed to feed for 30 minutes directly on blood-soaked cotton at 37°C in an incubator with 5% CO2 and without light. After feeding, mosquitoes are anesthetized at 4°C. Blood-fed female mosquitoes are selected on ice and transferred into netted-cardboard boxes with ad libitum 10% sucrose solution and kept in an incubator. After infection, incubation parameters were chosen according to environmental condition of each mosquito species in nature with 80% of humidity and a 12-hour photoperiodicity incubator for a maximum duration of 14-days. Temperature of 28°C was used for tropical mosquito species such as Cx. quinquefasciatus, Ae. aegypti and Ae. albopictus St-Benoit. Other mosquito species such as Cx. pipiens molestus Paris strain, Ae. albopictus Nice are considered temperate and were incubated at 24°C.
Mosquito sample dissections.
In the BSL-3 facility, mosquitoes were anesthetized on ice at 7- and 14 days after the infectious blood meal exposition. They went through a 70% ethanol bath and a PBS one. They were dissected in a drop of PBS under a magnifying glass with micro dissecting needles and micro dissecting needle holders (Fine Science Tools, Foster City, USA) and tweezers (#11252-23, Dumont tweezer - Style 5 - Dumoxel). For RNA extraction, midguts, legs and salivary glands were collected from the same mosquito and separately homogenized in 350 μL of RA1 lysis buffer from Nucleospin RNA kit (ref. 740955.50 Macherey-Nagel) with 1% of 𝛽-Mercaptoethanol (M6250, Sigma-Aldrich) and sterile glass beads (ref. 152018, Dutscher) and then stored at -80°C. For infectious particles quantification, midguts and salivary glands were collected from the same mosquito and separately homogenized in 500 μL of DMEM 2% FBS 1% P/S and 1X Antibiotics (ATB)/Antifungal (ATF). Homogenization was performed by the Precellys system (Bertin Technologies) at 10 000 x g 15 sec twice with a 10 sec break and kept at -80°C. For viral proteins detection, midguts and salivary glands from the same mosquito were collected and individually stored in 10 μL of RIPA 2X buffer (ref. RB4476, BioBasic Canada) at -20°C.
Saliva sample collection.
Legs from mosquitoes were first removed. Then, the mosquito proboscis was inserted in 10 μL tips pre-filled with PBS. From this saliva collection per mosquito, the sample is split in three. Saliva samples for RNA extraction were lysed in 100 μL of RA1 lysis buffer and 2 μL of reducing agent TCEP (Tris(2-carboxyethyl) phosphine) from Nucleospin RNA XS kit (ref. 740902.50 Macherey-Nagel). Samples for viral protein detection were mixed with a 1:1 ratio of RIPA 2X buffer (ref. RB4476, BioBasic Canada) and kept at -20°C. The remaining volume was used with DMEM 2% FBS 1% P/S and 1X ATB/ATF for quantification of infectious particles.
Viral RNA quantification by RT-qPCR analysis.
RNA extraction. After lysis, total RNA was extracted using the Nucleospin RNA kit (ref. 740955.50 – Macherey-Nagel) following manufacturer’s instructions. Reverse transcriptase (RT) and quantitative PCR (qPCR). Viral RNA quantification was performed using 2 μL of extract RNA with the Power SYBR Green RNA-to-CTTM 1- Step Kit (ref. 4389986, ThermoFisher Scientific) following the manufacturer’s instructions. Specific primers were used to amplify the viral RNA nsp2-Forward: AAGCGATGCGTTAAGAAGGA and nsp2-Reverse: ACTTGATGATAGCTGACTTGCC.
The QuantStudio 6 Flex Real-Time PCR System (Applied Biosystem) monitors the fluorescent signal produced by the SYBR Green which binds double-stranded DNA. The thermal cycling condition are: reverse transcription for 30 min at 48°C; 10 min at 95°C and then 40 cycles of 15 sec at 95°C followed by 1 min at 60°C. Quantity of RNA copies per mL of sample was extrapolated from the standard curve generated from the 10-fold serial dilution of the in vitro transcript mRNA previously quantified by the ND-1000 Spectrophotometer (Thermos Fisher Scientific).
Viral protein detection by Western Blot.
After thawing, midguts and salivary glands samples collected in RIPA buffer were centrifuged at maximum speed during 5min at 4°C. Then samples were denatured in 1X NuPage LDS Buffer (ref. NP0008, ThermoFisher Scientific) during 5 min at 95°C and loaded to a precast Nu-Page 4–12% Bis-Tris Gel (ref. NP0322BOX, ThermoFisher Scientific). Proteins were separated by electrophoresis at 60 mA and transferred thanks to a Trans-Blot Turbo Mini PVDF Transfer Packs (ref. 1704156, Bio-Rad) with the Trans-Blot Turbo System (Bio-Rad).
