https://orcid.org/0000-0003-4765-3263
Figures
Abstract
Leishmania is a genus of the family Trypanosomatidae that unites obligatory parasitic flagellates causing a variety of vector-borne diseases collectively called leishmaniasis. The symptoms range from relatively innocuous skin lesions to complete failures of visceral organs. The disease is exacerbated if a parasite harbors Leishmania RNA viruses (LRVs) of the family Pseudototiviridae. Screening a novel isolate of L. braziliensis, we revealed that it possesses not a toti-, but a bunyavirus of the family Leishbuviridae. To the best of our knowledge, this is a very first discovery of a bunyavirus infecting a representative of the Leishmania subgenus Viannia. We suggest that these viruses may serve as potential factors of virulence in American leishmaniasis and encourage researchers to test leishmanial strains for the presence of not only LRVs, but also other RNA viruses.
Author summary
Parasites of the genus Leishmania cause a series of neglected tropical diseases collectively known as leishmaniasis. Many isolates of these parasites possess Leishmania RNA viruses (LRVs) of the family Pseudototiviridae that increase a chance of developing more severe mucocutaneous leishmaniasis over the cutaneous form, facilitate the spread of leishamaniae, and make these flagellates more resistant to treatments. In this work, we demonstrate that pseudototiviruses are not the only infecting agents and some isolates of Leishmania may harbor other viruses, exemplified by the leishbuvirus LbrLBV1 of L. braziliensis. Because they may also be considered as potential factors of virulence, we advocate for routine testing of leishmanial strains for the presence of not only LRVs, but also other RNA viruses.
Citation: Kostygov AY, Grybchuk D, Heeren S, Gerasimov ES, Klocek D, Reddy A, et al. (2024) A novel strain of Leishmania braziliensis harbors not a toti- but a bunyavirus. PLoS Negl Trop Dis 18(12): e0012767. https://doi.org/10.1371/journal.pntd.0012767
Editor: Claudia Ida Brodskyn, Centro de Pesquisa Gonçalo Moniz-FIOCRUZ/BA, BRAZIL
Received: October 2, 2024; Accepted: December 9, 2024; Published: December 27, 2024
Copyright: © 2024 Kostygov et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The obtained raw sequencing data were deposited in GenBank (BioProject PRJNA1086002).
Funding: This work was primarily supported by the Grant Agency of the Czech Republic (https://gacr.cz) (GACR 24-10009S to V.Y.). Additional funding was provided by the European Union Operational Program ‘‘Just Transition” (https://www.mzp.cz/en/operational_programme_just_transition) (LERCO CZ.10.03.01/00/22_003/0000003 to V.Y.). P.V. was funded by the project National Institute of Virology and Bacteriology under the program EXCELES/ NextGenerationEU (https://msmt.gov.cz/vyzkum-a-vyvoj-2/program-exceles-komponenta-5-1-narodniho-planu-obnovy) (LX22NPO5103) and S.H. was funded by the Research Foundation Flanders (https://www.fwo.be) (G092921N). The funders played no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Trypanosomatids (Euglenozoa: Kinetoplastea: Trypanosomatidae) are a group of flagellates, whose members represent obligate parasites of invertebrates, plants, and vertebrates [1,2]. They have either one (monoxenous species) or two (dixenous species) hosts in their life cycles [3,4]. Many dixenous trypanosomatids are medically and/or economically important, yet they all can be traced back to their inconspicuous and unharmful (from the anthropocentric point of view) monoxenous kin, from which they have independently originated at least thrice in evolution [5]. One of such transitions to dixeny happened within the subfamily Leishmaniinae, facilitating emergence of the well-known genus Leishmania [6,7]. These flagellates, transmitted mostly by phlebotomine sand flies, infect vertebrates and cause a variety of diseases collectively named leishmaniases, which range from relatively innocuous skin lesions to complete failures of visceral organs [8]. The genus Leishmania is subdivided into four subgenera–Leishmania, Mundinia, Sauroleishmania, and Viannia, which can be defined phylogenetically and by details of their respective life cycles [9]. Genomes of numerous Leishmania spp. have been sequenced and scrutinized both bioinformatically and functionally [10–14].
Many trypanosomatids are known to harbor RNA viruses [15,16]. The very first virus-like particles in these flagellates were described a half-century ago in Porcisia hertigi (at that time classified as a member of the genus Leishmania) [17]. The pioneering molecular works were performed on leishmaniaviruses (double-stranded RNA viruses of the family Pseudototiviridae, order Ghabrivirales [18]) infecting L. (Viannia) and L. (Leishmania) spp. in the New and Old worlds, respectively [19–21]. In the case of LRV-1 (Leishmaniavirus ichi), it has been convincingly demonstrated that its presence in L. (V.) guyanensis and L. (V.) braziliensis is linked to the augmented parasite burden and immune response in vitro [22–24], as well as the severity of leishmaniasis and drug-treatment failures in patients [25–27]. LRV-2 appears to be restricted to L. (Leishmania) and L. (Sauroleishmania) spp. [28–32] and its effects on parasite biology might differ from those elicited by LRV-1 [33–35].
To the best of our knowledge, no viruses other than LRVs have been documented in L. (Viannia) and L. (Leishmania) spp. The situation is different in two other Leishmania subgenera–Mundinia and Sauroleishmania. Out of the four screened isolates of L. (Mundinia) one was shown to possess a leishbuvirus [36], while a narnavirus and a novel lineage of LRV-2 were documented in three out of seven isolates of L. (Sauroleishmania) analyzed [32].
Leishbuviruses (Negarnaviricota: Polyploviricotina: Bunyaviricetes: Leishbuviridae) [37] appear scarce in Leishmania but fairly prevalent in monoxenous trypanosomatids of the genera Blechomonas, Crithidia, and Leptomonas [16,38–41]. The family currently contains a single genus Shilevirus [42] and its members are exclusively associated with trypanosomatids. This suggests that their ancestors switched from insects (the predominant hosts in the outgroup) to trypanosomatids only once, after which horizontal transfer events determined co-speciation of these viruses with their new hosts. Similarly to other viruses of the class Bunyaviricetes, leishbuviruses have a tripartite genome with large (L), medium (M), and small (S) segments bearing terminal complementary sequences that facilitate replication [43] and encoding an RNA-dependent RNA polymerase (RdRp), a surface glycoprotein, and a nucleocapsid protein, respectively [44]. These viruses form enveloped virions 90–100 nm in diameter, where viral glycoproteins are incorporated into the membrane envelope [45,46].
In this work, we demonstrate that in addition to LRVs, Leishmania (Viannia) braziliensis can be infected by bunyaviruses. The LbrLBV1 virus identified in this work differs from other described leishbuviruses in sequences of its terminal repeats. The L. braziliensis cells without LbrLBV1 behave similarly to their virus-positive counterparts in terms of the cell division kinetics and development in the sand flies. Yet, the complex biological consequences of possessing a bunyavirus by Leishmania spp. need to be investigated further. We suggest that these viruses may serve as potential factors of virulence in American leishmaniasis and encourage investigators and practitioners to test leishmanial strains for the presence of not only LRVs, but also other RNA viruses.
Materials and methods
Ethics statement
Collection of the Leishmania sample was approved by the Ethics Committee of the Clinics of Infectious, Parasitic, and Tropical Diseases, Bulovka University Hospital under the approval number 9214/EK-Z. A formal verbal consent was obtained from the patient.
