https://orcid.org/0000-0002-2895-0732
Figures
Abstract
Nature-based wastewater treatment systems are increasingly implemented to support water reuse in arid regions, yet their effectiveness in removing viable culturable opportunistic pathogens remains insufficiently characterized. In this exploratory, culture-based study, we assessed bacterial population dynamics across a five-stage natural wastewater treatment system (Wadi Hanifa, Riyadh, Saudi Arabia), tracking culturable bacteria from secondary-treated influent to sand-filtered effluent. Water samples were collected at five sequential treatment stages and analyzed for physicochemical parameters, total culturable bacterial abundance, bacterial diversity, taxonomic composition, and antimicrobial susceptibility of persistent isolates. Total culturable bacterial counts decreased by approximately 1.1 log10 CFU mL‒1 across the system, accompanied by an approximately 50% reduction in observed isolate richness. The fecal indicator Escherichia coli was detected only in upstream and intermediate stages (sampling locations L3.1-L3.3) and was absent from downstream samples. In contrast, the opportunistic pathogen Klebsiella pneumoniae was recovered across all five treatment stages and accounted for 44.4% (8/18) of all morphologically distinct isolates grown on the selected culture media. Turbidity declined by 71% along the treatment train and showed a strong positive correlation with bacterial richness (Kendall’s τ = 0.84, p = 0.038), although this exploratory correlation should be interpreted with caution given the small sample size (n = 5 stages). Phenotypic antimicrobial susceptibility testing revealed multidrug resistance (MDR) in 62.5% (5/8) of K. pneumoniae isolates, although all remained susceptible to amikacin and meropenem. Under the conditions examined, multi-stage natural wastewater treatment substantially reduced overall bacterial abundance and diversity but did not eliminate viable, multidrug-resistant Klebsiella pneumoniae. The discordance between fecal-indicator removal and opportunistic pathogen recovery highlights system-specific limitations of indicator-based monitoring for assessing microbial safety in wastewater reuse systems. Given the limited isolate number (n = 8 K. pneumoniae) and the absence of molecular resistance-gene characterization, broader claims about wastewater as a dissemination pathway for antimicrobial resistance cannot be drawn from these data. These findings are based on a single cross-sectional sampling event and should be considered hypothesis-generating rather than confirmatory.
Citation: Aqel H, Farah H, Fodah R, Sannan N, Surakhi O (2026) Persistence of viable opportunistic pathogens in a multi-stage natural wastewater treatment system. PLoS One 21(7): e0354338. https://doi.org/10.1371/journal.pone.0354338
Editor: Muhammad Shahid, Government College University, Faisalabad, PAKISTAN
Received: January 12, 2026; Accepted: July 7, 2026; Published: July 27, 2026
Copyright: © 2026 Aqel et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: The author(s) received no specific funding for this work.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Increasing global water scarcity, particularly in arid and semi-arid regions, has driven growing reliance on wastewater reuse as a strategic resource [1–3]. In the Kingdom of Saudi Arabia, which generates approximately 3.2 million m3 day‒1 of municipal wastewater, treated effluent is increasingly used for agricultural and landscape irrigation [4,5]. Nature-based treatment systems, such as constructed wetlands and vegetated bio-cell corridors, offer low-energy, cost-effective treatment for arid-region reuse applications [6–8].
The microbiological safety of reclaimed water is conventionally assessed using fecal indicator organisms, principally Escherichia coli and total coliforms. However, accumulating evidence suggests that the removal of fecal indicators does not reliably predict the fate of opportunistic pathogens [9,10]. Fecal indicators are enteric in origin and may respond differently to environmental stressors than non-enteric opportunistic organisms [11,12]. Recent surveillance studies have documented the persistence of clinically relevant pathogens, including Klebsiella pneumoniae, in treated wastewater and reclaimed-water systems across diverse geographic settings [13,14].
Klebsiella pneumoniae is of particular concern in this context. Classified as a priority pathogen by the WHO, it is capable of causing urinary tract infections, pneumonia, and bloodstream infections, and is an important reservoir of antimicrobial resistance (AMR) determinants, including extended-spectrum β-lactamases (ESBLs) and carbapenemases [15–18]. Environmental strains have been shown to exhibit resistance profiles comparable to clinical isolates, raising concerns about dissemination via reclaimed-water irrigation [19,20].
