Ethics statement

All mouse experimental procedures were performed in accordance with the Ethical Principles in Animal Research approved by the Local Ethical Animal Committee (CEUA) of FMRP-USP (protocol 163/2017) and by the NIAID Animal Care and Use Committee (no. LPD 68E). Use of animals in this research was strictly monitored for accordance with the Animal Welfare Act, the Public Health Service Policy, the U.S. Government Principles for the Utilization and Care of Vertebrate Animals Used in Testing, Research, and Training, as well as the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Parasites and mice infection

Leishmania major strains CC1 (MHOM/IR/83/LT252), LV39 (MRHO/SU/59/P), Sd (MHOM/SN/74/SD), Fn (MHOM/IL/80/Friedlin) and Ryan (MHOM/IQ/07/WR2885) were cultured as promastigotes in vitro at 26 °C in complete Medium 199 (M199) supplemented with 20% heat-inactivated fetal calf serum (Gemini Bio-products), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 40 mM Hepes, 0.1 mM adenine (in 50 mM Hepes), 5 mg/ml hemin (in 50% triethanolamine), 1 mg/ml 6-biotin, and 50 μg/ml of Geneticin (G418, Gibco, Woodland, CA, USA). L. major CC1 transfectants (wild type, Δlmjprmt7 and ‘addback’ Δlmjprmt7, which contains ectopic copies of the wild type LmjPRMT7) were previously generated [13]. Parasites overexpressing mCherry were generated for in vivo uptake analysis by electroporation with the SwaI digest fragment from plasmid pLEXSY-mCherry-SAT2 and subsequent selection in complete M199 medium containing 200 μg/mL nourseothricin (Jenabioscence). Drug-resistant clones were obtained by serial dilution and mCherry expression was evaluated on a FACSCANTO II flow cytometer (BD Biosciences).

Infective stage metacyclic promastigotes were isolated from stationary cultures (7d) by density gradient centrifugation as described previously [15]. Mice were then inoculated with 100,000 metacyclic promastigotes in the ear by intradermal injection in a volume of 10 μl. Uninfected mice were used as the control group. Lesion development was monitored weekly by measuring the ear thickness with a direct-reading Vernier caliper (Thomas Scientific).

Female BALB/c mice, 6–8 weeks of age, were maintained in the National Institute of Allergy and Infectious Diseases (NIAID) animal care facility under specific pathogen-free conditions and female BALB/c mice and female C57BL/6 mice were also maintained in the University of São Paulo animal care facility.

Sand fly infection and parasite recovery

The colony of P. duboscqi (originating in Senegal) was maintained in the insectary of the Department of Parasitology, Charles University, under standard conditions (26°C on 50% sucrose, humidity 60–70% and 14h light/10h dark photoperiod) as previously described [16]. At 24 hours prior to the infection feeding, groups of approximately 150 sand fly females (5–7 days old) were separated and deprived of sucrose food. Promastigotes from log-phase cultures were resuspended in heat-inactivated rabbit blood at concentration of 10⁶ cells/mL and offered to sand flies through the chicken skin. Engorged females were separated, provided with sucrose, and maintained under standard conditions until the end of the experiment.

Dissections were performed before defecation (early stage of infection) on day 2 post blood meal (PBM) and after defecation (late stage of infection) on day 8 and 12 PBM. Abundance and localization of the flagellates in the sand fly gut were examined by light microscopy. Parasite loads were graded as light, moderate/medium, and heavy (≤100, 100–1000, and ≥1000 parasites per gut, respectively) [17]. The number of parasites was also assessed by Burker chamber counting. Experimental feeding of P. duboscqi was repeated four times, 209 P. duboscqi females were dissected for localization/estimation analysis and an additional 125 sand flies were dissected for burker chamber counting.