Clinical history, strain isolation and cultivation, genomic DNA and total RNA isolation, species validation, and analysis of viral presence
A healthy 31-year-old male Czech tourist visited Argentina, Chile, Bolivia, Ecuador, Peru, and Colombia from November 2016 to August 2017. The traveler reported numerous sand fly bites in Rurrenabaque, a popular tourist destination in the north-western Bolivia (14°26’ S, 67°31 W), in March 2017. Around mid-July, 2017, a boil with a crust appeared on the right shank just under the knee (Fig 1) and was painless on the onset. Its size increased from 1 to 2.5 cm (both values are approximate) over a few weeks, accompanied by the sanguinolent discharge. On July 27th, 2017, the patient was seen at the local clinics in Colombia and treated with the antibiotics ceflexin (p.o.) and sulfadiazine (topical) with no effect. Because a secondary bacterial infection has developed, the patient was admitted to the same local hospital and treated with oxacillin and clindamycin (both i.v.). He was later transferred to the larger Hospital Universitario San Vicente Fundación in Medellin, Colombia, where the treatment with clindamycin (p.o.) continued for 3 days. The biopsy from the lesion tested positive for leishmaniasis, and the thermotherapy [47] was performed on August 3rd, 2017. The patient was prescribed Alyeyuba cream and lotion (both topical) for 28 days. The patient returned to the Czech Republic on August 14, 2017 and the second biopsy taken in Prague on August 23rd confirmed Leishmania sp. infection. The blood test results were largely inconspicuous: white blood cell count and differential count were normal, biochemistry was normal, CRP was 3.9 mg/l, and alanine aminotransferase level was slightly elevated at 104 units/l. The serology for leishmaniasis was negative. The patient refused the recommended treatment with antimony and, instead, continued with Alyeyuba application. Over the next two months, the lesion doubled in size, which was accompanied by the enlargement of inguinal lymph nodes. A treatment with the antimony drug Glucantime (20 mg/day (i.m.)) lasted from October 19th till November 8th, 2017, followed by the intralesional application of 2 ml Glucantime (1.5 g/5 ml) once a week for 3 weeks. As there was discharge from the two smaller lesions under the knee, the treatment with itraconazole was continued under the following regimen: 400 mg daily from December 14th to December 27th, 2017; 300 mg daily from December 28th, 2017 to January 7th, 2018; 200 mg daily from January 7th to January 14th, 2018, when the treatment was discontinued due to an allergic reaction. The secondary bacterial infection in the scar was treated with clarithromycin in April 2024. There was no relapse of the leishmanial infection.
The parasite strain isolated from this patient was designated as Leishmania braziliensis MHOM/BO/17/BO17 (hereafter referred to as BO17 for short). The flagellates were cultivated in the M199 medium (Sigma-Aldrich/ Merck, Darmstadt, Germany) supplemented with 2 μg/ml Biopterin (Merck), 2 μg/ml Hemin (Jena Bioscience GmbH, Jena, Germany), 25 mM HEPES (VWR/ Avantor, Radnor, USA), 50 units/ml of penicillin, 50 μg/ml of streptomycin (both from Biowest, Nuaillé, France), and 10% fetal bovine serum (Biosera, Cholet, France) at 25°C as described previously [48].
Total genomic DNA and RNA were isolated from 10 ml of trypanosomatid cultures with the DNeasy Blood & Tissue and RNeasy Mini kits (both from Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The cultured species affinity to the subgenus Viannia was initially confirmed by 18S rRNA gene amplification and sequencing as described previously [49]. The detection of viral dsRNA in the studied isolate was performed according to a previously described method [50]. The strains L. (V.) guyanensis MHOM/BR75/M4147 (bearing LRV-1) and L. (S.) hoogstraali RHEM/SD/1963/NG-26 (virus-free) were used as positive and negative controls, respectively [10,32].
Whole-genome and transcriptome sequencing, assembly and variant calling
DNA and RNA libraries were prepared as described previously [51] and sequenced on NovaSeq X (Illumina, San Diego, USA) at Macrogen Europe (Amsterdam, Netherland) in paired-end mode with a read length of 150 bp. The sequencing runs produced 36.7 million and 4.9 million reads for DNA and RNA libraries, respectively, with the average base Q score of 36. The obtained raw sequencing data were deposited in GenBank (BioProject PRJNA1086002).
Genomic reads were quality-checked with FastQC v. 0.12.1 [52] and trimmed with fastp v. 0.23.4 [53]. These reads and those for a number of L. (Viannia) spp. isolates (S1 Table) were mapped to L. braziliensis MHOM/BR/75/M2904 2019 genome assembly (the most recent reference sequence for this species available on the TriTrypDB [54]) using SMALT v.0.7.6 [55] with the following parameters: k = 13; s = 2. Variant calling was performed using the Genome Analysis Toolkit GATK v. 4.1.4.1. [56] in several steps: i) calling of SNPs and indels in each sample with HaplotypeCaller; ii) uniting individual gVCF files with CombineGVCFs; iii) joint genotyping of samples with GenotypeGVCFs; iv) separation of SNPs from INDELs with SelectVariants; and v) filtration of SNP calls with VariantFiltration using the following criteria: QD < 2; FS > 60.0; MQ < 40.0; SOR > 3.0; MQRankSum < -12.5; ReadPosRankSum < -8.0; QUAL < 100; Format DP < 5; Format GQ < 30.
Raw RNA reads were trimmed using Trimmomatic v. 0.40 [57] and assembled de novo with Trinity v. 2.13.2 [58]. To estimate coverage, reads were mapped back to the assembled contigs using Bowtie 2 v. 2.4.4 [59] and sorted with SAMtools v. 1.13 [60]. Per-base coverage was calculated using BEDTools v. 2.30.0 [61] and, based on that, per-contig RPKM (Reads Per Kilobase per Million) values were computed with a custom awk script.
Phylogenetic analyses and assessment of potential hybrid ancestry of the studied isolate
A phylogenetic network was reconstructed using SplitsTree v. 4.17 with default parameters [62] based on 1,055,633 genome-wide biallelic SNPs that were inferred for the BO17 and 49 additional isolates (S1 Table). The phylogeny reconstruction based on 92 maxicircle SNPs identified as described previously [63] for the same set of isolates, was performed by the maximum likelihood method in IQ-TREE v. 2.3.4 with substitution model TN + F + ASC as chosen by the built-in ModelFinder and branch support assessed using 100 standard bootstrap replicates [64].
Species-level ancestry of the BO17 isolate was assessed with PCAdmix v. 1.0 [65] based on the Beagle v. 5.2 [66] phased genotype data (433,086 SNPs) for the dataset including 28 isolates of L. braziliensis, L. peruviana, and their hybrids (S2 Table). Local ancestry was inferred across the genome as described previously in bins of 20 SNPs using three isolates per each of the following categories: L. braziliensis from Peru and Bolivia (parent), L. peruviana from Peru (parent), and known L. braziliensis × L. peruviana hybrids [67]. Potential intraspecific hybrid ancestry of the studied isolate was investigated as above using a dataset of 169,519 SNPs from the previous study [67] including three populations of L. braziliensis L1 from Peru and Bolivia (PAU, INP, and HUP) as putative ancestral/parental groups and one hybrid population (ADM).