The Wadi Hanifa natural wastewater treatment corridor in Riyadh, Saudi Arabia, represents one of the largest nature-based treatment systems in the Middle East, processing approximately 300,000 m3 day‒1 of secondary-treated municipal wastewater through sequential bio-cells and sand filtration before discharge for landscape irrigation [6]. Despite its scale and public-health relevance, the persistence of viable opportunistic pathogens across the Wadi Hanifa treatment stages has not previously been characterized using culture-based methods that confirm viability.
We hypothesized that multi-stage natural treatment would reduce total culturable bacterial abundance and diversity but that certain opportunistic pathogens-particularly K. pneumoniae-would persist through the complete treatment train owing to their environmental adaptability, capsule production, and resistance to physicochemical stressors. We further hypothesized that fecal-indicator removal would not accurately predict the fate of these organisms.
Materials and methods
Study area and sampling design
Sampling was conducted along a 4.8-km section of the Wadi Hanifa natural wastewater treatment corridor in northwest Riyadh, Saudi Arabia (24°34′ N, 46°43′ E), in November 2015. The Wadi Hanifa system receives approximately 300,000 m3 day‒1 of secondary-treated municipal wastewater and employs sequential natural treatment processes over a hydraulic residence time of 4–6 days. Sampling was performed in November to represent stable dry-season operating conditions; seasonal variation in temperature, organic loading, and flow rates may influence bacterial community composition, and the findings should be interpreted accordingly.
Although the samples were collected in November 2015, the operational configuration, hydraulic residence time, vegetation regime, and effluent-reuse pattern of the Wadi Hanifa corridor have remained substantively unchanged since that time, as confirmed by recent operational reports of the Riyadh municipal water authority. Culture-based viability data of this granularity remain scarce for arid-region nature-based treatment systems, and the dataset therefore retains baseline relevance for current reuse-safety assessment.
Access to the Wadi Hanifa treatment corridor was granted under a research agreement with King Abdullah International Medical Research Centre (KAIMRC; reference KAIMRC/RFC/0092/17). The final sand-filtered effluent (L3.5) is currently used primarily for landscape irrigation and green-belt maintenance within the Riyadh metropolitan area; no terminal chlorination step is applied before this discharge.
Five sampling locations representing sequential treatment stages were selected: L3.1 (Raw influent) — inlet receiving secondary-treated municipal wastewater; L3.2 (Post-screening) – after coarse screening and grit removal, ~ 500 m downstream; L3.3 (Bio-cell 1) – first vegetated bio-cell dominated by Phragmites australis, ~ 1.2 km downstream; L3.4 (Bio-cell 2) – second bio-cell with established aquatic fauna and algal communities, ~ 2.8 km downstream; L3.5 (Final effluent) – post-sand filtration, ~ 4.8 km downstream.
Terminology Note. Throughout this manuscript, “culturable” refers to bacteria recoverable under the specific media and incubation conditions used in this study. “Viable” is used in the conventional sense of having metabolic activity and the potential for growth; however, culturability is considered a proxy for viability rather than a perfect synonym, as the viable-but-non-culturable (VBNC) state is well documented for many bacterial taxa, including Klebsiella pneumoniae, and is not captured by the culture-based approach used here. “Culture-based” describes the overall methodological framework, and findings should be interpreted with the understanding that VBNC cells are not enumerated.
Sample collection
Water samples (1 L) were collected in sterile, screw-cap polypropylene bottles at each of the five sampling locations. Samples were transported to the laboratory on ice and processed within 4 hours of collection. Triplicate samples were collected at each location to enable calculation of means and standard deviations.
Physicochemical analysis
Physicochemical parameters were measured in situ at each sampling location using a calibrated YSI Pro Plus multiparameter probe. Parameters measured included pH, temperature (°C), dissolved oxygen (DO; mg L‒1), turbidity (NTU), and electrical conductivity (EC; µS cm‒1). Three independent replicate readings per parameter were taken after a ~ 2-min stabilization period, with ~2 m spacing between replicate measurement positions. Raw triplicate measurements are provided in Supporting Table S3 in S1 File.