Viral protein detection by Dot blot.
An Immuno-blot PVDF membrane (ref. 1620177; Bio-Rad) was activated by submerging it in 100% ethanol and rinse it with PBS. Then, we applied 2 μL of each saliva sample in the RIPA buffer in one square. The blot was then air-dried for 5–10 min. After blocking with PBS – Tween 20 0.1% (ref. P7949, Sigma Aldrich) - Skim Milk 5% (ref. 232100, BD) during 1 hour at room temperature under agitation, the PVDF membrane was incubated overnight at 4°C with primary antibody diluted in blocking buffer under agitation. Finally, the membrane was incubated with the secondary antibody diluted in the blocking buffer during 1 hour at RT under agitation. Proteins were revealed using Pierce ECL Western Blotting Substrate (ref. 32106, ThermoFisher Scientific) and MyECL Imager (ThermoFisher Scientific).
Results interpretation.
To determine vector competence of each mosquito species, infection, dissemination and transmission rates are computed according to the titration by plaque assay results (from the midguts and salivary glands in DMEM buffer) and the following formulas [17]:
Biostatistical analysis
Differences in infection and engorgement rates among mosquito species were initially evaluated using a Chi-square test. When the overall test was significant (p < 0.05), pairwise Chi-square tests for comparisons between species were conducted. P-values were adjusted for multiple comparisons using the Bonferroni correction.
Statistical analyses on RT-qPCR and titration results were computed using Simstat software (v.2.5.8). Nonparametric Krustal-Wallis and Mann Whitney tests were used to test differences between groups. P-values were adjusted for multiple comparisons when appropriate (Tukey’s range test).
Mosquito species were maintained under temperature conditions reflecting their natural ecological environments. Therefore, comparisons between species are intended to reflect their relative performance within their ecological niches rather than direct comparisons under standardized laboratory conditions.
Results
Infectious molecular clone construction
To reduce experimental variability and enable controlled comparisons, we generated a molecular clone of BBKV. Molecular clones have proven highly valuable in alphavirus research, as demonstrated for virus and CHIKV [18,19]. The BBKV clone developed here provides a robust and reproducible tool for infection studies and establishes a foundation for future molecular systems—such as replicons, pseudoparticles, or virus-like particles—to investigate viral tropism and other biological properties.
Identification of predictive E. coli promoter sequences within BBKV genome ARY168
The full-length genome BBKV ARY168 sequence was kindly provided by IP Dakar. Non-structural and structural proteins were determined on the 2 open reading frames (ORF) based on the sequence alignment analyses with annotated reference sequences (BBKV HM147984.1 and SINV NC_001547.1) on Ugene. Based on the previous work done for Yellow fever and Japanese encephalitis viruses by the team of Pu et al. [20], putative predicted ECPs sequences for cryptic expression of viral protein were found using the NNPP from the Berkeley Drosophila Genome Project (https://www.fruitfly.org/seq_tools/promoter.html). In total, 14 putative predicted ECPs with a score higher than 0.9 were identified for the BBKV genome ARY168 sequence represented in Table 1.
Predicted ECPs found for ARY168 using the NNPP from the Berkeley Drosophila Genome Project (https://www.fruitfly.org/seq_tools/promoter.html).
BBKV molecular clone construction in silico
Silent mutation introduction in the BBKV genome did not affect the amino acid sequence of ARY168 genome. Silent mutations were manually introduced to lower the score to 0, except in the 5’ and 3’ UTR region and the non-coding part between the structural and non-structural protein genes. In total, 6 ECPs scores were lower to non-detectable (ND) keeping the same amino acid sequence (Fig 1A). These mutations were generated to improve the stability of the BBKV genome in bacteria when amplified.
A. Silent mutations introduced in ECPs in bold letters. New scores were not detectable (ND) with the NNPP. B. Annotated map of mutated BBKV ARY 168 genome with Snapgene and Ugene softwares. C. Observation of Plaque Forming Unit on infected VeroE6 cells at different BBKV dilutions. D. Replication kinetics of BBKV on C6/36 cells at a multiplicity of infection (MOI) of 0.1; 1 and 10. Total RNA was quantified at different time points in cell supernatant.
Using SnapGene in silico, a specific T7 promotor sequence was added at the 5’UTR and a termination sequence including a hepatitis delta virus (HDV) antigenomic ribozyme [21] and a simian virus (SV 40) polyadenylation signal (pA) (SV40pA) [22] was placed at the 3’ UTR. Combination of HDV ribozyme and SV40pA cassette would allow to generate more efficient gene expression [23].