Identification of viral sequences and phylogenetic analysis of viruses
Leishbuviral segments L and S were detected using DIAMOND v. 2.0.2 [68] search of all assembled contigs against Uniclust50 protein database [69]. Less conserved segment M was found by TBLASTn search of the Leishmania martiniquensis leishbuvirus 1 glycoprotein sequence [36,70] against a nucleotide database of assembled contigs. Open reading frames were annotated with NCBI’s ORF Finder web tool [71]. Terminal complementary sequences were identified and visualized using IPknot v. 2.2.1 [72].
Phylogeny of the discovered leishbuvirus was inferred from the amino acid sequence of segment L gene product—a multifunctional protein with RdRp activity [73]. The dataset included previously reported Leishbuviridae and Phenuiviridae (as an outgroup). Sequences were aligned using G-INS-i algorithm in MAFFT v. 7.490 [74] with a maximum of 1,000 iterations. A series of trimmed alignments with different gap thresholds (from 0.2 to 0.975 in steps of 0.025) was produced with trimAl v. 1.4 [75]. Each alignment was used to test the substitution model and build a phylogenetic tree with ultra-fast bootstrap supports using IQ-Tree v. 2.2.5. One alignment with the highest average ultra-fast bootstrap value (gap threshold 0.8) was selected for phylogenetic inference in IQ-Tree with 1,000 standard bootstrap replicates and the automatically selected best-fit model LG + I + F + G4. The same alignment and model were used for Bayesian inference in MrBayes v. 3.2.7. [76]. All other settings were left in their default states.
Obtaining the virus-free clonal lines and assessing growth curves
The BO17 culture was passaged every 10–12 days for two months allowing the culture to reach the post-plateau stage when the concentration of cells started to decline prior to sub-culturing. The culture was then spread onto 1% agar/supplemented M199 medium plates as described previously [77], and total RNA was extracted from 15 clonal colonies. Complementary DNA was synthesized from 1 μg of total RNA from each clone using Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Indianapolis, USA) following the manufacturer’s instructions. Abundance of LBV was estimated by RT-qPCR using the primers LBV_f: ttcattgccaccagatttgccc and LBV_r: acatcacccaataccgattccc and normalization to 60S ribosomal protein L7a [78]. Identities of the two virus-negative clones (named hereafter LBV(-) 1 and LBV(-) 2) were verified via sequencing of their genomic 18S ribosomal RNA locus as described previously [79].
For growth kinetics, the original BO17 culture (wild-type) and the two virus-negative lines were seeded at the density of 5 × 105 parasites per ml in triplicates. Parasite concentrations were determined every 24 hours for 7 days as described previously [80].
Infection of sand flies
Established laboratory colonies of the sand flies Lutzomyia longipalpis (from Jacobina, Brazil) and Lu. migonei (from Baturité, Brazil) were maintained under standard conditions [81]. Lutzomyia longipalpis is a frequent laboratory model permissive for several Leishmania spp., including L. braziliensis [82], while Lu. migonei is a natural vector of this parasite in eastern Brazil [83]. For sand flies’ infection, the wild type (WT) and LBV-negative cultures were maintained at 23°C in M199 (Sigma-Aldrich/ Merck) supplemented with 10% fetal calf serum (Thermo Fisher Scientific, Waltham, USA), 1× BME vitamins (Sigma-Aldrich/ Merck), 2% human urine, and 250 μg/ml amikin (Bristol-Myers Squibb, New York, USA).
Female sand flies (3–6 days old) were fed through a chick skin membrane on heat-inactivated ram blood (Bioveta International, Ivanovice na Hané, Czechia) containing 106 promastigotes/ml. Engorged females were maintained in the same conditions as the colony and dissected on days 3 and 10 post bloodmeal (PBM). Individual guts were analyzed by light microscopy for localization and intensity of infection. Parasite loads were graded according to [84] as light (< 100 parasites per gut), moderate (100 to 1,000 parasites per gut), and heavy (> 1,000 parasites per gut). The results were summarized for two independent biological experiments, and differences between groups in infection rate and location of infection at the stomodeal valve were calculated by “N-1” χ2 test [85].
Results
Genome analysis and classification of the patient-derived Leishmania isolate
The genome of L. braziliensis MHOM/BO/17/BO17 was sequenced to the median coverage of 266×, with only 0.2% of positions in the reference genome completely uncovered.
As L. braziliensis represents a phylogenetically complex taxon, which has close relationships with L. peruviana [86–88], we decided to perform a detailed phylogenetic analysis of the isolate under study. The phylogenetic network based on the nuclear SNPs convincingly demonstrated the position of the BO17 isolate within the lineage L1 of L. braziliensis [89] (Fig 2). A closer look at the clade under scrutiny revealed that BO17 clusters within a group of Bolivian isolates and shares the same branch with the isolate Lb-7933 [90], suggesting that their genomes are nearly identical. Indeed, analysis of SNPs in these two isolates identified only 21 heterozygous and 3 homozygous differences. Thus, BO17 is a Bolivian isolate of L. braziliensis belonging to the lineage L1. A similar situation was documented when phylogenetic relationships were inferred using kDNA data (S1 Fig).
Upper panel depicts the relationships at the subgenus level and the lower panel provides the closer view on the clade (highlighted in yellow) containing the BO17 isolate that is shown in magenta. The double-crossed branch is at 50% of its length. The scale bar denotes the number of substitutions per site.
Considering the fact that L. braziliensis can form hybrids with L. peruviana [86,91], we additionally assessed the ancestry of the studied isolate. The PCA plots produced using PCAdmix demonstrated that, while the ancestry of the parental samples matched well with their respective species identities, the L. braziliensis × L. peruviana hybrids occupied an intermediate position between the two parents. The BO17 isolate unambiguously clustered with L. braziliensis showing no signs of admixture of L. peruviana genome (S2 Fig.). However, our analysis at the intraspecific level demonstrated that all three previously characterized ancestral populations of L. braziliensis L1 lineage (HUP, PAU, and INP) contributed to the formation of the genomes of BO17 and its closest relative, Lb-7933. This was illustrated by the intermediate position in the PCA scatterplot and mosaic composition of chromosomes (S3 Fig). Thus, we concluded that the BO17 strain belongs to a hybrid population of L. braziliensis within the lineage L1 from Bolivia.
Viral presence and virus sequence analysis
The analysis of L. braziliensis BO17 dsRNA preparation allowed visualization of two bands of approximately 1 and 6 kb (Fig 3A). Of note, the mobility of dsRNA in the agarose gel differs from that of DNA, and the bands are shifted upwards. This pattern is consistent with the presence of a leishbuvirus (the M segment is often not detectable on a gel [40,41]). Notably, the abundance of dsRNA in this sample was lower than that of LRV-1 in L. guyanensis M4147 used as a positive control despite the same starting concentration of total RNA. This is not surprising since, in contrast to LRVs, which are genuine dsRNA viruses, LBVs have dsRNA only as a replicative intermediate.
(A) Agarose gel visualization of BO17 dsRNA. Leishmania guyanensis dsRNA was used as a positive control. GeneRuler 1kb DNA Ladder was added as size reference. (B) Representation of LbrLBV1 genomic segments (drawn to scale). Directional shapes depict predicted ORFs with the lengths of encoded proteins displayed inside. Terminal repeats are shown in callouts.
