Skip to main content
Advertisement
  • Loading metrics

Comparative genomics of Leishmania donovani progeny from genetic crosses in two sand fly species and impact on the diversity of diagnostic and vaccine candidates

  • Jovana Sádlová ,

    Contributed equally to this work with: Jovana Sádlová, Matthew Yeo

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Department of Parasitology, Faculty of Science, Charles University, Prague, Czech Republic

  • Matthew Yeo ,

    Contributed equally to this work with: Jovana Sádlová, Matthew Yeo

    Roles Conceptualization, Data curation, Formal analysis, Methodology, Resources, Validation, Writing – review & editing

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • David S. Mateus,

    Roles Data curation, Formal analysis, Investigation, Validation, Writing – original draft

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • Jody Phelan,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Software, Validation, Visualization, Writing – original draft

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • Le Anh Hai,

    Roles Data curation, Formal analysis, Investigation, Visualization, Writing – original draft

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • Tapan Bhattacharyya ,

    Roles Data curation, Formal analysis, Investigation, Supervision, Visualization, Writing – original draft, Writing – review & editing

    Tapan.Bhattacharyya@lshtm.ac.uk (TB); michael.miles@lshtm.ac.uk (MAM)

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • Stefan Kurtev,

    Roles Data curation, Formal analysis, Investigation, Visualization, Writing – original draft

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

  • Ondrej Sebesta,

    Roles Formal analysis, Investigation

    Affiliation Laboratory of Confocal and Fluorescence Microscopy, Faculty of Science, Charles University, Prague, Czech Republic

  • Jitka Myskova,

    Roles Formal analysis, Investigation

    Affiliation Department of Parasitology, Faculty of Science, Charles University, Prague, Czech Republic

  • Veronika Seblova,

    Roles Formal analysis, Investigation

    Affiliation Department of Parasitology, Faculty of Science, Charles University, Prague, Czech Republic

  • Björn Andersson,

    Roles Data curation, Formal analysis, Methodology, Software, Validation

    Affiliation Department of Cell and Molecular Biology, Karolinska Institute, Stockholm, Sweden

  • Paola Florez de Sessions,

    Roles Data curation, Formal analysis, Methodology, Software, Validation

    Affiliation Genome Institute of Singapore, Biomedical Sciences Institutes, Agency for Science, Technology and Research, Singapore

  • Petr Volf,

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Affiliation Department of Parasitology, Faculty of Science, Charles University, Prague, Czech Republic

  • Michael A. Miles

    Roles Conceptualization, Data curation, Formal analysis, Funding acquisition, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing

    Tapan.Bhattacharyya@lshtm.ac.uk (TB); michael.miles@lshtm.ac.uk (MAM)

    Affiliation Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London United Kingdom

Abstract

Sand fly transmitted Leishmania species are responsible for severe, wide ranging, visceral and cutaneous leishmaniases. Genetic exchange can occur among natural Leishmania populations and hybrids can now be produced experimentally, with limitations. Feeding Phlebotomus orientalis or Phlebotomus argentipes on two strains of Leishmania donovani yielded hybrid progeny, selected using double drug resistance and fluorescence markers. Fluorescence activated cell sorting of cultured clones derived from these hybrids indicated diploid progeny. Multilocus sequence typing of the clones showed hybridisation and nuclear heterozygosity, although with inheritance of single haplotypes in a kinetoplastid target. Comparative genomics showed diversity of clonal progeny between single chromosomes, and extraordinary heterozygosity across all 36 chromosomes. Diversity between progeny was seen for the HASPB antigen, which has been noted previously as having implications for design of a therapeutic vaccine. Genomic diversity seen among Leishmania strains and hybrid progeny is of great importance in understanding the epidemiology and control of leishmaniasis. As an outcome of this study we strongly recommend that wider biological archives of different Leishmania species from endemic regions should be established and made available for comparative genomics. However, in parallel, performance of genetic crosses and genomic comparisons should give fundamental insight into the specificity, diversity and limitations of candidate diagnostics, vaccines and drugs, for targeted control of leishmaniasis.

Author summary

Sand flies transmit Leishmania infections that cause devastating and potentially fatal infectious human diseases. The existence of genetic exchange between Leishmania populations has been proved in nature. We used laboratory techniques to create experimental hybrids comparable to those that arise in nature, and analysed the genomes of the resulting offspring. We found vast genetic exchange and diversity across all 36 Leishmania chromosomes of the hybrid (diploid) progeny. Genes that are involved in Leishmania parasite virulence may recombine into new forms that evade the human immune system. This genetic exchange was also shown to modify and disrupt candidate diagnostic antigens.

Introduction

An estimated 350 million people worldwide are at risk of leishmaniasis. The disease is prevalent over vast geographical ranges and many countries, notably in eastern Africa, the Indian subcontinent, South America, Central Asia and the Mediterranean region. The Leishmania donovani complex (L. donovani and L. infantum) causes widespread fatal human visceral leishmaniasis (VL, kala-azar), which is the most devastating form of leishmaniasis, predominantly associated with vulnerable populations, and opportunistic in individuals compromised by HIV co-infection. Without effective treatment symptomatic VL is almost always fatal; around 50,000 to 90,000 cases occur annually [1]. As well as human VL, L. infantum is responsible for widespread canine visceral leishmaniasis (CVL). Furthermore, L. braziliensis of the American subgenus Viannia causes a severe destructive mucocutaneous leishmaniasis (MCL), with catastrophic invasion and destruction of the nasopharynx. The mechanisms by which Leishmania survive in infected asymptomatic carriers and then relapse opportunistically in immunocompromised individuals, are not fully understood. There are no proven human vaccines, and drugs and diagnostics require substantial improvement [2].