Unique restriction sites were introduced for the cloning of the mutated full-length BBKV genome that was fragmented into 4 sections of 3.000 nt approximately (Fig 1B).
BBKV molecular clone construction and validation
High copy number pUC18 plasmid contains an ampicillin resistance gene that will be used as a selection gene by ampicillin antibiotic. pUC18 original multiple cloning site (MSC) was replaced by MSC_BBKV (ClaI-SpeI-PsiI-XhoI-NotI) allowing the cloning of BBKV synthetic gene fragments manufactured by Generay Company (China). The final full-length construction was confirmed by digestion restriction and by sequencing analysis. Plaque forming unit from the viral stock on VeroE6 cells (Fig 1C). Replication kinetics was also tested on C6/36 cells (Fig 1D).
Vector competence
Mosquito feeding rate.
Mosquitoes were exposed to an infectious BBKV blood meal at a viral titer of 1x108 PFU/mL. The viral titer was double checked after the meal exposition by titration assay. The feeding rate was calculated as the proportion of mosquitoes that ingested the blood meal over the number of total mosquitoes exposed to the infectious blood meal (Table 2). Significant variation was observed among mosquito species (p < 0.00001), with Cx. quinquefasciatus exhibiting the highest feeding rate (95%), while Ae. aegypti had the lowest (48%). Aedes albopictus (Nice and Saint-Benoît) showed similar feeding rates (~60%), whereas Cx. pipiens had a moderate feeding rate (82%) (S1 Table).
The feeding rate represents the number of fed mosquitoes over the number of total mosquitoes exposed to the infectious blood meal at 1.108 PFU/mL.
Infection and persistence
At 7 days post–viral exposure (dpve), viral RNA was detected in the midguts of all mosquito groups (Fig 2A). Overall, viral loads were heterogeneous across species. Ae. aegypti and Ae. albopictus Saint-Benoît mosquitoes showed the highest mean RNA levels (>108 copies/midgut). In contrast, Culex and Ae. albopictus mosquitoes displayed significantly lower midgut RNA copy numbers (p < 0.0001). Within Ae. aegypti (n = 30), three distinct midgut viral load categories were observed: high, intermediate, and low. For Ae. albopictus Saint-Benoît, all individuals belonged to a single high-load group, with viral RNA levels exceeding 10⁷ copies per midgut.
(A) Viral RNA amplification for genome quantification by RT-qPCR in mosquito midguts for BBKV. At 7-dpve, n = 30 for Ae. albopictus Nice and Ae. aegypti; n = 20 for Cx. quinquefasciatus, Ae. albopictus Saint-Benoît and Cx. pipiens Paris. At 14-dpve, n = 20 for Cx. pipiens Paris and Ae. albopictus Saint-Benoît; n = 22 for Ae. aegypti; n = 34 for Ae. albopictus Nice and n = 40 for Cx. quinquefasciatus. **: p < 0.01; ***: p < 0.001; ****: p < 0.0001 (Nonparamatric Krustal-Wallis and Mann-Whitney tests, Tukey p-value correction). (B) BBKV viral protein detection in the MG and SG. Mosquito organs were collected in the RIPA buffer. After SDS-PAGE electrophoresis and transfer to a PVDF membrane, SINV ascites were used. Bands at 35 kDa represent core protein and 50 kDa preE1-E2.
At 14-dpve, midgut viral loads differed significantly across all mosquito species (p < 0.0001), with the highest levels observed in Ae. aegypti and Ae. albopictus (Saint-Benoît), and the lowest in Cx. quinquefasciatus and Ae. albopictus (Nice) (S2, S3, S4, S5, S6, S7 Tables).
At 14-dpve, Cx. pipiens Paris, Cx. quinquefasciatus, Ae. albopictus Saint-Benoît and Ae. aegypti had a heterogeneous distribution with a high pool around 107-108 RNA copies/midguts and a lower one at 104-105 RNA copies/midgut. However, Ae. albopictus Nice midgut viral RNA had a homogeneous distribution ranging from 103 to 108 RNA copies/midguts.
Viral loads at 7- or 14-dpve were non-significantly different within the same species. If we compared the viral loads of the same climate area species, Cx. pipiens from Paris and Ae. albopictus from Nice were not significantly different) (S1, S2, S3, S4, S5, S6, S7 Tables).
Western blot analysis of mosquito midguts using anti-Sindbis virus antibodies revealed the presence of viral structural proteins, including the envelope glycoproteins preE1–E2 (~50 kDa) and the capsid protein (~35 kDa) at both 7- and 14-dpve (Fig 2B). Detection patterns varied between mosquito species. A double band around ~50 kDa was observed in several Aedes midgut samples, whereas a single band at a similar molecular weight was detected in some Culex samples. The band corresponding to the capsid protein (~35 kDa) was inconsistently detected across mosquito species (Fig 2B) (S1, S2, S3, S4, S5, S6 Figs, S8 Table).