Bacterial isolation and enumeration
Total culturable bacterial counts were determined by spread-plating serial dilutions (10‒1 to 10‒6) onto blood agar (BA) and MacConkey agar (MAC) plates in triplicate. Plates were incubated at 37°C for 24–48 h. Morphologically distinct colony types were counted and selected for further characterization. All colony counts were performed by two independent operators; counts were accepted when the coefficient of variation between triplicates was ≤ 15%. Raw triplicate counts are provided in Supporting Table S1 in S1 File.
Phenotypic and biochemical characterization
Morphologically distinct isolates were subjected to Gram staining and standard biochemical characterization using API 20E strips (bioMérieux, Marcy-l’Étoile, France) according to the manufacturer’s instructions. API 20E profiles were read at 24 h and 48 h and interpreted using the API® web database. Hierarchical clustering of biochemical profiles was performed to assess phenotypic similarity among isolates (Supporting Table S2 in S1 File). Isolate selection for further molecular characterization was based on frequency of recovery, phenotypic distinctiveness, and clinical relevance of the presumptive identification.
DNA extraction
Genomic DNA was extracted from overnight cultures using the boiling method: cells were resuspended in sterile distilled water, boiled for 10 min, centrifuged at 13,000 × g for 5 min, and the supernatant used as template. DNA concentration and purity were assessed by NanoDrop spectrophotometry (A260/A280 ≥ 1.8). The guanine‑plus‑cytosine (G+C) content was determined by the thermal denaturation method as described by Marmur and Doty [21].
Detection of 16S rRNA using PCR
16S rRNA gene amplification was performed using universal primers KP_16S F1 (NM3_F) (5′- ATGTCGCAAGACCAGAGTGG −3′) and KP_16S R1 (NM3_R) (5′- GCACAACCTCCAAATCGACA −3′). PCR conditions: 94°C for 3 min; 35 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 30 s; final extension 72°C for 10 min. Products (~657 bp) were resolved on 1.5% agarose gels.
Antimicrobial susceptibility testing
Antimicrobial susceptibility of the eight K. pneumoniae isolates was determined by Kirby-Bauer disk diffusion on Mueller–Hinton agar, following CLSI M100 (33rd edition, 2023) guidelines [22]. Eight antimicrobial agents were tested: ampicillin (10 µg), amoxicillin-clavulanate (20/10 µg), ceftazidime (30 µg), cefotaxime (30 µg), ciprofloxacin (5 µg), trimethoprim-sulfamethoxazole (1.25/23.75 µg), amikacin (30 µg), and meropenem (10 µg). Zone diameters were measured in triplicate and interpreted as susceptible, intermediate, or resistant. Multidrug resistance was defined as resistance to ≥3 antimicrobial classes. Raw zone-of-inhibition measurements are provided in Supporting Table S4 in S1 File.
Statistical analysis
All analyses were performed using R version 4.3.2 [23]. Bacterial diversity at each treatment stage was quantified using isolate richness (S), the Shannon-Wiener index (H′), Simpson’s diversity index (1 – D), and Pielou’s evenness (J′). Trends in culturable bacterial abundance across treatment stages were evaluated using linear regression. Given the ordinal nature of the treatment stages and the small sample size, Cochran-Armitage exact tests were used to detect monotonic trends in categorical variables. All statistical analyses presented here are exploratory and intended to identify trends consistent with biological mechanisms, rather than to provide definitive inferential conclusions. Associations between physicochemical parameters and bacterial richness were examined using Kendall’s τ rank correlation. Differences in Gram-type composition across treatment stages were evaluated using Fisher’s exact test. Statistical significance was defined at α = 0.05; all p-values are reported as exploratory.
Quality assurance and quality control
All culture media were prepared from commercially certified dehydrated powders and quality-controlled using ATCC reference strains (E. coli ATCC 25922, K. pneumoniae ATCC 13883) prior to use. Positive and negative controls were included in each PCR run. Field blanks (sterile distilled water processed identically to samples) were included at each sampling visit; no contamination was detected. All glassware and sampling equipment were sterilized by autoclaving (121°C, 15 min, 15 psi) prior to use.