Quantitative real-time PCR

RNA from procyclic promastigote and metacyclic promastigote stages was extracted using TRIzol reagent (Invitrogen), chloroform extraction step and the 70% ethanol wash (both steps performed twice). The extracted RNA was treated with RNase-free DNase (Ambion) and DNase Inactivation Reagent (Ambion). cDNA was synthesized from 2 μg of RNA using the SuperScript Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. An absolute quantification curve was performed for each oligonucleotide pair using serial dilutions of cDNA. Relative quantification was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) in 20 μL reactions. The PCR reactions were performed in an ABI 7500 thermocycler (Applied Biosystems). The following primers were used for quantification: RT_LmjF.06.0870_F (5′-CCATGAGCACCAGCAGCGAAA-3′), RT_LmjF.06.0870-v2_R (5′-GCGGCACGAAGATGTGCTGTT-3′), LLG6PD_F (5′-ACCGCATTGACCACTACCTC-3′), LLG6PD_R (5′-GATGTTGTTCGAGTTCCAC-3′), RNA45_F (CCTACCATGCCGTGTCCTTCTA) and RNA45_R (AACGACCCCTGCAGCAATAC).

Immunoblot analysis

Leishmania cells were pelleted (7 min, 3 °C, 2000 x g), washed with 500 μl of ice-cold PBS containing 1X complete protease inhibitors (Roche) and resuspended in ~ 10 μl of extraction buffer (SDS 2%, 50 mM Tris-Cl pH 7,4, 1 mM PMSF, 1x complete) per 1 x 10⁶cells. The samples were boiled 10 min, quantified on Nanodrop One (Thermo Scientific), mixed with 0.2V of sample buffer 6X (350 mM Tris-Cl pH 6.8, 30% glycerol, 10% SDS, 0.12 mg/mL bromophenol blue, 6% 2-mercaptoethanol) and boiled for 3 more minutes. ~ 40 μg of protein extract were loaded per well in polyacrylamide gels. The proteins were transferred to nitrocellulose membranes (GE Healthcare Life Sciences—REF 10600003), which were incubated with anti-monomethyl arginine antibody (Cell Signaling Technologies—REF 8015S), following manufacturer’s instructions. The antigen-antibody interaction was detected using an ECL kit (GE-Healthcare), and chemiluminescence was visualized using ImageQuant LAS 4000 (GE-Healthcare).

Processing of ear tissues and evaluation of parasite burden

Ear tissue was prepared as previously described [18]. In brief, the two sheets of infected ear dermis were separated, deposited in DMEM containing 0.2 mg/ml Liberase TL–purified enzyme blend (Roche Diagnostics Corp.), and incubated for 1.5 h at 37 °C. Digested tissue was processed in a tissue homogenizer for 3.5 min (Medimachine; Becton Dickinson) and filtered through a 70-μm cell strainer (Falcon Products). For preparation of the draining lymph node, in summary, the lymph nodes were extracted from the mice and macerated into a filter and washed with DMEM media. An aliquot of ear and lymph node homogenates were serially diluted in 96-well, flat-bottom microtiter plates containing 100 μl M199/S for parasite titrations. The number of viable parasites in each ear and draining lymph node was determined from the highest dilution at which promastigotes could be grown out after 7–10 days of incubation at 26 °C.

Immunolabeling and flow cytometry analysis

For immunolabelling, cells processed as above were washed and labeled with Live/Dead fixable AQUA at a 1:500 dilution of the manufacturer suggested stock solution (Invitrogen) to exclude dead cells. Cells were incubated with anti-Fc III/II (CD16/32) receptor Ab (2.4G2), followed by surface staining with various combination of the following antibodies for 30 min at 4 °C in the dark: FITC anti-Ly6G, APC anti-CD206, BV421 anti-SiglecF, APC-Cy7 anti-Ly6C, PE-Cy7 anti-CD11b, PerCp-Cy5.5 anti-CD64. All antibodies were from eBiosciences, BD Biosciences, Biolegends or R&D systems. For intracellular staining, the cells were fixated and permeabilized (Fixation/Permeabilization Concentrate and Fixation/Permeabilization Diluent, Invitrogen) for 20 min at 4 °C. After, the cells were washed twice (Fixation/Permeabilization Buffer, Invitrogen) and added the intracellular antibody for 30 min at 4°C. The Abs used were: FITC anti-γδTCR, FITC anti-NK1.1, APC anti-CD3, PE-Cy7 anti-CD2, APC-Cy7 anti-CD45.2, PerCp-Cy5.5 anti-CD11b. Data were collected using FACSDiva software on a FACSCANTO II flow cytometer (BD Biosciences) and analyzed using FlowJo software (TreeS- tar). To determine the absolute number of cells, a portion of each sample was removed for counting with AccuCheck Counting Beads (Invitrogen).

