A new mouse mutant with a discrete mutation in Pcdhgc5 reveals that the Protocadherin γC5 isoform is not essential for dendrite arborization in the cerebral cortex

Camille M. Hanes; David M. Steffen; George C. Murray; Robert W. Burgess; Joshua A. Weiner; Andrew M. Garrett

doi:10.1371/journal.pone.0344863

Abstract

There are ~ 60 clustered protocadherin (cPcdh) isoforms expressed from three gene clusters (Pcdha, Pcdhb, Pcdhg) arrayed in tandem across nearly 1 Mb in mammals. cPcdhs are homophilic cell adhesion molecules (CAMs) critical for a host of neural developmental functions consistent with a role in cell-cell recognition. Indeed, isoforms make recognition modules in combination to generate recognition diversity far exceeding the ~ 60 individual CAMs. However, there is also growing evidence for specialized functions for specific isoforms, particularly the C-type isoforms found at the 3’ ends of the Pcdha cluster (αC1 and αC2) and at the 3’ end of the Pcdhg cluster (γC3, γC4, and γC5). We have previously described unique roles for γC3 in dendrite arborization in the cerebral cortex and neural circuit formation in the spinal cord, as well as for γC4 in neuronal survival. Here we report a new mouse mutant specifically targeting the Pcdhgc5 exon encoding γC5. Unlike the rest of the Pcdhg cluster, expression of this isoform does not begin until postnatal stages of mouse development, increasing in the second week of life, suggesting specialized roles. We found significant expression changes in gene pathways involved in synaptic activity, learning and memory, and cognition. Despite this, we saw no major disruption in the cerebral cortex in neuronal organization, survival, dendritic arborization, or synaptic protein expression in these mutants. This new model will be an important tool for future studies delineating specific functions for γC5.

Citation: Hanes CM, Steffen DM, Murray GC, Burgess RW, Weiner JA, Garrett AM (2026) A new mouse mutant with a discrete mutation in Pcdhgc5 reveals that the Protocadherin γC5 isoform is not essential for dendrite arborization in the cerebral cortex. PLoS One 21(3): e0344863. https://doi.org/10.1371/journal.pone.0344863

Editor: Xiangming Zha, Tulane University School of Medicine, UNITED STATES OF AMERICA

Received: November 11, 2025; Accepted: February 26, 2026; Published: March 12, 2026

Copyright: © 2026 Hanes et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All RNA-seq data are available in the GEO database with accession number GSE310953. Other data are included in Supporting information.

Funding: NIH/NINDS R21 NS090030 to J.A.W. and R.W.B. NIH/NINDS R01 NS055272 to J.A.W. NIH/NEI R01 EY031690 to A.M.G. The funders played no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

The clustered protocadherins (cPcdhs) are a family of ~60 homophilic cadherin superfamily cell adhesion molecules (CAMs) with numerous essential functions in the developing nervous system. cPcdhs are expressed from three contiguous gene clusters in mammals: in the mouse, the Pcdha cluster encodes 14 α-Pcdhs, the Pcdhb cluster encodes 22 β-Pcdhs, and the Pcdhg cluster encodes 22 γ-Pcdhs [1,2]. Much of each individual isoform is encoded by a single large variable exon, including six extracellular cadherin (EC) repeats, a transmembrane domain, and a unique variable cytoplasmic domain. The Pcdha and Pcdhg clusters each have a set of constant exons at their 3’ ends that encode a shared cytoplasmic C-terminus specific to that individual cluster, while Pcdhb has no such constant exons such that each β-Pcdh is encoded entirely by the single variable exon (Fig 1A). Individual Pcdhg isoforms are further classified based on sequence homology as belonging to the γA, γB or γC subgroups (Fig 1B). The Pcdha cluster also has two C-type isoforms; altogether, the five C-type isoforms share more homology with each other than they do with the other members of their respective Pcdha and Pcdhg clusters. Each cPcdh isoform interacts in a strictly homophilic manner in trans (across two cells) but each promiscuously can form cis dimers with less isoform-specific stringency [3–5]. This organization of protein binding can result in the formation of a large lattice of dimers between membranes with isoform matching, and can thus encode for a very high level of recognition diversity [6–8].

Download:

Fig 1. cPcdh locus and isoform expression.

(A) The cPcdhs comprise three gene clusters: Pcdha (red), Pcdhb (green), and Pcdhg (blue). Pcdha and Pcdhg each have constant exons at the 3’ end of the locus (black). (B) Variable exons in the Pcdhg cluster are classified as A-, B-, or C-type. γC5 is at the 3’ end of the variable exons. (C) Western blot analysis of γC4 expression in brain lysates during postnatal development demonstrated stable expression from birth, while (D) γC5 was undetectable at P0 and increased from low expression at P7 to high expression at P21. GAPDH was used as a loading control for both isoforms.

https://doi.org/10.1371/journal.pone.0344863.g001

The large number of isoforms encoded by the cPcdhs raises the question of whether there is functional redundancy among the isoforms, or if all 58 are uniquely needed for proper development. Some cell types do require numerous isoforms to provide a mechanism for self/non-self discrimination important for neuronal self-avoidance, without a clear requirement for any one individual isoform [9–11]. However, the expression pattern of the C-type isoforms is more consistent with specialization. Three of the five (αC2, γC4, γC5) lack the conserved sequence element found in the promoters of nearly all other cPcdh exons, suggesting these isoforms are regulated in a different manner [1,2]. The C-type isoforms are highly expressed, often deterministically or preferentially in some cell types: αC2 is the dominant isoform in serotonergic neurons [12,13], γC4 in cortical interneurons vs. γC5 in cortical excitatory neurons [14], and γC3 in astrocytes of many brain regions [15]. This suggests that the primary role of the C-type isoforms may not be for self/non-self discrimination, as the widespread expression of these isoforms would seem to argue against this.

The expression patterns of C-type isoforms could, rather, suggest distinct roles. Consistent with this, we employed a discrete Pcdhgc3 mouse mutant to demonstrate unique roles for γC3 in dendritic arborization [16,17], spinal sensory neuron synapse formation [18] and astrocyte morphology [15]. The γC4 isoform is the only one necessary and sufficient for neuronal and organismal survival [16,19–21]. Additionally, αC2 has a unique role in establishing axon morphology in serotonergic neurons [12,13]. We therefore reasoned that the remaining γ-Pcdh C-type isoform, γC5, may also play unique roles in neural development. Indeed, it has been reported that γC5 localizes to GABAergic synapses, where it interacts with the γ2 subunit of the postsynaptic GABA_A receptor (γ2-GABA_AR) via the two proteins’ cytoplasmic domains [22]. Although γC5 is not required for GABAergic synapse formation, this interaction facilitates GABA_AR cell surface expression and GABAergic synapse stability and maintenance [22]. Similar to γC3 and γC4, γC5 is thought to be widely expressed in the central nervous system; however, the temporal and cell-type expression patterns of γC5 appear distinct from those of other γ-Pcdh isoforms. For example, mouse γC5 expression has been reported to begin only during the second postnatal week [23], coinciding with synaptogenesis [24]. This is in contrast to both γC4, which is highly expressed embryonically and within the first two postnatal weeks before declining, and several other γ-Pcdh isoforms, whose expression is relatively uniform during development and into adulthood [23]. Analysis of single-cell RNAseq data sets from adult mouse cortex observed a contrasting pattern of γC4 and γC5: γC4 is distinctly enriched in GABAergic interneurons compared to excitatory neurons, whereas glutamatergic excitatory neurons are enriched in γC5 expression [14,25].

We thus hypothesized that γC5 plays a unique role in the central nervous system. Here, we test this hypothesis with a new targeted mouse line harboring a discrete mutation disrupting Pcdhgc5. Despite significant expression changes in transcriptional pathways involved in synaptic activity, learning and memory, and cognition, we find no gross disruption in the morphology of the brain, nor in the organization, survival, dendritic arborization, or synaptic protein expression of cerebral cortex neurons in mice lacking γC5. While distinct roles for γC5 remain to be uncovered by further analysis, this result further highlights the uniqueness of demonstrated γC3 and γC4 functions and confirms that cPcdh C-type isoforms are not interchangeable.