BBKV replication in the mosquito midgut and persistence
Infectious particles or replicating viruses were quantified in the midguts of mosquitoes at 7- and 14-dpve (Fig 3). No significant difference was found between all mosquito species at 7-dpve whereas a high significant difference was found between viral titers measured in the midguts of the different species at 14-dpve. The viral titer found in Ae. albopictus Nice, Ae. albopictus Saint-Benoît and Ae. aegypti midguts were similar and significantly higher than those of Cx. pipiens and Cx. quinquefasciatus. We then compared the difference of viral replication between 7-and 14-dpve. A significantly decreasing viral titer was found in Cx. pipiens and Cx. quinquefasciatus midguts between the two time points (p < 0.04 and p < 0.0065 respectively). Interestingly, a significant increase of the viral titer was observed for Ae. albopictus Saint-Benoît (p < 0.024) whereas similar titers are observed for Ae. albopictus Nice and Ae. aegypti (S9 Table).
After the infected artificial blood meal, MG from the different mosquito species were collected and viral replicative particles were quantified by plaque assay titration on VeroE6 cells (n = 40 for all mosquito species). *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001 (Krustal-Wallis and Mann-Whitney tests, Tukey p-value correction).
The infection rates at 7- and 14-dpve (Table 3) were significantly different according to the different mosquito species (p = 0.00003 and p = 0.00006 respectively). Regarding the results at 7-dpve, Cx. pipiens mosquitoes had a lower rate of infection than both populations of Ae. albopictus (p = 0.0004 for Ae. albopictus Nice and for Ae. albopictus Saint- Benoît). The rate of infection of the three Aedes mosquitoes was not significantly different. The rate of infection of Cx. quinquefasciatus was similar to that of Cx. pipiens. In conclusion, the Aedes mosquitoes had a higher infection rate than the Culex mosquitoes tested.
At 14-dpve, the infection rates of Ae. albopictus strains, Ae. aegypti and Cx. pipiens were similar. The rate of infection of Cx. quinquefasciatus mosquitoes dropped and was significantly inferior to that of the two populations of Ae. albopictus (p = 0.00002 for the European strain and p = 0.0003 for the tropical strain).
The infection rate represents the number of infected mosquitoes over the number of fed mosquitoes exposed to the infectious blood meal at 7- and 14-dpve.
BBKV dissemination to the mosquito leg and persistence
Viral RNA was detected in mosquito legs at 7- and 14-dpve to confirm the BBKV dissemination from the midgut escape barrier and persistence. There was a heterogeneous distribution of the viral RNA in all the species studied: a very high pool and a lower one (Fig 4). As for the midguts, there was no significant difference within each species between 7- and 14-dpve. RT-qPCR Analysis of viral RNA in mosquito legs at 7-dpve reveals higher levels in Ae. aegypti compared to Ae. albopictus (Nice) and Cx. pipiens (p < 0.005). For Cx. quinquefasciatus and Ae. albopictus from Nice, the viral load in the legs was significantly lower compared to Ae. aegypti (p < 0.001) at 14-dpve. There was also a significant difference (p < 0.05) between Ae. albopictus from Réunion Island and Ae. albopictus Nice at 14-dpve.
At 7-dpve, n = 30 for Ae. albopictus Nice and Ae. aegypti; n = 20 for Cx. quinquefasciatus, Ae. albopictus Saint-Benoît and Cx. pipiens Paris. At 14-dpve, n = 20 for Cx. pipiens Paris and Ae. albopictus Saint-Benoît; n = 22 for Ae. aegypti; n = 34 for Ae. albopictus Nice and n = 40 for Cx. quinquefasciatus. *: p < 0.05; **: p < 0.01; **: p < 0.001; ****: p < 0.0001 (Krustal-Wallis and Mann-Whitney tests, Tukey p-value correction).
BBKV dissemination to the mosquito salivary glands and persistence
Viral RNA was extracted from salivary glands collected on the same mosquitoes for which we previously analyzed midguts and legs at both 7- and 14-dpve and analyzed by RT-qPCR (Fig 5). BBKV viral RNA genomes were detectable at both 7- and 14-dpve in salivary glands of mosquito species.
At 7- dpve, n = 30 for Ae. albopictus Nice and Ae. aegypti; n = 20 for Cx. quinquefasciatus, Ae. albopictus Saint-Benoît and Cx. pipiens Paris. At 14-dpve, n = 20 for Cx. pipiens Paris and Ae. albopictus Saint-Benoît; n = 22 for Ae. aegypti; n = 34 for Ae. albopictus Nice and n = 40 for Cx. quinquefasciatus. ns or not represented: non significative; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001 (Kruskal-Wallis and Mann-Whitney tests, Tukey p-value correction).