Analysis of the BO17 transcriptome revealed a leishbuvirus (hereafter called LbrLBV1 = Leishmania braziliensis leishbuvirus 1) with three genomic segments sizing 5.8, 1.1, and 0.8 kb, each encoding a single ORF (Fig 3B) The lengths of RNA segments and respective ORFs were typical for the “crown” clade of LBVs [38] (S3 Table). The relative abundance of the three RNAs estimated based on whole-transcriptome sequencing data was significantly different from their double-stranded variants observable on the gel. This could be explained by the different levels of strandedness bias and/or efficiency of dsRNA preservation during its preparation. All three segments contained terminal complementary sequences forming "panhandle" structures (Figs 3B and S4) characteristic for Bunyaviricetes [92]. Nevertheless, the sequences of these terminal repeats considerably differed from those in all other Leishbuviridae investigated so far: instead of the typical ACACAAAG, LbrLBV1 termini were AAGA(A/U)UUC and UUCAAACA for the L/S, and M segments, respectively (Fig 3B). Non-canonical and different between segments terminal repeats have been previously documented only in more divergent LBVs of the firebug-infecting trypanosomatid Leptomonas pyrrhocoris [38].
Phylogenetic analysis demonstrated a sister relationship of LbrLBV1 with the clade encompassing LmarLBV1 and CbomLBV1. These three viruses were nested within a large cluster of viruses from Leptomonas moramango and various species of Crithidia and Blechomonas (Fig 4).
The tree was rooted on Phenuiviridae (collapsed for better visibility). LbrLBV1 is highlighted in black. Numbers at nodes are standard bootstrap supports/Bayesian posterior probabilities, circles indicate support of 100/1.
Viral load during cultivation and comparison of virus-positive and -negative clones
Next, we obtained two virus-negative clones: LBV(-) 1 and LBV(-) 2. The analysis of growth kinetics demonstrated that the WT strain proliferated a bit slower and reached about one third lower density as compared to the virus-free clonal strains (Fig 5A). Although being small, this difference was statistically significant (p < 0.005 at day 5 by t-test). This suggests that the presence of the virus may have a slight deleterious effect on the cells. We also noted that viral prevalence was not stable: it increased during the log and early plateau phases reaching maximum at day 5 after passaging and went down afterwards (Fig 5B).
(A) Growth curves of the WT, LBV(-) 1, and LBV(-) 2 cultures. Data are calculated from three independent biological replicates. (B) Viral load in the WT culture analyzed by quantitative RT–PCR of RdRP mRNA. Data are summarized from three independent biological replicates, each with three technical replicates. Error bars indicate standard deviation.
Finally, we experimentally infected two Lutzomyia spp. (Lu. longipalpis and Lu. migonei) [83] with either the wild-type or one of the two virus-negative clonal strains of L. braziliensis. In Lu. migonei, the overall infection rates by all three strains were not significantly different (p = 0.1736 and 0.0504; χ2 = 1.851 and 3.830 for days 3 and 10 PBM, respectively). In Lu. longipalpis, the overall infection rates of LBV(-) 1 clone were about 20% lower than those of the wild-type on day 3 PBM (p = 0.0125; χ2 = 6.240) as well as on day 10 PBM (p = 0.0042; χ2 = 8.202), whereas LBV(-) 2 infection rates did not differ significantly from the WT (p = 0.0687 and 0.7486; χ2 = 3.313 and 0.103 for days 3 and 10 PBM, respectively). (S5 Fig). Considering that the statistically significant difference was observed only for one clone and one sand fly species, as well as the relatively small extent of this difference, we concluded that the virus did not essentially impact development of L. braziliensis in the vector.
Discussion
In this work, we investigated a leishmanial strain isolated from a Czech patient who had travelled to South America and identified a novel virus in it. The analysis of genomic data for this strain allowed us unambiguously identifying not only the parasite species (Leishmania braziliensis) and lineage (L1), but even the geographic origin of the strain (Bolivia), about which the anamnesis data were inconclusive. Our inference excluded interspecific hybrid ancestry of the isolated parasite, which was important considering that Leishmania spp. tend to hybridize [93–99]. However, the strain under study appears to be a result of intraspecific hybridization, which has been recently demonstrated to be associated with elevated frequency of infections by leishmaniaviruses [67]. By the analogy, the same effect could possibly be exerted for LBVs, but a single currently available example is not enough for making any sound conclusion. Of note and in contrast to LRVs, LBVs form enveloped virions, which should significantly facilitate horizontal viral transmission between host species [16,36].
The evolutionary origin LbrLBV1 cannot be unambiguously established, because the known diversity of the family Leishbuviridae is still relatively scarce. However, our phylogenetic inference indicates that it arose independently from the related virus of L. (M.) martiniquensis (LmarLBV1) [36]. In both cases, the viruses were likely acquired from monoxenous trypanosomatids, which are known to co-habit vector’s intestine with Leishmania spp. [100–102]. Of note, the distinctness of vectors for L. braziliensis and L. martiniquensis (sandflies and biting midges, respectively) is in line with the independent origin of viruses in these flagellates [103].
The discovered virus belongs to the crown group of Leishbuviridae and resembles its relatives in the sizes of genomic segments and ORFs. However, it possesses terminal complementary sequences not only distinct from the canonical ones, but even not identical for all the genomic segments. This phenomenon, previously detected only in the divergent viruses from the monoxenous trypanosomatid Leptomonas pyrrhocoris [38], warrants special attention, since it is unclear what could be the functional consequences of such a discrepancy. It may, for example, impact replication and transcription of a given segment, suggesting that expression of specific gene products may require specific regulation. In addition, the uniqueness of the terminal sequences for the M segment suggests that it has a different evolutionary origin, i.e., LbrLBV1 may be a reassortant.
Our observation that the viral load increases during the log and early plateau stages of the culture growth and subsequently decreases afterwards may have two explanations. Firstly, in some cells, the LBV proliferation may occur faster than in others. This would lead to subsequent elimination of such cells from the culture due to a presumable toxic effect. The persistence of viruses in the population can then be ensured by the cells, in which the multiplication of viruses is coordinated with that of their Leishmania host. If the presence of viruses exerts a negative effect, whatever small it could be in the mildly infected cells, the latter must be outcompeted by their virus-free counterparts. However, this apparently does not happen, which can be explained by the horizontal transmission of LBVs from the infected to uninfected cells. Secondly, the drastic decrease in the viral load could be explained by massive discharge of viral particles from the cells at the plateau stage. The underlying mechanism likely depends mainly on the host: under the stress conditions (high culture density is likely one of them), Leishmania and other trypanosomatids greatly intensify the release of extracellular vesicles [104–106], which may serve as vehicles for viral exit. In this scenario, excessive discharge of viral particles can result in the rise of virus-free cells.
Leishmania braziliensis is one of the two most common species (along with L. mexicana) causing American cutaneous leishmaniasis and the most frequent agent of its hyperergic mucocutaneous form [107]. As the presence of LRV-1 considerably elevates the risk of the development of the latter variant of the disease [22,108,109], a substantial effort has been put to the study of leishmaniaviruses in this and related Leishmania spp. belonging to the subgenus Viannia. Here, we discovered a novel virus from the family Leishbuviridae that has never been detected in the members of this group of trypanosomatids before. The overwhelming majority of studies devoted to viral endosymbionts of Leishmania spp. used methods allowing detection of LRVs only [67,110–112]. Therefore, it is not possible to estimate how prevalent LBVs can be in L. braziliensis and related species, not to say about the impact of such viruses on the clinical symptoms of the disease and other aspects of Leishmania biology. By this work we wanted to attract attention of the scientific community to LbrLBV1 as a potential factor of virulence in American leishmaniasis (pending validation in vivo) and encourage researchers to test leishmanial strains for the presence of not only LRVs, but also other RNA viruses.