Materials and methods

Mouse lines

All experiments included male and female mice and were carried out in accordance with the Institutional Animal Care and Use Committee at the University of Iowa, the Jackson Laboratory, and Wayne State University, as well as the National Institutes of Health guidelines. All mice were kept under standard housing and husbandry conditions with food and water provided ad libitum and 12/12 hour light/dark cycles. All control and mutant mice were on a C57BL/6J background. Control mice for all mutants were either wild-type littermates or age-matched C57BL/6J mice from the same colony and housed together. The Thy1-YFPH line [26] used for dendrite arborization and dendritic spine analysis was obtained from The Jackson Laboratory (Strain 003782).

Pcdhg^C5KO allele

Pcdhg^C5KO mice (γC5-KO) were generated by specifically targeting the Pcdhgc5 variable exon using CRISPR/Cas9 genome editing. An sgRNA (5’-TGGCATCACCACAGGTCGCTGGG-3’; PAM site underlined) complementary to the variable exon of C5 was microinjected (50 ng/μL), along with Cas9 mRNA (100 ng/μL), into C57BL/6J zygotes, which were subsequently implanted into pseudopregnant female C57BL/6J mice. Founders were identified by PCR genotyping, and one founder carrying the 7-base pair (bp) deletion of TCGCTGG, 25 bp after the start codon for PcdhgC5 exon 1, was bred to C57BL/6J mice for two generations to eliminate mosaicism and possible off target effects. Mice were genotyped via PCR using primers spanning the CRISPR target site (C5KO forward: 5’-GGCAAACCTCAGAGCAGTTT-3’ and C5KO reverse: 5’- GACAACTCTCCCAGCTTTGC-3’).

Tissue preparation and immunofluorescence

Experimental and control mice at 6 weeks of age were transcardially perfused with ice cold 4% paraformaldehyde (PFA) and brains were extracted and immersed overnight in the same fixative at 4°C. For cryostat sectioning, fixed tissues were sunk in 30% sucrose in PBS at 4°C, immersed in Tissue-Tek OCT compound, and frozen in an isopentane-cooled dry ice/ethanol bath. Cryostat sections (collected using a Leica CM1850 cryostat) were cut at 18 μm and thawed onto gelatin-subbed slides. For immunofluorescence, sections were rehydrated, blocked with 2.5% bovine serum albumin (BSA; Sigma, Fraction V), 0.1% Triton X-100 in PBS, and incubated with primary antibody overnight at 4°C in the same solution in a humidified chamber. The next day, sections were washed with PBS and incubated with secondary antibodies conjugated with Alexa-488, −568, or −647 (1:500, Invitrogen) for 1 hour at room temperature (RT). Slides were then washed and DAPI was added to the final wash to stain nuclei. FluoroGel (Electron Microscopy Sciences) was used to mount coverslips over the sections.

Vibratome sectioning

Brains were fixed as above, then embedded in 2% agarose and sectioned coronally at 200 μm using a Vibratome 3000 sectioning system. Brain sections were then mounted onto slides with Fluoro-Gel for confocal microscopy analysis.

Image collection for dendritic arborization analysis

Images were collected from pyramidal neurons in the S1 cortex using a 20x objective on a Leica TCS SPE confocal microscope via the Leica LAS X software. Stacks were 100 μm in the Z-dimension with a step size of 0.5 μm. Individual neurons were traced in 3D using FIJI’s Simple Neurite Tracer plugin. Sholl analysis was conducted for each individual neuron using FIJI’s Sholl Analysis plugin. Area under the curve for each neuron was calculated using Prism (GraphPad). Researchers were blind to genotype during imaging and analysis.

SDS/PAGE and Western blotting

Brain lysate was prepared by homogenizing brains in 1−2 ml RIPA buffer (50 mM Tris-HCl pH 7.4, 5mM NaF, 0.1% SDS, 0.25% sodium deoxycholate, 1% NP-40, 0.15M NaCl) supplemented with protease inhibitor (Roche miniComplete) and PhosSTOP phosphatase inhibitor (Roche). Protein samples of equal amounts were loaded into TGX precast gels (Bio-Rad), separated via SDS/PAGE, and transferred onto nitrocellulose membranes using a TransBlot Turbo System (Bio-Rad). After protein transfer, membranes were blocked in 5% nonfat milk or BSA in TBS with 0.1% Tween 20 (TBST) for 1 h. Membranes were then washed 3x for 5 min in TBST. Primary antibodies were diluted in 2.5% BSA in TBST and membranes were incubated overnight at 4°C. Blots were washed 3x in TBST. The membrane was then incubated for 1 h in horseradish peroxidase (HRP)-conjugated secondary antibodies (1:1000–1:5000, Jackson ImmunoResearch) diluted in 2.5% BSA in TBST. Blots were washed 3x in TBST with a final wash in deionized water. Signals were detected using SuperSignal West Pico or Femto Enhanced Chemiluminescent Substrates (Thermo Fisher Scientific) on a LI-COR Odyssey FC imager.

GAPDH, detected by reprobing blots with a specific primary antibody, served as the loading control unless noted. In some experiments, Revert™ 700 Total Protein Stain (LI-COR) was used instead to ensure equal loading. Briefly, immediately after transfer, nitrocellulose membranes were incubated in Revert™ 700 staining solution for one minute and then rinsed with a wash solution. Membranes were imaged in the 700nm channel of a LI-COR Odyssey FC imager with an exposure of one minute. Membranes were incubated in a destaining solution for 5–10 minutes before proceeding to the blocking step.

Synaptosome preparations

Cortical tissue was homogenized in Syn-PER synaptic protein extraction buffer (ThermoScientific) at 10 ml of buffer per gram of tissue. All centrifugation occurred at 4° C. Lysate was first cleared by centrifuging at 1,200 x g for 10 mins. The pellet was discarded and the resulting supernatant (total homogenate) was transferred to a new tube. Approximately 200 μL of this supernatant was saved; the remaining supernatant was centrifuged at 15,000 x g for 20 mins. The resulting supernatant (cytosolic fraction) was transferred to a new tube and saved. The synaptic pellet was resuspended in ~400 μL of Syn-PER™ buffer.

Antibodies

The following primary antibodies were used at the indicated concentrations.

Pan-γ-Pcdh N159/5 (Mouse, 1:500, NeuroMab 75−185, RRID:AB_2877195); Pan-γ-Pcdh-A N144/32 (Mouse, 1:500, NeuroMab 75−178 RRID:AB_2877459); γ-Pcdh-B2 N148/30 (Mouse, 1:500, NeuroMab 75−184, RRID:AB_2877457); γ-Pcdh-C5 (Mouse, 1:500, Invitrogen MA5−26922 RRID:AB_2724958); GAPDH (Mouse, 1:1000, Abcam 8245, RRID:AB_2107448); CC3 (Rabbit, 1:100, Cell Signaling 9661, RRID:AB_2341188); GFAP (Mouse, 1:500, Sigma-Aldrich G3893, RRID:AB_477010); NeuN (Mouse, 1:300, Millipore MAB377 RRID:AB_2298772); Cux1 (Rabbit, 1:100, Proteintech 11733–1-AP RRID:AB_2086995); Foxp2 (Rabbit, 1:500, Abcam 16046 RRID:AB_2107107); PSD95 (Mouse, 1:1000, Cell Signaling 36233 RRID:AB_2721262);

Gephyrin (Rabbit, 1:1000, Cell Signaling 14304, RRID:AB_2798443); Synapsin (Rabbit, 1:1000, Cell Signaling 5297 RRID:AB_2616578).

Quantitative RT-PCR (qPCR)

Whole brains were collected from mice at postnatal day (P)21 and RNA isolated using TRIzol reagent (ThermoFisher) according to the manufacturer’s protocol. RNA was further purified using the RNeasy Midi cleanup kit (Qiagen) according to the manufacturer’s protocol. Two μg of total RNA was used for cDNA synthesis using High-Capacity cDNA Reverse Transcription kit (ThermoFisher). The cDNA produced was diluted 1:2 for use with LightCycler 480 SYBR Green I Master (Roche) with primers for Pcdhgc5 (GTTCCCGCTCTAGTACGCTG and CAGGTGCCAGTTTCATCACC) and for GAPDH (AATGTGTCCGTCGTGGATCT and GTTGAAGTCGCAGGAGACAA). The QuantStudio 3 Real Time PCR system (ThermoFisher) was used to carry out qPCR reactions. Relative abundance of the target gene was calculated using the ΔΔCt method, normalized to GAPDH within each sample, with mutant mice then compared to control mice.