Viral RNA genome levels were not significantly different in the SG at 7- and 14-dpve within each species. At 7-dpve, viral RNA copy levels in the SG of Ae. albopictus Nice was significatively inferior to that of Cx. pipiens Paris, Ae. aegypti and Cx. quiquefasciatus (p < 0.005). At 14-dpve, the amount of RNA copies per pair of salivary glands was significantly higher (p < 0.005) for Cx. pipiens Paris, Ae. aegypti and Ae. albopictus Réunion Island than Ae. albopictus Nice (p < 0.005). The amount of viral RNA copies was also significantly (p < 0.005) higher in Ae. albopictus Saint-Benoît than in the Cx. quinquefasciatus population) (S2, S3, S4, S5, S6, S7 Tables).
Western blot analysis of mosquito salivary glands using anti-Sindbis virus antibodies revealed the presence of viral structural proteins at 7- and 14-dpve (Fig 1B). A band at ~35 kDa, corresponding to the capsid protein, was detected in several samples. In addition, in some salivary gland samples, a band or a double band around ~50 kDa was observed, consistent with the preE1–E2 envelope glycoproteins. Detection patterns varied across mosquito species and individual samples (S1, S2, S3, S4, S5, S6 Figs, S8 Table).
Replication in the salivary glands
Salivary glands were collected (from the same mosquito that were previously used for viral titer analysis) at 7-and 14-dpve and the viral titer was analyzed (Fig 6). No significant difference was observed at 7-dpve between the different species.
Salivary glands were collected at 7- and 14-dpve. Viral replicative particles were quantified by titration plaque assay on VeroE6 cells (n = 40 for all mosquito species). ns or not represented: non significative; *: p < 0.05; **: p < 0.01; ***: p < 0.001; ****: p < 0.0001 (Kruskal-Wallis and Mann-Whitney tests, Tukey p-value correction).
Infectious particles measured in Cx. pipiens, Ae. albopictus Nice, Ae. albopictus Saint-Benoît salivary glands were similar and significantly higher than those of Cx. quinquefasciatus at 14-dpve (p < 0.005).
A significant difference in the salivary glands titers was observed between 7- and 14- dpve for Cx. quinquefasciatus, Ae. albopictus Saint-Benoît and Ae. aegypti (p < 0.01; p < 0.05; p < 0.01) for which the viral titers decreased at 14-dpve compared to 7-dpve (S9 Table).
Using this dataset, the dissemination rate to the salivary glands can be determined by the ratio of infected salivary glands to infected midguts (Table 4). At 7-dpve, a significant difference was observed between all species (p < 0.0003), driven by the low dissemination rate in Ae. albopictus Nice. No significant differences were found among the other species. At 14-dpve, no significant differences were observed. However, for Ae. albopictus Nice, the dissemination rate was higher at 14-dpve than at 7-dpve (p < 0.008), consistent with the increased viral replication in the midgut at this time point.
The dissemination rate represents the number of infected salivary glands over the number of positive- infected midguts at 7- and 14-dpve.
BBKV transmission through mosquito saliva
Before detecting any viral protein in the saliva, the salivation needs to be confirmed. A first Dot blot on saliva samples was performed using polyclonal antibodies against the saliva protein of Aedes and Culex species as a primary antibody (Fig 7).
Saliva samples were deposited on PVDF membranes. After drying and blocking with a skimmed milk solution, the membranes were incubated in the presence of an anti-saliva polyclonal antibody and revealed by a peroxidase-labeled secondary antibody. The first row represents the positive controls with fold-dilution and negative controls and the rows below show results obtained with the samples.
These results confirm effective salivation in most tested mosquitoes (S7 Fig). We then performed RT-qPCR on saliva samples (Fig 8). Viral RNA was detected in saliva samples at both 7- and 14-dpve (S10, S11 Tables).
Saliva samples were collected at 7- and 14-dpve to BBKV. They were submitted to RNA extraction and RT-qPCR. Statistical tests were found not significative between the different species (Kruskal-Wallis test).
Titration assays were performed to confirm if infectious viral particles were released in saliva. Viral titers ranging to 102 to 103 pfu were found in the saliva of Aedes albopictus and Aedes aegypti at D7 and D14 (S9 Table).
Discussion
The present study aimed to assess the emergence potential of BBKV by evaluating its ability to infect, disseminate, and be transmitted by mosquito species from distinct ecological backgrounds. We provide direct experimental evidence that BBKV can efficiently complete its infection cycle in multiple mosquito species from both tropical and temperate regions. The detection of viral RNA in mosquito midgut, salivary glands and saliva demonstrates that the virus is able to overcome key vector barriers, supporting its capacity for transmission. Altogether, these findings indicate that BBKV is not restricted to a narrow vector range but instead exhibits broad vector competence and a strong potential for geographic expansion.
