Differentiation of the body shape of L. infantum LEM 5700 hosted in macrophage-like RAW 264.7 cells

L. infantum LEM 5700 promastigotes infected macrophage-like RAW 264.7 cells in which they differentiated into amastigotes (Fig 1A). 3D-reconstruction surface rendering confocal micrographs made it possible, for the first time, to follow the successive transformation of body shape of L. infantum hosted in macrophage-like RAW 264.7 cells during a time-course of infection. At early time-points PI, promastigotes had a typical spindle-shaped body, with one flagellum positioned at their anterior pole (Fig 1B, micrograph 1). The first observable morphological change was shortening of the flagellum, without modification of the spindle-shaped body (Fig 1B, micrograph 2). Next, the shortened flagellum transformed into an enlarged appendage (Fig 1B, micrograph 3) that finally disappeared into the parasite body, along with condensation of the spindle-shaped body itself (Fig 1B, micrographs 4 and 5). The condensed ellipsoidal form then transformed into a highly-condensed ovoid form (Fig 1B, micrograph 6), which ultimately developed into the spherical amastigote form (Fig 1B, micrograph 7). We then quantified the time-dependent evolution of the L. infantum forms arbitrarily grouped into three types: undifferentiated promastigotes, intermediate forms engaged in differentiation, and highly differentiated amastigotes (Fig 1C). There was rapid disappearance of the promastigotes from 1 h to 4 h PI, accompanied by the rapid appearance of the intermediate parasite forms. Subsequently, the number of intermediate forms steadily decreased from 4 to 18 h PI, at the same time as the number of amastigotes increased. In addition, CLSM showed the replication of L. infantum amastigotes, in which the PV membrane elongated preceding its fission, generating two new tight-fitting PVs, each containing one progeny amastigote (Fig 1D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. Time-course of promastigote-to-amastigote differentiation of L. infantum LEM 5700 parasites hosted in macrophage-like RAW 264.7 cells.

(A) Confocal micrographs showing intracellular promastigotes (left image) and amastigotes (right image) in macrophage-like cells. (B) 3D-reconstruction surface rendering confocal micrographs of the parasite body shape transformation during an infection time-course. 1—A promastigote form expressing one long flagellum positioned at the anterior pole of the spindle-shaped body. 2—Fusiform-like form with a shortened flagellum. 3—Condensed fusiform-like form with an enlarged anterior appendage. 4—Condensed fusiform-like form engulfing the enlarged appendage. 5—Non-flagellated condensed ellipsoidal form. 6—Non-flagellated highly condensed ovoid form. 7—Non-flagellated round amastigote form. (C) Quantification of the number of promastigotes, intermediate differentiated forms (summation of parasitic forms viewed in Fig 2 to 6), and amastigotes during an infection time-course. (D) 3D-reconstruction surface rendering confocal micrograph showing elongation of an L. infantum-containing vacuole preceding fission into two new parasite-containing vacuoles. The white dashed box shows the elongated L. infantum-containing vacuole viewed at high magnification in the adjacent image (Right panel). The white dashed line delineates the area of the elongated vacuole. Confocal micrographs are representative of two independent experiments in duplicate. The percentage of parasite forms was determined by examining at least 30 cells at each time-point for each condition. Data are presented as averages ± SEM. Data are from two or three independent experiments in duplicate.

https://doi.org/10.1371/journal.pntd.0008396.g001

Biogenesis of tight-fitting L. infantum LEM 5700-containing PVs hosted in macrophage-like RAW 264.7 cells

Wilson and co-workers [15–18] showed the decoration of L. infantum chagasi-containing vacuoles by several bona fide markers of sub-compartments of the host-cell endolysosomal pathway at various times post-infection (PI) in promastigote-infected human monocyte-derived macrophages, human U937 monocytic cells, and mouse bone-marrow-derived macrophages. This included transient decoration by early endosome antigen-1 and Rab5 GTPase and stable decoration by membrane-associated protein-1, belonging to the Lamp1/2 family of proteins distributed among LEs and lysosomes [19]. We revisited and extended these observations by conducting a time-course experiment to assess and quantify the association of a large set of endolysosomal markers with the parasites insulated in mouse macrophage-like RAW 264.7 cells infected with L. infantum promastigotes. We examined the classical markers, membrane-associated Rab7 GTPase, a marker of the transition between early endosomes (EEs) and LEs [20], membrane-associated protein-2 (Lamp-2) [19], and cathepsin D (CatD), an aspartyl protease that represents a major category of luminal lysosomal hydrolases [21]. In addition, we followed the Qb-SNAREs (soluble N‐ethylmaleimide‐sensitive factor attachment protein receptors) Vti1a and Vti1b (vesicle transport through t-SNARE Interaction) [22]. Knowledge of the membrane composition of tight-fitting PVs that insulate species of the L. donovani complex and L. major in terms of functional proteins is limited [9–12]. We also examined, for the first time, the lysosomal membrane-associated class III glucose/fructose transporter, GLUT8 (Slc2A8) [23,24] and polypeptide transporter associated with antigen processing-like (TAPL; ABCB9) [24,25].

Multi-channel confocal laser scanning microscopy (CLSM) acquisition and 3D-reconstruction surface rendering allowed the simultaneous observation of immunolabeled endolysosomal markers and parasites in infected cells. Quantification of decorated intramacrophage parasites during a time-course PI (Fig 2A) showed a rapid increase in the percentage of Rab7-positive parasites, reaching a maximum at 4 h PI, which than tended to decrease. The percentage of parasites decorated with Lamp-2 increased rapidly, reaching a maximum at 4 h PI, and remained stable up to 24 h. The percentage of parasites positive for Vti1a and Vti1b increased rapidly, reaching a maximum at 4 h PI, and then declined significantly. The percentage of CatD-positive parasites increased more slowly, reaching a maximum at 8 h PI, and remained stable at the subsequent time-points. We observed that the percentage of GLUT8- and TAPL-positive L. infantum parasites increased similarly, reaching a maximum at 8 h PI, and then decreased significantly.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Decoration of hosted L. infantum LEM 5700 parasites by the GTPase Rab7, Qb-SNAREs Vti1a and Vti1b, Lamp-2, hydrolase cathepsin D, hexose transporter GLUT8, and polypeptide transporter TAPL during an infection time-course in macrophage-like RAW 264.7 cells.