The taxonomy of Leishmania is complex. There are now four recognized subgenera, Leishmania, Viannia, Mundinia and Sauroleishmania [3]. The two subgenera Leishmania and Viannia include human parasites, each comprised of several species, which have different abilities to survive in sand fly species, and that have distinct distributions of developmental forms in the sand flies that are their associated vectors [4]. Molecular methods have allowed reassessment of Leishmania taxonomy, revealing that some named Leishmania species are invalid [5]. Historically, all Leishmania were considered to be fundamentally clonal. However, evidence accumulated of genetic exchange within and between natural populations of several Leishmania species, including those of Viannia, such as L. braziliensis and L. peruviana/guyanensis, and inbreeding has been detected in natural populations of both L. braziliensis and L. guyanensis [6]. Applying multilocus sequence typing (MLST) and microsatellite analysis (MLMT) revealed evidence of sympatric putative parents and hybrid progeny of L. donovani in an endemic focus of VL in Ethiopia, subsequently confirmed by detailed comparative genomics [7]. Genetic exchange has also been observed among other Leishmania populations, for example Leishmania tropica of the Middle East [8].

Experimental genetic crosses of L. major were finally achieved in the sand fly vector, and progeny from geographically disparate sources of L. major were shown to be viable. The hybrids had genotypes consistent with classical meiosis. However, aneuploidy, recurrent triploidy and loss of heterozygosity (LOH) were also observed [9,10]. More recently, genetic crosses of L. donovani, L. infantum, and L. braziliensis have been achieved in vitro, facilitated when the Leishmania were exposed to stress and DNA damage, with intraspecific hybridisation, although principally producing tetraploid hybrids [1113]. Similarly, interspecies crosses between L. donovani and L. major, and L. donovani and L. tropica, have been achieved in vitro [14]. No distinct male or female gametes of Leishmania have yet been described, although haploid stages of the trypanosomatid Trypanosoma brucei have been discovered in tsetse flies [15].

A range of sand fly species can now be grown in laboratory colonies, enabling great insight into the life cycles and natural genetics of Leishmania in the vector. Genetic exchange in Leishmania has profound epidemiological importance. It may lead to hybrid vigour (heterosis), with the emergence and spread of strains that are more virulent or are resistant to drugs, with adaptation to new insect vectors, hosts and ecological niches, with implications on the sensitivity and specificity of diagnostic methods and efficacy of vaccine candidates.

Here, we describe experimental genetic crosses of L. donovani in two sand fly species, Phlebotomus orientalis and Phlebotomus argentipes, and compare genomics of the parents and the progeny. We also consider the relevance of genetic diversity and genetic exchange on Leishmania diagnostic and vaccine candidates.

Material and methods

Sand fly colonies and parasites

Laboratory colonies of four sand fly species, Phlebotomus orientalis (from Ethiopia), P. argentipes (India), Sergentomyia schwetzi (Ethiopia) and P. duboscqi (Senegal), were maintained in the insectary of the Charles University in Prague under standard conditions (at 26°C, fed on 50% sucrose,) with a 14 h light/10 h dark photoperiod as described previously [16]. The latter two sand fly species were included as non-permissive vector controls.

Leishmania donovani Parent 1 (P1) (MHOM/ET/2010/GR347) expressing enhanced green fluorescence protein (eGFP) and L. donovani Parent 2 (P2) (MHOM/ET/2010/AM459) expressing red fluorescent protein (dsRFP), both strains originating from Ethiopia, were cultured in M199 medium (Sigma) containing 10% heat-inactivated foetal calf serum (Gibson) supplemented by 1% BME vitamins (Sigma), 2% sterile human urine, 250 μg/ml amikacin (Amikin, Bristol-Myers Squibb), and 150 μg/ml selective antibiotic G 418 (Sigma) and Hygromycin B (Sigma), respectively [4,7]. To obtain amastigote stages, mouse macrophage line J774 was exposed to stationary-phase parasites at a parasite to macrophage ratio 8:1. Both infected and uninfected macrophages were cultured in RPMI medium containing 10% FBS, 100 U/ml of penicillin, 100 μg/ml of streptomycin, 2mM L-glutamine, and 0.05 mM β-mercaptoethanol (all from Sigma) at 37°C with 5% CO2.

Sand fly infections

Amastigote stages were obtained from co-cultivation with J774 cells for 72 h. Non-internalized parasites were removed by washing 3 times with preheated culture medium. Numbers of parasites per macrophages were counted using fluorescent microscopy. Infected macrophages were removed from the cultivation flasks, centrifuged at 200 g for 10 minutes, washed in saline solution and resuspended in heat-inactivated rabbit blood (Bioveta) for sand fly infections at the concentration of 2 × 106 amastigotes ml-1 for eGFP parasites and 5 × 106 amastigotes ml-1 for dsRFP parasites. Different concentrations were used to account for different growth rates. Sand fly females were co-infected by feeding through a chicken skin membrane on a suspension of both Leishmania strains. Engorged females were separated and maintained in standard conditions, as described above. Females were dissected for subsequent analysis on days 2–3 and 7–10 post-blood meal (PBM) (i.e. before defecation of bloodmeal remnants and post defecation, respectively).

Recovery of hybrid Leishmania from sand flies

Live hybrids were recovered by cultivation in double drug selective medium: sand fly females were anesthetized on ice, sterilized in 70% ethanol and washed in sterile saline solution. Dissection was performed under semi-sterile conditions. Dissected midguts were inoculated into wells of microtitration plates containing 50 μl of M199 medium with 10% heat-inactivated fetal calf serum (Gibson), 1% BME vitamins (Sigma), 2% sterile urine, 250 μg/ml amikacin (Amikin, Bristol-Myers Squibb) and fluorocytosin (1.5 mg/ml). The selective antibiotics were both applied after 24 h of cultivation at a concentration of 200 μg/ml in a total volume 100 μl of media. After 7 days live promastigotes were sub-cultured into 1 ml of the medium with double selective antibiotics at a concentration of 150 μg/ml. Presence of the hybrids in cultures were checked by fluorescent microscopy and positive cultures were cryopreserved in liquid nitrogen for further characterisation of recovered parasites.