Ethical considerations
This study involved collection of environmental water samples from a managed public treatment waterway. No human subjects, animals, or personal data were involved. Approval was granted by the KAIMRC Institutional Review Board (reference KAIMRC/RFC/0092/17). No additional ethical approval was required.
Results and discussion
Physicochemical changes across treatment stages
Progressive improvements in physicochemical quality were observed across the five treatment stages (Table 1; raw triplicate data in Supporting Table S3 in S1 File). Turbidity declined from 28.4 NTU at L3.1 to 8.2 NTU at L3.5, representing a 71% reduction. Dissolved oxygen increased progressively from 3.1 mg L‒1 at L3.1 to 7.8 mg L‒1 at L3.5, consistent with phytoremediation activity in the bio-cells. pH remained within a narrow circumneutral range (7.2–7.9) throughout the system. Electrical conductivity declined modestly (1,280–1,045 µS cm‒1), suggesting limited ion removal by the natural treatment processes. Temperature (22.4–24.1°C) was relatively stable across stages, consistent with sampling in the November dry season.
Reduction in culturable bacterial load
Total culturable bacterial counts declined by approximately 1.1 log10 CFU mL‒1 across the treatment system (Table 2 and Supporting Table S1 in S1 File), with the greatest single-stage reduction occurring between Bio-cell 1 (L3.3) and Bio-cell 2 (L3.4). Linear regression revealed a consistent monotonic decreasing trend across treatment stages (R2 ≥ 0.96; p < 0.001, exploratory). Because only five treatment stages were sampled, this high R2 value should be interpreted cautiously, as regression models fitted to n = 5 data points carry an elevated risk of overfitting; the result is best regarded as an indicator of a consistent monotonic trend rather than a precise quantitative relationship.
Despite this reduction, the overall log10 decrease remains well below the ≥ 5-log pathogen-removal targets recommended by the WHO for unrestricted irrigation reuse [24]. It is important to emphasize that WHO ≥ 5-log targets refer to pathogen-specific reductions (e.g., for rotavirus, Cryptosporidium, and selected bacterial pathogens, generally evaluated at the unit-process level), not to total culturable heterotrophic bacterial counts. The comparison here is provided solely for contextual scale; total CFU reduction is not a direct equivalent of pathogen-specific log-removal credits. These findings suggest that while natural treatment substantially improves microbiological quality, it may be insufficient as a sole barrier for pathogen-risk control in reuse applications, and terminal disinfection should be considered.
Shifts in viable bacterial composition and persistence of Klebsiella pneumoniae
Culture-based profiling of 18 morphologically distinct isolates revealed pronounced shifts in bacterial composition along the treatment train (Table 3). Escherichia coli was detected only up to Bio-cell 1 (L3.3) and was absent from downstream stages, consistent with effective removal of fecal indicators. In contrast, Klebsiella pneumoniae persisted across all five treatment stages and accounted for 44.4% (8/18) of all characterized isolates.
The hierarchical clustering of biochemical profiles (Supporting Table S2 in S1 File) showed that all eight K. pneumoniae isolates-recovered across the full treatment train-grouped within a tight metabolic cluster distinct from E. coli, Enterobacter, and Proteus isolates, indicating phenotypic coherence of the persistent K. pneumoniae population and consistency of identification across stages.
This divergence underscores a system-specific limitation of indicator-based monitoring. The absence of E. coli would conventionally be interpreted as adequate microbial safety; however, the continued recovery of viable K. pneumoniae across all treatment stages demonstrates that clinically relevant opportunistic pathogens may persist even when fecal-indicator thresholds are met. Possible explanations include: (i) use of non-selective BA and MAC agar rather than selective chromogenic media, which may have led to underestimation of E. coli in downstream samples; (ii) the known environmental persistence of K. pneumoniae, facilitated by capsule formation, biofilm production, and metabolic versatility [18]; and (iii) the typically lower environmental stress tolerance of E. coli compared with non-enteric opportunistic pathogens under aerobic, low-turbidity conditions. Similar discrepancies have been documented in wastewater and reclaimed-water systems [13,25–28].