RNAseq

Cerebral cortex from 3 male and 3 female homozygous γC5-KO mice and 5 male and 1 female wild type were collected and snap frozen in liquid nitrogen before storage at -80C. Total RNA was isolated from tissue using the NucleoMag RNA Kit (Macherey-Nagel) and the KingFisher Flex purification system (ThermoFisher). Tissues were homogenized in MR1 buffer (Macherey-Nagel) using a gentleMACS dissociator (Miltenyi Biotec Inc). RNA isolation was performed according to the manufacturer’s protocol. RNA concentration and quality were assessed using the Nanodrop 8000 spectrophotometer (Thermo Scientific) and the RNA ScreenTape Assay (Agilent Technologies). Libraries were constructed using the KAPA mRNA HyperPrep Kit (Roche Sequencing and Life Science), according to the manufacturer’s protocol. The quality and concentration of the libraries were assessed using the D5000 ScreenTape (Agilent Technologies) and Qubit dsDNA HS Assay (ThermoFisher), respectively. Libraries were sequenced 150 bp paired-end on an Illumina NovaSeq 6000 using the S4 Reagent Kit v1.5. Analysis of RNAseq data in fastq format was performed using an open source Nextflow pipeline (v3.5) at The Jackson Laboratory comprised of tools to perform read quality assessment, alignment, and quantification [27]. The pipeline takes as input fastq files for a single sample and outputs read alignment counts. FastQC (0.11.9) was used for quality checks and Trim Galore (0.6.7) was used to remove adapters and sequences with low quality (Fred<20). Sequence reads that passed quality control were aligned to mouse reference (GRCm38) using STAR (v2.7) and gene expression estimates were made using RSEM (v1.3) with default parameters. Differential expression analysis was performed using a differential expression script in R developed by Computational Sciences at The Jackson Laboratory based on the EdgeR package [28]. We selected FDR < 0.05 and absolute Log₂FC > 0.5 as cutoffs for differential expression.

Results

Generation of the γC5-KO mouse

Expression of protocadherin γC5 has been reported to begin postnatally, in contrast to the other 21 members of the family [23]. We verified this by Western blot on brain lysates with isoform-specific antibodies (Fig 1). While γC4 expression was already strong at birth with stable expression through the first three weeks of life, γC5 was undetectable at P0 with increasing expression from P7 to P21 (Fig 1C and 1D). This suggests a specialized role for γC5 in later developmental processes. To probe such roles, we created a discrete γC5 knock-out mouse by targeting the 5’ end of the Pcdhgc5 variable exon using CRISPR/Cas9 genome editing. The resulting mutation generated a 7-base pair (bp) deletion 25 bp downstream of the start codon, creating a frameshift resulting in an early stop codon (Fig 2A). The new strain was dubbed Pcdhg^C5KO, referred to here as γC5-KO. Homozygous mutants proved to be viable and fertile with no obvious gross abnormalities.

Download:

Fig 2. Generation of a γC5 knockout mouse.

(A) Start of the mouse PcdhgC5 gene with protein translation. A seven base-pair (bp) deletion in the PcdhgC5 variable exon results in a frameshift, leading to an early stop codon. (B) Quantitative PCR performed on six-week control and γC5 KO mice show a significant nonsense-mediated reduction of PcdhgC5 transcripts in γC5 KO compared to control (p = .012). A forward primer in the 3’ end of the PcdhgC5 variable exon and a reverse primer in the first Pcdhg constant exon were used. Note that the forward primer does not span the 7 bp deletion; thus, we expect to see some PcdhgC5 transcription. However, there is no translation of full-length γC5 in the γC5 KO mutant, evident by the lack of γC5 signal in Western blots (C) and immunostaining (D). n = 6 mice per genotype run in triplicate. (C) Western blots from cytoplasmic (“C”) and synaptic (“S”) fractions of cortical brain lysate from control and γC5 KO mice demonstrate the synaptic enrichment of γC5 protein in control and the absence of all γC5 protein in γC5 KO mice. GAPDH serves as the loading control. n = 2 mice per genotype. (D) Immunostaining of control and γC5 KO cortical Layer 2/3 at six weeks of age using a γC5-specific antibody demonstrates the absence of γC5 expression in γC5 KO mice. (E) Western blots of cortical lysate from P60 control and γC5 KO mice reveal a significant decrease in γ-Pcdh subgroup A isoforms in γC5 KO cortex (p = .0041), while γ-Pcdh B2 and pan-α-Pcdh levels are unaltered. n = 7-8 mice per genotype run in duplicate. Unpaired t-test; error bars represent the SEM; ns = not significant. (F) Western blots from wildtype and γC5 KO mice at various postnatal ages using a pan-γ-Pcdh antibody. Prior to the onset of γC5 expression (P7), there is little difference between pan-γ-Pcdh expression in wildtype and γC5 KO. However, at ages following the onset of γC5 expression (P15 and P21) a striking decrease in pan-γ-Pcdh expression is observed in γC5 KO mice. This decrease in pan-γ-Pcdh expression likely reflects the loss of γC5, being a highly expressed C-type isoform, as well as the significant decrease in γ-Pcdh Subgroup A isoforms observed in C5 KO animals. Revert™ Total Protein Stain was performed on the blot prior to antibody incubation to ensure equal protein loading (not shown). n = 2 mice per genotype per age.

https://doi.org/10.1371/journal.pone.0344863.g002

Quantitative PCR showed a significant reduction in Pcdhgc5 transcripts in mutant brains, as expected: the frame-shift mutation should not completely abrogate transcription but is likely to induce some degree of nonsense-mediated decay (Fig 2B). Complete loss of γC5 protein in homozygous mutants, across both cytoplasmic and synaptic compartments, was confirmed by Western blotting (Fig 2C) as well as by immunostaining of the cerebral cortex with a γC5-specific antibody (Fig 2D). To test if disruption of the Pcdhgc5 variable exon affected expression across the gene cluster, we quantified levels of other cPcdh isoforms in mutant brains utilizing available monoclonal antibodies detecting 11 of the 12 γ-Pcdh A isoforms, γB2 specifically, or the constant domain of all α-Pcdhs (Fig 2E; [29]). Interestingly, we found that the γ-Pcdh A protein levels were reduced to ~70% of controls in γC5 KOs, while γB2 and the α-Pcdhs were unaltered (Fig 2E). As γC5 expression increased postnatally (Fig 1D), we tested the extent to which total γ-Pcdh levels would be reduced in the cortex of γC5-KO animals compared with controls over time. We performed Western blots of brain lysates at P7, P15, and P21 and observed more clear reduction of total γ-Pcdh protein in older animals (Fig 2F, total protein stain used as loading control, not shown). This may be due in part to reduced A-type isoforms, but the pattern towards greater reduction in older mice likely indicates that γC5 makes up a relatively large fraction of the γ-Pcdh pool at the later stages of development, particularly in cortical pyramidal neurons [14].

We next examined γC5-KO cerebral cortex for any major disruptions to neuronal survival or cell organization. We stained cryosections from mutants and controls with markers for all neurons (NeuN, Fig 3A and 3B), deep layer neurons (Foxp2, Fig 3C and 3D), and upper layer neurons (Cux1, Fig 3E and 3F). We observed no defects in gross brain morphology or neuronal layering. The γC4 isoform has been shown to uniquely control neuronal survival [19–21], including that of cortical interneurons [14,30,31]. Consistent with this specialized role for γC4, we did not observe any increase in the apoptotic marker cleaved caspase-3 (Fig 3I and 3J) nor in activated astrocytes (GFAP, Fig 3G and 3H) in γC5-KO mutants.

Download:

Fig 3. γC5 KO brains have grossly normal morphology.

Cryosections of adult control and γC5 KO cortices stained with the indicated layer- and cell type-specific markers (A-B, NeuN, neurons; C-D, FoxP2, deep layer neurons; E-F, Cux1, upper layer neurons; G-H, GFAP, astrocytes; I-J, cleaved caspase-3 [CC3], apoptotic cells), revealing grossly normal morphology and neuronal survival in γC5 KO mutants. Scale bar for NeuN and Foxp2: 100 μm. Scale bar for Cux1, GFAP, and CC3: 50 μm.

https://doi.org/10.1371/journal.pone.0344863.g003

Synaptic protein levels are unperturbed in adult γC5-KO cortex

The γ-Pcdh protein family has been implicated in the control of synapse development [18,32–35]. Additionally, due to the reported dichotomous expression of γC5 in excitatory neurons and γC4 in inhibitory neurons [14], as well as the reported interaction of γC5 and the γ2 subunit of GABA_A receptors [22], we reasoned that both excitatory and inhibitory synapses could be altered in γC5-KO mice. Western blot analysis was performed using P60 control and γC5-KO cortical lysates, using specific antibodies to quantify levels of PSD95, an excitatory postsynaptic protein, gephyrin, an inhibitory postsynaptic protein, and synapsin, a protein implicated in the regulation of neurotransmitter release. No statistical difference in levels of any of these proteins was observed between control and γC5-KO mice (Fig 4A and 4B), suggesting—along with the lack of any outward signs of aberrant behavior--that synapses are not grossly altered in the absence of the γC5 isoform.

