Table 1.
Presence of the URE3 matrix in the promoters of genes modulated by a dominant positive URE3-BP
Figure 1.
(A) Representative electrophoretic mobility shift assay (EMSA) performed with radioactively labeled hgl5-URE3 double-stranded DNA. The lanes with probe alone are indicated; all other reactions included 2 μg of E. histolytica nuclear extract. EMSA's were performed with a Klenow-radiolabeled double stranded DNA oligonucleotide that spanned the URE3 motif within the hgl5 promoter TGTTCCAAAAAGATATATTCTATTGAAAATAAAAGAAG (hgl5-URE3). A ten fold excess of either cold hgl5-URE3 (wt), or an oligonucleotide with a base pair substitution within the URE3 motif, was used as a competition to the wild type oligonucleotide. These are indicated by position and base substitution (i.e. T4C indicates that the T at position 4 in the URE3 motif [TATT4CTATT] was changed to a C). The image was generated with a PhosphorImager (Molecular Dynamics model 425) in conjunction with the Adobe PhotoShop software program. (B) DNA-binding profile of URE3-BP derived from the EMSA results. The intensity of an irrelevant control was set as 100% and competition of the wild type oligonucleotide set as 0% (y axis). The position and base changes in the competing oligonucleotides T1A2T3T4C5T6A7T8T9 are shown on the x axis. The results of three independent replicates were averaged and are shown as a mean with standard error. (C) Graphical representation of the URE3 consensus sequence. The percent contribution of each base to the total competition occurring at each position (from each of the four bases) was calculated and shown graphically using the sequence logo program of Crooks et al.
Figure 2.
Transcriptional Activity of the URE3 Motif as Assessed by URE3-driven Repression of a Reporter Gene.
The hgl5 promoter (wild type and containing the T4A, T4C, T4G and C5A mutations) was placed upstream of the luciferase reporter gene. These constructs were transfected into cultured E. histolytica trophozoites. Mutations (T4A and C5A) identical to those within the competing oligonucleotides were made within the hgl5 promoter URE3 motif. Luciferase values from at least three independent experiments with two different DNA preparations were performed. Luciferase values standardized to wt (100%) are shown as means with standard error. Promoter activity as a % of wild type is shown on the y axis and position and base mutated in the promoter on the x axis. All mutants were statistically different from the wild type promoter (p<0.0001 using the non-parametric Kruskal-Wallis Test).
Figure 3.
Inducible Overexpression of a Calcium-Insensitive Mutant of URE3-BP (EF(2)mutURE3-BP) in E. histolytica.
A recombinant version of URE3-BP was generated by mutating one of the two EF-hand motifs of URE3-BP (associated with the ability to bind calcium, EF(2)mutURE3-BP [10]) and by introducing an N terminal myc tag. As calcium inhibited DNA binding by URE3-BP, this generated a dominant positive mutant [10]. The recombinant protein was placed under the control of a tetracycline-inducible gene expression system of E. histolytica (previously described by Ramakrishnan et al. [27]). As a control, in a second construct the initial N terminal sequence of URE3-BP was replaced by the sequence CTTGTATTTAACAATAGCTAACATC, mutated bases underlined, which introduced stop codons into the two open reading frames at the N terminus. (A) Cartoon showing the salient features of the constructs. (B) qRT-PCR of un-induced and induced ameba transfected with the pEF((2))mutURE3-BP. Results are normalized to the levels of lgl1 and shown as a percentage of values of ameba induced for 9 h (y axis). Time after induction is shown on the X axis. (C) Western blot of nuclear and cytoplasmic extracts from tetracycline-induced and un-induced amebae probed with an antibody specific for the myc tag and therefore the recombinant protein (9E10), as well as with a monoclonal antibody to URE3-BP (4D6). (D) Calcium insensitive binding to URE3 DNA in extract prepared from EF(2)mutURE3-BP transformed trophozoites. EMSA performed with added calcium and radioactively labeled hgl5-URE3 double-stranded DNA. Other than the lane with probe alone, reactions included 2 μg of E. histolytica nuclear extract prepared from either induced trophozoites carrying EF(2)mutURE3-BP or as a control STOP- EF(2)mutURE3-BP. A six fold excess of either cold hgl5-URE3 (wt), or an oligonucleotide with a base pair change which substituted a G for a T at the first position and had no impact on URE3-BP specific band formation (T1G mut) were added as shown.
Figure 4.
Comparison of E. histolytica Gene Expression upon Inducible Expression of EF(2)mutURE3-BP and STOP- EF(2)mutURE3-BP.
(A) Heat map generated from microarray data reflecting gene expression values. Each column represents a microarray. Each row represents the expression pattern of one probe set across microarrays. The source of the RNA hybridized to each chip is indicated at the top of the columns. The ratios of transcript levels between experiments are color-coded in red and green. Red represents an increase of the transcript level of a gene in the transcript signal in this array compared to the expression of the transcript in induced STOP- EF(2)mutURE3-BP and green represents a decrease as indicated by the figure color bar. The genes modulated on induction of EF(2)mutURE3-BP, as compared to STOP- EF(2)mutURE3-BP are organized by functional category as shown in Table 2. Transcripts that had a potential URE3 matrix in the sequences −375-25bp 5′ of the start ATG codon, are indicated and detailed in Table 2 changes in transcript levels verified by qRT-PCR are marked by an asterisk (*). (B) Color bar scale of log2 transformed intensities. (C) Graphical representation of the observed URE3 sequences. The percent representation of the nucleotide occurring at each position (from each of the four bases) shown graphically using the sequence logo program of Crooks et al [53].
Table 2.
URE3 motif in promoters of genes modulated by a dominant positive URE3-BP
Figure 5.
Modulated Transcripts Encoding Potential Membrane Proteins.
Sequences were clustered using the ClustalW program. A) Promoter sequences B) Protein sequence at the amino terminal C) Protein sequence at the carboxyl terminal. Numbering is from initial methionine codon or amino acid. * open reading frames where an alternative from the database initiating methionine was used. Potential URE3-BP binding sites are underlined.
Figure 6.
Modulation of Transcripts Encoding Enzymes Involved in Phospholipid Degradation and Fatty Acid Biosynthesis.
Transcripts significantly modulated by (EF2)mutURE3-BP are shown in shaded boxes, green indicates a down-regulated transcript and red an up-regulated transcript. As lecithin:cholesterol acyltransferase has homology with phospholipid:diacylglycerol acyltransferase the simpler pathway of triacylglycerol biosynthesis is shown although alternative pathways exist [42],[54]. The locus number and the URE3 motif present within the promoter sequences follow the gene name.
Figure 7.
EF(2)mutURE3-BP expression induced migration of amebic trophozoites.
Expression of the EF(2)mutURE3-BP and STOP- EF(2)mutURE3-BP transcripts was induced by the addition of tetracycline. Analysis of trophozoite migration was then done by a transwell assay. Data shown are representative of assays using two independently transfected trophozoite lines with the relevant expression vectors in 4 separate experiments. The data are shown as mean ± SEM of the number of cells migrated measured using CellTracker™ Green CMFDA as described in Materials and Methods.