Supporting information
S1 Fig. Maximum likelihood tree of L. (Viannia) isolates based on maxicircle SNP data.
Bootstrap supports (100 replicates) are shown at nodes, but values below 50 are omitted. The scale bar corresponds to the number of substitutions per site. BO17 isolate is in magenta.
https://doi.org/10.1371/journal.pntd.0012767.s001
(PDF)
S2 Fig. PCAdmix ancestry assessment.
(A), (B) Scatterplots for PCA-based ancestry estimation (PC1 vs PC2 and PC2 vs PC3, respectively). (C) Local ancestry in bins of 20 SNPs across the whole genome. “+” signs in panels A and B represent a random sample of the parental strains used as control samples for hybrid ancestry estimation. The color scheme in panels (B) and (C) is coordinated with the graphical legend presented in panel (A).
https://doi.org/10.1371/journal.pntd.0012767.s002
(PDF)
S3 Fig. PCAdmix intraspecific ancestry assessment.
(A) Scatterplot for PCA-based ancestry estimation (PC1 vs PC2). (B) Local ancestry for selected chromosomes (20 SNPs per bin). The color scheme in panel (B) is coordinated with the graphical legend presented in panel (A).
https://doi.org/10.1371/journal.pntd.0012767.s003
(PDF)
S4 Fig. Secondary structures at the termini of the LbrLBV1 genomic segments.
https://doi.org/10.1371/journal.pntd.0012767.s004
(PDF)
S5 Fig. Infection of Lu. migonei and Lu. longipalpis.
(A), (B) Intensity of infection in Lu. migonei and Lu. longipalpis, respectively. Numbers of dissected females are indicated above the bars. * and ** indicate p-values below 0.05 and 0.01, respectively. Columns 1–3 and 4–6 in each panel correspond to days 3 and 10 PBM, respectively.
https://doi.org/10.1371/journal.pntd.0012767.s005
(PDF)
S1 Table. SRA accession numbers of L. (Viannia) isolates used for phylogenetic analyses.
https://doi.org/10.1371/journal.pntd.0012767.s006
(XLSX)
S2 Table. SRA accession numbers of L. braziliensis (no background), L. peruviana (magenta background), and L. braziliensis–L. peruviana interspecies hybrids (grey background) used for ancestry reconstruction.
Samples included into interspecific- and intraspecific hybrid analysis are marked on the right.
https://doi.org/10.1371/journal.pntd.0012767.s007
(XLSX)
S3 Table. Molecular characteristics of the LbrLVB1 genome.
https://doi.org/10.1371/journal.pntd.0012767.s008
(XLSX)
References
- 1. Kostygov AY, Karnkowska A, Votýpka J, Tashyreva D, Maciszewski K, Yurchenko V, Lukeš J Euglenozoa: taxonomy, diversity and ecology, symbioses and viruses. Open Biol. 2021;11: 200407. pmid:33715388
- 2. Lukeš J, Butenko A, Hashimi H, Maslov DA, Votýpka J, Yurchenko V Trypanosomatids are much more than just trypanosomes: clues from the expanded family tree. Trends Parasitol. 2018;34: 466–480. pmid:29605546
- 3. Frolov AO, Kostygov AY, Yurchenko V Development of monoxenous trypanosomatids and phytomonads in insects. Trends Parasitol. 2021;37: 538–551. pmid:33714646
- 4. McGhee RB, Cosgrove WB Biology and physiology of the lower Trypanosomatidae. Microbiol Rev. 1980;44: 140–173. pmid:6997722
- 5. Kostygov AY, Albanaz ATS, Butenko A, Gerasimov ES, Lukeš J, Yurchenko V Phylogenetic framework to explore trait evolution in Trypanosomatidae. Trends Parasitol. 2024;40: 96–99. pmid:38065790
- 6. Kostygov AY, Yurchenko V Revised classification of the subfamily Leishmaniinae (Trypanosomatidae). Folia Parasitol 2017;64: 020. pmid:28783029
- 7. Espinosa OA, Serrano MG, Camargo EP, Teixeira MMG, Shaw JJ An appraisal of the taxonomy and nomenclature of trypanosomatids presently classified as Leishmania and Endotrypanum. Parasitology. 2018;145: 430–442.
- 8.
WHO (2024) Leishmaniasis. https://www.who.int/en/news-room/fact-sheets/detail/leishmaniasis.
- 9.
Bruschi F, Gradoni L (2018) The leishmaniases: old neglected tropical diseases. Cham, Switzerland: Springer. 245 pp. p.
- 10. Zakharova A, Albanaz ATS, Opperdoes FR, Škodová-Sveráková I, Zagirova D, Saura A, et al. Leishmania guyanensis M4147 as a new LRV1-bearing model parasite: phosphatidate phosphatase 2-like protein controls cell cycle progression and intracellular lipid content. PLoS Negl Trop Dis. 2022;16: e0010510.
- 11. Coughlan S, Mulhair P, Sanders M, Schönian G, Cotton JA, Downing T The genome of Leishmania adleri from a mammalian host highlights chromosome fission in Sauroleishmania. Sci Rep. 2017;7: 43747.
- 12. Peacock CS, Seeger K, Harris D, Murphy L, Ruiz JC, Quail MA, et al. Comparative genomic analysis of three Leishmania species that cause diverse human disease. Nat Genet. 2007;39: 839–847.
- 13. Imamura H, Monsieurs P, Jara M, Sanders M, Maes I, Vanaerschot M, et al. Evaluation of whole genome amplification and bioinformatic methods for the characterization of Leishmania genomes at a single cell level. Sci Rep. 2020;10: 15043.
- 14. Fiebig M, Kelly S, Gluenz E Comparative life cycle transcriptomics revises Leishmania mexicana genome annotation and links a chromosome duplication with parasitism of vertebrates. PLoS Pathog. 2015;11: e1005186.
- 15. Grybchuk D, Kostygov AY, Macedo DH, d’Avila-Levy CM, Yurchenko V RNA viruses in trypanosomatid parasites: a historical overview. Mem Inst Oswaldo Cruz. 2018;113: e170487. pmid:29513877
- 16. Grybchuk D, Akopyants NS, Kostygov AY, Konovalovas A, Lye LF, Dobson DE, et al. Viral discovery and diversity in trypanosomatid protozoa with a focus on relatives of the human parasite Leishmania. Proc Natl Acad Sci U S A. 2018;115: E506–E515.
- 17. Molyneux DH Virus-like particles in Leishmania parasites. Nature. 1974;249: 588–589.
- 18. Lefkowitz EJ, Dempsey DM, Hendrickson RC, Orton RJ, Siddell SG, Smith DB Virus taxonomy: the database of the International Committee on Taxonomy of Viruses (ICTV). Nucleic Acids Res. 2018;46: D708–D717. pmid:29040670
- 19. Widmer G, Comeau AM, Furlong DB, Wirth DF, Patterson JL Characterization of a RNA virus from the parasite Leishmania. Proc Natl Acad Sci U S A. 1989;86: 5979–5982.
- 20. Weeks R, Aline RF Jr., Myler PJ, Stuart K LRV1 viral particles in Leishmania guyanensis contain double-stranded or single-stranded RNA. J Virol. 1992;66: 1389–1393.