Antimicrobial resistance profiles of persistent Klebsiella pneumoniae
Phenotypic antimicrobial susceptibility testing of the eight K. pneumoniae isolates revealed multidrug resistance (MDR; resistance to ≥3 antimicrobial classes) in 62.5% (5/8) of isolates (Table 4). Universal resistance to ampicillin was observed, consistent with the intrinsic AmpC-like β-lactamase of K. pneumoniae. High resistance rates were observed for ceftazidime (75%), amoxicillin-clavulanate (62.5%), and trimethoprim-sulfamethoxazole (62.5%), suggesting possible extended-spectrum β-lactamase (ESBL) or plasmid-mediated resistance. All isolates retained susceptibility to amikacin and meropenem, indicating that last-resort carbapenems remained effective against these isolates.
The recovery of viable MDR K. pneumoniae in the final sand-filtered effluent is consistent with recent reports suggesting that wastewater systems may act as environmental compartments where antimicrobial-resistant organisms can persist [18,29–34]. However, given the limited number of isolates (n = 8) and the absence of molecular characterization of resistance determinants in this study, broader claims regarding the role of this system as a dissemination pathway for antimicrobial resistance cannot be substantiated from the present dataset and would require dedicated genomic, longitudinal, and source-tracking investigations. Culture-based confirmation does, however, demonstrate that resistance phenotypes detected here correspond to viable organisms with environmental-persistence potential. Molecular characterization of resistance genes (e.g., blaSHV, blaTEM, blaCTX-M) and plasmid replicon typing would be needed to confirm the genetic basis of resistance in future studies. Raw zone-of-inhibition measurements for all eight isolates are provided in Supporting Table S4 in S1 File.
Bacterial diversity, correlations with physicochemical parameters, and compositional stability
Observed isolate richness declined by approximately 50% across treatment stages (from S = 4 at L3.1 to S = 2 at L3.5; Cochran–Armitage exact test, p = 0.022; n = 5 stages, exploratory), accompanied by reductions in Shannon–Wiener (H′: 1.33 → 0.69) and Simpson (1 – D: 0.73 → 0.45) diversity indices (Table 5). Turbidity exhibited a strong positive rank correlation with bacterial richness (Kendall’s τ = 0.84, p = 0.038), supporting the role of particulate removal as a primary driver of microbial diversity loss. Because only five treatment stages were sampled, this correlation is exploratory; nonetheless, the result is consistent with the established role of particle-associated transport in governing microbial fate in constructed wetland and bio-cell systems [16,35–37].
Dissolved oxygen showed a moderate negative trend with bacterial richness (Kendall’s τ = −0.74, p = 0.062), while pH, temperature, and EC were not significantly correlated with diversity metrics (Table 6). These findings suggest that physical removal processes-particularly sedimentation and filtration of particle-associated bacteria-were the dominant drivers of bacterial diversity loss, rather than gradual changes in water chemistry.
Despite overall diversity reduction, the proportion of Gram-negative isolates remained statistically stable across all treatment stages (Fisher’s exact test, p = 0.637; Table 5). With such small numbers of isolates per stage, this non-significant result carries a high risk of Type II error and should not be interpreted as confirming true compositional stability. The recovery of Gram-negative taxa, including K. pneumoniae, across all stages further suggests that capsule formation, metabolic versatility, and environmental adaptability are more critical determinants of survival than cell-wall structure [17, 38].
Representative K. pneumoniae isolates from all five treatment stages were further characterized molecularly (Table 7). All isolates showed %G + C contents consistent with the species (57.1–57.5%) and produced the expected 16S rRNA amplicon, supporting their identification. Detailed raw data for these molecular analyses are provided in Supporting Table S4 and Figure S1 in S1 File.
Implications for wastewater reuse monitoring and public health
The contrasting fate of E. coli and K. pneumoniae within this system (described in the preceding sub-section) demonstrates that fecal-indicator compliance does not guarantee removal of opportunistic pathogens under the conditions examined. Recent reviews and policy analyses increasingly recognize the limitations of indicator-only frameworks for reclaimed-water safety [11,15,24,26].
The recovery of viable MDR K. pneumoniae in the final effluent-which is used for landscape irrigation without terminal disinfection-suggests a potential exposure pathway that merits further risk quantification through quantitative microbial risk assessment (QMRA) [39,40], while acknowledging that the present cross-sectional dataset is not sufficient to characterize exposure or risk quantitatively.
These preliminary findings support calls to supplement routine indicator monitoring with targeted surveillance of clinically relevant opportunistic pathogens and to integrate terminal disinfection barriers into nature-based treatment systems when effluent reuse is intended. From a conceptual QMRA perspective, the recovery of viable MDR K. pneumoniae in irrigation-grade effluent suggests potential exposure pathways including aerosol inhalation during sprinkler irrigation, dermal contact during agricultural activity, and indirect ingestion through produce. Incorporating viability-based pathogen data into QMRA frameworks, together with dose-response models for opportunistic pathogens, may substantially improve the accuracy of health-risk estimates in arid-region reuse contexts [40]. Larger, longitudinal studies employing both culture-based and molecular approaches are needed to confirm and extend these observations.
Conclusions
This exploratory culture-based investigation provides preliminary evidence that a multi-stage natural wastewater treatment system can substantially reduce overall bacterial load and diversity while permitting the persistence of viable, frequently multidrug-resistant Klebsiella pneumoniae. Under the conditions examined, the elimination of E. coli contrasted with the continued recovery of K. pneumoniae across all treatment stages, revealing a system-specific limitation of fecal-indicator-based monitoring for water-reuse safety assessment.
These findings are based on a single sampling event with a limited number of isolates (n = 18) and should be regarded as preliminary and hypothesis-generating. Although the samples were collected in November 2015, the operational configuration of the Wadi Hanifa corridor has remained stable, supporting the continuing relevance of the dataset; however, larger, multi-season studies with expanded isolate collections, molecular confirmation, and resistance-gene characterization are required to validate and generalize these observations. The results highlight the potential need to integrate targeted pathogen surveillance and additional treatment barriers, such as terminal disinfection, into nature-based systems to support sustainable and safe wastewater reuse in arid regions.
Supporting information
S1 File. S1 Table.
Complete culturable bacterial counts (CFU mL‒1) across the five treatment stages, including mean ± SD from triplicate plate counts on blood agar (BA) and MacConkey agar (MAC). Table S2. Hierarchical clustering of the 18 bacterial isolates based on API 20E biochemical profiles. Groupings reflect similarity in metabolic traits and are consistent with presumptive taxonomic identification. Table S3. Raw triplicate physicochemical measurements across sequential treatment stages, underlying the means ± SD reported in Table 1. Instrument: YSI Pro Plus multiparameter probe (calibrated prior to each sampling event). Sampling date: November 2015; Wadi Hanifa treatment corridor, Riyadh, Saudi Arabia (24°34′ N, 46°43′ E). Table S4. Raw zone-of-inhibition measurements (mm) and CLSI interpretive categories for all eight K. pneumoniae isolates across the eight antimicrobial agents tested; raw agarose gel images of 16S rRNA PCR products for the five representative isolates; and individual API 20E reaction scores for all 18 isolates. Figure S1. Representative agarose gel electrophoresis images of 16S rRNA PCR products for K. pneumoniae isolates. (A) Lane 1: 100 bp DNA ladder; Lane 2: positive control (K. pneumoniae ATCC 13883); Lanes 3–7: five representative isolates from L3.1–L3.5; Lane 8: negative control (sterile water). Expected amplicon size: ~ 657 bp. (B) Confirmation gel showing PCR products from all eight K. pneumoniae isolates with DNA ladder. Gel conditions: 1.5% agarose, 100 V for 45 min, stained with ethidium bromide.
https://doi.org/10.1371/journal.pone.0354338.s001
(DOCX)
References
- 1. El-Rawy M, Batelaan O, Al-Arifi N, Alotaibi A, Abdalla F, Gabr M. Climate Change Impacts on Water Resources in Arid and Semi-Arid Regions: A Case Study in Saudi Arabia. Water. 2023;15(3):606.
- 2. Morante-Carballo F, Montalván-Burbano N, Quiñonez-Barzola X, Jaya-Montalvo M, Carrión-Mero P. What Do We Know about Water Scarcity in Semi-Arid Zones? A Global Analysis and Research Trends. Water. 2022;14(17):2685.
- 3.
Hassen TB, El Bilali H. Water management in the Gulf Cooperation Council: Challenges and prospects. Water scarcity and sustainable agriculture in semiarid environment. London: Academic Press. 2022. p. 525–40.
- 4. Alhajri MF, Jamil R, Abdalla EME, Alqahtany A, Almazroua S, Al-Gehlani WAG. Status of wastewater treatment and reuse in Saudi Arabia and its forecasting for the year 2035. Appl Water Sci. 2025;15(7).
- 5.
Ministry of Environment, Water and Agriculture. National Water Strategy 2030: Progress Report. Riyadh: Kingdom of Saudi Arabia. 2023.
- 6. Kashmiri S. Operationalizing sense of place concepts and cultural ecosystem services to explore urban ecosystem rehabilitation performance: The case of Wadi Hanifah, Riyadh, Saudi Arabia. Urban Ecosyst. 2023;26(3):789–804.
- 7. Al-Hagla K, Alrawaf T. Operationalizing Nature-Based Solutions for Urban Sustainability in Hyper-Arid Regions: The Case of the Eastern Province, Saudi Arabia. Sustainability. 2025;17(17):8036.
- 8. Rahman KZ, Al Saadi S, Al Rawahi M, van Afferden M, Bernhard K, Friesen J, et al. Small Decentralized Technologies for High-Strength Wastewater Treatment and Reuse in Arid and Semi-Arid Regions. Environments. 2024;11(7):142.
- 9. Bailey ES, Hopkins M, Casanova L, Sobsey MD. Evaluating fecal indicator and pathogen relationships in sewage-impacted surface waters. Pathogens. 2021;10(12):1603.
- 10. Serio F, Martella L, Imbriani G, Idolo A, Bagordo F, De Donno A. The water safety plan approach: application to small drinking-water systems. Int J Environ Res Public Health. 2021;18(8):4360.
- 11. Bivins A, North D, Ahmad A, Ahmed W, Alm E, Been F, et al. Wastewater-Based Epidemiology: Global Collaborative to Maximize Contributions in the Fight Against COVID-19. Environ Sci Technol. 2020;54(13):7754–7. pmid:32530639
- 12. Dogan OB, Meneses YE, Flores RA, Wang B. Risk-based assessment and criteria specification of the microbial safety of wastewater reuse in food processing. Water Research. 2020;171:115466.
- 13. Job OS, Bala JD, Abdulraham AA, Friday NN, Ibekie SA, Tsebam CJ, et al. Microbial source tracking: an emerging technology for microbial water quality assessment. UMYU J Microbiol Res. 2023;8(1):109–121.
- 14. Le TH, Truong T, Tran LT, Nguyen DH, Pham TPT, Ng C. Antibiotic resistance in the aquatic environments: the need for an interdisciplinary approach. Int J Environ Sci Technol. 2023;20(3):3395–408.
- 15.
World Health Organization. Guidelines on sanitation and health. Geneva: WHO. 2022.
- 16. Ågerstrand M, Josefsson H, Wernersson A-S, Larsson DGJ. Opportunities to tackle antibiotic resistance development in the aquatic environment through the Water Framework Directive. Ambio. 2023;52(5):941–51. pmid:36723847
- 17. Smith AM, Ramudzulu M, Munk P, Avot BJP, Esterhuyse KCM, van Blerk N, et al. Metagenomics analysis of sewage for surveillance of antimicrobial resistance in South Africa. PLoS One. 2024;19(8):e0309409. pmid:39186711
- 18. Dong N, Yang X, Chan EW-C, Zhang R, Chen S. Klebsiella species: Taxonomy, hypervirulence and multidrug resistance. EBioMedicine. 2022;79:103998. pmid:35405387
- 19. Sahoo S, Sahu A, Sahoo RK, Gaur M, Bhanjadeo D, Subudhi E. Environmental trafficking of superbug carbapenem-resistant Klebsiella pneumoniae and its silent spread in an urban population. Environ Sci Eur. 2025;37(1):132.
- 20. Qi FY, Zhang Y, Liu J, Li Q, Wang J, Tan W, et al. Phenotypic and genomic analysis of pathogenic Enterobacteriaceae isolated from leafy vegetables. Environ Int. 2025;188:109963.
- 21. Marmur J, Doty P. Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. J Mol Biol. 1962;5:109–18. pmid:14470099
- 22.
Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. Wayne, PA: CLSI. 2023.