Neutrophil isolation, leishmania uptake and NET-DNA release measurement

To obtain bone marrow derived neutrophils (BMDNs) the femurs and tibia were isolated and flushed with PBS. Neutrophils were sorted using the Neutrophil Isolation Kit, mouse (Miltenyi Biotec). The cells were infected with L. major strains. Uninfected/untreated neutrophils were used as controls. After 3 h post-infection, the cultures were cytocentrifuged (50 × g, 5 min) and stained with HEMA3 Differential Stain Procedure (Thermo Fisher). The number of neutrophils with intracellular parasites was determined by count among 200 cells/condition, using an Olympus BX50 microscope.

For NET formation assay, neutrophils (2 × 10⁵ cells/well in HBSS) were incubated with different multiplicities of infection (MOIs) of L. major strains and PMA (50 nM), for positive control, in a 96-well plate for 3 h at 37 °C, in 5% CO₂. NET-DNA was quantified by adding SYTOX green nucleic acid stain (Invitrogen; 1 μM) to the supernatant of each incubation in a black 96-well plate and incubating at 37 °C for 10 min. NET-DNA fragments were quantified using a FLx800 Fluorescence Microplate Reader (BioTek Instruments, USA; excitation 485 nm, emission 528 nm) and the results have been expressed as fold to control (HBSS).

RNA-seq in silico analysis

Reads were sequenced with exceptional quality above Q30 (Phred quality score) per base for both sample groups (promastigote metacyclic—META, and promastigote procyclic—PRO). Trimmomatic v. 0.36 [19] was used to remove any Illumina adaptor remaining sequences, and FastQC v. 0.11.5 analysis [20] and multiQC tool v. 1.3.dev0 [21] to calculate the quality of the reads. Bowtie2 v.2.2.6 [22] was used for alignment of reads (local alignment, one mismatch maximum admitted in the alignment seed, reference genome “TriTrypDB-41_LmajorFriedlin”). Other quality parameters were checked using QUALIMAP v.2.2.1 tool [23]. A high percent of reads was properly mapped over the reference genome of the parasite (97,95%) in accordance with the high general alignment of reads (99,24%) (S1 Table). FeatureCounts v. 1.5.3 [24], was used to count the number of reads mapped over each CDS coordinate (GFF file, TriTryDB, version 32). The genes were filtered using Counts Per Million (CPM) at least 1 in all samples. Limma R package was applied to quantile normalization (Trimmed mean of M-Values—TMM method) [25], log2 transformation and mean variance adjustment of count values (Voom) [26]. Similarity between the samples was evaluated by MDS plot. Detection of Differential Expressed Genes (DEG) of each contrast was proceeded using Generalized Linear Model (GLM) method of Limma [27]. p-Values were adjusted for multiple testing using the Benjamini-Hochberg (BH) method and adjusted p-value above 5% and Fold Change (FC) threshold of 1.5 were applied for selection of DEG (S2 Table). The DEG of each contrast (Wild type (WT)- Δlmjprmt7 (Δ7), Δlmjprmt7 [PRMT7] (AB), AB-WT) were clustered by the expression significance level in WT, Δ7 or AB based on Limma T-test (p = 5%—decideTest fuction) and F-test between groups (p = 5%).

All the combinations of expression levels for PRO and META samples are shown in S3 Table. DEG clustered in the combinations 6 (Δ7 down-regulated in relation to WT and AB with no significative difference between WT and AB) and 21 (Δ7 up-regulated in relation to WT and AB with no significative difference between WT and AB) were considered as interesting targets in PRO and META samples. The expression of these genes would be only altered by deletion of PRMT7 and it would be recovered in the ‘addback’ strain (S1 Fig).

Deletion of LmjPRMT7 impairs parasite development in Phlebotomus duboscqi vector

Previous work from our group had shown that deletion of LmjPRMT7 from an attenuated strain of Leishmania major correlates with increased pathogenicity [13]. To assess if LmjPRMT7 could play a role in the ability of the parasite to differentiate to metacyclics we first analyzed in vitro the expression of SHERP, a metacyclic-specific marker [28]. According to our data the levels of SHERP were drastically decreased in Δlmjprmt7 parasites in the metacyclic stage when compared to the wild type parasites (S2 Fig).