(A) Graph showing the kinetics of decoration of parasites by Rab7, Lamp-2, cadherin D (CatD), GLUT8, TAPL, Vti1a, and Vti1b during an infection time-course. (B) 3D-reconstruction surface rendering confocal micrographs of a fusiform-like parasite and an amastigote decorated with Rab7-positive patches. (C) 3D-reconstruction surface rendering confocal micrographs of fusiform-like and ellipsoidal parasite forms and amastigotes densely decorated with elongated Lamp-2-positive lamellae and Lamp-2-positive patches. See also S1 Video. (D) 3D-reconstruction surface rendering confocal micrographs of a fusiform-like parasite decorated by large Vti1a-positive patches and an amastigote sparsely decorated with large Vti1a-positive patches. (E) 3D-reconstruction surface rendering confocal micrographs of a fusiform-like parasite decorated by small Vti1b-positive patches and an amastigote sparsely decorated with small Vti1b-positive patches. (F) 3D-reconstruction surface rendering confocal micrographs of a fusiform-like parasite highly decorated with GLUT8-positive large patches and an amastigote sparsely decorated with small GLUT8-positive patches. (G) 3D-reconstruction surface rendering confocal micrographs of a fusiform-like parasite decorated with TAPL-positive patches and an amastigote sparsely decorated with small TAPL-positive patches. (H) z-stack and 3D-reconstruction surface rendering confocal micrographs of fusiform-like and ellipsoidal parasite forms, and amastigotes almost completely enwrapped by large and continuous CatD-positive patches. See also S2 Video. (I) z-stack and 3D-reconstruction surface rendering confocal micrographs showing strong Lysotracker Red positivity for ellipsoidal, ovoid, and round parasite forms. Confocal micrographs are representative of three independent experiments. The percentage of positive parasites for each endolysosomal marker was determined by counting parasites hosted in at least 30 cells for each time-point. Data are represented as the average ± SEM.

https://doi.org/10.1371/journal.pntd.0008396.g002

3D-reconstruction surface rendering confocal micrographs and videos showed various patterns of decoration of insulated L. infantum parasites by endolysosomal markers, including randomly distributed small patches of various sizes and large patches wrapping densely or almost entirely around the parasite body. Fusiform-like parasites were decorated by large Rab7-positive patches, whereas amastigotes were only decorated by small patches (Fig 2B). Lamp-2-positive tube-like structures and patches densely decorated both fusiform-like parasites and amastigotes (Fig 2C and S1 Video). Large Vti1a-positive patches decorated the fusiform-like parasites and amastigotes (Fig 2D). Both fusiform-like parasites and amastigotes were sparsely decorated by small randomly distributed Vti1b-positive patches (Fig 2E). Large GLUT8- and TAPL-positive patches decorated the fusiform-like parasites, whereas amastigotes were sparsely decorated by small randomly-distributed patches (Fig 2F and 2G, respectively). In contrast, both fusiform-like forms and amastigotes were almost entirely enwrapped by continuous patches positive for the lysosomal marker CatD (Fig 2H and S2 Video). The observed decoration of L. infantum parasites by Rab7 and Lamp-2 is reminiscent of their previously observed presence in the membrane of tight-fitting L. donovani-containing PVs [8,26]. The observed decoration of L. infantum parasites with Rab7, Lamp-2, and CatD is consistent with the previously observed presence of Rab7p, Lamp-1, and cathepsin B in tight-fitting L. major-containing PVs [27,28]. Loading of infected cells with LysoTracker Red, a small membrane-permeable lysosomotropic molecule that labels acidic vacuolar compartments, showed the intracellular ovoid and round parasite forms of L. infantum to be strongly enwrapped by LysoTracker Red fluorescence (Fig 2I).

We next measured the size of the luminal space of phagosomes/PVs that insulated the L. infantum parasites. We took advantage of the CatD immunofluorescence, which almost completely enwrapped the parasites, and which is known to localize to the luminal space of PVs [28]. Measurement of the volume of the parasite body and that of CatD immunolabeling by isosurface rendering analysis showed there to be a small vacuolar space between the parasite body and phagosome/PV membrane (S1 Fig), in accordance with the known tight-fitting nature of the phagosome/PV insulating parasites of the L. donovani complex and L. major [3,4].

Impairment of the maturation of tight-fitting L. infantum LEM 5700-containing phagosomes/PVs

We developed a pharmacological approach to block the maturation of L. infantum-containing phagosomes/PVs that occurs through heterotypic fusion with LEs and lysosomes. We used the small trafficking inhibitor Retro-2, known to block ricin and Shiga-toxin trafficking at the EEs-trans-Golgi network (TGN) interface [29,30]. For our time-dependent analysis, we took into account the previously [15–18] and above reported rapid insulation of L. infantum parasites within early tight-fitting phagosomes and subsequent mature tight-fitting PVs, also previously observed with tight-fitting PV-insulated L. major [27,31] and L. donovani [7,32]. Moreover, we also accounted for the fact that Retro-2 exerts direct parasiticide activity against axenic L. amazonensis at concentrations of 10 to 100 μM [33]. We thus infected the cells with L. infantum LEM 5700 in the continuous presence of the small compound at sub-parasiticide concentrations of 1 to 5 μM. We therefore ensured that both the number of L. infantum promastigote-infected cells and the number of promastigotes internalized within each cell were not modified relative to untreated infected cells (S2 Fig). In addition, we controlled that the continuous presence of Retro-2 at 1 μM promoted the re-localization of the Qa-SNARE syntaxin 5 (Stx5) from its normal perinuclear localization toward the cytoplasm (S3 Fig) previously observed when the small inhibitor blocks the retrograde transport of the toxins [29].