A key strength of this study lies in its ecologically grounded experimental design. Mosquito populations were maintained and tested at temperatures reflecting their natural environments, thereby preserving biologically relevant conditions under which vector competence is expressed. This approach does not aim to isolate intrinsic species-specific differences under artificial standardized conditions, but rather to evaluate the integrated performance of each species within its evolutionary thermal niche. Consequently, the observed differences reflect ecologically meaningful transmission capacities rather than methodological bias. This framework is particularly relevant for assessing emergence risk across climatic regions, as it identifies the mosquito species most likely to contribute to virus transmission under real-world conditions.
Biologically, the ability of BBKV to infect phylogenetically and ecologically distinct mosquito genera highlights a high level of viral plasticity, a feature commonly associated with arboviruses exhibiting strong emergence potential [24].
The involvement of both Aedes and Culex species is particularly informative, as these genera differ in their ecology, host preferences, and feeding behaviors, potentially facilitating the maintenance of the virus in distinct transmission cycles. Such flexibility may enable BBKV to bridge enzootic and more anthropophilic transmission patterns, as described for other alphaviruses [7,11,15]. In this context, the close phylogenetic relationship between BBKV and SINV, supported by high nucleotide identity and classification within the Western Equine Encephalitis antigenic complex [6,7], further suggests that BBKV may share similar transmission dynamics and adaptive potential. Among the tested species, Aedes albopictus emerged as the most efficient vector in both tropical and temperate settings, integrating high infection, dissemination, and transmission capacities.
Our results are consistent with previous field-based observations reporting the isolation of BBKV from a wide diversity of mosquito genera across sub-Saharan Africa, including Anopheles, Aedes, Culex, Eretmapodites, Coquillettidia, and Mansonia species [9–14]. However, while these studies demonstrated viral presence in natural settings, they did not provide direct evidence of vector competence. By experimentally demonstrating infection, dissemination, and potential transmission, our study extends these observations and provides functional validation of a broad vector range. This is in line with findings on related alphaviruses such as SINV, which are known for their ecological flexibility and ability to adapt to multiple vectors [7,15]. The high genetic similarity observed between BBKV and African SINV genotype I strains [6,7] further reinforces this parallel.
Some limitations should nevertheless be considered. Vector competence was assessed under controlled laboratory conditions, which do not fully capture the complexity of natural transmission cycles, including environmental variability and host availability. In addition, only a limited number of mosquito species and populations were tested, and intra-specific variability in susceptibility and transmission efficiency cannot be excluded. Finally, temperature, a key determinant of vector competence and arbovirus transmission dynamics, was incorporated here as an ecological parameter but not systematically dissected, despite its well-documented influence [25–27].
Taken together, our findings support the hypothesis that BBKV possesses a significant emergence potential. The identification of competent vectors in both tropical and temperate settings highlights its capacity to establish transmission cycles across diverse environments. Its ability to infect and be transmitted by mosquito species belonging to distinct ecological contexts suggests that it could spread beyond its currently recognized geographic range, particularly in the context of environmental change and vector expansion. Combined with previous reports of human infections and serological evidence of circulation [7,15], these results indicate that BBKV may be underrecognized and could represent an emerging arboviral threat.
In conclusion, BBKV emerges from this study as a potentially emerging arbovirus characterized by a broad ecological and vectorial niche. These findings underscore the need for enhanced surveillance and for integrative approaches combining vector competence, host susceptibility, and environmental drivers to better anticipate and mitigate its emergence.
Supporting information
S1 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Aedes aegypti PAEA at 7-dpve - chemiluminescent detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s001
(TIF)
S2 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Aedes aegypti PAEA at 14-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s002
(TIF)
S3 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Culex pipiens molestus PARIS at 7-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s003
(TIF)
S4 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Culex pipiens molestus PARIS at 14-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s004
(TIF)
S5 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Culex quinquefasciatus at 7-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s005
(TIF)
S6 Fig. Western Blot Raw data to detect viral protein in midguts and salivary glands in Culex quinquefasciatus at 14-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s006
(TIF)
S7 Fig. Dot Blot Raw data to detect viral protein in saliva in Aedes aegypti at 7-dpve - chemiluminescent detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s007
(TIF)
S1 Table. Blood feeding rate for all mosquito species.
https://doi.org/10.1371/journal.pntd.0013051.s008
(XLSX)
S2 Table. Sample map of 384 well plates for RT-qPCR to quantify BBKV RNA.