FACS analysis

At different time intervals PBM, guts of infected sand flies were dissected into a small volume of saline solution (100 μl) and filtered using 30 μl filters (Partec) into a further 2 ml of saline solution. Putative hybrid cells were sorted with a BD Influx instrument (BD Biosciences) with the laser emitting at 488 nm wavelength for eGFP and 516 nm wavelength for dsRFP and detection of emission at 530/30 (eGFP positive events) and 585/29 nm (dsRFP positive events). The cytometer was calibrated using both a positive control (eGFP and dsRFP transfected lines of Leishmania) and a negative control (wild type Leishmania strain). Events showing double positive emission were collected into 384 well glass bottom plates with lid (In Vitro Scientific) with 50 μl of saline solution. After complete cell sorting, glass bottom plates with potential hybrid cells were rapidly vortexed and centrifuged (4000 rpm for 1 min) to concentrate cells on the bottom of the plates. Events showing double-positive emission were analysed using the Inverted fluorescence microscope Delta Vision Core (Life Sciences) to detect single cells co-expressing red and green fluorescence.

Morphometry of hybrid Leishmania

Phlebotomus argentipes females co-infected with both parental L. donovani strains were dissected at days 7–9 PBM and the midguts containing parasites were embedded into Vectashield HardSet Antifade Mounting Medium (Vector laboratories, USA) and examined under the Zeiss LSM 880 confocal microscope. Abdominal and thoracic parts of midguts were embedded and evaluated separately. The spectral characteristics of both eGFP and dsRFP tagged cells were examined using a GaAsP spectral detector separately and subsequent on-line unmixing was performed to distinguish between red and green forms in mixed populations. This approach more effectively separated throughput of eGFP and dsRFP signals. Imaging was performed in Nyquist resolution using tile scan function to cover a larger area using a Plan-Apochromat 25x/0.8 oil immersion objective. For high resolution 3D imaging a Plan-Apochromat 63x/1.4 oil immersion objective was used. A 488 nm laser line for eGFP and 561 nm laser line for dsRFP were used in parallel as the excitation sources. Body length, flagellar length and body width of parasites were measured using Image-J software [17]. Three morphological forms were distinguished, according to Sadlova et al [18]: short promastigotes (SP, body length < 14 μm and flagellar length ⩽twice body length), elongated nectomonads (EN, body length ≥ 14 μm) and metacyclic promastigotes (MP, body length < 14 μm and flagellar length >2 times body length). In total, 333 promastigotes were measured.

Cloning of hybrid Leishmania on solid media

Three batches comprising a total of 19 hybrid cultures from 2 sand fly species (Phlebotomus orientalis and P. argentipes) were transferred to the London School of Hygiene & Tropical Medicine (Table 1) and maintained in α-MEM (Sigma) supplemented with 10% inactivated foetal calf serum (FBS) and both selective antibiotics, each at 150 μg/ml and 25°C. For cloning cultures were grown on solid media agar plates of α-MEM, with 3% agar (Sigma), and both antibiotics, adapted from Yeo et al. [19]. Briefly, 10 μl of a 5 x 103 promastigotes/ml dilution of each culture was spread evenly over the surface of the solid medium, plates sealed with parafilm and incubated at 25°C until individual clonal colonies became visible. One to ten colonies were isolated from each plate and inoculated into 2.5 ml of α-MEM, 10% FBS and both selective antibiotics. The cloned isolates were screened for fluorescence by epifluorescence microscopy and highly expressing cultures were selected. To confirm expression of both fluorescent proteins 1 ml of 1 x 107 promastigotes/ml was mixed with 1 ml of 4% paraformaldehyde in phosphate-buffered saline solution (PBS), incubated for 30 mins at room temperature, washed in 1 ml of PBS, centrifuged at 1800 x g for 10 mins, resuspended in 200 μl of PBS, and 100 μl of the suspension applied to individual wells in a multiwell polysine-coated slide, which was left to settle for 30 mins at room temperature. Excess fluid was removing by blotting, the slide washed three times in PBS (5 mins) and left to air dry; 10 μl of Vectashield mounting medium incorporating DAPI (Vector Laboratories, USA) was added to each well, covered with a coverslip and sealed with clear nail polish. Samples were examined using a Zeiss confocal laser scanning microscope and colonies containing dual-fluorescent single organisms were thus identified.

thumbnail
Table 1. Nineteen hybrid Leishmania donovani cultures produced by experimental sand fly infection, and vector origins.

https://doi.org/10.1371/journal.pntd.0011920.t001

FACS analysis of clones

From the selected cultures 1 x 107 parasites were taken at mid-log phase and washed with PBS three times by centrifugation at 1800 x g for 10 mins at 4°C, the pellet resuspended in 300 μl PBS, 700 μl of 100% ice-cold methanol added, and homogenised gently by inverting the tube. After 10 mins incubation at 4°C, suspensions were washed three times by centrifugation at 1800 x g for 10 mins with PBS at 4°C and resuspended in 10 ml of PBS (giving a final concentration of 1 x 106 cells/ml). Propidium iodide (PI) and RNAse A were added to a final concentration of 10 μg/ml and 1 μg/ml respectively and incubated for 30 mins at 37°C, protected from light. When bound to DNA and excited at 488 nm PI emits red fluorescence, and the fluorescence emitted by individual cells can be measured and compared to infer ploidy. Fluorescence was detected using a BD FACSCalibur flow cytometer (BD Biosciences, USA) with a setting of 10000 events for each sample. Data were gated to exclude clumps and debris and the cell clusters were plotted as area histograms (FlowJo v10.1).

Genetic analyses of clones

Several genetic analyses were performed on subsets of the 41 cloned hybrids generated at LSHTM. These were: MLST of nuclear and kinetoplastid targets; whole genome sequencing; targeted amplification of the HASPB locus.

Confirmation of integration and MLST sequencing

DNA was extracted from clonal cultures using DNeasy Blood & Tissue Kit (Qiagen, USA) during the mid-log phase, according to the manufacturer’s protocol. Using Primer-BLAST software [18] appropriate primers were selected for the regions flanking the plasmid vector genomic insertion, with one primer hybridising within the expression cassette and one to a SSU sequence absent from the plasmid (S1 Fig). Integration in all selected transgenic hybrid clones and parental strains was confirmed by amplification and DNA electrophoresis.