Download:

Fig 4. Synaptic protein levels are unperturbed in γC5 KO adult cortex.

(A) Cortical lysate from P60 control and γC5 KO were probed with synaptic proteins (PSD95, gephyrin, and synapsin) via Western blotting. (B) No significant differences were observed between control and γC5 KO. n = 8 mice/genotype, run in duplicate. Each dot represents one mouse averaged from at least 2 separate Western blot experiments. Unpaired t-test; error bars represent the SEM; ns = not significant.

https://doi.org/10.1371/journal.pone.0344863.g004

Dendritic arborization is not altered in γC5-KO mice

We have previously demonstrated critical roles for the γ-Pcdhs in cortical dendritic arborization, including mechanisms requiring the constant domain common to all isoforms [36–38], as well as an isoform-specific role for the variable cytoplasmic domain of γC3 [16,17]. If any other γ-Pcdh isoform were likely to influence dendritic arborization specifically, it would be γC5, given its predominant expression in cortical pyramidal neurons and its increase in expression during a time of extensive dendrite growth and branching. Therefore, we crossed γC5-KO mice with those harboring the Thy1-YFPH allele to label a subset of cortical pyramidal neurons [26]. Mice at six weeks of age were collected and Sholl analyses were performed on layer 5 neurons to assess dendritic complexity. Despite the broad expression of γC5 in excitatory neurons of the cortex, we found no significant alterations in dendritic arborization in γC5 KOs compared to controls (Fig 5A–5C). Because single-cell RNAseq data sets indicate that Pcdhgc5 transcription is higher in layer 2/3 pyramidal neurons compared to those in layer 5 [39], we reasoned that if γC5 does affect branching even slightly, we might be more likely to observe an effect of its loss in these upper-layer neurons, a subset of which is also labeled by the Thy1-YFPH transgene. Sholl analysis again did not reveal any significant differences in dendritic complexity between γC5-KO and control neurons in layer 2/3 (Fig 5D–5F). Thus, γC5 is not required for normal dendritic arbor development in the cerebral cortex.

Download:

Fig 5. Dendritic arborization is not perturbed in Layer 5 or Layer 2/3 in γC5 KO mice.

Top panel: (A) Representative YFP images (top) and tracings (bottom) of Thy1-YFPH-labeled Layer 5 pyramidal neurons of mice six weeks of age. Scale bar: 25 μm. (B) Sholl analysis graphs show dendritic crossings at spheres of increasing 10-μm intervals of mice at six weeks of age. (C) Graph showing area under the curve of Sholl graph. Bottom panel: (D) Representative YFP images (top) and tracings (bottom) of Thy1-YFPH-labeled Layer 2/3 pyramidal neurons of mice six weeks of age. (E) Sholl analysis graphs show dendritic crossings at spheres of increasing 10-μm intervals of mice at six weeks of age. (F) Graph showing area under the curve of Sholl graph. No significant differences in dendritic complexity are seen in γC5 KO compared to control in either Layer 5 or Layer 2/3. n = ≥ 51 neurons across 4-6 mice (Layer 5); ≥ 48 neurons across 3-6 mice (Layer 2/3). Unpaired t-test; error bars represent the SEM; ns = not significant.

https://doi.org/10.1371/journal.pone.0344863.g005

RNAseq analysis reveals differentially expressed genes in γC5-KO cortex

Given the lack of clear structural or molecular phenotypes in γC5-KO brains, we turned to transcriptomic analyses to gain insight on potential functions for γC5. Cerebral cortices were isolated from male and female control (n = 6) and γC5-KO (n = 6) mice at 4 weeks of age for RNAseq analysis. First, we analyzed the expression of cPcdh isoforms for potential off-target disruptions (Table 1). In confirmation of our quantitative RT-PCR analysis, Pcdhgc5 itself was significantly reduced (Log₂FC = −0.389, FDR = 2.90 X10^-4). Despite our identification of reduced γA expression at the protein level, the only change in any other cPcdh isoforms detectable at the transcript level was a significant increase in Pcdhgc4 (Log₂FC = 1.205, FDR = 2.27X10^-40), encoded in part by the variable exon adjacent to that of Pcdhgc5 (Fig 1B).

Download:

Table 1. Relative expression of cPcdh isoform transcripts in γC5 KO compared to control cortex.

https://doi.org/10.1371/journal.pone.0344863.t001

We detected a total of 51 upregulated and 146 down-regulated genes using modest cutoffs of Log₂FC > 0.5 and FDR < 0.05. Among the significantly upregulated genes in γC5-KO cortex was the transcription factor Npas4 (Neuronal PAS domain protein 4) (Fig 6A). Npas4 is known to control the expression of genes involved in regulating excitatory-inhibitory balance within neural circuits (reviewed by [40]). For example, Npas4 promotes an increased number of inhibitory synapses onto excitatory neurons and, conversely, increased excitatory input onto inhibitory somatostatin+ interneurons, resulting in enhanced feedback inhibition [40]. Interestingly, RNAseq analyses on mouse medial prefrontal cortex after shRNA-mediated knockdown of Npas4 revealed differentially regulated genes pertaining to glutamatergic synapses, including a significant upregulation of Pcdhgc5 [41]. Npas4 also plays a role in circadian behavior and the suprachiasmatic nucleus’s transcriptional response to light [42]. Another circadian-related gene, Ciart (circadian associated repressor of transcription), was also upregulated in γC5-KO mice, and our Gene Ontology (GO) enrichment analysis reports rhythmic behavior and circadian rhythm as potential altered pathways in γC5-KO mice (Fig 6B).

Download:

Fig 6. RNAseq analysis of control and γC5 KO mice.

(A) Volcano plot depicting the statistical significance (y-axis, -log₁₀ p-value) vs. the magnitude of change (x-axis, log₂ fold change) of differentially expressed genes (DEGs) obtained through RNAseq analysis of control and γC5 KO cortex at 4 weeks of age. Median and median absolute deviation of the log₂ fold change were calculated to remove outliers. Outliers that were greater than 20x the median absolute deviation were removed. Long noncoding RNAs and other non-coding RNAs were also filtered out. DEGs were then identified by the criteria of having a false discovery rate (FDR) of <.01 and a fold change cutoff of +/- 0.5. Blue dots represent genes that had a p-value of <.05. Red dots represent genes that met both the p-value cutoff (< 0.05) and the fold change cutoff (+/- 0.5). Black dots represent non-DEGs. (B) GO enrichment analysis was performed using the list of DEGs that met both the FDR and fold change cutoff.

https://doi.org/10.1371/journal.pone.0344863.g006

Among the significantly downregulated genes in γC5-KO mice was Lhx8 (LIM homeobox protein 8), a transcription factor that is expressed in postmitotic neurons in the developing medial ganglionic eminence (MGE), and that is thought to play a role in specifying MGE cell fate via modulation of other transcription factors [43]. Interestingly, Sp8 was also downregulated in γC5-KO (Fig 6A). Sp8 is a transcription factor that regulates the migration of MGE-derived cortical interneurons [44]. Our GO enrichment analysis reveals terms such as GABAergic synaptic transmission (Fig 6B); thus, future studies investigating these processes may be valuable.

Discussion

Here, we describe a new mouse model with a targeted mutation in the Pcdhgc5 gene that specifically disrupts the protocadherin γC5 protein while leaving the other 21 γ-Pcdhs intact. Having previously described unique roles for γC3 in circuit formation [16,18] and γC4 in neuronal survival [14,19,20], we generated this new model to aid in identifying any unique functions for γC5. In this initial analysis, we found that γC5-KO mice lacked any gross morphological or overt behavioral phenotypes, and exhibited no disruption in neuronal survival, the organization of the cerebral cortex (Fig 3), the levels of pre- and post-synaptic proteins (Fig 4), or dendritic arborization of cortical neurons (Fig 5). Nevertheless, transcriptomic analysis identified that genes in biological pathways including rhythmic behavior, synaptic transmission, and learning and memory were significantly up- or down-regulated in the absence of γC5 (Fig 6). This suggests that further analyses utilizing this new genetic tool may uncover neurobiological functions of this γ-Pcdh isoform, which is uniquely expressed only during the postnatal period.