- 21. Scheffter SM, Ro YT, Chung IK, Patterson JL The complete sequence of Leishmania RNA virus LRV2-1, a virus of an Old World parasite strain. Virology. 1995;212: 84–90.
- 22. Ives A, Ronet C, Prevel F, Ruzzante G, Fuertes-Marraco S, Schutz F, et al. Leishmania RNA virus controls the severity of mucocutaneous leishmaniasis. Science. 2011;331: 775–778.
- 23. Brettmann EA, Shaik JS, Zangger H, Lye LF, Kuhlmann FM, Akopyants NS, et al. Tilting the balance between RNA interference and replication eradicates Leishmania RNA virus 1 and mitigates the inflammatory response. Proc Natl Acad Sci U S A. 2016;113: 11998–12005.
- 24. Rossi M, Castiglioni P, Hartley MA, Eren RO, Prevel F, Desponds C, et al. Type I interferons induced by endogenous or exogenous viral infections promote metastasis and relapse of leishmaniasis. Proc Natl Acad Sci U S A. 2017;114: 4987–4992. pmid:28439019
- 25. Adaui V, Lye LF, Akopyants NS, Zimic M, Llanos-Cuentas A, Garcia L, et al. Association of the endobiont double-stranded RNA virus LRV1 with treatment failure for human leishmaniasis caused by Leishmania braziliensis in Peru and Bolivia. J Infect Dis. 2016;213: 112–121.
- 26. Bourreau E, Ginouves M, Prevot G, Hartley MA, Gangneux JP, Robert-Gangneux F, et al. Presence of Leishmania RNA Virus 1 in Leishmania guyanensis increases the risk of first-line treatment failure and symptomatic relapse. J Infect Dis. 2016;213: 105–111.
- 27. Jha B, Reverte M, Ronet C, Prevel F, Morgenthaler FD, Desponds C, et al. In and out: Leishmania metastasis by hijacking lymphatic system and migrating immune cells. Front Cell Infect Microbiol. 2022;12: 941860.
- 28. Kostygov AY, Grybchuk D, Kleschenko Y, Chistyakov DS, Lukashev AN, Gerasimov ES, Yurchenko V Analyses of Leishmania-LRV co-phylogenetic patterns and evolutionary variability of viral proteins. Viruses. 2021;13: 2305.
- 29. Rêgo FD, da Silva ES, Lopes VV, Teixeira-Neto RG, Belo VS, Fonseca Júnior AA, et al. First report of putative Leishmania RNA virus 2 (LRV2) in Leishmania infantum strains from canine and human visceral leishmaniasis cases in the southeast of Brazil. Mem Inst Oswaldo Cruz. 2023;118: e230071.
- 30. Kleschenko Y, Grybchuk D, Matveeva NS, Macedo DH, Ponirovsky EN, Lukashev AN, Yurchenko V Molecular characterization of Leishmania RNA virus 2 in Leishmania major from Uzbekistan. Genes. 2019;10: e830.
- 31. Saberi R, Fakhar M, Hajjaran H, Ataei-Pirkooh A, Mohebali M, Taghipour N, et al. Presence and diversity of Leishmania RNA virus in an old zoonotic cutaneous leishmaniasis focus, northeastern Iran: haplotype and phylogenetic based approach. Int J Infect Dis. 2020;101: 6–13.
- 32. Klocek D, Grybchuk D, Tichá L, Votýpka J, Volf P, Kostygov AY, Yurchenko V Evolution of RNA viruses in trypanosomatids: new insights from the analysis of Sauroleishmania. Parasitol Res. 2023;122: 2279–2286.
- 33. Saura A, Zakharova A, Klocek D, Gerasimov ES, Butenko A, Macedo DH, et al. Elimination of LRVs elicits different responses in Leishmania spp. mSphere. 2022;7: e0033522.
- 34. Saberi R, Fakhar M, Hajjaran H, Abbaszadeh Afshar MJ, Mohebali M, Hezarjaribi HZ, et al. Leishmania RNA virus 2 (LRV2) exacerbates dermal lesions caused by Leishmania major and comparatively unresponsive to meglumine antimoniate treatment. Exp Parasitol. 2022;241: 108340.
- 35. Mirabedini Z, Mirjalali H, Kazemirad E, Khamesipour A, Samimirad K, Koosha M, et al. The effects of Leishmania RNA virus 2 (LRV2) on the virulence factors of L. major and pro-inflammatory biomarkers: an in vitro study on human monocyte cell line (THP-1). BMC Microbiol. 2023;23: 398.
- 36. Grybchuk D, Macedo DH, Kleschenko Y, Kraeva N, Lukashev AN, Bates PA, et al. The first non-LRV RNA virus in Leishmania. Viruses. 2020;12: 168.
- 37. Kuhn JH, Brown K, Adkins S, de la Torre JC, Digiaro M, Ergunay K, et al. Promotion of order Bunyavirales to class Bunyaviricetes to accommodate a rapidly increasing number of related polyploviricotine viruses. J Virol. 2024: e0106924.
- 38. Macedo DH, Grybchuk D, Režnarová J, Votýpka J, Klocek D, Yurchenko T, et al. Diversity of RNA viruses in the cosmopolitan monoxenous trypanosomatid Leptomonas pyrrhocoris. BMC Biol. 2023;21: 191.
- 39. Akopyants NS, Lye LF, Dobson DE, Lukeš J, Beverley SM A novel bunyavirus-like virus of trypanosomatid protist parasites. Genome Announc. 2016;4: e00715–00716. pmid:27491985
- 40. Klocek D, Grybchuk D, Macedo DH, Galan A, Votýpka J, Schmid-Hempel R, et al. RNA viruses of Crithidia bombi, a parasite of bumblebees. J Invertebr Pathol. 2023;201: 107991.
- 41. Grybchuk D, Kostygov AY, Macedo DH, Votýpka J, Lukeš J, Yurchenko V RNA viruses in Blechomonas (Trypanosomatidae) and evolution of Leishmaniavirus. mBio. 2018;9: e01932–01918.
- 42. Kuhn JH, Abe J, Adkins S, Alkhovsky SV, Avšič-Županc T, Ayllón MA, et al. Annual (2023) taxonomic update of RNA-directed RNA polymerase-encoding negative-sense RNA viruses (realm Riboviria: kingdom Orthornavirae: phylum Negarnaviricota). J Gen Virol. 2023;104: 001864.
- 43. Malet H, Williams HM, Cusack S, Rosenthal M The mechanism of genome replication and transcription in bunyaviruses. PLoS Pathog. 2023;19: e1011060. pmid:36634042
- 44. Wichgers Schreur PJ, Kormelink R, Kortekaas J Genome packaging of the Bunyavirales. Curr Opin Virol. 2018;33: 151–155.
- 45. Elliott RM Molecular biology of the Bunyaviridae. J Gen Virol. 1990;71: 501–522.
- 46. Barker J, daSilva LLP, Crump CM Mechanisms of bunyavirus morphogenesis and egress. J Gen Virol. 2023;104: 001845. pmid:37083579
- 47. Lopez L, Robayo M, Vargas M, Velez ID Thermotherapy. An alternative for the treatment of American cutaneous leishmaniasis. Trials. 2012;13: 58. pmid:22594858
- 48. Ishemgulova A, Kraeva N, Hlaváčová J, Zimmer SL, Butenko A, Podešvová L, et al. A putative ATP/GTP binding protein affects Leishmania mexicana growth in insect vectors and vertebrate hosts. PLoS Negl Trop Dis. 2017;11: e0005782.