- 23.
R Core Team. R: A language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. 2023.
- 24.
World Health Organization. Guidelines for the safe use of wastewater, excreta and greywater. Geneva: WHO. 2006.
- 25. Noor ZZ, Rabiu Z, Sani MHM, Samad AFA, Kamaroddin MFA, Perez MF. A review of bacterial antibiotic resistance genes and their removal strategies from wastewater. Current Pollution Reports. 2021;7(4):494–509.
- 26. Chen J, Liu C, Teng Y, Zhao S, Chen H. The combined effect of an integrated reclaimed water system on the reduction of antibiotic resistome. Sci Total Environ. 2022;838(Pt 3):156426. pmid:35660592
- 27. Galarde-López M, Velazquez-Meza ME, Bobadilla-del-Valle M, et al. Surveillance of antimicrobial resistance in hospital wastewater: identification of bacterial genera and resistance determinants. Antibiotics. 2024;13(4):369.
- 28. Hooban B, Joyce A, Fitzhenry K, Chique C, Morris D. The role of the natural aquatic environment in the dissemination of extended spectrum beta-lactamase and carbapenemase encoding genes: A scoping review. Water Res. 2020;180:115880. pmid:32438141
- 29. Liu M, Zheng L, Zhu L, Lu G, Guo H, Guan J, et al. Characteristics of Carbapenem-resistant Klebsiella pneumoniae in sewage from a tertiary hospital in Jilin Province, China. PLoS One. 2023;18(5):e0285730. pmid:37195919
- 30. Booq RY, Abutarboush MH, Alolayan MA, Huraysi AA, Alotaibi AN, Alturki MI, et al. Identification and Characterization of Plasmids and Genes from Carbapenemase-Producing Klebsiella pneumoniae in Makkah Province, Saudi Arabia. Antibiotics (Basel). 2022;11(11):1627. pmid:36421271
- 31. Zapata C, Rodríguez L, Romero Y, Coila P, Hañari-Quispe RD, Oros O, et al. Genomic Characterization of Escherichia coli Isolates from Alpaca Crias (Vicugna pacos) in the Peruvian Highlands: Insights into Functional Diversity and Pathogenicity. Microorganisms. 2025;13(7):1533.
- 32.
American Public Health Association. Standard methods for the examination of water and wastewater. 24th ed. Washington, DC: APHA. 2023.
- 33. Cahill N, O’Connor L, Mahon B, Varley Á, McGrath E, Ryan P, et al. Hospital effluent: a reservoir of carbapenemase-producing Enterobacterales?. Sci Total Environ. 2019;672:618–24.
- 34. Sukhum KV, Diorio-Toth L, Dantas G. Genomic and Metagenomic Approaches for Predictive Surveillance of Emerging Pathogens and Antibiotic Resistance. Clin Pharmacol Ther. 2019;106(3):512–24. pmid:31172511
- 35. Ma J, Cui Y, Li A, Zou X, Ma C, Chen Z. Antibiotics and antibiotic resistance genes from wastewater treated in constructed wetlands. Ecol Eng. 2022;177:106548.
- 36. Masoud AMN, Alfarra A, Sorlini S. Constructed Wetlands as a Solution for Sustainable Sanitation: A Comprehensive Review on Integrating Climate Change Resilience and Circular Economy. Water. 2022;14(20):3232.
- 37. Wu S, Carvalho PN, Müller JA, Manoj VR, Dong R. Sanitation in constructed wetlands: A review on the removal of human pathogens and fecal indicators. Sci Total Environ. 2016;541:8–22. pmid:26398446
- 38. Adegoke AA, Amoah ID, Stenström TA, Verbyla ME, Mihelcic JR. Epidemiological Evidence and Health Risks Associated With Agricultural Reuse of Partially Treated and Untreated Wastewater: A Review. Front Public Health. 2018;6:337. pmid:30574474
- 39. Zhang Z, Teng M, Zhao L, Sun J, Li Y, Ma H, et al. Metagenome-informed QMRA and resistome profiling reveal hidden health risks in Yongding River wastewater. Water Research X. 2025;29:100403.
- 40.
World Health Organization. Quantitative microbial risk assessment: Application for water safety management. Geneva: WHO. 2016.