We previously found that disruption of the entire Pcdhg locus in excitatory forebrain neurons resulted in a decrease of ~40% in dendritic complexity compared to controls [36], while discrete loss of only the γC3 isoform yielded nearly the same result: a decrease of ~30% in dendritic complexity compared to controls [16]. Considering the large role γC3 clearly plays in dendritic arborization, in addition to the role of the γ-Pcdh constant domain via FAK/PKC/MARCKS signaling [37,38], it is plausible that other isoforms and mechanisms simply do not play a large role in dendritic arborization. Consistent with this, the Pcdhg^13R1 mutant mouse line, which harbors mutations in 9 of the Pcdhg genes (but retaining an intact Pcdhgc3 gene as well as the Pcdhgc5 gene; [19]), did not exhibit a significant disruption of dendritic complexity [16].

While we were in the course of characterizing our new mutant line, another group reported a different mouse model targeting Pcdhgc5 with significantly different results from ours [45]. Su et al. described ~25–50% reduction in synaptic proteins PSD95, gephyrin, and synapsin in the cerebral cortices of their mutants, while we found no changes in our homozygous mutants. These authors also described a striking reduction in dendrite arborization in cortical neurons cultured from their mutant, while we found no change in vivo [45]. The authors did not provide any characterization of the actual mutation that they generated, but their guide sequences suggest that their goal was to remove the entire Pcdhgc5 exon (>2000 bp). Conversely, we created a small 7 bp frameshifting deletion that we documented by sequencing, qPCR, Western blot, and immunostaining. The generation of Su et al.’s distinct γC5 knockout mice may have produced off-target effects disrupting other isoforms or reducing their expression. Indeed, in the many previous Pcdhg genetic models we have generated and characterized, we found that larger deletions within the locus can significantly reduce expression from otherwise intact variable exons [19,35]. Even with our small mutation, we found minor disruptions in γA protein isoforms here as well as an increase in Pcdhgc4 transcription (Fig 2 and Table 1). Su et al. (2024) did not report any analysis of other γ-Pcdhs at the mRNA or protein level in their distinct γC5 mutant [45]. Given the confirmed complete loss of γC5 protein in the γC5-KO mutant described here (Fig 2), we posit that our findings accurately reflect the isoform-specific importance of γC5 to these processes.

Finally, our RNAseq analyses on cerebral cortex identified differentially expressed genes with gene ontology enriched for GABAergic categories, rhythmic behavior, and circadian rhythms, among others. This could reflect γC5 functions in regulating inhibitory synapses, as has been previously reported [22]. Additional behavioral and physiological analyses will be needed to connect the transcriptional differences we observed to functional outcomes. In addition, transcriptome profiling at earlier time points may help clarify the developmental basis for gene expression changes observed in four-week-old mice analyzed here and help distinguish cause-and-effect between the changes in physiology and gene expression. This new mutant will be essential for those efforts.

Supporting information

S1 Raw Images. Full Western blot images.

https://doi.org/10.1371/journal.pone.0344863.s001

(PDF)

S1 File. Raw data points used for quantification.

https://doi.org/10.1371/journal.pone.0344863.s002

(PDF)