- 49. Yurchenko V, Lukeš J, Tesařová M, Jirků M, Maslov DA Morphological discordance of the new trypanosomatid species phylogenetically associated with the genus Crithidia. Protist. 2008;159: 99–114.
- 50. Grybchuk D, Galan A, Klocek D, Macedo DH, Wolf YI, Votýpka J, et al. Identification of diverse RNA viruses in Obscuromonas flagellates (Euglenozoa: Trypanosomatidae: Blastocrithidiinae). Virus Evol. 2024;10: veae037.
- 51. Albanaz ATS, Carrington M, Frolov AO, Ganyukova AI, Gerasimov ES, Kostygov AY, et al. Shining the spotlight on the neglected: new high-quality genome assemblies as a gateway to understanding the evolution of Trypanosomatidae. BMC Genomics. 2023;24: 471. pmid:37605127
- 52. Andrews S (2019) FastQC: a quality control tool for high throughput sequence data.
- 53. Chen S, Zhou Y, Chen Y, Gu J Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34: i884–i890. pmid:30423086
- 54. Shanmugasundram A, Starns D, Böhme U, Amos B, Wilkinson PA, Harb OS, et al. TriTrypDB: An integrated functional genomics resource for kinetoplastida. PLoS Negl Trop Dis. 2023;17: e0011058. pmid:36656904
- 55. Ponsting H, Ning Z (2010) SMALT—A new mapper for DNA sequencing reads. Intelligent Systems for Molecular Biology. Boston, USA.
- 56. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20: 1297–1303. pmid:20644199
- 57. Bolger AM, Lohse M, Usadel B Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30: 2114–2120.
- 58. Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8: 1494–1512.
- 59. Langmead B, Salzberg SL Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9: 357–359. pmid:22388286
- 60. Ramirez-Gonzalez RH, Bonnal R, Caccamo M, Maclean D Bio-SAMtools: Ruby bindings for SAMtools, a library for accessing BAM files containing high-throughput sequence alignments. Source Code Biol Med. 2012;7: 6. pmid:22640879
- 61. Quinlan AR BEDTools: the swiss-army tool for genome feature analysis. Curr Protoc Bioinformatics. 2014;47: 11.12.11–11.12.34. pmid:25199790
- 62. Huson DH, Bryant D Application of phylogenetic networks in evolutionary studies. Mol Biol Evol. 2006;23: 254–267. pmid:16221896
- 63. Gerasimov ES, Novozhilova TS, Zimmer SL, Yurchenko V Kinetoplast genome of Leishmania spp. is under strong purifying selection. Trop Med Infect Dis. 2023;8: 384.
- 64. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol Biol Evol. 2020;37: 1530–1534. pmid:32011700
- 65. Brisbin A, Bryc K, Byrnes J, Zakharia F, Omberg L, Degenhardt J, et al. PCAdmix: principal components-based assignment of ancestry along each chromosome in individuals with admixed ancestry from two or more populations. Hum Biol. 2012;84: 343–364. pmid:23249312
- 66. Browning BL, Tian X, Zhou Y, Browning SR Fast two-stage phasing of large-scale sequence data. Am J Hum Genet. 2021;108: 1880–1890. pmid:34478634
- 67. Heeren S, Maes I, Sanders M, Lye LF, Adaui V, Arevalo J, et al. Diversity and dissemination of viruses in pathogenic protozoa. Nat Commun. 2023;14: 8343. pmid:38102141
- 68. Buchfink B, Reuter K, Drost HG Sensitive protein alignments at tree-of-life scale using DIAMOND. Nat Methods. 2021;18: 366–368. pmid:33828273
- 69. Mirdita M, von den Driesch L, Galiez C, Martin MJ, Söding J, Steinegger M Uniclust databases of clustered and deeply annotated protein sequences and alignments. Nucleic Acids Res. 2017;45: D170–D176. pmid:27899574
- 70. Mendes Junior AAV, Filgueira CPB, Miranda LFC, de Almeida AB, Cantanhede LM, Fagundes A, et al. First report of Leishmania (Mundinia) martiniquensis in South American territory and confirmation of Leishbunyavirus infecting this parasite in a mare. Mem Inst Oswaldo Cruz. 2023;118: e220220.
- 71. Wheeler DL, Church DM, Federhen S, Lash AE, Madden TL, Pontius JU, et al. Database resources of the National Center for Biotechnology. Nucleic Acids Res. 2003;31: 28–33. pmid:12519941
- 72. Sato K, Kato Y, Hamada M, Akutsu T, Asai K IPknot: fast and accurate prediction of RNA secondary structures with pseudoknots using integer programming. Bioinformatics. 2011;27: i85–93. pmid:21685106
- 73. Reguera J, Weber F, Cusack S Bunyaviridae RNA polymerases (L-protein) have an N-terminal, influenza-like endonuclease domain, essential for viral cap-dependent transcription. PLOS Pathog. 2010;6: e1001101.
- 74. Katoh K, Standley DM MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30: 772–780.
- 75. Capella-Gutiérrez S, Silla-Martinez JM, Gabaldon T trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25: 1972–1973.
- 76. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012;61: 539–542. pmid:22357727
- 77. Hamilton PT, Votýpka J, Dostálová A, Yurchenko V, Bird NH, Lukeš J, et al. Infection dynamics and immune response in a newly described Drosophila-trypanosomatid association. mBio. 2015;6: e01356–01315.
- 78. Ishemgulova A, Kraeva N, Faktorová D, Podešvová L, Lukeš J, Yurchenko V T7 polymerase-driven transcription is downregulated in metacyclic promastigotes and amastigotes of Leishmania mexicana. Folia Parasitol. 2016;63: 016.
- 79. Yurchenko V, Kostygov A, Havlová J, Grybchuk-Ieremenko A, Ševčíková T, Lukeš J, et al. Diversity of trypanosomatids in cockroaches and the description of Herpetomonas tarakana sp. n. J Eukaryot Microbiol. 2016;63 198–209.
- 80. Ishemgulova A, Hlaváčová J, Majerová K, Butenko A, Lukeš J, Votýpka J, et al. CRISPR/Cas9 in Leishmania mexicana: a case study of LmxBTN1. PLoS One. 2018;13: e0192723.
- 81. Volf P, Volfová V Establishment and maintenance of sand fly colonies. J Vector Ecol. 2011;36 Suppl 1: S1–S9. pmid:21366760
- 82. Dostálová A, Volf P Leishmania development in sand flies: parasite-vector interactions overview. Parasit Vectors. 2012;5: 276.
- 83. Alexandre J, Sádlová J, Leštinová T, Vojtková B, Jančářová M, Podešvová L, et al. Experimental infections and co-infections with Leishmania braziliensis and Leishmania infantum in two sand fly species, Lutzomyia migonei and Lutzomyia longipalpis. Sci Rep. 2020;10: 3566.
- 84. Myšková J, Votýpka J, Volf P Leishmania in sand flies: comparison of quantitative polymerase chain reaction with other techniques to determine the intensity of infection. J Med Entomol. 2008;45: 133–138.
- 85. Campbell I Chi-squared and Fisher-Irwin tests of two-by-two tables with small sample recommendations. Stat Med. 2007;26: 3661–3675. pmid:17315184
- 86. Tabbabi A, Caceres AG, Bustamante Chauca TP, Seki C, Choochartpong Y, Mizushima D, et al. Nuclear and kinetoplast DNA analyses reveal genetically complex Leishmania strains with hybrid and mito-nuclear discordance in Peru. PLoS Negl Trop Dis. 2020;14: e0008797.