3D-reconstruction surface rendering confocal microscopy showed the absence of decoration by the LE-associated Rab7 of the fusiform-like and ellipsoidal forms of the parasites present in 18 h-infected Retro-2-treated cells (Fig 3A and 3D). For Lamp-2, 3D-reconstruction surface rendering confocal microscopy and video showed the absence of decoration of fusiform-like and ellipsoidal parasite forms by Lamp-2-positive tube-like and small patches in 8 h-, 18 h- and 24 h-treated infected cells (Fig 3B and 3D, and S3 Video). Similarly, parasite forms present in 8 h-, 18 h- and 24 h-treated infected cells showed the absence of decoration by Vti1a and Vti1b (Fig 3C and 3D). Quantification of Lamp-2 showed the decreased association of LE-associated markers with the parasites to develop as a function of the concentration of Retro-2 (Fig 3E).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. Decrease or lack of decoration of L. infantum LEM 5700 parasites with GTPase Rab7, Lamp-2, and Qb-SNAREs Vti1a and Vti1b in macrophage-like RAW 264.7 cells infected in the continuous presence of Retro-2.

(A) z-stack and 3D-reconstruction surface rendering confocal micrographs showing decreased decoration of fusiform-like and ellipsoidal parasites hosted in Retro-2 (1 μM)-treated cells with Rab7-positive patches. See Fig 2B for control decoration of parasites in untreated cells. (B) z-stack and 3D-reconstruction surface rendering confocal micrographs showing decreased decoration of fusiform-like and ellipsoidal parasite forms in Retro-2 (1 μM)-treated infected cells with Lamp-2, characterized by the presence of dispersed Lamp-2-positive small patches. See also S3 Video. See Fig 2C for control decoration of parasites in untreated cells. (C) 3D-reconstruction surface rendering confocal micrograph showing the absence of decoration of fusiform-like parasites with Vti1a patches in a Retro-2 (1 μM)-treated infected cell. See Fig 2D for control decoration of parasites in untreated cells. (D) Bar graph showing a decrease in the percentage of parasites decorated with Rab7-, Lamp-2-, or Vti1a- or Vti1b-positive patches during an infection time-course in cells infected in the continuous presence of Retro-2 (1 μM). (E) Bar graph showing the average percentage of parasites decorated with Lamp-2 in untreated infected cells and cells infected in the continuous presence of increasing concentrations of Retro-2. Confocal micrographs are representative of three independent experiments. High-magnification images correspond to the white dashed boxes. The percentage of parasites decorated with Rab7-, Lamp-2-, Vti1a-, and Vti1b-positive patches was determined by counting parasites hosted in at least 30 cells at each time-point for each condition. Data are represented as the average ± SEM and were analyzed using the unpaired Student t test. *p < 0.01.

https://doi.org/10.1371/journal.pntd.0008396.g003

3D-reconstruction surface rendering confocal micrographs also showed there to be a marked decrease or the absence of decoration of fusiform-like and ellipsoidal parasite forms by the lysosomal membrane-associated GLUT8 (Fig 4A and 4D) and TAPL (Fig 4B and 4D) transporters in 8 h-, 18 h- and 24 h-infected Retro-2-treated cells relative to untreated infected cells. Consistent with these results, 3D-reconstruction surface rendering confocal micrographs and quantification showed the almost total absence of decoration by the lysosomal luminal-associated CatD hydrolase of fusiform-like and ellipsoidal parasite forms hosted in 8 h-, 18 h- and 24 h-infected Retro-treated cells relative to untreated infected cells (Fig 4C and 4D, and S4 Video). Quantification of the number of intramacrophage parasites decorated by CatD showed that the decrease of parasite decoration developed as a function of the concentration of Retro-2 (Fig 4E). For the CatD-decorated fusiform-like parasites hosted in Retro-2-treated infected cells (Fig 4C), scanning of the CatD RFI in fusiform-like parasites showed the level of decoration per parasite to be dramatically lower than that of fusiform-like parasites hosted in untreated infected cells (Fig 4F to 4H). In addition, LysoTracker Red fluorescence did not enwrap the parasites in cells infected in the presence of Retro-2 (Fig 5A and 5B), contrasting with the extensive enwrapping of parasites hosted in infected untreated cells (Fig 2H). The observed decrease of association with LE- and lysosome-associated molecules was not the consequence of Retro-2-triggered alteration of the cellular presence or distribution of LES and lysosomes, as CLSM images and quantification showed that the cell expression and distribution of Lamp-2- and CadD-positive vesicles were not modified in Retro-2-treated cells relative to that of untreated cells (S4 Fig).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. Lack of decoration of L. infantum LEM 5700 parasites with lysosome-associated hydrolase cathepsin, hexose transporter GLUT8, and polypeptide transporter TAPL in macrophage-like RAW 264.7 cells infected in the continuous presence of Retro-2.

(A) 3D-reconstruction surface rendering confocal micrograph showing the absence of decoration of fusiform-like and ellipsoidal parasite forms with GLUT8-positive patches in a Retro-2 (1 μM)-treated cell. See Fig 2F for control decoration of parasites in untreated cells. (B) 3D-reconstruction surface rendering confocal micrograph showing the absence of decoration of fusiform-like and ellipsoidal parasite forms with TAPL-positive patches in a Retro-2 (1 μM)-treated cell. See Fig 2G for control decoration of parasites in untreated cells. (C) z-stack and 3D-reconstruction surface rendering micrograph showing the absence of decoration with CatD-positive patches of fusiform-like and ellipsoidal parasite forms hosted in Retro-2 (1 μM)-treated cells. See also S4 Video. See Fig 2H for control decoration of parasites in untreated cells. (D) Bar graph showing the decrease in the percentage of parasites decorated with GLUT8-, TAPL- and CatD-positive patches during an infection time-course in cells infected in the continuous presence, or not, of Retro-2 (1 μM). (E) Bar graph showing the average percentage of parasites positive for CatD in cells infected in the continuous presence, or not, of increasing concentrations of Retro-2. (F) Confocal micrographs (z-stack projection) showing green (parasite) and red immunofluorescence labeling (cathepsin D, CatD) in a delineated fusiform-like parasite hosted in an untreated infected cell. Profile showing the scanning analysis of the relative fluorescence intensity (RFI) of green and red fluorescence signals in the delineated fusiform-like parasite. (G) A representative profile showing the scanning analysis of RFIs of green and red fluorescence signals measured in a fusiform-like parasite hosted in a Retro-2-treated infected cell. (H) Bar graph showing the RFIs of CatD measured in fusiform-like parasites hosted in untreated infected cells and Retro-2 (1 μM)-treated infected cells. Confocal micrographs are representative of three independent experiments. High-magnification images correspond to the white dashed boxes. The percentage of parasites associated with TAPL, GLUT8, or CatD were determined by counting parasites hosted in at least 30 cells at each time-point for each condition. The RFIs were measured by analyzing 8 to 10 parasites for each condition. Data are represented as the average ± SEM. Data are from two independent experiments in duplicate and were analyzed by the unpaired Student t test. *p < 0.01.

https://doi.org/10.1371/journal.pntd.0008396.g004

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. Lack of acquisition of LysoTracker Red positivity by L. infantum LEM 5700 parasites during an infection time-course in macrophage-like RAW 264.7 cells infected in the continuous presence of Retro-2.

(A) z-stack and 3D-reconstruction surface rendering confocal micrograph showing the absence of acquisition of Lysotracker Red by fusiform-like and ellipsoidal parasites hosted in Retro-2 (1 μM)-treated infected cells during an infection time-course. See Fig 2I for control LysoTracker Red positivity of parasites in untreated cells. (B) Graph showing an increase in the percentage of parasites positive for LysoTracker Red in untreated infected cells and the absence of an increase of parasite LysoTracker Red-positivity in Retro-2 (1 μM)-treated infected cells during an infection time-course. Confocal micrographs are representative of two independent experiments. The high-magnification image corresponds to the white dashed box. The percentage of positive parasites was determined by counting parasites hosted in at least 30 cells at each time-point for each condition. Data are presented as the average ± SEM.

https://doi.org/10.1371/journal.pntd.0008396.g005

Overall, these results show that Retro-2 impaired the acquisition of host cell LE- and lysosome-associated markers by L. infantum-containing phagosomes hosted in macrophage-like cells, suggesting that the small trafficking blocker arrested the heterotypic interactions between these vacuolar compartments. To confirm that Retro-2 triggers failure of the heterotypic interaction of donor vacuoles with lysosomes, we conducted a control experiment in a non-infectious cellular autophagy model in which the fusion of donor autophagosomes with recipient lysosomes leads to the formation of the final degradative vacuolar compartment, autolysosomes [34,35]. We used HeLa cells stably expressing the autophagy marker microtubule-associated protein 1 light chain 3 (LC3) coupled to green fluorescent protein (GFP-LC3). As expected [36], nutrient starvation induced the strong presence of autolysosomes in the cell cytoplasm (S5A Fig, Middle image, and S5B Fig) versus their absence in non-starved cells (S5A Fig; left image, and S5B Fig). In contrast, there was an absence of autolysosomes and the strong presence of autophagosomes in nutrient-starved Retro-2-treated cells, showing the failure of fusion between autophagosomes and lysosomes induced by the small compound (S5A Fig, right image, and S5B Fig). We next analyzed autophagic flux by treating the cells with the lysosomotropic agent, chloroquine (CQ), which inhibits lysosomal protease degradation of LC3-II [36]. Western blotting showed the abundance of LC3-II protein to be no higher in nutrient-starved Retro-2-treated cells in the presence of CQ than nutrient-starved Retro-2-treated cells without CQ (S5C Fig), showing that Retro-2 blocks autophagic flux.

Permanent residence of L. infantum LEM 5700 parasites in immature phagosomes negatively affects parasite differentiation and survival

We next examined whether impairment of the heterotypic interaction between the L. infantum-containing phagosomes and the macrophage LEs and lysosomes has an impact on parasite differentiation. Quantitative imaging showed Retro-2-treated infected cells to contain mostly intermediate forms that showed a marked delay in transformation into amastigotes (Fig 6A). This observed delay of differentiation of intramacrophage parasites was not simply a direct effect of the compound on the parasites, as the differentiation of Retro-2-treated axenic parasites was not altered (S6 Fig). CLSM analysis showed a high number of L. infantum intermediate and amastigote forms residing in Retro-2-treated infected cells with a highly-altered cell surface (Fig 6B and 6C), which strongly differed from that of the regular body surface of parasites hosted in untreated infected cells (Fig 1). RT-qPCR quantification showed marked time-dependent lowering of the parasite and amastigote burden in Retro-2-treated infected cells (Fig 6D). Overall, these results provide evidence that the maturation of L. infantum-containing phagosomes is necessary for L. infantum parasites to successfully complete promastigote-to-amastigote differentiation and survive.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 6. L. infantum LEM 5700 parasites are morphologically altered and die when hosted in Retro-2-treated macrophage-like RAW 264.7 cells.

(A) Graph showing the percentage of intermediate parasite forms and amastigotes during an infection time-course in cells infected in the continuous presence, or not, of Retro-2 (1 μM). (B) 3D-reconstruction surface rendering confocal micrographs showing representative altered fusiform-like and ellipsoidal forms of parasites with a wrinkled cell surface, forming deep undulations when hosted in 18 h-Retro-2-treated infected cells. For comparison, see the smooth surface of parasite forms hosted in untreated infected cells in Fig 1. (C) Bar graph showing the percentage of intermediate parasite forms and amastigotes exhibiting a smooth or wrinkled body surface in cells infected for 18 h in the continuous presence, or not, of Retro-2. (D) Graph showing the parasite (left) and amastigote (right) loads determined by RT-qPCR in cells infected in the continuous presence, or not, of Retro-2 during an infection time-course. Confocal micrographs are representative of two independent experiments. The percentage of intermediate parasite forms and amastigotes was determined by analyzing at least 40 cells for each time-point for each condition. The percentage of parasites with a smooth or wrinkled surface was determined by analyzing parasites hosted in at least 30 cells for each time-point for each condition. Parasite and amastigote levels per culture well were quantified by RT-qPCR in two independent experiments in duplicate. Data are presented as averages ± SEM and were analyzed using the unpaired Student t test. *p < 0.01.

https://doi.org/10.1371/journal.pntd.0008396.g006

Routing of L. infantum LEM 5700-containing phagosomes toward LEs and lysosomes is microtubule (MT) dependent

The functional maturation process of phagosomes implies dynein-dependent movements of early phagosomes along MT tracts followed by their fusion with lysosomes controlled by SNAREs-containing membrane fusion platforms[6]. The above observed lack of decoration of poorly differentiated L. infantum parasites by LE and lysosomal markers in Retro-2-treated infected macrophage-like cells may result from the absence of L. infantum-containing phagosome movement along MT tracks or downstream impairment of SNAREs-dependent membrane fusion with LEs and lysosomes. Thus, we first examined the organization of the MT network in Retro-2-treated infected macrophage-like cells. Unexpectedly, 3D-reconstruction surface rendering confocal micrographs revealed the dense tubulin network in L. infantum LEM 5700-infected macrophage-like cells (Fig 7A and 7C) to be highly disorganized in cells infected for 24 h in the continuous presence of Retro-2 (Fig 7B and 7C). In these cells, large spaces devoid of tubulin and dispersed fragmented tubulin-positive bar-like structures were evident. We validated this unexpected observation by conducting a control experiment with epithelial HeLa cells in which the MT network consisted of straight MT filaments well-oriented from the cell nucleus toward the membrane (Fig 7D). CLMS analysis showed that, as in macrophage-like cells, 24 h of treatment with Retro-2 triggered dramatic concentration-dependent disorganization of the HeLa MT network, characterized by the concentration-dependent appearance of dispersed tubulin-positive bar-like and vesicle/aggregate structures (Fig 7E and 7F). We finally confirmed the ability of Retro-2 to induce concentration-dependent MT disassembly using an in vitro tubulin polymerization assay (Fig 7G).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 7. Retro-2 treatment results in disassembly the cell microtubule network.

(A) 3D-reconstruction surface rendering confocal micrograph showing the well-ordered perinuclear distribution of tubulin immunolabeling in an untreated infected macrophage-like cell. (B) 3D-reconstruction surface rendering confocal micrograph showing the dispersion of tubulin immunolabeling in a cell infected for 24 h in the continuous presence of Retro-2 (1 μM). (C) Bar graph showing the percentage of macrophage-like cells infected in the continuous presence, or not, of Retro-2, with homogeneous perinuclear or dispersed tubulin immunolabeling. (D) x-y confocal micrograph showing the MT network in an untreated epithelial HeLa cell. (E) x-y confocal micrograph showing marked disorganization of the MT network in 24 h-Retro-2-treated HeLa cells. Note the appearance of short tubulin-positive bar-like (1 μM) and vesicle/aggregate (5 μM) structures distributed throughout the cell cytoplasm. (F) Graph showing quantification of cells expressing well-organized tubulin-positive fibers, dispersed bar-like structures, or vesicle-like aggregates in untreated cells and cells treated for 24 h with DMSO or increasing concentrations of Retro-2. (G) Graph showing the effect of increasing concentrations of Retro-2 on GTP-dependent tubulin polymerization in vitro. Confocal micrographs are representative of two independent experiments in duplicate. High-magnification images correspond to the white dashed boxes. Tubulin in the reaction buffer was incubated at 37°C in the presence of vehicle (DMSO) or Retro-2 and polymerization measured by spectrophotometry. Data were obtained from two independent experiments. Data are presented as the mean ± SEM.

https://doi.org/10.1371/journal.pntd.0008396.g007

Nocodazole and siRNA dynein silencing mimic the effects of Retro-2

We confirmed the pivotal role of MTs in the maturation process of L. infantum LEM 5700-containing phagosomes/PVs by infecting macrophage-like cells in the continuous presence of the reference MT-disassembling agent (MDA), nocodazole [37]. 3D-reconstruction surface rendering analysis showed the elevated presence of hosted fusiform-like and ellipsoidal parasites in nocodazole-treated 24 h-infected cells (Fig 8A). The maturation of L. infantum-containing phagosomes/PVs hosted in macrophage-like cells infected in the continuous presence of nocodazole was impaired, shown by the scarcity of CatD decorating the hosted parasites (Fig 8A and 8B). The continuous treatment of cells with nocodazole impaired parasite differentiation, shown by the prolonged elevated presence of the intermediate forms of the parasite, with the concomitant delayed appearance of amastigotes (Fig 8C), as in Retro-2-treated infected cells (Fig 6A). Moreover, the parasites hosted in nocodazole-treated infected cells had an altered cell surface (Fig 8A and 8D), such as those in infected cells treated with Retro-2 (Fig 6B and 6C).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 8. The microtubule-disassembly agent nocodazole abolishes the maturation of L. infantum LEM 5700-containing phagosomes, delays parasite differentiation, and promotes parasite death in macrophage-like Raw 264.7 cells.

(A) 3D-reconstruction surface rendering confocal micrographs showing limited association of cathepsin D (CatD) with parasites hosted in nocodazole-treated infected cells. For comparison, see the CatD decoration of parasites hosted in untreated cells in Fig 1G. (B) Bar graph showing the percentage of parasites decorated with CatD in cells infected in the continuous presence, or not, of nocodazole during a time-course of infection. (C) Graph showing the time-dependent evolution of the percentage of amastigotes in cells infected in the continuous presence, or not, of nocodazole (1 μM) during a time-course of infection. (D) Bar graph showing the percentage of intermediate parasite forms and amastigotes exhibiting a smooth or wrinkled body surface when hosted in cells infected in the continuous presence, or not, of nocodazole. Confocal micrographs are representative of two independent experiments. The percentage of parasites was determined by analyzing at least 30 cells for each time-point for each condition. Data are presented as averages ± SEM and were analyzed using the unpaired Student t test. *p < 0.01.

https://doi.org/10.1371/journal.pntd.0008396.g008

We completed our analysis by silencing the cellular gene dynein. This gene codes for the MT-associated motor minus-end-directed dynein [38], which generates rapid unidirectional movement of phagosomes towards lysosomes along MTs [39]. RT-qPCR showed siRNA-mediated silencing of the dynein gene to be effective in macrophage-like RAW 264.7 cells (Fig 9A). The siRNA dynein-transfected infected cells showed a dramatic reduction in the maturation of the L. infantum LEM 5700-containing phagosomes/PVs and a delay in the differentiation of the insulated parasites (Fig 9B and 9C), as observed in Retro-2-treated infected cells (Figs 2 and 3, and Fig 6A) and nocodazole-treated infected cells (Fig 8A to 8C). Moreover, the fusiform-like parasites hosted in siRNA dynein-transfected infected cells expressed a strong altered surface (Fig 9B and 9C), similar to that of the parasites hosted in Retro-2-treated (Fig 6B and 6C) and nocodazole-treated (Fig 8D and 8E) infected cells. In addition, RT-qPCR quantification showed that the parasites in siRNA dynein-transfected infected cells died, shown by marked lowering of the amastigote burden (Fig 9D), as found in infected cells treated with Retro-2 (Fig 6D).

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 9. Silencing of the dynein gene in macrophage-like Raw 264.7 cells abolishes the maturation of L. infantum LEM 5700-containing phagosomes/PVs, delays parasite differentiation, and promotes parasite death.

(A) Bar graph showing dynein mRNA levels relative to those of gapdh mRNA measured by RT-qPCR in mock and dynein siRNA-transfected cells. (B) 3D-reconstruction surface rendering confocal micrograph showing limited association of cathepsin D (CatD) with fusiform-like parasites hosted in an infected dynein siRNA-transfected cell, and the highly altered morphology of these parasites. For comparison, see the CatD decoration of parasites hosted in untreated cells in Fig 1G. (C) Bar graph showing the percentage of parasites associated with CatD, the percentage of intermediate parasite forms and amastigotes, and the percentage of parasites with a wrinkled cell surface in mock-transfected and siRNA dynein-transfected cells. (D) Bar graph showing the amastigote load determined by RT-qPCR in mock-infected cells and dynein siRNA-transfected infected cells. The confocal micrograph is representative of two or three independent experiments. The high-magnification view corresponds to the white dashed box. The percentage of parasites was determined by analyzing at least 30 cells for each condition. The percentage of parasites with a smooth or wrinkled cell surface was determined by analyzing parasites hosted in at least 20 cells for each condition. Dynein mRNA levels were quantified by RT-qPCR of over three independent biological samples for each time-point. Amastigote levels per culture well were quantified by RT-qPCR in two independent experiments in duplicate. Data are presented as averages ± SEM and were analyzed by the unpaired Student t test. *p < 0.01.

https://doi.org/10.1371/journal.pntd.0008396.g009

Reagents, siRNAs and antibodies

Retro-2 (2,3-Dihydro-2-(5-methyl-2-thienyl)-3-phenyl-4(1H)-quinazolinone), chloroquine, nocodazole, and rabbit anti-actin (A2066) were purchased from Sigma-Aldrich (Saint Quentin Fallavier, 38070 France). LysoTracker Red and 4′,6-diamidino-2-phenylindole (DAPI) were purchased from Invitrogen (Life Technologies, ThermoFisher Scientific, Courtaboeuf, 91941 France). RT-qPCR primers (forward and reverse) and siRNA dynein were purchased from Eurogentec (Angers, France). The TransIT-X2 Dynamic Delivery System was purchased from Euromedex (Souffelweyersheim, France). Mouse mAb 2A3-26 directed against a plasma membrane antigen of L. amazonensis amastigotes [72] and recognizing L. infantum (this study) was kindly donated by Dr E. Prina (Institut Pasteur, Paris, France). Mouse anti-cathepsin D mAb (E7, sc-13148), anti-Stx5 (B-8), and rabbit anti-Rab7 (sc-10767) were purchased from Santa Cruz Biotechnology Inc. Rabbit anti-Lamp-2/CD107b was purchased from Thermo Fisher Scientific (Villebon sur Yvette, 91963 France). Mouse anti-Vti1a (D8U3M) and anti-α-tubulin mAbs (11H10) were purchased from Cell Signaling Technology (Ozyme, Saint Quentin en Yvelines, 78053 France). Mouse anti-Vti1b mAb (clone 7) was purchased from BD Biosciences (Le Pont de Claix, 38801 France). Rabbit anti-GLUT8 [73] was kindly provided by Pr. A Schürman (German Institute of Human Nutrition Potsdam-Rehbrücke, Nuthetal, Germany). Rabbit anti-TAPL [74] was kindly provided by Pr. R. Abele (German Institute of Human Nutrition Potsdam-Rehbrücke, Nuthetal, Germany). Alexa-488 and -594-conjugated anti-rabbit and anti-mouse secondary antibodies were purchased from Interchim (Montluçon, 03100, France) and Euromedex. Anti-LC3 antibody (L7543), anti-β-actin-peroxidase (A3853), goat anti-rabbit IgG- and sheep anti-mouse IgG-peroxidase antibodies (A0545 and A5906, respectively) were purchased from Sigma-Aldrich.

L. infantum LEM 5700 culture

L. infantum strain LEM 5700 (MHOM/FR/2008/LEM5700—zymodeme MON-1) was provided by the Centre National de Ressources des Leishmania (CRB-Leish) (Université de Montpellier, Centre Hospitalier Universitaire (CHU), UMR MIVEGEC CNRS 5288/IRD 224/UM, Département de Parasitologie—Mycologie, 34295 Montpellier, France). This strain was isolated in the Department of Pediatrics of the CHU Montpellier from the bone marrow of an eight-year-old girl suffering from visceral leishmaniasis. Parasites were grown as previously described in M-199 medium supplemented with 40 mM HEPES, 100 mM adenosine, 0.5 mg/l hemin, and 10% heat-inactivated fetal bovine serum (FBS) at 26°C in a dark environment under an atmosphere of 5% CO₂ [75]. All cell experiments were performed with L. infantum promastigotes, the physiologically relevant virulent stage of Leishmania, in their stationary phase of growth.

Differentiation of axenic L. infantum promastigotes into axenic L. infantum amastigotes was achieved by dilution of 1 x 10⁶ promastigotes in 5 mL axenic amastigote media (M-199 media supplemented with 15 mM KCl, 8 mM glucose, 5 mM glutamine, 2.5% BBL trypticase peptone, 4 mM hemin, and 20% FCS) (pH 5.5) [75].