https://doi.org/10.1371/journal.pntd.0013051.s009
(XLSX)
S3 Table. RTqPCR Raw data to quantify BBKV RNA in midguts, legs and salivary glands in Aedes aegypti PAEA at 7- and 14-dpve.
https://doi.org/10.1371/journal.pntd.0013051.s010
(XLS)
S4 Table. RTqPCR Raw data to quantify BBKV RNA in midguts, legs and salivary glands in Aedes albopictus NICE at 7- and 14-dpve.
https://doi.org/10.1371/journal.pntd.0013051.s011
(XLS)
S5 Table. RTqPCR Raw data to quantify BBKV RNA in midguts, legs and salivary glands in Aedes albopictus St Benoît at 7- and 14-dpve.
https://doi.org/10.1371/journal.pntd.0013051.s012
(XLS)
S6 Table. RTqPCR Raw data to quantify BBKV RNA in midguts, legs and salivary glands in Culex quinquefasciatus at 7- and 14-dpve.
https://doi.org/10.1371/journal.pntd.0013051.s013
(XLS)
S7 Table. RTqPCR Raw data to quantify BBKV RNA in midgut, legs and salivary glands for all species at 7- and 14-dpve.
https://doi.org/10.1371/journal.pntd.0013051.s014
(XLSX)
S8 Table. Western Blot Raw data to detect viral protein in midguts and salivary glands in Aedes albopictus NICE at 7- and 14-dpve and Aedes albopictus St Benoît at 14-dpve - chemiluminescence detection and white light exposure.
https://doi.org/10.1371/journal.pntd.0013051.s015
(XLSX)
S9 Table. Raw data titration plaque assay to quantify BBKV infectious particles in midguts and salivary glands at 7- and 14-dpve for all mosquito species.
https://doi.org/10.1371/journal.pntd.0013051.s016
(XLSX)
S10 Table. RT-qPCR Raw data to quantify BBKV RNA in saliva samples from all mosquito species #1.
https://doi.org/10.1371/journal.pntd.0013051.s017
(XLS)
S11 Table. RT-qPCR Raw data to quantify BBKV RNA in saliva samples from all mosquito species #2.
https://doi.org/10.1371/journal.pntd.0013051.s018
(XLS)
Acknowledgments
The authors are grateful to Carine Maisse-Paridisi for her help in designing the Babanki virus primer. The authors are also grateful to Mylène Weill for kindly providing Cx. quinquefasciatus (Slab strain) larvae.
References
- 1. Weaver SC, Winegar R, Manger ID, Forrester NL. Alphaviruses: population genetics and determinants of emergence. Antiviral Res. 2012;94(3):242–57. pmid:22522323
- 2.
Karabatsos N. International catalogue of arboviruses: including certain other viruses of vertebrates. 3rd ed. San Antonio, Tex.: Published for the Subcommittee on Information Exchange of the American Committee on Arthropod-borne Viruses by the American Society of Tropical Medicine and Hygiene; 1985.
- 3. Adouchief S, Smura T, Sane J, Vapalahti O, Kurkela S. Sindbis virus as a human pathogen-epidemiology, clinical picture and pathogenesis. Rev Med Virol. 2016;26(4):221–41. pmid:26990827
- 4. de Oliveira Souza R, Duarte Júnior JWB, Della Casa VS, Santoro Rosa D, Renia L, Claser C. Unraveling the complex interplay: immunopathology and immune evasion strategies of alphaviruses with emphasis on neurological implications. Front Cell Infect Microbiol. 2024;14:1421571. pmid:39211797
- 5.
Büchen-Osmond, Cornelia, éditeur. Babanki virus (ICTVdB Taxon Code 00.073.0.01.024.00.003). International Committee on Taxonomy of Viruses, 2004.
- 6. Lundström JO, Pfeffer M. Phylogeographic Structure and Evolutionary History of Sindbis Virus. Vector-Borne and Zoonotic Diseases. 2010;10(9):889–907. https://doi.org/10.1089/vbz.2009.0069
- 7. Tricou V, Selekon B, Faye O, Gessain A, Kazanji M, Nakouné E, et al. Complete genome sequences of igbo-ora and babanki alphavirus strains isolated in the Central African Republic in the 1960s and 1970s. Microbiol Resour Announc. 2019;8(41):e00868-19. pmid:31601666
- 8.
Robin Y. Annual report, Centre Collaborateur OMS de reference pour les arbovirus en Afrique de l’Quest. Dakar, Senegal: Centre Collaborateur OMS de reference; 1970.
- 9. Traoré-lamizana M, Fontenille D, Diallo M, Bâ Y, Zeller HG, Mondo M. Arbovirus surveillance from 1990 to 1995 in the Barkedji area (Ferlo) of Senegal, a possible natural focus of Rift Valley fever virus. J Med Entomol. 2001;38(4):480–92.