We also investigated if LmjPRMT7 could affect the growth and development of the parasite within the sand fly vector. We used Phlebotomus duboscqi, which is a known vector for Leishmania major [29]. Eight days post blood meal (PBM), similar/high infection rates were obtained in females infected with all the three strains (wild type: 75.92%, Δlmjprmt7: 76.92%, Δlmjprmt7 [PRMT7]: 78.94%) (Fig 1A). Localization of infection was also similar, the stomodeal valve (SV) of P. duboscqi was colonized in similar frequency among all tested strains—wild type: 85.29%, Δlmjprmt7: 89.74%, Δlmjprmt7 [PRMT7]: 86.84%, respectively (Fig 1B). However, heavy infections were more frequent in flies infected with the wild type (50.84%) and addback strain (40.25%) compared to the flies infected with Δlmjprmt7 (2.89%), in which predominantly medium and low intensity infections were observed (Fig 1A).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Deletion of LmjPRMT7 results in a decrease in the number of parasites inside the P. duboscqi vector.

(A) Infection rates and parasite load in P. duboscqi on day 2, 8 and 12 post blood meal. Abbreviations: 0 no infection; 0–100 low infection; 100–1000 medium infection; 1000+ heavy infection. (B) Localization of parasites inside the P. duboscqi gut on day 2, 8 and 12 post blood meal. Abbreviations: SV—stomodeal valve, TM—thoracic midgut, AM—abdominal midgut, BM—within the bloodmeal. Data originate from 4 independent experiments; sand flies were infected by 10⁶ parasites per ml of bloodmeal.

https://doi.org/10.1371/journal.pntd.0009230.g001

On day 12 PBM, similar infection rates among all strains were observed (wild type: 77.72%, Δlmjprmt7: 73.91%, Δlmjprmt7 [PRMT7]: 77.78%,) (Fig 1A) and the stomodeal valve was colonized in all infected flies (Fig 1B). As on day 8 PBM, heavy parasite loads prevailed in flies infected with wild type and addback strains, while low and medium intensity infection dominated flies infected with Δlmjprmt7 strain (Fig 1A).

Levels of LmjPRMT7 are negatively correlated with Leishmania major pathogenicity

The interaction of the attenuated L. major strain with the mammalian host was previously shown to be affected by the levels of LmjPRMT7 [13]. Following up these findings we performed a quantitative PCR to evaluate the expression of LmjPRMT7 in different strains of Leishmania major. For this assay we used the attenuated (LT252, clone CC1) strain of L. major in comparison with other known virulent strains of this parasite (Fig 2A). Interestingly, there is no difference in the levels of LmjPRMT7 in all the strains tested in the sand fly-infective procyclic stage (early logarithmic phase—day 2). By contrast, in the mammalian-infective metacyclic stage (enriched metacyclics by Ficoll gradient—day 7) the levels of PRMT7 transcript were higher in the attenuated strain in comparison with the virulent strains. Nevertheless, we observed no major differences in the monomethylation profile when comparing the attenuated with the evaluated pathogenic strains of L. major (S3 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Higher levels of PRMT7 enzyme are found in a nonpathogenic strain of L. major.

(A) Quantitative RT-PCR analysis of RNA extracted from promastigotes during the early-log (procyclic) culture phase and purified metacyclic. Levels of PRMT7 were comparable between the pathogenic Leishmania major strains: Ryan, LV39, Sd and Friedlin (Fn) in comparison to the nonpathogenic CC1 strain. The expression is relative to the expression of the G6PD and RNA45 genes. The results are shown as mean ± SEM. p < 0.05 (*) and p < 0.01 (**) were considered statistically significant. Statistical analysis was performed by Two-way ANOVA followed by Sidak post-test. (B) BALB/c mice (n = 5 per group) were injected with 10⁵ metacyclic promastigotes of the different strains of L. major and ear thicknesses were followed weekly. (C) Image of infected ears 5 weeks post infection and photos were taken by the author. Five weeks after infection, parasite titers were determined in the ear (D) and draining lymph node (E). The results are shown as mean ± SEM. For the parasite burden, statistical analysis was conducted comparing virulent strains with the LmjCC1 attenuated line. Statistical analysis was performed by unpaired, two-tailed student’s t-test. *p<0.05.

https://doi.org/10.1371/journal.pntd.0009230.g002

To confirm that L. major CC1 is less pathogenic than the other tested strains we monitored the thickness of BALB/c ear lesions in vivo for 5 weeks post infection (Fig 2B). As expected, infection with L. major CC1 strain caused minor lesions during the period analyzed. By contrast, each of the other strains produced uncontrolled, ulcerative lesions (Fig 2C). To verify possible differences in parasites proliferation and survival in the site of infection in the different strains after 5 weeks of infection, we quantified the parasite burdens in the infected ears (Fig 2D) and the draining lymph nodes (Fig 2E). As expected, there was a positive correlation between lesion formation and parasite load, with the number of parasites significantly lower in the attenuated L. major CC1 strain.