Cell culture and infection and treatment protocols

The mouse monocyte/macrophage-like cell line RAW 264.7 (Cell collection CNRS UMR 8076 BioCis, University Paris-Saclay) [75] was cultured in Dulbecco’s modified Eagle's minimal essential medium (DMEM) (Invitrogen Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum, at 37°C in a humidified atmosphere containing 5% CO₂. For infection, RAW 264.7 cells were placed in 24-well TPP tissue culture plates (ATGC, Marne la Vallée, France), with or without sterile coverslips, and infected with unopsonized, L. infantum LEM 5700 promastigotes (MOI of 10 parasites per cell) at 37°C in an atmosphere containing 5% CO₂. For treatments, cells were infected for the indicated time-periods in the continuous presence, or not, of compounds. At the indicated time-periods post-infection, samples were washed three times with cold EBSS to remove free parasites and treated for immunofluorescence labeling. Observation and image acquisition of fixed macrophage-like cultures by confocal microscopy were performed at various times after infection, ranging from 4 to 24 h, depending on the experiment.

HeLa cells and HeLa cells stably transfected with rat GFP-LC3 (GFP-LC3-expressing HeLa cells) were kindly provided by A.M. Tolkovsky (Department of Biochemistry, University of Cambridge, UK) [76]. Cells were seeded and grown in culture plates (TPP, ATGC Biotechnologie, Noisy Le Grand, France) containing coverslips and cultured in RPMI-1640 with L-glutamine (Life Technologies, Cergy, France) at 37°C in an atmosphere containing 5% CO₂. For autophagy induction by amino-acid deprivation, the cells were incubated for the indicated times in Earle’s balanced salt solution (EBSS) (Sigma) at 37°C in an atmosphere containing 5% CO₂ [36].

RNA interference

Transfection of macrophage-like RAW 264.7 cells with siRNA targeting the dynein gene (forward [5’-CUGUGAUUGAUGCAGACAAUU-3’] and reverse: [5’-UUGUCUGCAUCAAUCACAGUU-3’]) was performed using the TransIT-X2 Dynamic Delivery System (Euromedex) following the manufacturer’s protocol. Cells were transfected 48 h before infection and collected for experiments.

Immunofluorescence labelling

L. infantum LEM 5700 and components of L. infantum LEM 5700-containing PVs were identified by indirect immunofluorescence labelling. Specimens were fixed with 3% paraformaldehyde in phosphate-buffered saline (PBS) for 5 min at room temperature, washed three times with PBS, treated with PBS containing 50 mM NH₄Cl for 10 min to neutralize the aldehyde, and blocked by adding PBS containing 0.2% gelatin. Cells were permeabilized by incubation in 0.2% Triton X-100 in PBS for 4 min at room temperature and then washed three times with PBS. Intramacrophage L. infantum promastigotes and amastigotes were immunolabeled with mAb 2A3-26 (1/500). Immunolabeling of endolysosomal pathway markers was performed using anti-Rab7 (1/200), anti-Lamp-2 (1/200), anti-cathepsin D (1/100), anti-GLUT8 (1/100), anti-TAPL (1/100), anti-Vti1a (1/100), anti-Vti1b (1/100), and anti-Stx5 (1/200) antibodies. Microtubules and the actin cytoskeleton were immunolabeled with anti-α-tubulin (1/500) and anti-actin (1/100) antibodies, respectively. After immunolabeling with primary antibodies, the specimens were developed using appropriate conjugated secondary antibodies (Jackson Immunoresearch). Cells were also stained for 15 min with DAPI (100 μg/ml) (Invitrogen Life Technologies) to visualize the nucleus. Coverslips were mounted using Dako fluorescent mounting medium (Invitrogen Life Technologies) for CLSM examination.

LysoTracker Red labeling

Cells were labeled with LysoTracker Red (50 nM) by incubating them with the probe for 60 min. The labeled cells were washed three times with sterile PBS, and then fixed with 3% paraformaldehyde in PBS for 5 min at room temperature. Coverslips were mounted using Dako fluorescent mounting medium.

Confocal laser scanning microscopy (CLSM)

The samples were imaged with an inverted STED-gated Leica TCS SP8 microscope (Leica, Germany) using a HC PL APO CS2 63x/1.40 oil immersion objective lens. The instrument was equipped with a 405-nm diode for DAPI excitation and a WLL Laser. Blue, green, and red fluorescence emission was collected using 410–460, 505–550, and 560–760 nm wide emission slits in sequential mode, respectively. The pinhole was set to 1.0 Airy unit, giving an optical slice thickness of 0.89 μm. Twelve-bit numerical confocal micrographs were processed using Leica SP8 LAS X software (Version 2.0.1; Leica, Germany). Confocal optical sectioning was performed each 0.3 μm along the z axis.

Multidimensional imaging analysis and quantification

Three-dimensional volume renders (3D-reconstruction surface rendering) from confocal microscopy optical sections (z-stack) were obtained using Imaris Measurement Pro software (Bitplane AG, Zurich, Switzerland). Isosurface rendering was used to measure the volume of identified structures. To measure the volume of a defined object, confocal z-stack images (row data following the Nyquist sampling theorem) were used to perform 3D reconstruction views. The resulting volume rendering data sets were then processed to obtain a surface rendering calculation based on voxel intensities. A smoothing Gaussian filter of 0.09 was applied before thresholding. Imaris provides volumes and surfaces of the structure. Each channel was analyzed separately. Relative fluorescence intensities (RFIs) were determined on maximum-intensity projections using z-stacks. The level of a given host cell marker associated with an intramacrophage L. infantum parasite was quantified using the "segmented line" tool was to cleanly delineate the area relative to the immunolabeled parasite in the z-stack micrographs. Once the area of interest was determined, the "Plot profile" tool of ImageJ was used to obtain the RFIs (in arbitrary units) of the parasite and associated marker, given by Channel #1 or #2, respectively, of the confocal acquisition system. This procedure can reliably estimate the level of an endolysosomal marker associated with intramacrophage L. infantum-containing PVs. Cropping of movies was performed in ImageJ (ImageJ, NIH). The percentage of intramacrophage parasites positively associated with a host cell endolysosomal marker was determined manually using Imaris software. Quantitative values obtained for host cell and parasite numbers were exported to Excel for further analysis and graphical representations. All imaging analyses and quantifications were performed blindly to eliminate any possible bias.