- 87. Kato H, Caceres AG, Hashiguchi Y First evidence of a hybrid of Leishmania (Viannia) braziliensis/L. (V.) peruviana DNA detected from the phlebotomine sand fly Lutzomyia tejadai in Peru. PLoS Negl Trop Dis. 2016;10: e0004336.
- 88. Odiwuor S, Veland N, Maes I, Arevalo J, Dujardin JC, Van der Auwera G Evolution of the Leishmania braziliensis species complex from amplified fragment length polymorphisms, and clinical implications. Infect Genet Evol. 2012;12: 1994–2002.
- 89. Van den Broeck F, Heeren S, Maes I, Sanders M, Cotton JA, Cupolillo E, et al. Genome Analysis of triploid hybrid Leishmania parasite from the Neotropics. Emerg Infect Dis. 2023;29: 1076–1078. pmid:37081624
- 90. Patiño LH, Muñoz M, Cruz-Saavedra L, Muskus C, Ramírez JD Genomic diversification, structural plasticity, and hybridization in Leishmania (Viannia) braziliensis. Front Cell Infect Microbiol. 2020;10: 582192.
- 91. Nolder D, Roncal N, Davies CR, Llanos-Cuentas A, Miles MA Multiple hybrid genotypes of Leishmania (viannia) in a focus of mucocutaneous Leishmaniasis. Am J Trop Med Hyg. 2007;76: 573–578. pmid:17360886
- 92. Ren F, Zhou M, Deng F, Wang H, Ning YJ Combinatorial minigenome systems for emerging banyangviruses reveal viral reassortment potential and importance of a protruding nucleotide in genome "panhandle" for promoter activity and reassortment. Front Microbiol. 2020;11: 599. pmid:32322247
- 93. Van den Broeck F, Savill NJ, Imamura H, Sanders M, Maes I, Cooper S, et al. Ecological divergence and hybridization of Neotropical Leishmania parasites. Proc Natl Acad Sci U S A. 2020;117: 25159–25168.
- 94. Romano A, Inbar E, Debrabant A, Charmoy M, Lawyer P, Ribeiro-Gomes F, et al. Cross-species genetic exchange between visceral and cutaneous strains of Leishmania in the sand fly vector. Proc Natl Acad Sci U S A. 2014;111: 16808–16813.
- 95. Akopyants NS, Kimblin N, Secundino N, Patrick R, Peters N, Lawyer P, et al. Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector. Science. 2009;324: 265–268.
- 96. Sádlová J, Yeo M, Seblová V, Lewis MD, Mauricio I, Volf P, Miles MA Visualisation of Leishmania donovani fluorescent hybrids during early stage development in the sand fly vector. PLoS One. 2011;6: e19851.
- 97. Lypaczewski P, Matlashewski G Leishmania donovani hybridisation and introgression in nature: a comparative genomic investigation. Lancet Microbe. 2021;2: e250–e258.
- 98. Volf P, Benková I, Myšková J, Sádlová J, Campino L, Ravel C Increased transmission potential of Leishmania major/Leishmania infantum hybrids. Int J Parasitol. 2007;37: 589–593.
- 99. Rogers MB, Downing T, Smith BA, Imamura H, Sanders M, Svobodova M, et al. Genomic confirmation of hybridisation and recent inbreeding in a vector-isolated Leishmania population. PLoS Genet. 2014;10: e1004092.
- 100. Songumpai N, Promrangsee C, Noopetch P, Siriyasatien P, Preativatanyou K First evidence of co-circulation of emerging Leishmania martiniquensis, Leishmania orientalis, and Crithidia sp. in culicoides biting midges (Diptera: Ceratopogonidae), the putative vectors for autochthonous transmission in southern Thailand. Trop Med Infect Dis. 2022;7: 379.
- 101. Bhattarai NR, Das ML, Rijal S, van der Auwera G, Picado A, Khanal B, et al. Natural infection of Phlebotomus argentipes with Leishmania and other trypanosomatids in a visceral leishmaniasis endemic region of Nepal. Trans R Soc Trop Med Hyg. 2009;103: 1087–1092.
- 102. Ferreira TdS Minuzzi-Souza TT, Andrade AJ Coelho TO, Rocha Dde A Obara MT, et al. Molecular detection of Trypanosoma sp. and Blastocrithidia sp. (Trypanosomatidae) in phlebotomine sand flies (Psychodidae) in the Federal District of Brazil. Rev Soc Bras Med Trop. 2015;48: 776–779.
- 103. Akhoundi M, Kuhls K, Cannet A, Votýpka J, Marty P, Delaunay P, Sereno D A historical overview of the classification, evolution, and dispersion of Leishmania parasites and sandflies. PLoS Negl Trop Dis. 2016;10: e0004349.
- 104. Vasconcelos CI, Cronemberger-Andrade A, Souza-Melo N, Maricato JT, Xander P, Batista WL, et al. Stress induces release of extracellular vesicles by Trypanosoma cruzi trypomastigotes. J Immunol Res. 2021;2021: 2939693.
- 105. Dong G, Filho AL, Olivier M Modulation of host-pathogen communication by extracellular vesicles (EVs) of the protozoan parasite Leishmania. Front Cell Infect Microbiol. 2019;9: 100.
- 106. Eliaz D, Kannan S, Shaked H, Arvatz G, Tkacz ID, Binder L, et al. Exosome secretion affects social motility in Trypanosoma brucei. PLoS Pathog. 2017;13: e1006245.
- 107. Grimaldi G Jr., Tesh RB Leishmaniases of the New World: current concepts and implications for future research. Clin Microbiol Rev. 1993;6: 230–250. pmid:8358705
- 108. Olivier M, Zamboni DS Leishmania (Viannia) guyanensis, LRV1 virus and extracellular vesicles: a dangerous trio influencing the faith of immune response during muco-cutaneous leishmaniasis. Curr Opin Immunol. 2020;66: 108–113.
- 109. Cantanhêde LM, da Silva Junior CF, Ito MM, Felipin KP, Nicolete R, Salcedo JM, et al. Further evidence of an association between the presence of Leishmania RNA Virus 1 and the mucosal manifestations in tegumentary leishmaniasis patients. PLoS Negl Trop Dis. 2015;9: e0004079.
- 110. Bonilla AA, Pineda V, Calzada JE, Saldaña A, Laurenti MD, Goya S, et al. Epidemiology and genetic characterization of Leishmania RNA virus in Leishmania (Viannia) spp. isolates from cutaneous leishmaniasis endemic areas in Panama. Microorganisms. 2024;12: 1317.
- 111. Zabala-Peñafiel A, Fantinatti M, Dias-Lopes G, da Silva JL, Miranda LFC, Lyra MR, et al. First report of Leishmania RNA virus 1 in Leishmania (Viannia) braziliensis clinical isolates from Rio de Janeiro State—Brazil. Mem Inst Oswaldo Cruz. 2022;117: e210107.
- 112. Parra-Muñoz M, Aponte S, Ovalle-Bracho C, Saavedra CH, Echeverry MC Detection of Leishmania RNA Virus in clinical samples from cutaneous leishmaniasis patients varies according to the type of sample. Am J Trop Med Hyg. 2021;104: 233–239.