Deletion of LmjPRMT7 from the attenuated strain of L. major rescues pathogenicity

To determine if the elevated expression of LmjPRMT7 is causally associated with the attenuated phenotype of the L. major CC1 strain, we examined whether CC1 lacking LmjPRMT7 could rescue a pathogenic phenotype. Indeed, an analysis of the progression of BALB/c mice lesions infected with L. major CC1 transfectants (wild type, Δlmjprmt7 and ‘addback’ Δlmjprmt7, which contains ectopic copies of the wild type LmjPRMT7) for 7 weeks showed that the LmjPRMT7 knockout strain led to a significant increase in the lesion size (Fig 3A). In addition, the addback strain complemented perfectly the non-pathogenic profile of the wild type L. major CC1 strain (Fig 3A and 3B).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Deletion of LmjPRMT7 in a nonpathogenic strain leads to lesion formation not affecting parasite load.

(A) BALB/c female mice (n = 5 per group) were injected intradermally in both ears with 100,000 metacyclic promastigotes and ear thicknesses was followed for 7 weeks. (B) Photographs of infected ears on the 7th week post infection, taken by the author. Results shown are the mean ± SEM of twenty ears, five mice/group, from two independent experiments, **p < 0.01, ****p<0.0001, comparing infection with wild type and Δlmjprmt7, using 2way ANOVA, with Tukey’s multiple comparison test. (C-D) Parasite burden determined by limiting dilution analysis (LDA) in the site of infection (ear, left) and draining lymph node (LN, right) after 7 weeks post-infection. Results shown are the mean ± SEM of fourteen ears from two independent experiments. Unpaired, two-tailed student’s t-test.

https://doi.org/10.1371/journal.pntd.0009230.g003

Remarkably, despite significant difference in lesion size, comparable parasite burdens were observed for transfectant and wild type parasites in both the ears (Fig 3C) and the draining lymph nodes (Fig 3D) 7 weeks post infection. Importantly, we find that removal of LmjPRMT7 from the attenuated strain recovers parasite pathogenicity, but this pathology no longer correlates with parasite burden.

Neutrophils are the main myeloid cell subset associated to the pathogenicity

Since there was no difference in the parasite load between the genetically modified strains of L. major CC1, we characterized the inflammatory and immune cells present in the lesions that could account for the different pathologic outcomes. The ears of the infected BALB/c mice were extracted and processed 7 weeks post infection, as previously described [18]. The gates used to define the myeloid cell subsets in the control group are shown in Fig 4A. Comparing the different immune cell subsets, neutrophils were preferentially recruited to the site of infection with Δlmjprmt7 (Fig 4B). The other resident and recruited cell populations did not differ in their total numbers per ear comparing the wild type and transfected L. major strains.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Subset of myeloid cells recruited to the site of infection after 7 weeks post-infection.

BALB/c mice were infected in the ear dermis with 100,000 Lmj CC1 metacyclic promastigotes from the wild type, Δlmjprmt7 and Δlmjprmt7 [PRMT7] strains. Ear tissues were processed at 7 weeks post-infection to study the cell recruitment by flow cytometry. (A) Representative dot plots of ear-derived dermal cells. Subpopulations of myeloid (CD11b+) cells are defined as 1. Neutrophils, 2. Eosinophils, 3. Conventional dendritic cells, 4. Dermal macrophages, 5. Monocyte derived dendritic cells, 6. Inflammatory monocytes. (B) The number of cells in each myeloid cell subset after 7 weeks of infection (NΦ: neutrophils; Eos: eosinophils; DCs: dendritic cells; Dermal MΦ: dermal macrophages; Infl. MNC: inflammatory monocytes; MNC DCs: Monocyte derived dendritic cells). All data are shown as the mean ± SEM of twenty samples (five mice, per group) from two independent experiments ***p<0.001, using ordinary one-way ANOVA, with Dunn’s multiple comparison test. (C) The representative contour plot of another independent experiment and (D) the percentages of neutrophils (CD11b+Ly6G+ cells) after 7 weeks of infection.