- 10. Ochieng C, Lutomiah J, Makio A, Koka H, Chepkorir E, Yalwala S, et al. Mosquito-borne arbovirus surveillance at selected sites in diverse ecological zones of Kenya; 2007–2012. Virol J. 2013;10:140. pmid:23663381
- 11. Braack L, Gouveia de Almeida AP, Cornel AJ, Swanepoel R, de Jager C. Mosquito-borne arboviruses of African origin: review of key viruses and vectors. Parasit Vectors. 2018;11(1):29. pmid:29316963
- 12. Nyaruaba R, Mwaliko C, Mwau M, Mousa S, Wei H. Arboviruses in the East African Community partner states: a review of medically important mosquito-borne Arboviruses. Pathog Glob Health. 2019;113(5):209–28. pmid:31664886
- 13. Mayanja MN, Mwiine FN, Lutwama JJ, Ssekagiri A, Egesa M, Thomson EC. Mosquito-borne arboviruses in Uganda: history, transmission and burden. J Gen Virol. 2021;102(10).
- 14. Graff SL, Eibner GJ, Ochieng JR, Jones TC, Nsubuga AM, Lutwama JJ, et al. Detection of two alphaviruses: middelburg virus and Sindbis virus from enzootic amplification cycles in southwestern Uganda. Front Microbiol. 2024;15:1394661. pmid:38863760
- 15. Kading RC, Kityo RM, Mossel EC, Borland EM, Nakayiki T, Nalikka B, et al. Neutralizing antibodies against flaviviruses, Babanki virus, and Rift Valley fever virus in Ugandan bats. Infect Ecol Epidemiol. 2018;8(1):1439215. pmid:29511459
- 16.
Sokoloski KJ, Snyder AJ, Liu NH, Hayes CA, Mukhopadhyay S, Hardy RW. Encapsidation of Host-Derived Factors Correlates with Enhanced Infectivity of Sindbis Virus. Journal of Virology. 2013;87(22):12216–26. https://doi.org/10.1128/JVI.02437-13
- 17. Danet L, Beasley DW, Beauclair G, Berthet M, Moratorio G, Gracias S, et al. Midgut barriers prevent the replication and dissemination of the yellow fever vaccine in Aedes aegypti. PLOS Neglected Tropical Diseases. 2019;13(8):e0007299. https://doi.org/10.1371/journal.pntd.0007299
- 18. Belarbi E, Legros V, Basset J, Desprès P, Roques P, Choumet V. Bioluminescent ross river virus allows live monitoring of acute and long-term alphaviral infection by in vivo imaging. Viruses. 2019;11(7):584.
- 19. Legros V, Belarbi E, Jeannin P, Kümmerer B, Hardy D, Desprès P, et al. A recombinant CHIKV-NLuc virus identifies chondrocytes as target of Chikungunya virus in a immunocompetent mouse model; 2024.
- 20. Pu S-Y, Wu R-H, Yang C-C, Jao T-M, Tsai M-H, Wang J-C, et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 2011;85(6):2927–41. pmid:21228244
- 21. Perrotta AT, Been MD. A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature. 1991;350(6317):434–6. pmid:2011192
- 22. Hans H, Alwine JC. Functionally significant secondary structure of the simian virus 40 late polyadenylation signal. Mol Cell Biol. 2000;20(8):2926–32. pmid:10733596
- 23. Yamanaka R, Xanthopoulos KG. Development of improved Sindbis virus-based DNA expression vector. DNA Cell Biol. 2004;23(2):75–80. pmid:15000747
- 24. Weaver SC, Barrett ADT. Transmission cycles, host range, evolution and emergence of arboviral disease. Nature Reviews Microbiology. 2004;2(10):789–801. https://doi.org/10.1038/nrmicro1006
- 25. Vogels CBF, Göertz GP, Pijlman GP, Koenraadt CJM. Vector competence of northern and southern European Culex pipiens pipiens mosquitoes for West Nile virus across a gradient of temperatures. Medical and Veterinary Entomology. 2017;31(4):358–64. https://doi.org/10.1111/mve.12251
- 26. Jansen S, Lühken R, Helms M, Pluskota B, Pfitzner WP, Oerther S, et al. Vector Competence of Mosquitoes from Germany for Sindbis Virus. Viruses. 2022;14(12):2644. https://doi.org/10.3390/v14122644
- 27. Liu Z, Zhang Z, Lai Z, Zhou T, Jia Z, Gu J, et al. Temperature Increase Enhances Aedes albopictus Competence to Transmit Dengue Virus. Frontiers in Microbiology. 2017;8:null. https://doi.org/10.3389/fmicb.2017.02337