For multilocus sequence typing (MLST) three nuclear genes were selected, encoding an hypothetical protein in chromosome 36 (Ch36-1130), a non-coding sequence in chromosome 36 (Ch36-0350), a hypothetical protein in chromosome 28 (Ch28), together with a kinetoplastid gene encoding cytochrome b, all targets containing known SNPs suitable for analysis of genetic exchange [19] (S1 Table). Amplification conditions were optimized with different annealing temperatures and PCR performed in 20 μl reaction mixture containing 1 μl of sample, 2 μl of 10 x NH4 Reaction Buffer (Bioline, UK), 0.8 μl of 50 mM MgCl2 (Bioline), 1.6 μl of 2 mM dNTPs (Bioline), 1 μl of 20 pmol/μl forward primer and reverse primer, 0.2 μl of 5U/μl BIOTAQ DNA Polymerase solution (Bioline) and 12.4 μl of ultra-pure water. Amplification conditions were 5 minutes at 95°C, 40 cycles of: 30 seconds at 95°C, 30 seconds at primer/gene specific TAN (S1 Table), 30 seconds at 72°C, and a final elongation step of 5 minutes at 72°C. Products were confirmed by gel electrophoresis with 1.5% m/v agarose in Tris-acetate-EDTA (TAE) buffer containing 0.1 μl/ml of 10000 x GelRed Nucleic Acid Stain (Biotium, USA). The amplified MLST targets were excised from the gel, purified using QIAEX II gel extraction kit (Qiagen) according to the manufacturer’s instructions.

Sequencing reactions were performed in 10 μl of a mixture containing 1 μl of sample, 0.5 μl of BigDye (ThermoFisher Scientific, USA), 1.7 μl of BigDye reaction buffer (ThermoFisher Scientific, USA), 1 μl of 3.2 pmol/μl primer and 5.8 μl of ultra-pure water. Reaction conditions were 1 minute at 96°C for DNA denaturation and 25 cycles of: 10 seconds at 96°C, 5 seconds at 50°C and 4 mins at 60°C, with a rapid thermal ramp of 1°C/second. DNA was then precipitated with ethanol by adding 8 μl of ultra-pure water and 32 μl of 100% ice cold ethanol to each sample, with incubation for 15 mins. The samples were centrifuged at 3000 x g for 45 mins at 4°C, supernatant carefully removed, 50 μl of 70% ice cold ethanol added and after a brief vortex, samples were centrifuged at 2000 x g for 20 mins at 4°C. The supernatant was again removed, and samples dried at 90°C for 1 min. 10 μl of Hi-Di formamide (ThermoFisher Scientific) was added to each sample and the sequencing was performed on an ABI3730 machine (Applied Biosystems, USA). The forward and reverse sequences for each gene were aligned to create consensus sequences and identify SNPs by comparison between both parental strains and the hybrids. Nucleotide positions displaying allelic heterozygosity (split peaks) were classified according to IUPAC nomenclature. A total of 24 hybrid progeny clones were analysed, 13 derived from 5 P. argentipes and 11 from 5 P. orientalis, together with clones representing the two parents (Table 2).

thumbnail
Table 2. Hybrid and parental clones used in MLST analyses.

https://doi.org/10.1371/journal.pntd.0011920.t002

Comparative genomics of parents and hybrid progeny

Whole genomes of both parents and cloned progeny were sequenced at the Karolinska Institute (Sweden) and/or at the Genome Institute of Singapore, using a combination of Illumina and PacBio. A reference assembly was generated for the PacBio sequenced parental strain and was scaffolded using the companion annotation server [20]. Fastq data for parental and progeny strains were aligned to the PacBio reference using bwa (v0.7.17) [21] and processed using samtools (v1.12) [22]. Small variants were called using gatk HaplotypeCaller (v4.1.4.1) [23]. Parent-specific SNPs were found by comparing frequencies of alternate alleles in both parent strains, selecting those that were homozygous for different alleles. Frequencies of parent-specific SNPs were then extracted from progeny and were used to construct bottle brush plots using R to detect recombination. S2 Table lists the accession numbers on the European Nucleotide Archive of the genome sequences from one of the parental and 26 of the hybrid clones.

HASPB diversity

For HASBP, which is a component of the rK28 antigen used in VL diagnosis and of a therapeutic vaccine under trial [24], two primers (LdonHASPBfor 5’- CATAAAACCACTGAGGC-3’ and LdonHASPBrev 5’-ATCTTCGTTCTTCTCCTG-3’) were designed to amplify the repeated regions in the HASPB1 and HASPB2 genes of three parental samples and 7 hybrid clones, as described above but using annealing temperature of 52°C, and 0.4 μM dNTPs. Each band separated by electrophoresis on 1% agarose gels was excised and purified using QIAquick Gel Extraction Kit, according to manufacturer’s instruction, and BigDye reactions conducted with the same amplification primers. Consensus nucleotide sequences were aligned with L. donovani reference genome and translated into amino acid sequence, using Bioedit and Chromas software.

Diversity of diagnostic and vaccine candidates

A wider selection of published proposed L. donovani vaccine and diagnostic candidates was made to compare the diversity between parents and among progeny. Criteria for selection of targets were: high antigenicity; involvement in surface signalling or vital Leishmania metabolism; sequence data or nomenclature that allowed access to such data in the public domain. The gene sequences were extracted from alignments with NCBI database sequences. The SNP-containing sequences were translated to amino acids and a table created with all SNPs classified as either synonymous (no amino acid change), missense (amino acid substitution present) or stop-codon inducing. Finally, a list was created of targets observed to have amino acid sequence diversity (missense and stop codon inducing mutations) impact on diagnostic or vaccine candidates.

Results

Detection and recovery of hybrids

Two methods were used to detect primary hybrid Leishmania from experimental infection—flow cytometry and cultivation of sand fly guts in double-selective media. Both methods revealed presence of hybrid cells, although only in late stage infections (days 7–9 PBM) from P. orientalis and P. argentipes, both of these sand fly species being the proven natural vectors of L. donovani. Early stage infections (days 2–3 PBM) did not yield any hybrids in all four sand fly species (Table 3 and 4); bacterial or fungal infections were higher in these early stage samples (Table 4). Flow cytometry gave positive results in 2 out of 3 experiments with late stage infections in P. orientalis and 2 out of 4 experiments with late stage infections in P. argentipes, although numbers of hybrid cells detected by flow cytometry were very low (Table 3).

thumbnail
Table 3. Flow cytometry analysis detecting both red and green fluorescence by confocal microscopy.

https://doi.org/10.1371/journal.pntd.0011920.t003

thumbnail
Table 4. Cultivation of guts from sand flies co-infected with both parental strains of L. donovani then grown on double drug selective media.

https://doi.org/10.1371/journal.pntd.0011920.t004

Recovery of hybrids in double drug selective media was successful with all 3 late stage infections of P. orientalis and 4 of 7 late stage infections of P. argentipes. Non-hybrid cells usually survived for up to 1 week. Stably growing cultures were obtained in 16% and 10% of isolates from P. orientalis and P. argentipes, respectively (Table 4). All these selected cultures showed both red and green fluorescence by fluorescence microscopy.