References

1. Wu Q, Maniatis T. A striking organization of a large family of human neural cadherin-like cell adhesion genes. Cell. 1999;97(6):779–90. pmid:10380929
- View Article
- PubMed/NCBI
- Google Scholar
2. Wu Q, Zhang T, Cheng JF, Kim Y, Grimwood J, Schmutz J. Comparative DNA sequence analysis of mouse and human protocadherin gene clusters. Genome Res. 2001;11(3):389–404.
- View Article
- Google Scholar
3. Schreiner D, Weiner JA. Combinatorial homophilic interaction between gamma-protocadherin multimers greatly expands the molecular diversity of cell adhesion. Proc Natl Acad Sci U S A. 2010;107(33):14893–8. pmid:20679223
- View Article
- PubMed/NCBI
- Google Scholar
4. Thu CA, Chen WV, Rubinstein R, Chevee M, Wolcott HN, Felsovalyi KO, et al. Single-cell identity generated by combinatorial homophilic interactions between α, β, and γ protocadherins. Cell. 2014;158(5):1045–59. pmid:25171406
- View Article
- PubMed/NCBI
- Google Scholar
5. Goodman KM, Rubinstein R, Dan H, Bahna F, Mannepalli S, Ahlsén G, et al. Protocadherin cis-dimer architecture and recognition unit diversity. Proc Natl Acad Sci U S A. 2017;114(46):E9829–37. pmid:29087338
- View Article
- PubMed/NCBI
- Google Scholar
6. Rubinstein R, Thu CA, Goodman KM, Wolcott HN, Bahna F, Mannepalli S, et al. Molecular logic of neuronal self-recognition through protocadherin domain interactions. Cell. 2015;163(3):629–42. pmid:26478182
- View Article
- PubMed/NCBI
- Google Scholar
7. Brasch J, Goodman KM, Noble AJ, Rapp M, Mannepalli S, Bahna F, et al. Visualization of clustered protocadherin neuronal self-recognition complexes. Nature. 2019;569(7755):280–3. pmid:30971825
- View Article
- PubMed/NCBI
- Google Scholar
8. Zhang Z, Chen F, Zhang Z, Guo L, Feng T, Fang Z, et al. Structural insights into the in situ assembly of clustered protocadherin γB4. Nat Commun. 2025;16(1):1682. pmid:39956828
- View Article
- PubMed/NCBI
- Google Scholar
9. Kostadinov D, Sanes JR. Protocadherin-dependent dendritic self-avoidance regulates neural connectivity and circuit function. Elife. 2015;4:e08964. pmid:26140686
- View Article
- PubMed/NCBI
- Google Scholar
10. Lefebvre JL, Kostadinov D, Chen WV, Maniatis T, Sanes JR. Protocadherins mediate dendritic self-avoidance in the mammalian nervous system. Nature. 2012;488(7412):517–21. pmid:22842903
- View Article
- PubMed/NCBI
- Google Scholar
11. Mountoufaris G, Chen WV, Hirabayashi Y, O’Keeffe S, Chevee M, Nwakeze CL, et al. Multicluster Pcdh diversity is required for mouse olfactory neural circuit assembly. Science. 2017;356(6336):411–4. pmid:28450637
- View Article
- PubMed/NCBI
- Google Scholar
12. Chen WV, Nwakeze CL, Denny CA, O’Keeffe S, Rieger MA, Mountoufaris G, et al. Pcdhαc2 is required for axonal tiling and assembly of serotonergic circuitries in mice. Science. 2017;356(6336):406–11. pmid:28450636
- View Article
- PubMed/NCBI
- Google Scholar
13. Katori S, Noguchi-Katori Y, Okayama A, Kawamura Y, Luo W, Sakimura K, et al. Protocadherin-αC2 is required for diffuse projections of serotonergic axons. Sci Rep. 2017;7(1):15908. pmid:29162883
- View Article
- PubMed/NCBI
- Google Scholar
14. Leon WRM, Steffen DM, Dale-Huang FR, Rakela B, Breevoort A, Romero-Rodriguez R, et al. The clustered gamma protocadherin PcdhγC4 isoform regulates cortical interneuron programmed cell death in the mouse cortex. Proc Natl Acad Sci U S A. 2024;121(6):e2313596120. pmid:38285948
- View Article
- PubMed/NCBI
- Google Scholar
15. Zipursky S, Lee J, Sergeeva A, Ahlsen G, Mannepalli S, Bahna F, et al. Astrocyte morphogenesis requires self-recognition. Res Sq. 2024;:rs.3.rs-3932947. pmid:38463964
- View Article
- PubMed/NCBI
- Google Scholar
16. Steffen DM, Hanes CM, Mah KM, Valiño Ramos P, Bosch PJ, Hinz DC, et al. A unique role for protocadherin γC3 in promoting dendrite arborization through an Axin1-dependent mechanism. J Neurosci. 2023;43(6):918–35. pmid:36604170
- View Article
- PubMed/NCBI
- Google Scholar
17. Mah KM, Houston DW, Weiner JA. The γ-Protocadherin-C3 isoform inhibits canonical Wnt signalling by binding to and stabilizing Axin1 at the membrane. Sci Rep. 2016;6:31665. pmid:27530555
- View Article
- PubMed/NCBI
- Google Scholar
18. Meltzer S, Boulanger KC, Chirila AM, Osei-Asante E, DeLisle M, Zhang Q, et al. γ-Protocadherins control synapse formation and peripheral branching of touch sensory neurons. Neuron. 2023;111(11):1776-1794.e10. pmid:37028432
- View Article
- PubMed/NCBI
- Google Scholar
19. Garrett AM, Bosch PJ, Steffen DM, Fuller LC, Marcucci CG, Koch AA, et al. CRISPR/Cas9 interrogation of the mouse Pcdhg gene cluster reveals a crucial isoform-specific role for Pcdhgc4. PLoS Genet. 2019;15(12):e1008554. pmid:31877124
- View Article
- PubMed/NCBI
- Google Scholar
20. McLeod CM, Hanes CM, Fuller LC, Bhandari S, Lanthier HG, Burgess RW, et al. A new targeted transgenic mouse line for the study of protocadherin γC4. Genesis. 2025;63(1):e70010. pmid:39923243
- View Article
- PubMed/NCBI
- Google Scholar
21. McLeod CM, Lanthier HG, Nitschke GR, Bhandari S, Humphries AC, Garrett AM. Protocadherin γC4 promotes neuronal survival in the mouse retina through its variable cytoplasmic domain. Mol Neurobiol. 2025;62(12):16081–95. pmid:40742403
- View Article
- PubMed/NCBI
- Google Scholar
22. Li Y, Xiao H, Chiou T-T, Jin H, Bonhomme B, Miralles CP, et al. Molecular and functional interaction between protocadherin-γC5 and GABAA receptors. J Neurosci. 2012;32(34):11780–97.
- View Article
- Google Scholar
23. Frank M, Ebert M, Shan W, Phillips GR, Arndt K, Colman DR, et al. Differential expression of individual gamma-protocadherins during mouse brain development. Mol Cell Neurosci. 2005;29(4):603–16. pmid:15964765
- View Article
- PubMed/NCBI
- Google Scholar
24. Li Y, Serwanski DR, Miralles CP, Fiondella CG, Loturco JJ, Rubio ME, et al. Synaptic and nonsynaptic localization of protocadherin-gammaC5 in the rat brain. J Comp Neurol. 2010;518(17):3439–63. pmid:20589908
- View Article
- PubMed/NCBI
- Google Scholar
25. Tasic B, Yao Z, Graybuck LT, Smith KA, Nguyen TN, Bertagnolli D, et al. Shared and distinct transcriptomic cell types across neocortical areas. Nature. 2018;563(7729):72–8. pmid:30382198
- View Article
- PubMed/NCBI
- Google Scholar
26. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, et al. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron. 2000;28(1):41–51. pmid:11086982
- View Article
- PubMed/NCBI
- Google Scholar
27. Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, et al. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol. 2020;38(3):276–8. pmid:32055031
- View Article
- PubMed/NCBI
- Google Scholar
28. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. pmid:19910308
- View Article
- PubMed/NCBI
- Google Scholar
29. Lobas MA, Helsper L, Vernon CG, Schreiner D, Zhang Y, Holtzman MJ, et al. Molecular heterogeneity in the choroid plexus epithelium: the 22-member γ-Protocadherin family is differentially expressed, apically localized, and implicated in CSF regulation. J Neurochem. 2012;120(6):913–27. pmid:22092001
- View Article
- PubMed/NCBI
- Google Scholar
30. Carriere CH, Wang WX, Sing AD, Fekete A, Jones BE, Yee Y, et al. The γ-Protocadherins regulate the survival of GABAergic interneurons during developmental cell death. J Neurosci. 2020;40(45):8652–68. pmid:33060174
- View Article
- PubMed/NCBI
- Google Scholar
31. Mancia Leon WR, Spatazza J, Rakela B, Chatterjee A, Pande V, Maniatis T, et al. Clustered gamma-protocadherins regulate cortical interneuron programmed cell death. Elife. 2020;9:e55374. pmid:32633719
- View Article
- PubMed/NCBI
- Google Scholar
32. Garrett AM, Weiner JA. Control of CNS synapse development by {gamma}-protocadherin-mediated astrocyte-neuron contact. J Neurosci. 2009;29(38):11723–31. pmid:19776259
- View Article
- PubMed/NCBI
- Google Scholar
33. Molumby MJ, Anderson RM, Newbold DJ, Koblesky NK, Garrett AM, Schreiner D. γ-Protocadherins interact with neuroligin-1 and negatively regulate dendritic spine morphogenesis. Cell Reports. 2017;18(11):2702–14.
- View Article
- Google Scholar
34. Steffen DM, Ferri SL, Marcucci CG, Blocklinger KL, Molumby MJ, Abel T, et al. The γ-Protocadherins interact physically and functionally with neuroligin-2 to negatively regulate inhibitory synapse density and are required for normal social interaction. Mol Neurobiol. 2021;58(6):2574–89. pmid:33471287
- View Article
- PubMed/NCBI
- Google Scholar
35. Weiner JA, Wang X, Tapia JC, Sanes JR. Gamma protocadherins are required for synaptic development in the spinal cord. Proc Natl Acad Sci U S A. 2005;102(1):8–14. pmid:15574493
- View Article
- PubMed/NCBI
- Google Scholar
36. Garrett AM, Schreiner D, Lobas MA, Weiner JA. γ-protocadherins control cortical dendrite arborization by regulating the activity of a FAK/PKC/MARCKS signaling pathway. Neuron. 2012;74(2):269–76. pmid:22542181
- View Article
- PubMed/NCBI
- Google Scholar
37. Keeler AB, Schreiner D, Weiner JA. Protein kinase C phosphorylation of a γ-Protocadherin C-terminal lipid binding domain regulates focal adhesion kinase inhibition and dendrite arborization. J Biol Chem. 2015;290(34):20674–86. pmid:26139604
- View Article
- PubMed/NCBI
- Google Scholar
38. Hanes CM, Mah KM, Steffen DM, McLeod CM, Marcucci CG, Fuller LC, et al. A C-terminal motif containing a PKC phosphorylation site regulates γ-Protocadherin-mediated dendrite arborization in the cerebral cortex in vivo. Dev Neurobiol. 2024;84(3):217–35. pmid:38837880
- View Article
- PubMed/NCBI
- Google Scholar
39. Yao Z, van Velthoven CTJ, Nguyen TN, Goldy J, Sedeno-Cortes AE, Baftizadeh F, et al. A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell. 2021;184(12):3222-3241.e26. pmid:34004146
- View Article
- PubMed/NCBI
- Google Scholar
40. Fu J, Guo O, Zhen Z, Zhen J. Essential functions of the transcription factor Npas4 in neural circuit development, plasticity, and diseases. Front Neurosci. 2020;14:603373. pmid:33335473
- View Article
- PubMed/NCBI
- Google Scholar
41. Hughes BW, Siemsen BM, Tsvetkov E, Berto S, Kumar J, Cornbrooks RG, et al. NPAS4 in the medial prefrontal cortex mediates chronic social defeat stress-induced anhedonia-like behavior and reductions in excitatory synapses. Elife. 2023;12:e75631. pmid:36780219
- View Article
- PubMed/NCBI
- Google Scholar
42. Xu P, Berto S, Kulkarni A, Jeong B, Joseph C, Cox KH, et al. NPAS4 regulates the transcriptional response of the suprachiasmatic nucleus to light and circadian behavior. Neuron. 2021;109(20):3268-3282.e6. pmid:34416169
- View Article
- PubMed/NCBI
- Google Scholar
43. Kessaris N, Magno L, Rubin AN, Oliveira MG. Genetic programs controlling cortical interneuron fate. Curr Opin Neurobiol. 2014;26(100):79–87. pmid:24440413
- View Article
- PubMed/NCBI
- Google Scholar
44. Tao G, Li Z, Wen Y, Song X, Wei S, Du H, et al. Transcription factors Sp8 and Sp9 regulate medial ganglionic eminence-derived cortical interneuron migration. Front Mol Neurosci. 2019;12:75. pmid:31001083
- View Article
- PubMed/NCBI
- Google Scholar
45. Su M, Xuan E, Sun X, Pan G, Li D, Zheng H, et al. Synaptic adhesion molecule protocadherin-γC5 mediates β-amyloid-induced neuronal hyperactivity and cognitive deficits in Alzheimer’s disease. J Neurochem. 2024;168(6):1060–79. pmid:38308496
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Wu Q, Maniatis T. A striking organization of a large family of human neural cadherin-like cell adhesion genes. Cell. 1999;97(6):779–90. pmid:10380929
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Wu Q, Zhang T, Cheng JF, Kim Y, Grimwood J, Schmutz J. Comparative DNA sequence analysis of mouse and human protocadherin gene clusters. Genome Res. 2001;11(3):389–404.
View Article
Google Scholar

[6] View Article

[7] Google Scholar

[ref3] 3. Schreiner D, Weiner JA. Combinatorial homophilic interaction between gamma-protocadherin multimers greatly expands the molecular diversity of cell adhesion. Proc Natl Acad Sci U S A. 2010;107(33):14893–8. pmid:20679223
View Article
PubMed/NCBI
Google Scholar

[9] View Article

[10] PubMed/NCBI

[11] Google Scholar

[ref4] 4. Thu CA, Chen WV, Rubinstein R, Chevee M, Wolcott HN, Felsovalyi KO, et al. Single-cell identity generated by combinatorial homophilic interactions between α, β, and γ protocadherins. Cell. 2014;158(5):1045–59. pmid:25171406
View Article
PubMed/NCBI
Google Scholar

[13] View Article

[14] PubMed/NCBI

[15] Google Scholar

[ref5] 5. Goodman KM, Rubinstein R, Dan H, Bahna F, Mannepalli S, Ahlsén G, et al. Protocadherin cis-dimer architecture and recognition unit diversity. Proc Natl Acad Sci U S A. 2017;114(46):E9829–37. pmid:29087338
View Article
PubMed/NCBI
Google Scholar

[17] View Article

[18] PubMed/NCBI

[19] Google Scholar

[ref6] 6. Rubinstein R, Thu CA, Goodman KM, Wolcott HN, Bahna F, Mannepalli S, et al. Molecular logic of neuronal self-recognition through protocadherin domain interactions. Cell. 2015;163(3):629–42. pmid:26478182
View Article
PubMed/NCBI
Google Scholar

[21] View Article

[22] PubMed/NCBI

[23] Google Scholar

[ref7] 7. Brasch J, Goodman KM, Noble AJ, Rapp M, Mannepalli S, Bahna F, et al. Visualization of clustered protocadherin neuronal self-recognition complexes. Nature. 2019;569(7755):280–3. pmid:30971825
View Article
PubMed/NCBI
Google Scholar

[25] View Article

[26] PubMed/NCBI

[27] Google Scholar

[ref8] 8. Zhang Z, Chen F, Zhang Z, Guo L, Feng T, Fang Z, et al. Structural insights into the in situ assembly of clustered protocadherin γB4. Nat Commun. 2025;16(1):1682. pmid:39956828
View Article
PubMed/NCBI
Google Scholar

[29] View Article

[30] PubMed/NCBI

[31] Google Scholar

[ref9] 9. Kostadinov D, Sanes JR. Protocadherin-dependent dendritic self-avoidance regulates neural connectivity and circuit function. Elife. 2015;4:e08964. pmid:26140686
View Article
PubMed/NCBI
Google Scholar

[33] View Article

[34] PubMed/NCBI

[35] Google Scholar

[ref10] 10. Lefebvre JL, Kostadinov D, Chen WV, Maniatis T, Sanes JR. Protocadherins mediate dendritic self-avoidance in the mammalian nervous system. Nature. 2012;488(7412):517–21. pmid:22842903
View Article
PubMed/NCBI
Google Scholar

[37] View Article

[38] PubMed/NCBI

[39] Google Scholar

[ref11] 11. Mountoufaris G, Chen WV, Hirabayashi Y, O’Keeffe S, Chevee M, Nwakeze CL, et al. Multicluster Pcdh diversity is required for mouse olfactory neural circuit assembly. Science. 2017;356(6336):411–4. pmid:28450637
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref12] 12. Chen WV, Nwakeze CL, Denny CA, O’Keeffe S, Rieger MA, Mountoufaris G, et al. Pcdhαc2 is required for axonal tiling and assembly of serotonergic circuitries in mice. Science. 2017;356(6336):406–11. pmid:28450636
View Article
PubMed/NCBI
Google Scholar

[45] View Article

[46] PubMed/NCBI

[47] Google Scholar

[ref13] 13. Katori S, Noguchi-Katori Y, Okayama A, Kawamura Y, Luo W, Sakimura K, et al. Protocadherin-αC2 is required for diffuse projections of serotonergic axons. Sci Rep. 2017;7(1):15908. pmid:29162883
View Article
PubMed/NCBI
Google Scholar

[49] View Article

[50] PubMed/NCBI

[51] Google Scholar

[ref14] 14. Leon WRM, Steffen DM, Dale-Huang FR, Rakela B, Breevoort A, Romero-Rodriguez R, et al. The clustered gamma protocadherin PcdhγC4 isoform regulates cortical interneuron programmed cell death in the mouse cortex. Proc Natl Acad Sci U S A. 2024;121(6):e2313596120. pmid:38285948
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref15] 15. Zipursky S, Lee J, Sergeeva A, Ahlsen G, Mannepalli S, Bahna F, et al. Astrocyte morphogenesis requires self-recognition. Res Sq. 2024;:rs.3.rs-3932947. pmid:38463964
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref16] 16. Steffen DM, Hanes CM, Mah KM, Valiño Ramos P, Bosch PJ, Hinz DC, et al. A unique role for protocadherin γC3 in promoting dendrite arborization through an Axin1-dependent mechanism. J Neurosci. 2023;43(6):918–35. pmid:36604170
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref17] 17. Mah KM, Houston DW, Weiner JA. The γ-Protocadherin-C3 isoform inhibits canonical Wnt signalling by binding to and stabilizing Axin1 at the membrane. Sci Rep. 2016;6:31665. pmid:27530555
View Article
PubMed/NCBI
Google Scholar

[65] View Article

[66] PubMed/NCBI

[67] Google Scholar

[ref18] 18. Meltzer S, Boulanger KC, Chirila AM, Osei-Asante E, DeLisle M, Zhang Q, et al. γ-Protocadherins control synapse formation and peripheral branching of touch sensory neurons. Neuron. 2023;111(11):1776-1794.e10. pmid:37028432
View Article
PubMed/NCBI
Google Scholar

[69] View Article

[70] PubMed/NCBI

[71] Google Scholar

[ref19] 19. Garrett AM, Bosch PJ, Steffen DM, Fuller LC, Marcucci CG, Koch AA, et al. CRISPR/Cas9 interrogation of the mouse Pcdhg gene cluster reveals a crucial isoform-specific role for Pcdhgc4. PLoS Genet. 2019;15(12):e1008554. pmid:31877124
View Article
PubMed/NCBI
Google Scholar

[73] View Article

[74] PubMed/NCBI

[75] Google Scholar

[ref20] 20. McLeod CM, Hanes CM, Fuller LC, Bhandari S, Lanthier HG, Burgess RW, et al. A new targeted transgenic mouse line for the study of protocadherin γC4. Genesis. 2025;63(1):e70010. pmid:39923243
View Article
PubMed/NCBI
Google Scholar

[77] View Article

[78] PubMed/NCBI

[79] Google Scholar

[ref21] 21. McLeod CM, Lanthier HG, Nitschke GR, Bhandari S, Humphries AC, Garrett AM. Protocadherin γC4 promotes neuronal survival in the mouse retina through its variable cytoplasmic domain. Mol Neurobiol. 2025;62(12):16081–95. pmid:40742403
View Article
PubMed/NCBI
Google Scholar

[81] View Article

[82] PubMed/NCBI

[83] Google Scholar

[ref22] 22. Li Y, Xiao H, Chiou T-T, Jin H, Bonhomme B, Miralles CP, et al. Molecular and functional interaction between protocadherin-γC5 and GABAA receptors. J Neurosci. 2012;32(34):11780–97.
View Article
Google Scholar

[85] View Article

[86] Google Scholar

[ref23] 23. Frank M, Ebert M, Shan W, Phillips GR, Arndt K, Colman DR, et al. Differential expression of individual gamma-protocadherins during mouse brain development. Mol Cell Neurosci. 2005;29(4):603–16. pmid:15964765
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref24] 24. Li Y, Serwanski DR, Miralles CP, Fiondella CG, Loturco JJ, Rubio ME, et al. Synaptic and nonsynaptic localization of protocadherin-gammaC5 in the rat brain. J Comp Neurol. 2010;518(17):3439–63. pmid:20589908
View Article
PubMed/NCBI
Google Scholar

[92] View Article

[93] PubMed/NCBI

[94] Google Scholar

[ref25] 25. Tasic B, Yao Z, Graybuck LT, Smith KA, Nguyen TN, Bertagnolli D, et al. Shared and distinct transcriptomic cell types across neocortical areas. Nature. 2018;563(7729):72–8. pmid:30382198
View Article
PubMed/NCBI
Google Scholar

[96] View Article

[97] PubMed/NCBI

[98] Google Scholar

[ref26] 26. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, et al. Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Neuron. 2000;28(1):41–51. pmid:11086982
View Article
PubMed/NCBI
Google Scholar

[100] View Article

[101] PubMed/NCBI

[102] Google Scholar

[ref27] 27. Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, et al. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol. 2020;38(3):276–8. pmid:32055031
View Article
PubMed/NCBI
Google Scholar

[104] View Article

[105] PubMed/NCBI

[106] Google Scholar

[ref28] 28. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. pmid:19910308
View Article
PubMed/NCBI
Google Scholar

[108] View Article

[109] PubMed/NCBI

[110] Google Scholar

[ref29] 29. Lobas MA, Helsper L, Vernon CG, Schreiner D, Zhang Y, Holtzman MJ, et al. Molecular heterogeneity in the choroid plexus epithelium: the 22-member γ-Protocadherin family is differentially expressed, apically localized, and implicated in CSF regulation. J Neurochem. 2012;120(6):913–27. pmid:22092001
View Article
PubMed/NCBI
Google Scholar

[112] View Article

[113] PubMed/NCBI

[114] Google Scholar

[ref30] 30. Carriere CH, Wang WX, Sing AD, Fekete A, Jones BE, Yee Y, et al. The γ-Protocadherins regulate the survival of GABAergic interneurons during developmental cell death. J Neurosci. 2020;40(45):8652–68. pmid:33060174
View Article
PubMed/NCBI
Google Scholar

[116] View Article

[117] PubMed/NCBI

[118] Google Scholar

[ref31] 31. Mancia Leon WR, Spatazza J, Rakela B, Chatterjee A, Pande V, Maniatis T, et al. Clustered gamma-protocadherins regulate cortical interneuron programmed cell death. Elife. 2020;9:e55374. pmid:32633719
View Article
PubMed/NCBI
Google Scholar

[120] View Article

[121] PubMed/NCBI

[122] Google Scholar

[ref32] 32. Garrett AM, Weiner JA. Control of CNS synapse development by {gamma}-protocadherin-mediated astrocyte-neuron contact. J Neurosci. 2009;29(38):11723–31. pmid:19776259
View Article
PubMed/NCBI
Google Scholar

[124] View Article

[125] PubMed/NCBI

[126] Google Scholar

[ref33] 33. Molumby MJ, Anderson RM, Newbold DJ, Koblesky NK, Garrett AM, Schreiner D. γ-Protocadherins interact with neuroligin-1 and negatively regulate dendritic spine morphogenesis. Cell Reports. 2017;18(11):2702–14.
View Article
Google Scholar

[128] View Article

[129] Google Scholar

[ref34] 34. Steffen DM, Ferri SL, Marcucci CG, Blocklinger KL, Molumby MJ, Abel T, et al. The γ-Protocadherins interact physically and functionally with neuroligin-2 to negatively regulate inhibitory synapse density and are required for normal social interaction. Mol Neurobiol. 2021;58(6):2574–89. pmid:33471287
View Article
PubMed/NCBI
Google Scholar

[131] View Article

[132] PubMed/NCBI

[133] Google Scholar

[ref35] 35. Weiner JA, Wang X, Tapia JC, Sanes JR. Gamma protocadherins are required for synaptic development in the spinal cord. Proc Natl Acad Sci U S A. 2005;102(1):8–14. pmid:15574493
View Article
PubMed/NCBI
Google Scholar

[135] View Article

[136] PubMed/NCBI

[137] Google Scholar

[ref36] 36. Garrett AM, Schreiner D, Lobas MA, Weiner JA. γ-protocadherins control cortical dendrite arborization by regulating the activity of a FAK/PKC/MARCKS signaling pathway. Neuron. 2012;74(2):269–76. pmid:22542181
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

[ref37] 37. Keeler AB, Schreiner D, Weiner JA. Protein kinase C phosphorylation of a γ-Protocadherin C-terminal lipid binding domain regulates focal adhesion kinase inhibition and dendrite arborization. J Biol Chem. 2015;290(34):20674–86. pmid:26139604
View Article
PubMed/NCBI
Google Scholar

[143] View Article

[144] PubMed/NCBI

[145] Google Scholar

[ref38] 38. Hanes CM, Mah KM, Steffen DM, McLeod CM, Marcucci CG, Fuller LC, et al. A C-terminal motif containing a PKC phosphorylation site regulates γ-Protocadherin-mediated dendrite arborization in the cerebral cortex in vivo. Dev Neurobiol. 2024;84(3):217–35. pmid:38837880
View Article
PubMed/NCBI
Google Scholar

[147] View Article

[148] PubMed/NCBI

[149] Google Scholar

[ref39] 39. Yao Z, van Velthoven CTJ, Nguyen TN, Goldy J, Sedeno-Cortes AE, Baftizadeh F, et al. A taxonomy of transcriptomic cell types across the isocortex and hippocampal formation. Cell. 2021;184(12):3222-3241.e26. pmid:34004146
View Article
PubMed/NCBI
Google Scholar

[151] View Article

[152] PubMed/NCBI

[153] Google Scholar

[ref40] 40. Fu J, Guo O, Zhen Z, Zhen J. Essential functions of the transcription factor Npas4 in neural circuit development, plasticity, and diseases. Front Neurosci. 2020;14:603373. pmid:33335473
View Article
PubMed/NCBI
Google Scholar

[155] View Article

[156] PubMed/NCBI

[157] Google Scholar

[ref41] 41. Hughes BW, Siemsen BM, Tsvetkov E, Berto S, Kumar J, Cornbrooks RG, et al. NPAS4 in the medial prefrontal cortex mediates chronic social defeat stress-induced anhedonia-like behavior and reductions in excitatory synapses. Elife. 2023;12:e75631. pmid:36780219
View Article
PubMed/NCBI
Google Scholar

[159] View Article

[160] PubMed/NCBI

[161] Google Scholar

[ref42] 42. Xu P, Berto S, Kulkarni A, Jeong B, Joseph C, Cox KH, et al. NPAS4 regulates the transcriptional response of the suprachiasmatic nucleus to light and circadian behavior. Neuron. 2021;109(20):3268-3282.e6. pmid:34416169
View Article
PubMed/NCBI
Google Scholar

[163] View Article

[164] PubMed/NCBI

[165] Google Scholar

[ref43] 43. Kessaris N, Magno L, Rubin AN, Oliveira MG. Genetic programs controlling cortical interneuron fate. Curr Opin Neurobiol. 2014;26(100):79–87. pmid:24440413
View Article
PubMed/NCBI
Google Scholar

[167] View Article

[168] PubMed/NCBI

[169] Google Scholar

[ref44] 44. Tao G, Li Z, Wen Y, Song X, Wei S, Du H, et al. Transcription factors Sp8 and Sp9 regulate medial ganglionic eminence-derived cortical interneuron migration. Front Mol Neurosci. 2019;12:75. pmid:31001083
View Article
PubMed/NCBI
Google Scholar

[171] View Article

[172] PubMed/NCBI

[173] Google Scholar

[ref45] 45. Su M, Xuan E, Sun X, Pan G, Li D, Zheng H, et al. Synaptic adhesion molecule protocadherin-γC5 mediates β-amyloid-induced neuronal hyperactivity and cognitive deficits in Alzheimer’s disease. J Neurochem. 2024;168(6):1060–79. pmid:38308496
View Article
PubMed/NCBI
Google Scholar

[175] View Article

[176] PubMed/NCBI

[177] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Mouse lines

PcdhgC5KO allele

Tissue preparation and immunofluorescence

Vibratome sectioning

Image collection for dendritic arborization analysis

SDS/PAGE and Western blotting

Synaptosome preparations

Antibodies

Quantitative RT-PCR (qPCR)

RNAseq

Results

Generation of the γC5-KO mouse

Synaptic protein levels are unperturbed in adult γC5-KO cortex

Dendritic arborization is not altered in γC5-KO mice

RNAseq analysis reveals differentially expressed genes in γC5-KO cortex

Discussion

Supporting information

S1 Raw Images. Full Western blot images.

S1 File. Raw data points used for quantification.

References

Pcdhg^C5KO allele