https://doi.org/10.1371/journal.pntd.0009230.g004

In a repeat experiment in BALB/c mice (Fig 4C and 4D), we confirmed that neutrophils were preferentially recruited to the site of infection in the Δlmjprmt7 group compared to the wild type and addback infected groups after 7 weeks post infection. This led us to postulate that the accumulation of neutrophils might be responsible for lesion formation in the ears of mice infected with the mutant strain. We also investigated the neutrophils’ recruitment in the early infection (24h and 72h p.i.). We observed a transient initial wave of neutrophil recruitment with a slight increase in neutrophil numbers in the knockout line after 24h and no difference among the strains after 72h. The percentage of neutrophils in the infected ears was low during these initial time points post infection (S4 Fig).

Lesion formation by Δlmjprmt7 is similar in a susceptible and resistant mice genetic background

To further refine this immune contribution to PRMT7-dependent pathology, we analyzed the effect that the different transfectants of L. major CC1 strain would have on a C57BL/6 mice “resistant” background. Interestingly, we verified that in the wild type and PRMT7-complemented strains there was no lesion formation, while in the knockout mutant there was a clear lesion formed in the ear after 7 weeks post infection (Fig 5A). The severe pathogenic phenotype produced by the Δlmjprmt7 strain in susceptible BALB/c mice is shown for comparison (Fig 5B). After quantifying the parasite loads in the infected ears, we observed not only a similar number of parasites among the different transfectants but also in the comparison between C57BL/6 and BALB/c mice (Fig 5C and 5D). Of note, despite the different genetic background and immune response from the different mice model used (Th1 or Th2 polarized response), the infection outcome was indistinguishable.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Infection of resistant and susceptible mice strains display similar lesion outcome.

(A) C57BL/6 and (B) BALB/c mice were injected in the ear with 10⁵ metacyclic promastigotes of Lmj CC1 WT and transfectants (n = 6 mice per group), and the ear thicknesses were followed for 7 weeks. Images of infected ears are shown next to each graph as follow: 1 WT, 2 ΔlmjPRMT7 and 3 ΔlmjPRMT7 [PRMT7] and pictures were taken by the author. (C-D) Parasite quantification at 7 weeks post-infection. The results are shown as mean ± SEM. Statistical analysis was performed by unpaired, two-tailed student’s t-test.

https://doi.org/10.1371/journal.pntd.0009230.g005

In vitro assay indicates higher uptake of Δlmjprmt7 parasites by neutrophils

To examine specific leukocyte response to LmjPRMT7 levels, we evaluated the behavior of these transfectants in vitro. First, we investigated the role of LmjPRMT7 in the parasite uptake by neutrophils in vitro. Neutrophils were isolated from BALB/c mice bone marrow and the cells were incubated with serum opsonized, metacyclic promastigotes of the different Leishmania strains. Interestingly, the uptake of the knockout mutant parasites by neutrophils was higher than that of wild type or LmjPRMT7 complemented parasites (Fig 6A). We considered that this more efficient uptake might be associated with greater release of Neutrophils Extracellular Traps (NETs). While we detected no difference in DNA release by neutrophils infected with the different strains in this in vitro assay (Fig 6B), we cannot rule out possible in vivo stimulation not inducible in the given conditions.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. Neutrophils display increased uptake of parasites lacking PRMT7 in in vitro assays.

(A) To evaluate the uptake of parasites by neutrophils, 10,000 BMDN were incubated for 3 hours with metacyclic promastigotes (MOI 1). The cells were centrifuged on slides and stained for evaluation by light microscopy. Data are expressed as the mean of neutrophils with intracellular parasites ± SEM. ** p<0.01. Statistical analysis was performed by ordinary one-way ANOVA followed by Tukey’s multiple comparison test. These results are a pool of 3 independent experiments. (B) NET formation was assessed after incubating 10,000 BMDNs with modified strains of L. major CC1, PMA (50nM), or medium (untreated) at MOI of 1 for 3 hours. DNA release after the treatment/infection was quantified in the cell supernatants by fluorescence detection (Ex./Em. 480/520 nm) after reaction with SYTOX green. Data are expressed as a mean of fluorescence intensity ± SEM; **** p<0.0001. Statistical analysis was performed by two-way ANOVA followed by Tukey’s multiple comparison test. DNA quantitation assays were performed in duplicate and, the data shown are the pool of two independent experiments. (C) To evaluate the uptake in vivo by flow cytometry, 4x10⁵ Lmj CC1 metacyclic promastigotes from the wild type and Δlmjprmt7 fluorescently tagged with mCherry were used to infect BALB/c mice. Ear tissues were processed at 4-hours post-infection to study the number of macrophages and neutrophils infected with the different fluorescent strains. Data are shown as the mean ± SEM of four samples per group. Representative data from two independent experiments. *** p<0.001, using two-way ANOVA followed by Tukey’s multiple comparison test.

https://doi.org/10.1371/journal.pntd.0009230.g006

We also tested the in vivo uptake capability of the wild type and knockout strains after 4 hours post-infection during the initial transient wave of neutrophil recruitment to the skin. The in vivo uptake of fluorescent strains by macrophages is consistent with our previous published data [13] in which the phagocytosis is increased in the knockout strain (Fig 6C). By contrast, the neutrophil uptake in vivo did not mimic the phenotype seen for the in vitro assay (Fig 6C). Taken together, the in vitro assay revealed that the knockout mutant strain increases the uptake by neutrophils in a mechanism that apparently does not involve host mediators to either recruit or activate neutrophils, suggesting that other factors not related to the host might be involved.

Few differentially expressed transcripts are detected in the LmjPRMT7 compared transfectants

To investigate possible parasite factors explaining the pathology induced by the LmjPRMT7 knockout parasites, we searched for those genes differentially expressed in LmjPRMT7 knockout parasites compared to the controls in procyclic and metacyclic promastigotes. Differentially expressed genes (DEG) were clustered in 27 groups obtained by comparison of each strain with one another (WT-Δ7, Δ7-AB and AB-WT) and 3 possible relative expression outcomes (up-regulated, down-regulated and no difference). This approach generated a list of genes that were DE only in Δlmjprmt7 with no differences detectable between control lines (S2 Table). DEGs clustered by their presence in each comparison are shown in Venn diagrams (Fig 7A). Four out of the seven DEGs from procyclic samples code for Histone H4 (LmjF.21.0015, LmjF.35.0015, LmjF.36.0020, LmjF.02.0020); all of which are downregulated in Δlmjprmt7 versus wild type and addback strains. The other three genes are galactose oxidase (LmjF.28.1590), phosphonopyruvate decarboxylase (LmjF.28.1580) and octanoyltransferase (LmjF.36.3080). This last gene is the only one that was found upregulated in Δlmjprmt7 compared to wild type and addback strains. Genes coding for phosphonopyruvate decarboxylase (LmjF.28.1580) and a hydrolase, alpha/beta fold family (LmjF.28.1570) were downregulated in Δlmjprmt7 metacyclics (Fig 7B). Interestingly, galactose oxidase (LmjF.28.1590) and phosphonopyruvate decarboxylase (LmjF.28.1580) are present in the same region on chromosome 28 in a convergent SSR (Fig 7C). PRMT7 targets numerous RNA binding proteins impacting protein stability and regulatory function. This and PRMT intra-regulation offer some explanation to the complexity of these outcomes.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Analysis of transcripts differentially expressed in the LmjPRMT7 compared transfectants.

(A) Venn diagram of the three contrasts obtained after differentially expressed analysis of transcriptomes from L. major parasite samples (WT, ΔlmjPRMT7 and ΔlmjPRMT7 [PRMT7]). In bold the DEG only differentially expressed in Δ7 compared to WT and AB but not between the last two groups (FDR 5%, FC > 1.5). On the right bottom corner, the number of genes with no expression difference found between the groups. (B) Description of genes showed in bold in the Venn Diagram. (C) The convergent switch strand region on chromosome 28 depicting the location of three of the DEG identified, LmjF.28.1580, LmjF.28.1590 and LmjF.28.1570.

https://doi.org/10.1371/journal.pntd.0009230.g007