Western-blot analysis

Cells are washed once with cold PBS and then treated for 15 min at 4°C with extraction buffer (25 mM HEPES, 0.5% Triton, 150 mM NaCl, 2 mM EDTA) containing proteases and phosphatase inhibitors. Protein fractions were dissolved in the appropriate volume of Laemlli buffer and incubated at 100°C for 5 min. The proteins were immediately separated on 12% SDS-polyacrylamide gels. For western-blot analysis, gels were transferred to polyvinylidene difluoride membranes (Perkin Elmer, Les Ullis, France). A primary rabbit anti-LC3 antibody was used to reveal LC3-I and LC3-II proteins. A primary mouse antibody specific for β-actin was used to verify the equal loading of lanes. Primary antibodies were revealed with anti-rabbit- or anti-mouse-peroxidase secondary antibodies. The abundance of LC3-II and β-actin proteins in the western blots was quantified by densitometry using ImageJ software.

Quantitative real-time PCR (RT-qPCR)

Total RNA was extracted from cells using TRIzol reagent (ThermoFisher Scientific) following the manufacturer’s protocol. The level of L. infantum parasites in macrophage-like RAW 264.7 cells was quantified by L. infantum cytochrome b gene (Licytb, LinJ.02.0020) RT-qPCR in a 20-μl volume with 2 μl template DNA and 18 μl Hot FIREPol EvaGreen qPCR Mix (Solis BioDyne, Dutscher, Burmat, France) containing 1 U Taq Polymerase and 200 nM of each primer (forward [5’-CACAACAGCAAGGAGAGTGG-3’] and reverse [5’-CGATGACGAATAGTGCGAGA-3’]), designed by Primer3 web version 4.0.0 (http://primer3.ut.ee/). The amplification profile was: 94°C for 7 min, followed by 35 cycles at 94°C for 35 s, 60°C for 35 s, and 72°C for 35 s. At the end of each run, a melting curve analysis was performed from 55°C to 95°C to monitor primer dimers and verify amplicon specificity. The reactions were performed in duplicate. The level of L. infantum LEM 5700 amastigotes hosted in macrophage-like RAW 264.7 cells was quantified by amplification of the amastin gene (LinJ.34.4350), which codes for a surface glycoprotein highly expressed in the intracellular amastigote forms of Leishmania. Amastin RT-qPCR was performed in a 20-μl volume with 2 μl template DNA under the same conditions as those already described using specific primers (forward [5’-GCCGTTCTTGAGGTTGGTT-3]’ and reverse [5’-CGCTCGACGTGTTGATCT-T-3’]). A clinical isolate typed L. infantum MON-1, kindly provided by S. Houze (AP-HP, Bichat-Claude Bernard hospital, Paris, France), was used as an amastigote positive control and cultured promastigotes as amastigote negative controls. The ddCt method was used to calculate the level of total parasites and amastigote load in macrophages. Genomic DNA isolated from L. infantum strain MON-1 served as the quantification standard for the Licytb qPCR assay. We considered 150 ng of leishmanial DNA to be equivalent to 1.5 x 10⁶ parasites based on the conversion between the quantification of leishmanial DNA and parasites. This equivalence was used to prepare the standard curves based on serial dilutions of the Leishmania DNA standard in nuclease-free water, corresponding to a range of 5 × 10⁷ to 5 × 10⁻³ parasites, for which the equation was y = -1.431n(x) + 22.889 and R² = 0.9958.

The determination of dynein RNA levels in non-transfected and siRNA-transfected macrophage-like RAW 264.7 cells was performed by RT-qPCR using specific dynein primers (forward [5’- TACGCTGGCTACTTTGACCA -3’] and reverse [5’-CGTTCGTCAGCATTGGAGAG-3’]). Data were normalized against that of the housekeeping gene GAPDH (forward [5’-CAAGAAGGT-GGTGAAGCAGG-3’] and reverse [5’-GCATCGAAGGTGGAAGAGTG-3’]). One microgram of extracted RNA was treated with DNase I (Amplification Grade, Life Technologies) to eliminate the risk of contamination by mouse DNA before the RT reaction was carried out using the Superscript VILO commercial kit (Life Technologies). The RT-qPCR reaction consisted of a mixture of 20 μl, including 2 μl cDNA, 10 μl SensiFAST SYBR No Rox Mix (Bioline, Paris, France) and 400 nM primers. The PCR amplification conditions consisted of an incubation cycle of 2 min at 95°C, followed by 40 cycles of amplification of 10 s at 95°C, 10 s at 60°C, and 20 s at 72°C. A melting curve cycle was performed at the end of the cycle to verify the specificity of the amplicon.

RT-qPCR determinations were monitored using the Via 7 Real-Time PCR System (ViA 7 system, ThermoFisher Scientific). The efficiency of PCR amplification was evaluated for each pair of primer and was > 1.9.

Analysis of microtubule polymerization in vitro

Compounds were tested using the Tubulin Polymerization BK004P kit as specified by the manufacturer (Cytoskeleton, Inc., Denver, CO). Briefly, tubulin protein (> 99% purity) was suspended (300 μg/sample) in 100 μl G-PEM buffer (80 mM PIPES, 2 mM MgCl₂, 0.5 mM EGTA, 1.0 mM GTP, pH 6.9) plus 5% glycerol, with or without the test compound, at 4°C. Then, the sample mixture was transferred to a pre-warmed 96-well plate and polymerization measured by the change in absorbance at 340 nm every 1 min for 60 min (SpectraMAX Plus; Molecular Devices, Inc., Sunnyvale, CA) at 37°C.

Presentation of the data and statistics

Each experiment was performed at least two times in duplicate or triplicate. Representative confocal micrographs or movies of typical cells were used for the Fig. For the final Fig, the presented confocal micrographs were resized using Adobe Photoshop CS6 software (San Jose, CA). Quantitative data are presented as the means ± standard error of the mean (SEM). Graphs were produced using Microsoft Excel software. Comparisons between the experimental groups were performed using the unpaired Student t-test. Significance was established when P < 0.01.