Morphology of hybrid Leishmania in sand flies

Morphology of L. donovani was evaluated at days 7–9 PBM with gut smears of P. argentipes co-infected with both parental strains. Hybrid Leishmania were present in both abdominal and thoracic parts of the guts. Representation of three morphological forms among parental and hybrid cells bordered on statistical significance (Chi-square = 9.066, d.f. = 4, P = 0.059). Elongated nectomonads (EN) were more frequent in the GR347 green parental strain than in the AM459 red strain and hybrids (Fig 1).

thumbnail
Fig 1. Proportions of three morphological Leishmania forms in guts of P. argentipes at days 7–9 PBM.

SP, short promastigotes, EN, elongated nectomonads, MP, metacyclic promastigotes, and potentially hybrid yellow short promastigotes.

https://doi.org/10.1371/journal.pntd.0011920.g001

Hybrid clones express both fluorescence proteins and are principally diploid

Of the 19 isolates from dissected sand flies, 41 clonal colonies were obtained, 31 clones from batch 1, 10 from batch 3 and none from batch 2; 14 were derived from P. orientalis and 27 from P. argentipes. All the clones were initially pre-screened for green and red fluorescing cells using an epifluorescence microscope (Table 5). Eight clonal isolates, highly expressing both green and red fluorescence, and parental strain GR347 in duplicate, were selected to assess ploidy of the hybrid population (Fig 2). The DNA contents of the parental strain (P1, GR347) and the clonal isolates clearly showed 2n (G1) and 4n (G2/M) peaks. The percentage of cells in the G1 phase for all the samples ranged from 44.1% to 68.6%, while the percentage in the G2/M phase was between 14.3% to 19.7% (Fig 2). Cultures and single clonal hybrids, previously selected using epifluorescence microscopy from batches 1 and 3 and from both P. orientalis and P. argentipes, were viewed and hybrids confirmed by confocal microscopy (Fig 3).

thumbnail
Fig 2. Frequency of G1 and G2/M populations in parental and hybrid clones indicate that hybrids are diploid.

PI, Propidium iodide; P1.1 and P1.2, parent GR347.

https://doi.org/10.1371/journal.pntd.0011920.g002

thumbnail
Fig 3. Confocal microscopy of in vitro hybrid clones showing: a) DNA (using DAPI) stained, eGFP expressing, dsRED expressing, and dual-expressing yellow hybrid single cells; b) Dual-expressing hybrid cultures, dsRED having a lower level of expression than eGFP.

https://doi.org/10.1371/journal.pntd.0011920.g003

thumbnail
Table 5. Hybrid clones, derived from P. orientalis (ORI) and P. argentipes (ARG), and epifluorescence microscopy.

Origins of C1.3, C1.21, C1.23 and C1.25 are uncertain; + = presence of fluorescence;— = no fluorescence detected.

https://doi.org/10.1371/journal.pntd.0011920.t005

MLST shows nuclear hybridisation

Twenty-four of the hybrid clones were analysed by MLST. From the three nuclear markers, Ch28, Ch36-0350 and Ch36-1130, a total of 13 SNP sites were identified, where parental strains and hybrid clones showed differences, with the hybrid clones possessing allelic heterozygosity at multiple locations (Fig 4). For the cytochrome b kinetoplast gene, whilst the two parental strains possessed distinct genotypes at 5 positions, hybrid clones showed no heterozygosity, possessing only one of the parental genotypes (Fig 5).

thumbnail
Fig 4. Thirteen relevant SNPs found by MLST analysis of three nuclear markers of parental strains and hybrid clones.

WT, Ethiopian L. donovani wild type. Parental strains P1 (GR347) and P2 (AM459); P1.1 and P1.2 (clones derived from GR347); P2.1 and P2.2 (clones derived from AM459). ARG and ORI denotes hybrid clones derived from P. argentipes and P. orientalis respectively. Clones from the same sand fly are indicated by distinct clone ID. SNPs with low level of confidence are denoted with lower cases. NA indicates sequencing data not available; R = G+A; Y = T+C; S = G+C; W = T+A; K = G+T; M = A+C.

https://doi.org/10.1371/journal.pntd.0011920.g004

thumbnail
Fig 5. Analysis of cytochrome b SNPs indicates homozygosity of hybrid kinetoplast DNA.

https://doi.org/10.1371/journal.pntd.0011920.g005

Clonal progeny and chromosomal genomics

Bottle brush plots were used to compare parent 1 (GR347) and parent 2 (AM459) contributions to clonal progeny and to chromosomal diversity. Fig 6 illustrates diversity of chromosome 26 between 4 of the different clonal progeny (labelled 1026_S67; 1001_S42; 1002_S43; 1007_S46). A vertical line is drawn for each SNP position at which parent 1 and parent 2 are homozygous for different alleles. The lines are plotted on the x-axis according to the genomic position on the respective chromosome. The height of the line extending out from the midpoint represents the allele frequency at which both parent 1 (top/ depicted in red) and parent 2 (bottom/ depicted in blue) specific alleles are found in the progeny. The proportional contribution from each parent varies between different sequenced progeny, although at each site a contribution from both parents is almost always observed. As in Figs 6 and S2 plots parent 1 depicted in red and parent 2 depicted in blue to show the allele contributions. However, in S2 Fig contributions are shown for all 36 chromosomes (LDON_1 to LDON_36) of one of the clonal progeny (1026_S67). Hybridisation and allelic diversity are apparent and distributed across all chromosomes of the genome.

thumbnail
Fig 6. Bottle brush plots show contributions to chromosome 26 by parent 1 (depicted in red) and by parent 2 (depicted in blue) and their diversity in 4 of the hybrid clonal progeny (labelled 1026_S67; 1001_S42; 1002_S43; 1007_S46), with each line representing a SNP position (see text).

https://doi.org/10.1371/journal.pntd.0011920.g006

Characterization of HASPB antigen in parents and hybrid progeny

Amplification of HASPB with primers LdonHASPBFor and LdonHASBPRev revealed two expected fragments of 1064 bp and 260 bp in parent 1, corresponding to repeat coding regions in HASPB1 and HASPB2 respectively. However, the same primers also amplified an unexpected fragment of around 420 bp in parent 2. All 7 hybrid clones (C1.1, C1.2, C1.7, C1.27, C1.32, C1.35, C1.36) had indistinguishable profiles with three amplicons of sizes corresponding with those in parental strains; a representative hybrid is shown in Fig 7. Despite multiple optimization the 1064 bp amplicons could not be sequenced, suggesting divergence in the templates. Sequencing of the 260 bp amplicons yielded the predicted HASPB2 repeated coding region in P1.2 and all 7 hybrid clones, and analysis of the 420 bp band of P2.1 and hybrid clones revealed a HASPB1/HASPB2-like combined composition across their 7 repeat coding regions.

thumbnail
Fig 7. HASPB gene amplification pattern of a representative hybrid clone (C1.1) shows characteristics of both parental strains (P).

Sizes (bp) adjacent to DNA ladder.

https://doi.org/10.1371/journal.pntd.0011920.g007

Genomic diversity of parents and progeny in diagnostic and vaccine targets

NCBI sequences of diagnostic and vaccine candidates were blasted against both parental and progeny genomes. Where function was known, most of the genes had roles either in signalling pathways (both intra- and extracellular) or metabolic pathways. In summary, many of the proteins were diverse between the progeny, including those involved in signalling and metabolism, hypothetical proteins coding for surface antigens, such as enolase, ATP synthase alpha subunit. In contrast, other proteins were highly conserved, such as histones and products of housekeeping genes (Table 6; S2 Fig).

thumbnail
Table 6. Missense mutations observed in the Leishmania progeny.

https://doi.org/10.1371/journal.pntd.0011920.t006

Discussion

Trypanosomatids were originally considered to be entirely or predominantly clonal. With the advent of MLST and comparative genomics, evidence of genetic exchange became more apparent in natural populations of Leishmania [25,26]. Initially there were small studies, such as those in Peru [27] that gave convincing evidence of parental Leishmania and hybrid progeny. When larger, wide-ranging populations were analysed, encompassing different continents, it became clear that genetic exchange in Leishmania was commonplace and abundant [2832]. Experimental research proved the occurrence of active genetic exchange in sand flies, demonstrated by infecting flies with pairs of transgenic Leishmania strains carrying different fluorescence and selective drug resistance markers [33,34].

Transmission of infection was increased among hybrids [35]. The growth in the sand flies was dependent on the structure of Leishmania species and the presence of parasite HASPB and SHERP proteins, which could govern whether flies were permissive or resistant to infection [36]. Visualisation of fluorescent hybrids in situ was possible by microscopy of sand fly gut contents [37]. Mating competence could be observed in natural and unnatural vectors [4,38]. Extensive genetic diversity is seen in L. donovani infections [39] and evidence of meiosis sexual recombination in Leishmania species [40].

Here, genetic crosses of two parental strains of L. donovani (GR347 and AM459) were achieved in the two species of sand fly, P. argentipes and P. orientalis. Successful crosses of the two parental strains of Leishmania in these two sand fly species, which have different geographical origins in India and Africa, confirmed the permissive nature of the vectors. Cloning of hybrid progeny from both P. argentipes and P. orientalis produced a series of clonal lines for studies of the nature and diversity of the progeny. The life cycle stages of the hybrids could be clearly visualised within these sand flies, and after cloning, FACS analysis indicated that progeny was predominantly diploid (Fig 2) and diploidy was shown to be consistent with the analyses of sand fly populations, for example by showing genetic profiles of progeny and hybrids among L. donovani in Ethiopia [7]. In contrast, progeny obtained from crosses under stress in vitro appeared to be predominantly tetraploid, and without classical meiosis [9,10].

Multilocus sequence typing targeting three nuclear genes indicated that the progeny were hybrids. In contrast, the kinetoplast cytochrome b target had alternate SNPs derived uniparentally, as has been observed in the kinetoplast genome of other trypanosomatid hybrids [15]. This may be explicable by the complications of communication between kinetoplastid and nuclear genomes.

Genome sequencing confirmed the diversity between cloned hybrid progeny, as exemplified by comparison of a single chromosome between 4 different progeny (Fig 6). Sequencing of all 36 chromosomes of a single progeny genome showed that the hybrid nature of the progeny was consistent across the entire genome, with fluctuations in the allele proportions, as shown in S2 Fig. This extraordinary diversity in the progeny of these genetic crosses was also apparent from the targeted comparative sequence analysis of diagnostic and vaccine candidates, in Table 6. This showed the widespread occurrence of missense mutations across diagnostic and vaccine expression sites of the genomes. In contrast sequence of house-keeping genes was more stable. Aneuploidy in the genomes of Leishmania is another manner in which gene expression and function can evolve [9].

Point-of-care diagnostic tests depend on specificity of antigens. Thus, genetic exchange in Leishmania can give rise to significant diagnostic challenges. As a simple example, the diversity of HASPB was apparent and of particular interest, because this stage-regulated surface protein, essential for development in sand flies, is considered to be a candidate component of therapeutic Leishmania vaccines. To protect efficacy the known diversity of HASPB has been incorporated into a chemotherapeutic vaccine under trial [24].

One approach to diagnostics and vaccine discovery is to apply comparative genomics to analyse the diversity of agents of leishmaniasis or of other infectious agents, collected in endemic regions or that are already present in biological archives. However, this approach can be demanding, ambitious and costly.

As we have seen from our research findings, another powerful approach is to perform genetic crosses in sand flies, analyse the diversity of the diploid progeny and assess the impact of genetic exchange on the diversity of antigen and vaccine candidates. This is an approach that may also be applicable to drug discovery, if potential drug targets are known or can be identified.

Thus, accumulation and conservation of biobanks, should continue to be a crucial part of vaccine, diagnostics and drug discovery. However, herein we have shown the emergence of novel diversity in candidate diagnostic and vaccine coding sequences can occur.

We have also demonstrated that further similar efforts to perform genetic crosses in sand flies can identify strategic high impact targets to guide future control of infectious diseases. Hopefully, the research presented here will encourage future impetus that will continue to benefit from the extraordinary analytical capacity of comparative genomics.

Supporting information

Genome sequence data described in this article have been deposited in the European Nucleotide Archive under accession numbers ERR12185559 –ERR12185585.

S1 Fig. Fluorescent markers.

Fluorescent markers inserted into the Leishmania 18S ssu rRNA locus by PCR confirmed amplification of a region spanning the internal fluorescent and flanking sequences. Primers 5’ FW AGCACTCTTCAACCGCGAAA; RV GTGTCGAGTGTCTCCTCCTTTT (57°C, 1382 bp amplicon); 3’ FW ATTCGCGATCTCACAGAGGC; RV GGTTCACCTACAGCTACCTTGT (62°C, 1589 bp amplicon).

https://doi.org/10.1371/journal.pntd.0011920.s001

(PPTX)

S2 Fig. Progeny chromosomes.

Depicting all 36 chromosomes (LDON_1 to LDON_36) of a single clonal progeny (1026_S67) illustrating hybridization and diversity across the genome.

https://doi.org/10.1371/journal.pntd.0011920.s002

(PDF)

S1 Table. Primers used in amplification of MLST targets for sequencing.

TA−temperature of annealing; FW–forward primer; RV–reverse primer; bp–base pairs; kDNA–kinetoplast DNA.

https://doi.org/10.1371/journal.pntd.0011920.s003

(DOCX)

S2 Table. European Nucleotide Archive accession numbers of Illumina sequences of hybrid clones.

ERR12185567 was from a parental clone.

https://doi.org/10.1371/journal.pntd.0011920.s004

(DOCX)

References

  1. 1. World Health Organization, Leishmaniasis, Geneva, Switzerland, 2023, January.
  2. 2. World Health Organization. Control of the leishmaniases Technical Report Series 949; WHO: Geneva, Switzerland, 2010; pp1–173.3.
  3. 3. Espinosa OA, Serrano MG, Camargo EP, Teixeira MMG, Shaw JJ. An appraisal of the taxonomy and nomenclature of trypanosomatids presently classified as Leishmania and Endotrypanum. Parasitology. 2018;145: 430–442. pmid:27976601
  4. 4. Dostálová A, Volf P. Leishmania development in sand flies: parasite-vector interactions overview. Parasit Vectors. 2012;5: 276. pmid:23206339
  5. 5. Lukes J, Mauricio IL, Schönian G, Dujardin JC, Soteriadou K, Dedet JP, et al. Evolutionary and geographical history of the Leishmania donovani complex with a revision of current taxonomy. Proc. Natl. Acad. Sci. USA 2007;104: 9375–9380. pmid:17517634
  6. 6. Van den Broeck F, Savill NJ, Imamura H, Sanders M, Maes I, Cooper S, et al. Ecological divergence and hybridization of Neotropical Leishmania parasites. Proc. Natl. Acad. Sci. USA. 2020; 117: 25159–25168. pmid:32958676
  7. 7. Cotton JA, Durrant C, Franssen SU, Gelanew T, Hailu A, Mateus D, et al. Genomic analysis of natural intra-specific hybrids among Ethiopian isolates of Leishmania donovani. PLoS Negl. Trop. Dis. 2020; 14: e0007143. pmid:32310945
  8. 8. Glans H, Lind Karlberg M, Advani R, Bradley M, Alm E, Andersson B, Downing T. High genome plasticity and frequent genetic exchange in Leishmania tropica isolates from Afghanistan, Iran and Syria. PLoS Negl. Trop. Dis. 2021; 15: e0010110. pmid:34968388
  9. 9. Dumetz F, Imamura H, Sanders M, Seblova V, Myskova J, Pescher P, et al. Modulation of Aneuploidy in Leishmania donovani during Adaptation to Different In Vitro and In Vivo Environments and Its Impact on Gene Expression. mBio 2017; 8: e00599–17. pmid:28536289
  10. 10. Akopyants NS, Kimblin N, Secundino N, Patrick R, Peters N, Lawyer P, et al. Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector. Science 2009; 324: 265–268.
  11. 11. Louradour I, Ferreira TR, Duge E, Karunaweera N, Paun A, Sacks D. Stress conditions promote Leishmania hybridization in vitro marked by expression of the ancestral gamete fusogen HAP2 as revealed by single-cell RNA-seq. Elife. 2022; 11: e73488. pmid:34994687
  12. 12. Monte-Neto RL, Fernandez-Prada C, Moretti NS. Sex under pressure: stress facilitates Leishmania in vitro hybridization. Trends Parasitol. 2022;38: 274–276. pmid:35181250
  13. 13. https://protect-eu.mimecast.com/s/6EHxC0LKzCMZyRDhWQZml?domain=pubmed.ncbi.nlm.nih.gov Ferreira TR, Sacks DL. Experimental Hybridization in Leishmania: Tools for the Study of Genetic Exchange. Pathogens 2022; 11: 580. https://doi.org/10.3390/pathogens11050580
  14. 14. Gutiérrez-Corbo C, Domínguez-Asenjo B, Pérez-Pertejo Y, García-Estrada C, Bello FJ, Balaña-Fouce R, et al. Axenic interspecies and intraclonal hybrid formation in Leishmania: Successful crossings between visceral and cutaneous strains. PLoS Negl. Trop. Dis. 2022; 16: e0010170. pmid:35139072
  15. 15. Peacock L, Bailey M, Carrington M, Gibson W. Meiosis and haploid gametes in the pathogen Trypanosoma brucei. Curr Biol. 2014; 24: 181–6. pmid:24388851
  16. 16. Volf P, Volfova V. Establishment and maintenance of sand fly colonies. J. Vector Ecol. 2011; 36: Suppl 1, S1–S9. pmid:21366760
  17. 17. Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012; 9: 671–5. pmid:22930834
  18. 18. Sadlova J, Myskova J, Lestinova T, Votypka J Yeo M, Volf P. Leishmania donovani development in Phlebotomus argentipes: comparison of promastigote- and amastigote-initiated infections. Parasitology 2017; 144: 403–410. pmid:27876097
  19. 19. Yeo M, Lewis MD, Carrasco HJ, Acosta N, Llewellyn M, da Silva Valente SA, et al. Resolution of multiclonal infections of Trypanosoma cruzi from naturally infected triatomine bugs and from experimentally infected mice by direct plating on a sensitive solid medium. Int J Parasitol. 2007; 37:111–20. pmid:17052720
  20. 20. Steinbiss S, Silva-Franco F, Brunk B, Foth B, Hertz-Fowler C, Berriman M, et al. Companion: a web server for annotation and analysis of parasite genomes. Nucleic Acids Res. 2016: 44: W29–W34, pmid:27105845
  21. 21. Li H, Durbin R. Fast an accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009;25:1754–60. pmid:19451168
  22. 22. Danecek P, Bonfield JK, Liddle J, Marshall J, Valeriu O, Pollard MO, et al. Twelve years of SAMtools and BCFtools. Gigascience. 2021;10: giab008. pmid:33590861
  23. 23. <Poplin R, Ruano-Rubio V, De Pristo MA, Tim J, Fennell MO, Carneiro, Van der Auwera GA et al. Scaling accurate genetic variant discovery to tens of thousands of samples. https://doi.org/10.1101/201178
  24. 24. Osman M, Mistry A, Keding A, Gabe R, Cook E, Forrester S et al. A third generation vaccine for human visceral leishmaniasis and post kala azar dermal leishmaniasis: First-in-human trial of ChAd63-KH. PLoS Negl Trop Dis. 2017; 11: e0005527. pmid:28498840
  25. 25. Mauricio IL, Yeo M, Baghaei M, Doto D, Pratlong F, Zemanova E et al. Towards multilocus sequence typing of the Leishmania donovani complex: resolving genotypes and haplotypes for five polymorphic metabolic enzymes (ASAT, GPI, NH1, NH2, PGD). Int J Parasitol. 2006; 36: 757–769. pmid:16725143
  26. 26. Galanew T, Hailu AJ, Schönian G, Lewis MD, Miles MA, Yeo M. Multilocus sequence and microsatellite identification of intra-specific hybrids and ancestor-like donors among natural Ethiopian isolates of Leishmania donovani. Int J Parasitol. 2014; 44: 751–757.
  27. 27. Nolder D, Roncal N, Davies CR, Llanos-Cuentas A, Miles MA. Multiple hybrid genotypes of Leishmania (Viannia) in a focus of mucocutaneous Leishmaniasis. Am J Trop Med Hyg. 2007; 76: 573–578. pmid:17360886
  28. 28. Rogers MB, Downing T, Smith BA, Imamura H, Sanders M, Svobodova M et al. Genomic confirmation of hybridisation and recent inbreeding in a vector-isolated Leishmania population. PLoS Genet. 2014; 10: e1004092. pmid:24453988
  29. 29. Imamura H, Downing T, Van den Broeck F, Sanders MJ, Rijal S, Sundar S, et al. Evolutionary genomics of epidemic visceral leishmaniasis in the Indian subcontinent. Elife. 2016; 5:e12613. pmid:27003289
  30. 30. Franssen SU, Durrant C, Stark O, Moser B, Downing T, Imamura H, et al. Global genome diversity of the Leishmania donovani complex. Elife. 2020;25: 9:e51243. pmid:32209228
  31. 31. Inbar E, Shaik J, Lantorno SA, Romano A, Nzelu CO, Owens K, et al. Study on the Occurrence of Genetic Exchange Among Parasites of the Leishmania mexicana Complex. Front Cell Infect Microbiol. 2020;10: 607253. pmid:33365278
  32. 32. Schwabl P, Boité MC, Bussotti G, Jacobs A, Andersson B, Moreira O et al. Colonization and genetic diversification processes of Leishmania infantum in the Americas. Commun Biol. 2021;4: 139. pmid:33514858
  33. 33. Miles MA, Yeo M, Mauricio IL. Genetics. Leishmania exploit sex. Science. 2009; 324(5924):187–189. pmid:19359570
  34. 34. Volf P, Sadlova J. Sex in Leishmania. Science 2009;324(5935):1644. pmid:19556486
  35. 35. Volf P, Benkova I, Myskova J, Sadlova J, Campino L, Ravel C. Increased transmission potential of Leishmania major/Leishmania infantum hybrids. Int J Parasitol. 2007; 37: 589–593.
  36. 36. Sádlová J, Price HP, Smith BA, Votýpka J, Volf P, Smith DF. The stage-regulated HASPB and SHERP proteins are essential for differentiation of the protozoan parasite Leishmania major in its sand fly vector, Phlebotomus papatasi. Cell Microbiol. 2010;12: 1765–79. pmid:20636473
  37. 37. Sadlova J, Yeo M, Seblova V, Lewis MD, Mauricio I, Volf P and Miles MA. Visualisation of Leishmania donovani fluorescent hybrids during early stage development in the sand fly vector. PLoS One. 2011; 6: e19851.
  38. 38. Inbar E, Akopyants NS, Charmoy M, Romano A, Lawyer P, Elnaiem DE et al. The mating competence of geographically diverse Leishmania major strains in their natural and unnatural sand fly vectors. PLoS Genet. 2013;9: e1003672. pmid:23935521
  39. 39. Bhattacharyya T., Boelaert M., Miles MA. Comparison of Visceral Leishmaniasis Diagnostic Antigens in African and Asian Leishmania donovani Reveals Extensive Diversity and Region-specific Polymorphisms. PLoS Neglected Diseases. 2013; 7: e2057. pmid:23469296
  40. 40. Inbar E, Shaik J, Lantorno SA, Romano A, Nzelu CO, Owens K, et al. Whole genome sequencing of experimental hybrids supports meiosis-like sexual recombination in Leishmania. PLoS Genet. 2019;15: e1008042. pmid:31091230