Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Effect of transplanted oligodendrocyte precursor cells derived from inflammatory and non-inflammatory microenvironment on remyelination in a chronic cuprizone model

  • Hoda Akbari,

    Roles Data curation, Formal analysis, Investigation, Methodology, Software, Writing – original draft, Writing – review & editing

    Affiliation Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    ⨯
  • Iraj Ragerdi-Kashani,

    Roles Conceptualization, Funding acquisition, Project administration, Supervision, Validation, Visualization, Writing – review & editing

    Affiliation Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    ⨯
  • Farzaneh Rezaei-Yazdi,

    Roles Data curation, Investigation, Methodology, Software, Writing – original draft

    Affiliation Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    ⨯
  • Parichehr Pasbakhsh

    Roles Conceptualization, Formal analysis, Funding acquisition, Project administration, Validation, Visualization, Writing – review & editing

    parichehr.pasbakhsh@gmail.com

    Affiliation Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

    ⨯

Abstract

Introduction

Multiple sclerosis is a chronic demyelinating disease of the central nervous system. Transplantation of oligodendrocyte progenitor cells (OPCs) is a promising approach to enhance remyelination; however, the influence of the OPCs’ microenvironmental origin on their therapeutic efficacy remains unclear. This study compared the remyelinating capacity of OPCs isolated from inflammatory (lipopolysaccharide) and non-inflammatory (cuprizone) microenvironments after transplanting into the corpus callosum and examined their effects on extracellular matrix chondroitin sulfate proteoglycans (CSPGs).

Methods

OPCs were isolated from two microenvironments and characterized by immunocytochemistry and RT-qPCR. After transplanting, OPC homing, remyelination, gene expression, and CSPG levels were evaluated using DiI labeling, LFB staining, RT-qPCR, and immunofluorescence, respectively.

Results

Severe demyelination exhibited in the cuprizone group compared with healthy controls (p < 0.001) by Luxol fast blue staining. Myelin content significantly increased in both transplating OPCs groups (p < 0.001), with a higher impact observed in mice received OPCs isolated from cuprizone as compared with lipopolysaccharide (p < 0.001). Also, RT-qPCR analysis exhibited significantly reduced MBP expression in the cuprizone group, whereas was significantly increased after OPC transplantation, particularly in the cuprizone-derived OPC group (p < 0.001), whereas a lower increased with lipopolysaccharide-derived OPCs (p < 0.01). MOG expression exhibited a same pattern, with a significantly increase in the cuprizone-derived OPC group compared with both the cuprizone and lipopolysaccharide-derived OPC groups (p < 0.001). Additionally, Immunofluorescence analysis exhibited increasing CSPG4 levels in the cuprizone group, but significantly reduced after OPC transplantation (p < 0.001). Notably, in the cuprizone-derived OPC group higher reduction of CSPG4 levels observed compare with in the lipopolysaccharide-derived OPC group (p < 0.001).

Conclusion

OPC transplantation improves remyelination and reduces the CSPG level, but the effectiveness is more related to the previous history of the OPC isolation microenvironment and the new donor.

Introduction

Multiple sclerosis (MS) is the prevalent neurodegenerative disease distinguished by severe demyelination, oligodendrocyte (OL) death, and axon damage within the central nervous system (CNS), which results in neurological disabilities in youthful individuals [1,2]. Research has revealed novel cell-based therapy strategies to avoid irreversible disabilities via effective remyelination and the prevention of subsequent neurodegeneration [3,4]. Among the cells that are transplanted, oligodendrocyte progenitor cells (OPCs) are particularly important because they can create new myelinating OLs, which help repair damaged myelin [5,6]. OPCs make up 5–8 percent of all the cells in an adult brain and can be found in every MS lesion, including the edges of chronic demyelinated plaques, but they remain quiescent and undifferentiated [7]. Following CNS damage, signaling from microglia and astrocytes activates OPCs from their quiescent state [8]. However, their numbers decrease with age and disease duration [9]. Also, the reduced capacity of OPCs, such as less proliferation and differentiation, and inadequate migration of OPCs into lesions, along with changes in extracellular matrix (ECM) components, caused failure in myelin regeneration [10,11]. Thus, boosting OPC populations may serve as an initial strategy to enhance remyelination in the CNS. Sun et al. demonstrated OPCs derived from mouse embryonic stem cells (mESCs) improved remyelination of spinal cord injury at the cervical zone and forelimb locomotor function [12]. In other research, Chen et al. indicated OPC transplantation formed a myelin sheath in periventricular leukomalacia brain injury [13]. However, the studies did not assess the impact of the prior microenvironment on isolated OPC or OPC effects in the newly transplanted microenvironment. Furthermore, the regulatory extracellular matrix component, as the cellular microenvironment, influences the signaling and cell interactions, differentiation, and migration of OPCs; its alterations are implicated in remyelination failure [14]. For instance, chondroitin sulfate proteoglycans (CSPGs), an important part of the ECM, are secreted by activated astrocytes following tissue injury [2]. CSPGs are a large family characterized by a protein core and repeating glycosaminoglycan sugar units, which exhibit structural variations due to sulfation at various sites [15]. CSPG upregulation in MS, such as versican, aggrecan, and neurocan, plays an inhibitory role for OPC migration, differentiation to myelinated OLs, and remyelination failure [16,17]. On the other hand, the cuprizone toxin model causes changes like astrogliosis and microgliosis, primary oligodendrogliopathy, atrophy in the corpus callosum, an intact blood-brain barrier (BBB), and a change of CSPG content, resulting in widespread loss of myelin in certain brain regions (pattern III MS lesions), which fits with a progressive type of MS [18,19]. Consequently, it serves as a simple, reproducible, and useful animal model for evaluating the remyelination process. Although it takes time to achieve chronic demyelination [20]. A notable aspect of the chronic cuprizone model after stopping toxin feeding is that, while remyelination occurs, its extent is significantly diminished [21].

The aim of this study is to investigate the effect of the previous microenvironment on the remyelinating capacity of OPCs isolated from two types of inflammatory and non-inflammatory microenvironments after transplantation into a new chronic non-inflammatory microenvironment of cuprizone.

Materials & methods

Study design

30 mature male C57BL/6 mice (approximately 20–25 g; 8–10 weeks) were purchased from the Pasteur Institute of Karaj (Iran). For adaptation, the animals were maintained in a regulated conditions with unlimited food and water and a standard 12 h light/dark cycle for one week. The clinical signs of the mice, including weight loss, dehydration, lethargy and decreased activity, and neurological impairments, were monitored daily. Body weight was recorded weekly during the experiment. All animals survived until the end of the experiment. After the designed time, the animals were anesthetized with ketamine/xylazine to reduce suffering and pain and then euthanized. All procedures were performed by trained professionals. The Tehran University of Medical Science Institutional Animal Care and Use Committee (IACUC) approved all animal-related procedures (ethics number: IR.TUMS.AEC.1402.120).

In the first step, 30 mice were randomly divided for two purposes:

  1. 6 mice were used to isolate OPCs from the cuprizone (CPZ) model (C-OPCs) and lipopolysaccharide (LPS) model (L-OPCs) (n = 3 from each model).
  2. 24 mice were classified into 3 groups (n = 8 per group): (1) CPZ group (the chronic cuprizone demyelination that was considered as the control group), (2) CPZ + C-OPCs group (the chronic cuprizone demyelination that received transplanted OPCs isolated from the CPZ model (C-OPCs)), and (3) CPZ + L-OPCs group (similar to the second group, but received OPCs isolated from the LPS model (L-OPCs)).

Demyelination model

Part 1: The OPCs’ isolation was performed by activating them from a quiescent state. Consequently, two models were selected to be activated: 1. Cuprizone model-induced non-inflammatory demyelination 2. Lipopolysaccharide model-induced neuroinflammation demyelination [22]. A multiple sclerosis model was designed, following previous research:

  1. Cuprizone model: Mice received a powdered diet chow mixed with 0.2% (W/W) cuprizone (Sigma-Aldrich, St. Louis, MO) for 12 weeks to achieve chronic demyelination [23].
  2. Lipopolysaccharide model: Mice were injected with LPS (1 mg/kg body weight) intraperitoneally (Escherichia coli O55:B5, L2880 10 mg; Sigma-Aldrich, St. Louis, MO), a single time per day for five days to induce a model of chronic neuroinflammation [24].

Part 2: Finally, the chronic cuprizone model was utilized, as described in Part 1 above, for cell transplantation in the 13th week, and subsequently, the mice were fed a typical diet for 1 week. Then we examined the objectives of this study.

Isolation, culture, and purification of OPCs

The procedure for acquiring OPCs has been explained and is based on previous research methods [25,26]. In summary, the brains of mice in the LPS and CPZ models were extracted after cervical dislocation and situated in a sterile petri dish with chilly HBSS. The brain’s meninges were eliminated, and the tissue was cut into 2 mm3 pieces. Digestion was facilitated by pipetting with trypsin and collagenase IV followed by an incubation at 37°C. The pellet was suspended in OPCs medium (high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) and 10% fetal bovine serum (Biochrom, Germany) and 1% penicillin/streptomycin (Sigma‐Aldrich)) and cultured in T25 cm2 poly-L-lysine-covered flasks with OPCs medium supplemented with PDGF AA (10 ng/ml; 100-13A, PeproTech) for 15 days. After an additional 10 days in the OPC medium without supplement, a mixed culture of OPCs, astrocytes, and microglia was achieved. To obtain pure OPCs, the flasks were shaken for 18–20 hours at 37°C and 250 rpm and then cultured on an uncoated flask for 45 minutes. This procedure allowed microglial adhesion but prevented OPCs from adhering. The collected OPCs were cultured in OPC medium for one week again, and finally, we used a high purity of OPCs for subsequent steps.

Immunocytochemistry (ICC)

The identified OPCs were verified using the primary and secondary antibodies mentioned as follows: rabbit anti-PDGFRα (platelet-derived growth factor receptor α) (Abcam; ab203491), goat anti-rabbit FITC conjugated (Elabscience; E-AB-1014), mouse anti-Olig2 (oligodendrocyte transcription factor 2) (Santa Cruz; sc-518069), and goat anti-mouse CY3 conjugated (Elabscience; E-AB-1011). The cells were fixed with 10% formalin for 2 hours and washed twice and treated with Triton X-100 and BSA. Primary antibodies were incubated with the cells overnight, followed by secondary antibodies for 10 minutes. The nuclei were stained with DAPI. The cells were mounted and covered. Images of OPCs were captured by a fluorescence microscope (Olympus BX50, Japan) equipped with a camera (Olympus DP72, Japan) [27]. PDGFRα and Olig2 were quantified by analyzing the immunostained regions with ImageJ software. The results were exhibited as the percentage of positively staining regions.

DiI labeling of OPCs, transplantation, homing assay

After counting the gathered OPCs, 1 × 106 cells were labeled with 2 μg DiI/mL according to the manufacturer’s instructions (Life Technologies, USA). Injection of 3 × 105 OPCs in 100 µL PBS [28] was performed via the tail vein for the mice of the CPZ + C-OPCs and CPZ + L-OPCs groups. The homing of transplanted OPCs was evaluated in the corpus callosum and in visceral organs (lung, liver, spleen) after 24 h. For histological assessments, ketamine (Sigma, St. Louis, USA) and xylazine (Heidelberg, Germany) were injected intraperitoneally (IP) to completely anesthetize the mice. After perfusing the mice with a 0.9% NaCl solution and 4% paraformaldehyde (PFA, Merck, Germany), the tissues were extracted and placed in 10% formalin for 48 h. Sections of 5 μm thickness were obtained from the tissues. The nuclei were stained with DAPI. Images of sections were captured by a fluorescence microscope (Olympus BX51, Japan) equipped with an E.30 digital camera (Olympus, Japan) [29,30]. We quantified the percentage of arriving OPCs in the corpus callosum by using the ImageJ cell counter plugin to count DiI-labeled cells and divide them by the whole number of cells multiplied by 100. Additionally, we counted the arriving DiI-labeled OPCs to the lung, liver, and spleen per field by using the ImageJ cell counter plugin.

Luxol fast blue (LFB) staining

The study used Luxol Fast Blue (LFB) staining to identify the demyelinating CPZ model and assess the remyelinated zone in the corpus callosum based on the method of previous research [31]. Randomly, 10 sections per mouse were captured by a light microscope (Olympus CX310, Japan) equipped with an E.30 digital camera (Olympus, Japan). The healthy mice’s brains were used to compare the corpus callosum and the CPZ model. The myelinated zone was quantified using ImageJ software, and the percentage was determined by dividing the LFB-dyed region by the total chosen region multiplied by 100.

Immunofluorescence (IF) staining

After OPC transplantation, the CSPG4 in the microenvironment of the corpus callosum was verified using the primary and secondary antibodies mentioned as follows: mouse anti-CSPG4 (Santa Cruz; sc-166251) and goat Anti-Mouse (Abcam; ab6785). The sections were prepared and histologically examined, with antigen retrieval, heating, and incubation with 1% BSA in TBS for 2 hours. The sections were then incubated with primary antibodies overnight, followed by secondary antibodies for 10 minutes. The nuclei were stained with DAPI. The sections were mounted and covered. Images of the corpus callosum were captured by a fluorescence microscope (Olympus BX50, Japan) equipped with a camera (Olympus DP72, Japan) [32]. CSPG4 was quantified by analyzing the immunostained regions with ImageJ software. The results were exhibited as the percentage of positively staining regions.

Quantitative real-time PCR

mRNA expression assessment was conducted on liquid nitrogen-frozen corpus callosum tissue using RT-qPCR for SRY-Box Transcription Factor 10 (SOX10), Myelin Basic Protein (MBP), Myelin Oligodendrocyte Glycoprotein (MOG), and Transforming Growth Factor β (TGFβ). All procedures followed the kit instructions. Extraction of total RNA was performed with SinaPure RNA (Sinaclon, Iran) and quantified with a NanoDrop 1000 (Thermo Fisher Scientific). Synthesis of cDNA was performed with the Easy cDNA Synthesis Kit (Parstous, Iran). VERNER SYBER Green Master Mix (Thermo Fisher Scientific) was combined with equal amounts of cDNA and designed primers in a StepOnePlus real-time PCR system (Applied Biosystems, USA). The sequences of the primer are as follows: SOX10, F:GACGZTGACAAGTTCCCCGT and R:TCCTCAATGAAGGGGCGCTT; MBP, F:GTCCCTGAGCAGATTTAGCTT and R:GAATCCCTTGTGAGCCGATT; MOG, F:CAGATGAAGGAGGCTACACC and R:GCACGAAGTTTTCCTCTCAGTC; TGFβ, F:GAACCAAGGAGACGGAATAC and R:AGTTGGTATCCAGGGCTCTC. The ΔCT method quantified gene expression relative to the housekeeping gene (β-Actin), and CPZ groups (as the control group) were employed for normalizing the data [32].

Statistical analysis

The analysis of data was performed by GraphPad Prism Software (version 7, Boston, MA, USA) and displayed as mean ± SD. Shapiro-Wilk tests confirmed that the data distribution was normal. Unpaired T-tests and one-way ordinary ANOVAs followed by Tukey post hoc tests, in order, were utilized to compare two and three groups. The P-value of less than 0.05 was regarded as significant. * P < 0.05, ** P < 0.01, and *** P < 0.001 indicate significance.

Results

Characterization of OPCs

For purified isolated OPCs before transplantation, an immunocytochemistry was performed to measure the expression of two specific OPC markers, PDGFRα and Olig2 (Fig 1A-1D). The analysis results in the chart showed that the percentages of PDGFRα were (94.1 ± 1.16) and (92.6 ± 0.660) respectively, in OPCs isolated from CPZ models and LPS models. The analysis results in the chart showed that the percentages of Olig2 were (81.7 ± 0.533) and (82.6 ± 1.37), respectively, in OPCs isolated from CPZ models and LPS models (Fig 1E). To further characterize the isolated OPCs, the expression of the transcription factor SOX10 by RT-qPCR was significantly increased in both C-OPCs (1.50 ± 0.04) and L-OPCs (1.46 ± 0.05) compared to the normal OPCs (1.00 ± 0.08) (p < 0.001 for both comparisons) (Fig 1F). However, the difference in PDGFRα, Olig2, and SOX10 expression between the C-OPCs and L-OPCs was not statistically significant (p > 0.05). The strong expression of specific markers of OPCs approved the identity of the isolated cells as OPCs.

thumbnail
Fig 1. Characterization of OPCs by immunocytochemistry.

(A) PDGRFα expression in C-OPCs, (B) Olig2 expression in C-OPCs, (C) PDGRFα expression in L-OPCs, (D) Olig2 expression in L-OPCs (scale bar = 20 µm). (E) Chart of quantitative analysis of PDGFRα and Olig2 markers in isolated OPCs from the CPZ and LPS model (n = 3), (F) Chart of quantitative analysis of SOX10 expression in the normal OPCs and isolated OPCs from the CPZ and LPS model (n = 3). Means ± SD are used to define all data. (ns: non-significant); *P < 0.05, **P < 0.01, and ***P < 0.001.

https://doi.org/10.1371/journal.pone.0343039.g001

Homing assay

After transplantation, DiI-labeled OPCs were evaluated in mouse models. The results revealed that the corpus callosum contained two types of isolated OPCs 24 h after transplantation. In particular, the percentage of C-OPCs in the CPZ + C-OPCs group (29.9 ± 0.634) was significantly greater than the percentage of L-OPCs in the CPZ + L-OPCs group (26.6 ± 0.986; p < 0.01). This result indicates that C-OPCs had a greater capacity for migration or survival rate within the corpus callosum than L-OPCs (Fig 2A-2B). The chart (Fig 2I) also represents these results. Further analysis of the visceral organs revealed the presence of two types of transplanted OPCs in the liver and spleen 24 h after transplantation. However, the number of C-OPCs per field in the liver and spleen of the CPZ + C-OPCs group (18.0 ± 3.00 and 126 ± 5.57, respectively) was significantly less than the number of L-OPCs in the CPZ + L-OPCs group (32.0 ± 4.58 and 231 ± 4.04, respectively) (p < 0.05 and p < 0.001, respectively). These results indicated that C-OPCs were less likely to be trapped in the liver and spleen, which may explain their greater presence in the corpus callosum. No isolated OPCs were observed in the lung for either group (Fig 2C-2H). The chart (Fig 2J) also represents these results.

thumbnail
Fig 2. DiI-labeled OPCs in the corpus callosum and visceral organs (lung, liver, and spleen) 24 h after transplantation.

Results of the CC showed C-OPC homing was higher than L-OPCs: (A) CC of the CPZ + C-OPCs group, (B) CC of the CPZ + L-OPCs group (scale bar = 50 µm). Also, results of the liver and spleen showed trapped C-OPCs were less than L-OPCs: (C) liver of the CPZ + C-OPCs group, (D) liver of the CPZ + L-OPCs group, (E) spleen of the CPZ + C-OPCs group, and (F) spleen of the CPZ + L-OPCs group (scale bar = 50 µm). No OPCs showed in the lung: (G) lung of the CPZ + C-OPCs group, (H) lung of the CPZ + L-OPCs group (scale bar = 50 µm). (I) Chart of quantitative analysis of homing OPCs in the CC (n = 4). (J) Chart of quantitative analysis of trapped OPCs in the lung, liver, and spleen (n = 3). Means ± SD are used to define all data. *P < 0.05, **P < 0.01, and ***P < 0.001.

https://doi.org/10.1371/journal.pone.0343039.g002

LFB staining for remyelination

According to the LFB staining assessment, the corpus callosum of the healthy group exhibited normal myelin content (blue) (91.5 ± 1.06). On the other hand, the corpus callosum of the CPZ group showed considerable demyelination (white) (12.4 ± 1.22) or a significant reduction in the myelinated area compared to the healthy group (p < 0.001). The corpus callosum in the CPZ + C-OPCs (83.4 ± 0.849) and CPZ + L-OPCs (74.5 ± 1.29) groups displayed a considerably higher myelin content (p < 0.001) as compared to the CPZ group. This indicates that the remyelination after OPC transplants was significantly improved. The CPZ + C-OPCs group showed better myelin content than the CPZ + L-OPCs group, which indicates C-OPCs had a more significant remyelination improvement (p < 0.001) (Fig 3A-3E). The chart (Fig 3F) also represents these results.

thumbnail
Fig 3. Evaluation of myelinating area in the corpus callosum by LFB staining.

Results showed complete myelin content (blue color) in healthy and decreased myelin content in the chronic CPZ group (white color); after OPC transplantation, the myelin content increased in CPZ + C-OPCs & CPZ + L-OPCs; also, the increase was higher in CPZ + C-OPCs; (A) Healthy CC, (B) CC of Chronic CPZ group, (C) CC of CPZ + C-OPCs group, (D) CC of CPZ + L-OPC group (scale bar = 100 µm), (E) Mouse coronal brain atlas of Paxino. (F) Chart of quantitative analysis of the remyelination area in the corpus callosum for all groups (n = 3). Means ± SD are used to define all data. *P < 0.05, **P < 0.01, and ***P < 0.001.

https://doi.org/10.1371/journal.pone.0343039.g003

IF staining for CSPGs

Immunofluorescence staining for CSPG4 showed significant changes in its levels within the corpus callosum. CSPG4 levels were high in the demyelinated CPZ group (67.0 ± 1.14), reflecting the inhibitory microenvironment that typically forms after injury in MS. In contrast, the CSPG4 levels for the CPZ + C-OPCs group and the CPZ + L-OPCs group were (8.20 ± 2.65 and 27.8 ± 1.88, respectively, which indicates both the CPZ + C-OPCs and CPZ + L-OPCs groups showed a significant decrease in CSPG4 levels compared to the CPZ group (p < 0.001). This reduction suggests that the transplanted OPCs were enabled to modulate the inhibitory environment. Furthermore, a direct comparison between the two treatment groups showed that the decrease in CSPG4 levels was significantly greater in the CPZ + C-OPCs group than in the CPZ + L-OPCs group (p < 0.001). This evidence indicates that C-OPCs were more effective at reducing CSPG4 levels and, by extension, had a greater positive impact on the microenvironment, which aligns with the above remyelination results observed with C-OPC transplantation (Fig 4A-4C). The chart (Fig 4D) also represents these results.

thumbnail
Fig 4. Evaluation of CSPG4 level in the corpus callosum by IF.

Results showed an increase in the CPZ group; also, after transplantation, CSPG4 decreased in both the CPZ + C-OPCs group and the CPZ + L-OPCs group but significantly more in the CPZ + C-OPCs group compared with others: (A) chronic CPZ group, (B) CPZ + C-OPCs group, (C) CPZ + L-OPCs group (scale bar = 50 µm). (D) Chart of quantitative analysis of CSPG level in the corpus callosum for all groups (n = 3). Means ± SD are used to define all data. *P < 0.05, **P < 0.01, and ***P < 0.001.

https://doi.org/10.1371/journal.pone.0343039.g004

Expression of MOG, MBP, and TGFβ

RT-qPCR analysis of MBP expression, as a crucial component of the myelin sheath, indicated considerable enhancements in remyelination. The CPZ group exhibited a significantly reduced MBP expression (1.10 ± 0.566), demonstrating severe demyelination. Conversely, the CPZ + C-OPCs group (29.6 ± 2.15) and the CPZ + L-OPCs group (11.2 ± 2.92) exhibited a significant elevation in MBP expression compared to the CPZ group (p < 0.001 and p < 0.01, respectively). Therefore, both types of transplanted OPCs enabled new remyelination. The increase of MBP expression was significantly higher in the CPZ + C-OPCs group than in the CPZ + L-OPCs group (p < 0.001), which means that C-OPCs were more effective at improving remyelination (Fig 5A). We also evaluated the expression of MOG, which is another important myelin protein. The MOG expression was reduced in the CPZ group (1.01 ± 0.178). A significant increase of MOG expression was detected in the CPZ + C-OPCs group (56.8 ± 9.81) compared to the CPZ group and the CPZ + L-OPCs group (14.3 ± 4.85) (p < 0.001 for both comparisons). Notably, the increase of MOG expression in the CPZ + L-OPCs group was not significant compared to the CPZ group (p > 0.05). This finding supports the enhanced remyelinating capacity of the C-OPCs (Fig 5B). Finally, RT-qPCR was used to evaluate the expression of an important cytokine, TGFβ. The CPZ + C-OPCs group showed a significant increase in TGFβ expression (3.17 ± 0.411) compared to both the CPZ group (1.01 ± 0.173) and the CPZ + L-OPCs group (1.64 ± 0.259) (p < 0.001, p < 0.01), respectively. The increase in TGFβ expression in the CPZ + L-OPCs group was not significant when compared to the CPZ group (p > 0.05) (Fig 5C), which has been discussed in detail.

thumbnail
Fig 5. Evaluation of (A) MBP, (B) MOG, and (C) TGFβ mRNA expression by RT-qPCR and quantitative analysis.

Results showed significantly higher levels in the CPZ + C-OPCs group compared with the CPZ & CPZ + L-OPCs groups (n = 3). Means ± SD are used to define all data. (ns: non-significant); *P < 0.05, **P < 0.01, and ***P < 0.001.

https://doi.org/10.1371/journal.pone.0343039.g005

Discussion

Our study showed that transplantation of OPCs isolated from both inflammatory and non-inflammatory microenvironments simultaneously into the chronic cuprizone demyelination model facilitated remyelination; however, myelination was significantly greater in the CPZ + C-OPCs group than in the CPZ + L-OPCs group. Increased expression of MBP and MOG genes further confirmed these results. Also, transplantation of OPCs isolated from both inflammatory and non-inflammatory microenvironments resulted in a decrease in CSPG, which was more significant in the CPZ + C-OPCs group compared to the CPZ + L-OPCs group.

Consistent with prior studies, CPZ serves as a model in animal research to examine demyelination and remyelination processes, as well as therapeutic strategies for MS, without damaging the BBB or causing peripheral immune system stimulation or adaptive autoimmune responses, and it is regarded as a simple, reproducible model [20,33,34]. Feeding cuprizone for 12 weeks, as a model of chronic demyelination, results in the destruction of mature OLs due to copper deficiency in complex IV of the respiratory chain and mitochondrial dysfunction [35]; it diminishes their ability to preserve existing myelin and ultimately leads to significant demyelination of the corpus callosum [36]. Conversely, following the termination of cuprizone treatment, despite a decrease in the reserve of OPCs, spontaneous remyelination occurs at a rate of under 30% but requires at least 9 weeks [37,38]. Thus, the chronic cuprizone model can be appropriate and cost-effective for examining the impact of cell transplantation isolated from various isolation microenvironments.

Recent studies have shown that transplantation of various cells (including embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), mesenchymal stem cells (MSCs), neural progenitor cells (NPCs), and oligodendrocyte progenitor cells (OPCs)) in animal and pathological demyelination models has improved remyelination by replacing lost cells and modulating the immune system [39,40]. Among them, OPCs have received more attention for their differentiation into myelinating oligodendrocytes, thereby reducing OL and neuronal death, neuroprotection, and ultimately improving remyelination [13,41]. In a study, Chen et al. indicated transplanted OPCs in periventricular leukomalacia (PVL), a prevalent ischemic brain injury, persevered and generated a myelin sheath and stimulated neural stem cell (NSC) proliferation [13]. Bojnordi et al. demonstrated that bone marrow stromal-derived OPC transplantation into the rat corpus callosum improved remyelination in a lysophosphatidylcholine-induced (LPC) demyelination model in contrast with the control group [42]. Fan et al. revealed that transplantation of OPCs derived from miR219-mESCs (miR219-OPCs) promoted remyelination in a chronic cuprizone model in C57BL/6 male mice, improved cognitive capacity, and enhanced the endogenous NPC proliferation [43]. Therefore, in this study, OPCs, which are the progenitor cells of myelinating OLs, were used. However, prior studies have not reported on the role of the microenvironment of OPC isolation and its effect on their differentiation and myelination capacity post-transplantation.

Cells at each stage of oligodendroglia lineage maturation and differentiation, from OPCs to myelinating OLs, express specific and distinct morphology and markers. OPCs are identified by markers, including specific mitogenic receptors as platelet-derived growth factor receptor (PDGFRα), proteoglycan NG2, ganglioside A2B5, or transcription factors SOX10 and OLIG2 [44,45]. It has been observed that signaling through the binding of platelet-derived growth factor α (PDGFα) and the PDGFRα ensures the proliferation and survival of OPCs [46,47]. In other hand, OPCs express SOX10 [48], which is crucial for activating and differentiating OPCs into myelinated oligodendrocytes and directly activating myelin genes [49]. So, increased SOX10 plays a critical role in determining oligodendroglia fate [50]. Also, increased SOX10 significantly increases the expression of Olig2 in OPCs [51]. Increased OLIG2, in turn, acts to increase OPC migration and increase remyelination [52]. Notably, The expression of Olig2 and Sox10 indicates the pre-OPC stage, while the presence of PDGFRα indicates progression to the OPC stage [53]. Therefore, the factors PDGFRα, Olig2, and SOX10 were considered as specific markers characterizing OPC before transplanting, and confirmed by both C-OPC and L-OPC groups, without significant differences.

In our study, it was observed that after intravenous injection, under similar transplantation conditions, both non-inflammatory (C-OPC) and inflammatory (L-OPC) OPCs were engrafted and established in the corpus callosum. This is because OPC migration is modulated by different molecules, both during the development of the central nervous system and after demyelination in the adult central nervous system [54]. For example, CCl2 and IL1 are chemoattractant factors that are secreted by inflammatory cells, microglia, and astrocytes in neurological diseases such as Alzheimer’s and MS (both in acute and chronic lesions). These factors increase their motility and migration by affecting their receptors (CCR2 and ILR1) in activated OPCs [55]. On the other hand, increased expression of CCL2 has been observed in the cuprizone model [56] (the host tissue of the study), which itself causes more C-OPCs to be attracted to the demyelinated lesions of the corpus callosum of the brain. However, it has been observed that in inflammatory models of MS, attractant chemokines such as CCL2 and CCL5 undergo structural and mitogenic changes [57], and perhaps this could explain the role of less L-OPCs recruitment to the corpus callosum by negatively affecting cellular receptors. However, our data do not allow further explanation in this regard.

Neuroinflammation induced by LPS can damage the BBB, causing LPS, together with inflammatory cells and their components, to reach the brain [58]. LPS also promotes the production of inflammatory cytokines, IL-1β, IL-6, and TNF-α, from immune cells [59]. Also, in the cuprizone model, microglia accumulation leads to an increase in pro-inflammatory factors IL-1α and IFN-γ, but after cuprizone cessation, these factors decline, followed by an increase in the anti-inflammatory cytokine IL-10 [60]. In a study by Omri Zveik et al., after co-culturing OPC in vitro with anti-inflammatory factors interleukin IL-4 and IL-10, OPC differentiation was reduced, and with pro-inflammatory factors interferon (IFN)-γ and tumor necrosis factor (TNF)-α, the harmful effect of interferon was eliminated and differentiation was increased [61]. Another investigation showed increased differentiation of OLs in an environment with microglia treated with anti-inflammatory cytokines (IL10 and IL13) [62]. So, according to our DiI and LFB observations, for the first time after transplanting OPCs isolated from two types of microenvironments in vivo, L-OPCs had a lower rate of homing and remyelination in the corpus callosum compared to the C-OPC group. They were also more likely to be trapped in lymphoid organs such as the spleen and liver.

TGFβ is a multifunctional cytokine that has diverse functions, including cell differentiation and migration, growth promotion and inhibition, and immune system modulatory effects [63]. According to prior research, OPCs secrete transforming growth factor β (TGFβ), which affects the cerebral endothelium via activating the MEK/ERK pathway and then improves the blood-brain barrier (BBB) integrity, which is a factor in healing [64]. Also, OPCs suppress microglia activation and provide immune homeostasis in the brain for myelin regeneration through the TGFβ2- TGFβ type II receptor (TGFβR2)-CX3C chemokine receptor 1 (CX3CR1) signaling chain [65,66]. Additionally, the TGFβ signaling pathway suppresses inflammation via influences on Treg cell activity and influences remyelination [67]. The TGFβ-TGFβR signaling mechanism in OPC cells modulates and activates the Smad2/3/4-FoxO1-Sp1cascade complex. This signaling cascade in turn inhibits and activates c-myc and p21 transcription, respectively, which ultimately causes OPCs to exit the cell cycle and progress toward myelinating oligodendrocyte differentiation at the appropriate time and remyelination [68]. Other observations showed that TGFβ1 administration increased remyelination in an animal model of MS, and its reduction prevented myelin regeneration in demyelinated spinal cord [69]. However, another study stated that increased TGFβ levels due to aging and microglia dysfunction caused a decrease in OPC differentiation [70]. However, it is noteworthy that our results also showed that due to the increased expression of TGFβ in the CPZ + C-OPC group compared to the other groups, myelination was also increased in this group.

In the CNS, myelin basic protein (MBP) is generated by myelinating OLs, and it is crucial for the myelin sheath’s compactness and rigidity [71]. Myelin oligodendrocyte glycoprotein (MOG), a minor component, is essential to maintain the integrity of the myelin sheath and act as an important communication part in the myelin sheath [72]. Research shows that MBP and MOG reduction is significant after 1 week of CPZ feeding [34]. In our chronic cuprizone model, a severe decrease in these proteins was observed after 12 weeks; however, following transplantation, there was a significant increase in these proteins in the CPZ + C-OPCs group compared to the CPZ + L-OPCs and CPZ groups, confirming greater improvement in myelination.

Prior studies showed that high expression of CSPG by reactive astrocytes causes increased stiffness of ECM in the chronic cuprizone model and inhibition of remyelination [73]. Besides, mechanical sensitivity of OPCs to the microenvironment prevents cell migration and differentiation, reducing the remyelination process [74,75]. Research methods indicated that reducing CSPG may enhance remyelination. As an example, Nori et al. showed that simultaneous NPC transplantation and chondroitinase ABC in a rat spinal cord injury model improved NPC survival, differentiation into OLs, remyelination, and nerve function recovery [76]. Luo et al. demonstrated that in an inflammatory EAE model of MS, inhibiting the binding of CSPG to its receptor, protein tyrosine phosphatase σ (PTP-σ), using the intracellular sigma peptide increased cell migration, differentiation, remyelination, and animal function [77]. On the other hand, studies have shown that increased TGFβ increases the expression of three types of CSPGs, neurocan, brevican, and aggrecan, through the activation of non-Smad signaling pathways and the PI3K–Akt–Mtor molecular cascade [78,79]. However, no study has yet reported the role of transplantation of cells isolated from different microenvironments on the CSPGs. In current research, we demonstrated that transplantation of OPCs causes a reduction of CSPG that previously, by the chronic cuprizone model, increased in the microenvironment of the mouse brain. The important point is that the reduction of CSPG was significantly greater in the CPZ + C-OPCs group, which finally resulted in more remyelination. This result was despite the fact that we observed an increase in TGFβ in the same group, and our results were contrary to previous studies in this field, and in our study, these two factors worked in concert.

The findings of this study can be attributed to the high compatibility of OPCs isolated from the cuprizone model with the host environment because the host environment matches the source of cell isolation. Future research will provide additional data. It is suggested that future studies: 1. Examine other CNS regions to assess progress in myelination. 2. Monitor animals for long periods of time and assess motor function. 3. Assess environmental inflammatory and anti-inflammatory factors, cell-secreted factors, and additional ECM components. 4. Compare results using alternative models. 5. Evaluate the optimal environment for remyelination after cell transplantation so that cells can act as both immunomodulators and pro-myelinators.

Conclusion

The failure of myelin regeneration frequently results from the inability of OPCs to differentiate into myelinating OLs within the pathogenic environment of MS. Our study showed remyelination and a reduction of CSPG4 following the transplantation of OPCs, activated under both inflammatory and non-inflammatory conditions, into the corpus callosum of a chronic cuprizone model. The most significant modifications were linked to the cuprizone-dissected cells, which closely matched the host tissue. Therefore, the increased effectiveness of transplanting for enhancing remyelination demands greater attention to the cellular background and features of the host environment.

Acknowledgments

We would like to thank our colleagues in the “cell culture laboratories of the Anatomy Department” and “ARENA Diagnostic lab” for providing the necessary equipment. We also thank Dr. Amir-Mohammad Akbari for measurements.

References

  1. 1. Croxford AL, Spath S, Becher B. GM-CSF in Neuroinflammation: Licensing Myeloid Cells for Tissue Damage. Trends Immunol. 2015;36(10):651–62. pmid:26431942
  2. 2. Filippi M, Bar-Or A, Piehl F, Preziosa P, Solari A, Vukusic S, et al. Multiple sclerosis. Nat Rev Dis Primers. 2018;4(1):43. pmid:30410033
  3. 3. Lubetzki C, Zalc B, Williams A, Stadelmann C, Stankoff B. Remyelination in multiple sclerosis: from basic science to clinical translation. Lancet Neurol. 2020;19(8):678–88.
  4. 4. Nave K-A, Trapp BD. Axon-glial signaling and the glial support of axon function. Annu Rev Neurosci. 2008;31:535–61. pmid:18558866
  5. 5. Kuhn S, Gritti L, Crooks D, Dombrowski Y. Oligodendrocytes in Development, Myelin Generation and Beyond. Cells. 2019;8(11):1424. pmid:31726662
  6. 6. Li W, He T, Shi R, Song Y, Wang L, Zhang Z, et al. Oligodendrocyte Precursor Cells Transplantation Improves Stroke Recovery via Oligodendrogenesis, Neurite Growth and Synaptogenesis. Aging Dis. 2021;12(8):2096–112. pmid:34881088
  7. 7. Yeung MSY, Zdunek S, Bergmann O, Bernard S, Salehpour M, Alkass K, et al. Dynamics of oligodendrocyte generation and myelination in the human brain. Cell. 2014;159(4):766–74. pmid:25417154
  8. 8. Miller RH, Mi S. Dissecting demyelination. Nat Neurosci. 2007;10(11):1351–4. pmid:17965654
  9. 9. Kuhlmann T, Miron V, Cui Q, Wegner C, Antel J, Brück W. Differentiation block of oligodendroglial progenitor cells as a cause for remyelination failure in chronic multiple sclerosis. Brain. 2008;131(Pt 7):1749–58. pmid:18515322
  10. 10. Franklin RJM, Ffrench-Constant C. Remyelination in the CNS: from biology to therapy. Nat Rev Neurosci. 2008;9(11):839–55. pmid:18931697
  11. 11. Rosenberg SS, Kelland EE, Tokar E, De la Torre AR, