https://orcid.org/0000-0001-6195-0614
Figures
Abstract
Scrub typhus, caused by mite-borne Orientia tsutsugamushi (O. tsutsugamushi), is a major febrile disease in the Asia-Pacific region. The DNA load of O. tsutsugamushi in the blood was previously found to be significantly higher in patients with fatal disease than those with non-fatal disease and correlated with the duration of illness, presence of eschar, and hepatic enzyme levels. In this prospective observation study, we analyzed the association of bacterial DNA load with clinical features, disease severity, and genotype using real-time PCR targeting the 56 kDa TSA gene of O. tsutsugamushi in the blood samples of 117 surviving patients with scrub typhus who had not received appropriate antibiotic treatment. The median O. tsutsugamushi DNA load was 3.11×103 copies/mL (range, 44 to 3.3×106 copies/mL). The severity of patients was categorized as mild, moderate, and severe based on the number of dysfunctional organs, and no significant difference in O. tsutsugamushi DNA load was found among these groups. Patients infected with the Karp group showed a significantly higher O. tsutsugamushi DNA load than those in the Gilliam (P < 0.05) and TA763 (P < 0.01) groups. Patients belonging to the Li ethnic group showed a significantly higher DNA load than those in the Han ethnic groups. The blood bacterial DNA load of patients showed no significant difference between groups divided by gender, age, with or without eschar, or the season of disease onset. The highest body temperature recorded during fever onset was positively correlated with O. tsutsugamushi DNA load (ρ = 0.272, P = 0.022). Correlation analyses indicated that the serum total bilirubin level was positively correlated with O. tsutsugamushi DNA load. In conclusion, the findings in this study demonstrated the association of DNA load of O. tsutsugamushi with the severity and genotype in patients with scrub typhus in Hainan, China.
Author summary
High genomic DNA load is a marker for the virulence of the pathogen and is associated with disease severity in bacterial infectious diseases. Recent studies have indicated that the non-surviving patients with scrub typhus had a significantly higher bacterial load than the surviving patients, and that duration of illness, presence of eschar, and hepatic enzyme levels were positively correlated with the O. tsutsugamushi DNA load in patient from northeast Thailand and South Korea. However, the severity and fatality of scrub typhus showed largely geographic variability. To further analyze the association of genomic DNA load with severity in surviving patients, the O. tsutsugamushi genomic load in blood samples of patients with scrub typhus in Hainan, China was evaluated. The results indicated that O. tsutsugamushi DNA load was associated with the genotypes, ethnic group of the patients, the highest body temperature recorded during fever onset and the total bilirubin (TBil) in the blood. However, no significant difference in O. tsutsugamushi DNA load was found between mild, moderate, and severe patient groups, nor between groups of patients with or without eschar. This research contributes to a better overall understanding of the pathogenic mechanism of O. tsutsugamushi.
Citation: Wang G, Fu R, Zhang L, Xue L, Al-Mahdi AY, Xie X, et al. (2023) Genomic bacterial load associated with bacterial genotypes and clinical characteristics in patients with scrub typhus in Hainan Island, Southern China. PLoS Negl Trop Dis 17(4): e0011243. https://doi.org/10.1371/journal.pntd.0011243
Editor: Manisha Biswal, Postgraduate Institute of Medical Education and Research, INDIA
Received: July 6, 2022; Accepted: March 14, 2023; Published: April 21, 2023
Copyright: © 2023 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All sequences analyzed during this study are available from the NCBI database (GenBank accession No. ON862382 - ON862498).
Funding: This study was supported by the Hainan Provincial Natural Science Foundation of China (http://dost.hainan.gov.cn/) grant No. 820RC628 (awarded to FY), 820QN267 (awarded to GW), 820QN412 (awarded to MX), 821QN258 (awarded to RP), 821QN0896 (awarded to YH) and 822MS076 (awarded to GW), the Key Research and Development Plan of Hainan Province (http://dost.hainan.gov.cn/) grant No. ZDYF2022SHFZ085 (awarded to FY) and ZDYF2022SHFZ098 (awarded to LZ), the Education Department of Hainan Province (http://edu.hainan.gov.cn/) grant No. Hnky021-40 (awarded to CT), the National Natural Science Foundation of China (https://isisn.nsfc.gov.cn/pmpweb/login) grant No. 82060378(awarded to FY), 81860367(awarded to FY), the Open Foundation of Key Laboratory of Tropical Translational Medicine of Ministry of Education, Hainan Medical University (https://ttm.hainmc.edu.cn/) grant No. 2021TTM005 (awarded to LZ), HYPY201919(awarded to YH), the Major Science and Technology Program of Hainan Province (http://dost.hainan.gov.cn/) grant No. ZDKJ202003 (awarded to FY) and ZDKJ2021035 (awarded to CH), Hainan Province Clinical Medical Center (http://wst.hainan.gov.cn/swjw/) QWYH202175 (awarded to MX) and donations from the Lee Wan Keung Charity Foundation Limited, Marina Man-Wai Lee, and the Hong Kong Hainan Commercial Association South China Microbiology Research Fund (awarded to JF-WC). The funding sources had no role in the study design, data collection, analysis, interpretation, or writing of this report.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Orientia tsutsugamushi (O. tsutsugamushi) is an obligate intracellular bacterium that causes the mite-borne acute febrile disease scrub typhus, which accounts for up to 20% of all febrile cases in the Asia-Pacific region (the Tsutsugamushi Triangle). The disease was also discovered in the Arabian Peninsula, Chile, and possibly Kenya, suggesting that it may be more widespread than previously thought [1–4]. The widespread re-emergence of scrub typhus in India, Micronesia, and the Maldives, and the rapid emergence of cases in northern China and South Korea have raised considerable concern in endemic countries [5,6]. The most common clinical features of scrub typhus are fever and headache beginning 7–14 days after inoculation with an infected larval mite. Other symptoms include rash, myalgia, cough, lymphadenopathy, nausea, vomiting, abdominal pain, and eschar at the site of mite bite [7–9]. Additionally, multiple organ failures including acute renal failure, acute respiratory distress, meningoencephalitis, myocarditis, septic shock, and disseminated intravascular coagulation have been reported in severe cases [10,11]. The fatality rate is 30–50% in untreated cases and 4% in cases treated with antibiotics [12,13]. O. tsutsugamushi is subdivided into 3 classes: high virulence (Karp, Kato, and KN-3 serotypes), intermediate virulence (Gilliam serotype), and low virulence (Kuroki, Kawasaki, and KN-2 serotypes) [14]. Although scrub typhus is a major public health issue, it remains a neglected disease worldwide [5].
The severity and fatality of scrub typhus show geographic variability [13]. The basis for this variability remains largely unknown and was proposed to be influenced by multiple factors, including differences in host genetic susceptibility and immune response, variability in the virulence of the pathogen, and vector species. Additionally, recent studies have investigated the relationship between O. tsutsugamushi genomic DNA load and clinical characteristics of scrub typhus. The results indicated that the patients with fatal disease had a significantly higher bacterial load than patients with non-fatal disease, and that duration of illness, presence of eschar, and hepatic enzyme levels were positively correlated with the O. tsutsugamushi DNA load [15,16] High genomic DNA load is a marker for the virulence of the pathogen and is associated with disease severity in bacterial infectious diseases. In severe sepsis, the genomic bacterial load has been proposed to be a useful marker for assessing severity, predicting prognosis, and monitoring clinical response [17]. Patients with a high bacterial load of Mycobacterium tuberculosis complex (MTBC) showed a lower rate of conversion to negative by the 8th week of treatment than those with a lower bacterial burden, and the virulence of MTBC isolates in the macrophage lysis model was positively associated with the MTBC DNA load in sputum of patients [18,19]. In meningococcal disease, a higher DNA load of Neisseria meningitidis is associated with an increased risk of death, prolonged hospitalization, and infection with the more virulent serogroup C [20].
Although studies have examined the relationship of DNA load and disease severity for surviving and non-surviving patients with scrub typhus, the association between DNA load and severity in surviving patients has not been investigated [15,16]. In this study, the O. tsutsugamushi genomic load in blood samples of patients with scrub typhus taken at the time of hospital admission was evaluated, and its association with disease severity, O. tsutsugamushi genotypes, and other clinical features was analyzed.
Methods
Ethics statement
This study was approved by the Ethics Committee of Hainan Medical University. Written informed consent to participate in this study was obtained from adult patients. For patients younger than 18 years, the written informed consent was obtained from their parent or legal guardian.
Patient recruitment and case definition
Patients presenting at the infectious disease departments with acute undifferentiated fever (FUO) were recruited from 4 hospitals in Hainan Province from July 2018 to November 2021. The hospitals included the First Affiliated Hospital of Hainan Medical University, the Second Affiliated Hospital of Hainan Medical University, the People’s Hospital of Haikou City from Haikou, which is the provincial capital, and the People’s Hospital of Qiongzhong Li Miao Autonomous County, located at the center of Hainan Province. Patients who fulfilled the following criteria were enrolled in this study: 1) axillary temperature ≥ 37.5°C accompanied by at least 1 of these symptoms (eschar, skin rash, lymphadenopathy, hepatomegaly, and/or splenomegaly); and 2) history of field exposure within 3 weeks before the onset of symptoms.
Whole blood and serum samples were collected immediately following admission. The samples were transported to the laboratory within 48 h using cold chain transportation and stored at -80°C before testing. The clinical characteristics and demographic features of the enrolled patients were also collected.
Scrub typhus severity was grouped by the number of dysfunctional organs, with mild, moderate, and severe corresponding to no organ dysfunction, one-organ dysfunction, and two-organ or more dysfunction, respectively, as previously described [21,22]. Briefly, organ dysfunction was defined as follows: 1) Pulmonary dysfunction: bilateral pulmonary shadows on chest X-rays with moderate or severe hypoxia (PaO2/FiO2 < 250 mmHg or PaO2 < 60 mmHg or SpO2 < 90%) or mechanical ventilation requirement, 2) Cardiovascular dysfunction: cardiovascular systolic blood pressure < 80 mmHg despite fluid resuscitation or severe anemia (hemoglobin < 60 g/L) or a diagnosis of myocarditis/myocardial ischemia/arrhythmia/heart failure, 3) Central nervous system dysfunction: a clinical diagnosis of epilepsy/cerebral hemorrhage/cerebral infarction/meningitis or coma, 4) Hepatic dysfunction: bilirubin (total) ≥ 42.7μmol/L, 5) Renal dysfunction: creatinine ≥177μmol/L, and 6) Digestive dysfunction: a diagnosis of gastrointestinal hemorrhage
Nucleotide sequence and phylogenetic analyses
Genomic DNA was extracted from whole blood samples using a QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Nested PCR was performed using primers targeting a 483bp fragment of the 56-kDa TSA gene as previously reported [23]]. The amplified product of nested PCR was purified using a QIAquick gel extraction kit (Qiagen) and sent to Sangon Biotech (Sangon, Shanghai) for Sanger sequencing with a 3730×1 DNA analyzer (Applied Biosystems, Foster, CA, USA) in both forward and reverse directions. The 2 obtained sequences of the 56 kDa TSA gene from the same samples were aligned using DNASTAR SeqMan II to obtain a confirmed sequence for further analyses. The resulting sequences (GenBank accession No. ON862382—ON862498) were aligned with the basic local alignment search tool (BLAST) using the National Center for Biotechnology Information (NCBI) database to determine the closest sequences. The newly obtained nucleotide sequences were aligned with their closest related sequences and representative sequences from the worldwide NCBI database using CLUSTAL X software. Phylogenetic analysis was performed using the neighbor-joining method with a bootstrap of 1000.
Quantitative real-time PCR and O. tsutsugamushi DNA load
The 56 kDa TSA protein, a major antigenic determinant, is widely used in the diagnosis and quantification of O. tsutsugamushi infection by real-time PCR [24,25]. In this study, a quantitative real-time PCR assay was developed based on the 56 kDa TSA gene of O. tsutsugamushi (GenBank accession numbers: AY357216, AF050669, AY222631, AY222635, and M33004). The dual-labeled probe (TaqMan) and primers were designed using primer5, and the sequences were as follows: 5′ TGATAAGGATATTAAAGGGCATA 3′ (Ot56KDa-F), 5′ ATACACCCTCAGCAGCATTAAT 3′ (Ot56KDa-R), and 5′ [6-carboxyfluorescein]-ATGGTTGCATCAGGAGCACTTGG-[BHQ1] 3′ (Ot56KDa-Probe). The real-time PCR was performed in a 20-μL reaction mixture containing 5 μL template DNA, 1 μL (10 μmol/L) of each primer, 1 μL (10 μmol/L) probe, 10 μL 2x Fast Probe Mixture (Fast Probe Mixture, China), 0.4 μL 50×Low ROX, and 2.6 μL of distilled water. The reaction conditions consisted of an initial activation at 95°C for 5 min, followed by 40 cycles of 5 s at 95°C and 10 s at 60°C.
Statistical analysis
Statistical analyses were performed using SPSS software version 19.0, and figures were generated using GraphPad Prism 6.0. Nonparametric tests (Kruskal–Wallis test) were used to compare the differences between bacterial DNA copies and the indicated groups. The duration of illness and the highest body temperature recorded during fever among the groups with different disease severity were compared by one-way analysis of variance (ANOVA) tests. Statistical significance was set as P < 0.05. Correlation analyses were performed using Spearman correlation.
Results
Variation of O. tsutsugamushi DNA load in patients with scrub typhus
From 2018 to 2021, 680 blood samples were collected from hospitalized patients with FUO for this prospective observation study. One hundred and forty-two patients were positive for nested PCR, accounting for 21% (142/680) of the FUO patients. Real-time PCR was performed on the 142 nested PCR positive patients, and 135 cases had detectable bacterial loads with detection rate of 95% (135/142), accounting for 20% (135/680) of the FUO patients. The median (interquartile range [IQR], range) O. tsutsugamushi DNA load was 2.92×103 (442–21824, 66–3.3×106) copies/ml. As O. tsutsugamushi is sensitive to treatment with the appropriate antibiotics, to exclude the interference of treatment, 117 samples from patients who had not received prior antibiotic treatments (screened using the medical history information in their medical records), including doxycycline, tetracycline, chloramphenicol, rifampicin, or azithromycin, were selected for further analyses. The most common symptoms of the 117 patients included fever (117/117, 100%) followed by eschar or skin ulcer (44/117, 38%). Other nonspecific symptoms included chill, headache, fatigue, cough, lymphadenopathy, and generalized myalgia (Table 1). The median (IQR) O. tsutsugamushi DNA load of the 117 patients was 3.11×103 (470–21616) copies/mL, ranging between 44–3.3×106 copies/mL (Fig 1). Most (87%) patients had an O. tsutsugamushi DNA load ranging between 1×102 and 1×105 copies/mL, of which 34 cases had a DNA load ranging from 102 to 103 copies/mL, 36 cases ranged between 103 and 104 copies/mL, and 32 cases ranged between 104 and 105 copies/mL. Only 13% of the patients had a DNA load of ≤ 102 copies/mL or ≥ 105 copies/mL.
Relationship between O. tsutsugamushi DNA load and genotype
Phylogenic analysis was performed based on truncated 56 kDa TSA protein gene sequences amplified by nested PCR (S1 Fig). The results indicated that among the 117 cases, 64 were closely related to the Karp group, with sub-genotypes A, B, and C contributing to 29, 15, and 20 cases, respectively. Forty-four cases were closely related to the Gilliam group, comprising 13 and 27 cases with contributions from the JG-B and JG-G sub-genotypes, respectively, and 4 cases of untyped Gilliam. Seven cases were closely related to the TA763 group, all of which were TA763 A sub-genotypes. The DNA loads of the 3 groups were compared, and the results indicated that the DNA load of patients in the Karp group was significantly higher than that in the Gilliam (mean [SD] values: 106926.61 [446370.52] copies/mL versus 16994.09 [40620.40] copies/mL, P = 0.01) and TA763 groups (mean [SD] values: 106926.61 [446370.52] copies/mL versus 470.14 [762.32] copies/mL, P = 0.001) (Fig 2A). No significant difference was observed between the Gilliam and TA763 (P = 0.07) groups (Fig 2A). The DNA loads of the samples between sub-genotypes were further analyzed, and there was no significant difference between sub-genotypes within the Karp (P = 0.21) or Gilliam groups (P = 0.059) (Fig 2B and 2C).
P values among groups were calculated by Kruskal-Wallis test; * represented P < 0.05; ** represented P < 0.01.
The Relationship between O. tsutsugamushi DNA load and general characteristics of patients with scrub typhus
Among the 117 patients, 55% (64/117) were men and 45% (53/117) were women. The mean age of the patients was 55.88 ± 14.33 years, with 1 patient aged < 20 years (10 years old). Among the patients, 43% were 41–60 years old, which was the largest age group, followed by 41% of patients aged > 61 years. Eighty-three of the cases belonged to the Han Chinese ethnic group, 21 belonged to the Li ethnic group. The patients were grouped according to sex, age, and ethnicity, and the DNA load was compared among the groups (Fig 3A, 3B and 3C). The DNA load of patients in the Li group was significantly higher than that of the Han ethnic groups (median DNA load of 8145 copies/mL versus 2177 copies/mL, P = 0.018) (Fig 3C). There was no significant difference in the O. tsutsugamushi DNA load among patients of different sexes (P = 0.48) and ages (P = 0.60) (Fig 3A and 3B).
Relationship between O. tsutsugamushi DNA load and gender (A), age (B) and ethnicity (C) of patients with scrub typhus. P values among groups were calculated by Kruskal-Wallis test; * represented P < 0.05.
The association between O. tsutsugamushi DNA load and clinical characteristics
Detailed medical documentation was available for 77 patients with positive RT-PCR, based on which these cases were categorized as mild (N = 54), moderate (N = 15), or severe (N = 8). Although the median value of O. tsutsugamushi DNA load in the severe group is considerably higher than that in the moderate (mean [SD] values: 210,094.25 [505,200.32] copies/mL versus 5,938.22 [8,908.11], P = 0.11) and mild groups (mean [SD] values: 210,094.25 [505,200.32] copies/mL versus 17,910.41 [38,752.41] copies/mL), these differences were not statistically significant (P = 0.11 and P = 0.21, respectively) (Fig 4A). The duration of illness and the highest body temperature recorded during fever was also compared and no significant difference was found among the three groups with different disease severity. In addition, we compared the differences in DNA load between patients with (N = 44) and without eschars (N = 67), and the results showed no significant differences between the 2 groups (Fig 4B). Patients were divided into 4 groups based on the season of disease onset: spring (March–May), summer (June–August), autumn (September–November), and winter (December–February). A comparison of the O. tsutsugamushi DNA load in patients indicated that there was no significant difference among the 4 groups (P = 0.09) (Fig 4C). The correlation between DNA load and duration of illness (N = 117) and the highest body temperature recorded during fever (N = 77) was also evaluated using correlation analyses. The results indicated that only the highest body temperature (ρ = 0.272, P = 0.022) was positively correlated with O. tsutsugamushi DNA load (Table 2).
Changes in blood profile have been proposed as being related to the severity of scrub typhus. Therefore, we analyzed the correlation of white blood cell count (N = 85), lymphocyte ratio (N = 44), neutrophil ratio (N = 64), platelet count (N = 47), alanine aminotransferase (N = 55), aspartate aminotransferase (N = 53), total bilirubin (TBil) (N = 28), and creatinine (N = 24) with DNA load. The results showed that TBil was positively correlated with DNA load (ρ = 0.454, P = 0.015), whereas other tests showed no significant correlation (Table 2).
Relationship between O. tsutsugamushi DNA load with severity of disease (A), eschars (B) and disease onset (C). P values among groups were calculated by Kruskal-Wallis test; * represented P < 0.05, ** represented P < 0.01.
Discussion
High bacterial load is an indicator of disease severity in many infections; however, the association between O. tsutsugamushi DNA load and disease severity has not been widely investigated. In this study, we analyzed the association of DNA load with disease severity, O. tsutsugamushi genotype and clinical factors in 117 patients who had not received appropriate antibiotic treatment. Our results indicated that 95.07% of nested PCR positive patients had detectable bacterial loads in real-time PCR assays. Several real-time PCR assays have been developed for the detection and quantitative analysis of O. tsutsugamushi infection, in which 16S rRNA genes and the membrane protein 56-kDa and 47-kDa genes are the most widely used targets [15,16,26]. In this study, we developed a real-time PCR assay for the quantification of O. tsutsugamushi targeting the 56-kDa TSA gene of O. tsutsugamushi, and the assay showed good concordance with the nested PCR assay.
The median O. tsutsugamushi DNA load in this study was 3.11×103 copies/mL, ranging between 44 and 3.2×106 copies/mL. However, this load varies among studies; Singhsilarak et al. reported a median number of 4.2×106 copies/mL (range, 1×106–2.88 ×107 copies/mL) using real-time PCR targeting the 47 kDa gene in 7 patients with scrub typhus and positive RT-PCR, whereas Kim et al. reported a median number of 7.8×104 copies/mL (range 3,960) in surviving patients, and a median number of 8.38×107 copies/mL (range 244,600) in 3 non-surviving patients using the same primers and probes [15,16]. Sonthayanon et al reported a median number of 284 copies/mL of O. tsutsugamushi DNA (range, 124–943 copies/mL) in 81 patients with positive quantitative RT-PCR results targeting 16 S rRNA [15]. In addition to population, chigger species, and O. tsutsugamushi strains, variation in bacterial loads was proposed to be partially affected by the target genes selected for the RT-PCR assay and inclusion criteria of these studies [15].
The mortality rate of scrub typhus varies greatly among regions studied, and the cause of this variation remains largely unknown; however, the distribution of O. tsutsugamushi genotypes was proposed to play an important role in this variation [16]. Karp and closely related strains are found in most endemic countries, including Japan, Korea, China, Thailand and Southeast Asia [12,13,27]. The dominance of sub-genotypes varies among countries: Boryong is predominant in South Korea, Karp_C in Japan, and Karp_A in Taiwan, Thailand and Cambodia [13,27]. Several sub-genotypes of the Gilliam group are also prevalent in endemic countries: the Kawasaki genotype is prevalent in South Korea, and the JG-C genotype is primarily found in Taiwan, Thailand and Cambodia [27]. Isolates belonging to the TA763 and Kato groups were mainly reported in Taiwan [27]. The characteristics of the genetic components of each genotype can influence the ability of O. tsutsugamushi to invade the host, grow in large numbers, and disseminate. The severity and clinical presentation of scrub typhus were found to be strain-dependent in both humans and laboratory animals [7,28]. Differences in clinical features between prototypes of O. tsutsugamushi have also been reported. Patients infected by the Boryoung cluster had significantly more generalized weakness, eschars, skin rashes, conjunctival injection, high albumin levels, and greater ESR and fibrinogen levels than those infected with the Karp cluster; however, the treatment response to current antibiotics was significantly slower in the Karp cluster than in the Boryoung cluster [14]. Additionally, the Karp genotype was proposed as a severe genotype. Consistently, our results indicate that Karp is correlated with the severe clinical characteristics of patients. The DNA load of the Karp genotype was significantly higher than that of the Gilliam and TA763 genotypes, indicating a more efficient propagation of O. tsutsugamushi and a slower immune clearance in infections with the Karp genotype. Similar results were reported in C57BL/6NJcl mice showing a higher bacterial load of the Karp genotype compared to the less virulent strain UT176 [29].
Genetic differences in host populations may influence susceptibility and responses to O. tsutsugamushi infection and are proposed to be another factor that influences DNA load. Single-nucleotide polymorphisms (SNPs) in TLR2, TLR4, and HSP70 genes, which lead to variations in immune response and alter susceptibility to various infectious diseases, were analyzed in the Tamil-speaking Dravidian ethnic group in India, and the prevalence of the TLR4D299G SNP was found to be significantly higher in patients with scrub typhus than in controls [30]. A genome-wide association study (GWAS) in Korean patients with scrub typhus identified 8 potent scrub typhus-related SNPs located on PRMT6, PLGLB2, DTWD2, BATF, JDP2, ONECUT1, WDR72, KLK, MAP3K7, and TGFBR2 genes [31]. A study in mice using the Gilliam strain found that O. tsutsugamushi infections showed significantly different degrees of virulence due to genetic differences between mouse strains [32]. Additionally, a comparison of lethal and nonlethal mouse models of O. tsutsugamushi infection revealed differences in CD4+ and CD8+ T-cell population-associated cytokines between the 2 groups [33]. Notably, in the present study, patients in the Li ethnic group showed significantly higher DNA load than the Han groups. To verify whether the difference was caused by the infecting O. tsutsugamushi genotypes, the composition of the genotypes in Han and Li ethnic groups was analyzed. The main genotypes of Han ethnic groups (N = 51) were Karp (N = 30, 59%), Gilliam (N = 18, 35%), and TA763 (N = 3, 6%), while those of Li ethnic groups (N = 21) were Karp (N = 13, 62%) and Gilliam (N = 8, 38%). Statistical analysis showed that the genotypes of the two ethnic groups were not significantly different. Additionally, 95% (20/21) of the Li ethnic patients were recruited in the Qiongzhong Li Miao Autonomous County. The county is located at the center of Hainan Island and most of the area is mountainous with forests. Most patients of the area are forest workers or rubber workers. In contrast, patients recruited in Haikou were mostly from the coastal cities and the vegetation varied from Qiongzhong. Patients from Haikou also had various occupations including farmers and factory workers. These differences in ecological and behavioral factors may also contribute to the difference in O. tsutsugamushi DNA load between patients of Li and Han ethnic groups. It would be interesting to assess the existence of SNPs in these patients that might explain the variations in the immune response and susceptibility to O. tsutsugamushi infection.
Sonthayanon et al. reported that hepatic enzymes are positively correlated with O. tsutsugamushi DNA load in patients recruited in northeast Thailand [15]. In contrast, we found no significant difference in O. tsutsugamushi DNA load between the severe, moderate, and mild groups. This is consistent with the finding of no correlation between hematological indicators and DNA load, with the exception of TBil being positively related to DNA load, which is indicative of hepatic impairment. Eschar is a typical clinical sign of scrub typhus, and the prevalence of eschar in patients has been reported to be highly variable (7%–80%) and largely dependent on the O. tsutsugamushi genotype [14,34]. The presence of eschar was reported to be correlated with DNA load in the study by Sonthayanon et al.; however, although eschar was observed in 40.5% (45/111) of patients with physical examination data available in this study, no significant difference was found between patients with and without eschar [15]. The differences in the correlation analyses of DNA load with clinical characteristics between this study and that by Sonthayanon et al. may be due to multiple factors. The population in the study reported by Sonthayanon et al. in northeast Thailand was predominantly Thai, whereas our study population was predominantly Han and Li ethnic groups. Additionally, the differences could be related to the chigger. The main vectors of scrub typhus in Thailand were reported to be Leptotrombidium imphalum, L. deliense, and L. chiangraiensis. In contrast, although the vectors in Hainan Island were not studied widely, the mainly reported vector was L. deliense [35,36]. Bitten by different species of chiggers could result in the difference in clinical characteristics in both human and mice, which may also related to O. tsutsugamushi DNA load [37,38].
The major limitation of the study was that a small number of cases with scrub typhus were include. In addition, only 77 patients had detailed medical documentation. Another limitation of the study was that only some of the cases had a detailed blood profile comprising all the indicators shown in Table 2, as the clinical test items varied among patients with different symptoms. This may have led to bias in the results obtained from correlation analyses. A larger sample cohort with more clinical data is recommended in future studies to explore the relationship between O. tsutsugamushi DNA load and clinical characteristics in patients with scrub typhus.
Conclusion
In conclusion, our study demonstrated that genomic DNA load of O. tsutsugamushi was associated with its genotypes, ethnic group of the patients, the highest body temperature recorded during fever onset and the total bilirubin (TBil) in the blood. However, no significant difference in O. tsutsugamushi DNA load was found when comparing mild, moderate, and severe patient groups nor when comparing the groups of patients with or without eschar. This research contributes to the understanding of the pathogenic mechanism of O. tsutsugamushi.
Supporting information
S1 Fig. Phylogenetic analysis of truncated 56 kDa TSA protein gene sequences of Orientia tsutsugamushi.
Phylogenetic analysis was performed using the software MEGAX. Phylogenetic tree was constructed by the neighbor-joining method with bootstrap of 1000 repeat.
https://doi.org/10.1371/journal.pntd.0011243.s001
(DOCX)
Acknowledgments
The authors wish to thank all the patients for participating in this study, and the support from Emerging Tropical Infectious Diseases Science Innovation Group of Hainan Medical University and the Hainan Tropical Infectious Diseases Biobank.
References
- 1. Horton KC, Jiang J, Maina A, Dueger E, Zayed A, Ahmed A, et al. Evidence of Rickettsia and Orientia Infections Among Abattoir Workers in Djibouti. Am J Trop Med Hyg. 2016;95(2):462–465. pmid:27273647
- 2. Maina AN, Farris CM, Odhiambo A, Jiang J, Laktabai J, Armstrong J, et al. Q Fever, Scrub Typhus, and Rickettsial Diseases in Children, Kenya, 2011–2012. Emerg Infect Dis. 2016;22(5):883–886. pmid:27088502
- 3. Izzard L, Fuller A, Blacksell SD, Paris DH, Richards AL, Aukkanit N, et al. Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai. J Clin Microbiol. 2010;48(12):4404–4409. pmid:20926708
- 4. Weitzel T, Dittrich S, López J, Phuklia W, Martinez-Valdebenito C, Velásquez K, et al. Endemic Scrub Typhus in South America. N Engl J Med. 2016;375(10):954–961. pmid:27602667
- 5. Li Z, Xin H, Sun J, Lai S, Zeng L, Zheng C, et al. Epidemiologic Changes of Scrub Typhus in China, 1952–2016. Emerg Infect Dis. 2020;26(6):1091–1101. pmid:32441637
- 6. Walker DH. Scrub Typhus—Scientific Neglect, Ever-Widening Impact. N Engl J Med. 2016;375(10):913–915. pmid:27602663
- 7. Díaz FE, Abarca K, Kalergis AM. An Update on Host-Pathogen Interplay and Modulation of Immune Responses during Orientia tsutsugamushi Infection. Clinical microbiology reviews. 2018;31(2)e00076. pmid:29386235
- 8. Salje J, Fisher J, Card G, Soong L. Neuroinflammation associated with scrub typhus and spotted fever group rickettsioses. PLoS Negl Trop Dis. 2020;14(10):e0008675. pmid:33091013
- 9. Wang YC, Chen PC, Lee KF, Wu YC, Chiu CH. Scrub typhus cases in a teaching hospital in Penghu, Taiwan, 2006–2010. Vector Borne Zoonotic Dis. 2013;13(3):154–159. pmid:23421889
- 10. Jeong YJ, Kim S, Wook YD, Lee JW, Kim KI, Lee SH. Scrub typhus: clinical, pathologic, and imaging findings. Radiographics. 2007;27(1):161–172. pmid:17235005
- 11. Tsay RW, Chang FY. Serious complications in scrub typhus. J Microbiol Immunol Infect. 1998;31(4):240–244. pmid:10496165
- 12. Kelly DJ, Fuerst PA, Ching WM, and Richards AL. Scrub typhus: the geographic distribution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clin Infect Dis. 2009;48 Suppl 3:S203–230. pmid:19220144
- 13. Xu G, Walker DH, Jupiter D, Melby PC, Arcari CM. A review of the global epidemiology of scrub typhus. PLoS Negl Trop Dis. 2017;11(11):e0006062. pmid:29099844
- 14. Kim DM, Yun NR, Neupane GP, Shin SH, Ryu SY, et al. Differences in Clinical Features According to Boryoung and Karp Genotypes of Orientia tsutsugamushi. PLoS ONE. 2011;6(8):e22731. pmid:21857951
- 15. Sonthayanon P, Chierakul W, Wuthiekanun V, Phimda K, Pukrittayakamee S, Day NP, et al. Association of high Orientia tsutsugamushi DNA loads with disease of greater severity in adults with scrub typhus. J Clin Microbiol. 2009;47(2):430–434. pmid:19091812
- 16. Kim SW, Kim CM, Kim DM, Yun NR, Neupane GP, Pyun SH, et al. Orientia tsutsugamushi DNA load and genotypes in blood as a marker of severity. Acta Trop. 2021;215:105786. pmid:33309595
- 17. Lisboa T, Waterer G, Rello J. We should be measuring genomic bacterial load and virulence factors. Crit Care Med. 2010;38(10):S656–662. pmid:21164411
- 18. Tram TTB, Nhung HN, Vijay S, Hai HT, Thu D, Ha V, et al. Virulence of Mycobacterium tuberculosis Clinical Isolates Is Associated With Sputum Pre-treatment Bacterial Load, Lineage, Survival in Macrophages, and Cytokine Response. Front Cell Infect Microbiol. 2018;8:417. pmid:30538956
- 19. Sabiiti W, Azam K, Farmer ECW, Kuchaka D, Mtafya B, Bowness R, et al. Tuberculosis bacillary load, an early marker of disease severity: the utility of tuberculosis Molecular Bacterial Load Assay. Thorax. 2020;75(7):606–608. pmid:32354738
- 20. Darton T, Guiver M, Naylor S, Jack DL, Kaczmarski EB, Borrow R, et al. Severity of meningococcal disease associated with genomic bacterial load. Clin Infect Dis. 2009;48(5):587–594. pmid:19191644
- 21. Astrup E, Janardhanan J, Otterdal K, Ueland T, Prakash JAJ, Lekva T, et al. Cytokine network in scrub typhus: high levels of interleukin-8 are associated with disease severity and mortality. PLoS Negl Trop Dis. 2014;8(2):e2648. pmid:24516677
- 22. Furuya Y, Yoshida Y, Katayama T, Yamamoto S, Kawamura A. Serotype-specific amplification of Rickettsia tsutsugamushi DNA by nested polymerase chain reaction. J Clin Microbiol. 1993;31(6):1637–1640. pmid:8315007
- 23. Kang SJ, Park KJ, Jin HM, Cho YN, Oh TH, Kim SE, et al. Circulating Plasmacytoid and Conventional Dendritic Cells Are Numerically and Functionally Deficient in Patients With Scrub Typhus. Front Immunol. 2021;12:700755. pmid:34276693
- 24. Kim DM, Park G, Kim H.S, Lee JY, Neupane GP, Graves S, et al. Comparison of conventional, nested, and real-time quantitative PCR for diagnosis of scrub typhus. J Clin Microbiol. 2011;49(2):607–612. pmid:21068287
- 25. Bakshi D, Singhal P, Mahajan SK, Subramaniam P, Tuteja U, Batra HV. Development of a real-time PCR assay for the diagnosis of scrub typhus cases in India and evidence of the prevalence of new genotype of O. tsutsugamushi. Acta Trop. 2007;104(1):63–71. pmid:17870041
- 26. Sonthayanon P, Chierakul W, Wuthiekanun V, Blacksell SD, Pimda K, Suputtamongkol Y, et al. Rapid diagnosis of scrub typhus in rural Thailand using polymerase chain reaction. Am J Trop Med Hyg. 2006;75(6):1099–1102. pmid:17172374
- 27. Kim G, Ha NY, Min CK, Kim HI, Yen NT, Lee KH, et al. Diversification of Orientia tsutsugamushi genotypes by intragenic recombination and their potential expansion in endemic areas. PLoS Negl Trop Dis. 2017;11(3):e0005408. pmid:28248956
- 28. Wei Y, Ma Y, Luo L, Wu X, Huang Y, Li X, et al. Differences in Clinical and Laboratory Features for Different Genotypes of Orientia tsutsugamushi in Guangzhou, Southern China. Vector Borne Zoonotic Dis. 2017;17(4):260–267. pmid:28055333
- 29. Mika-Gospodorz B, Giengkam S, Westermann AJ, Wongsantichon J, Kion-Crosby W, Chuenklin S, et al. Dual RNA-seq of Orientia tsutsugamushi informs on host-pathogen interactions for this neglected intracellular human pathogen. Nat Commun. 2020;11:3363. pmid:32620750
- 30. Janardhana J, Joseph Martin S, Astrup E, Veeramanikandan R, Aukrust P, Abraham OC, et al. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus. J Hum Genet. 2013;58(11):707–710. pmid:23985798
- 31. Kim YC, Kim S, Kim HK, Lee Y, Shin C, Lee C, et al. Genome-Wide Association Study Identifies Eight Novel Loci for Susceptibility of Scrub Typhus and Highlights Immune-Related Signaling Pathways in Its Pathogenesis. Cells. 2021;10(3):570. pmid:33807835
- 32. Groves MG, Osterman JV. Host defenses in experimental scrub typhus: genetics of natural resistance to infection. Infect Immun. 1978;19(2):583–588. pmid:415980
- 33. Luce-Fedrow A, Chattopadhyay S, Chan TC, Pearson G, Patton JB, Richards AL. Comparison of Lethal and Nonlethal Mouse Models of Orientia tsutsugamushi Infection Reveals T-Cell Population-Associated Cytokine Signatures Correlated with Lethality and Protection. Trop Med Infect Dis. 2021;6(3):121. pmid:34287349
- 34. Rajapakse S, Rodrigo C, Fernando D. Scrub typhus: pathophysiology, clinical manifestations and prognosis. Asian Pac J Trop Med. 2012;5(4):261–264. pmid:22449515
- 35. Shirai A, Huxsoll DL, Dohany AL, Montrey RD, Werner RM, Gan E. Characterization of Rickettsia tsutsugamushi strains in two species of naturally infected, laboratory-reared chiggers. Am J Trop Med Hyg. 1982;31(2):395–402. pmid:6176132
- 36. Shirai A, Saunders JP, Dohany AL, Huxsoll DL, Groves MG. Transmission of scrub typhus to human volunteers by laboratory-reared chiggers. Jpn J Med Sci Biol. 1982;35(1):9–16. pmid:6808205
- 37. Yu X, Zhan D, Tang T, Liu Z, Fang C, Peng X. Ecological Distribution of Leptotrombium(L) dedefensen Tropical Coral Island. Chin DJ Vector Bio & Control. 2002;13(1):44–45.
- 38. Zhou P, Cai Z, Shi J. Investigation of ecological habits of fixigus in Wuzhishan, Hainan Province. Chinese Journal of Vector Biology and Control. 1996;7(5):361–362.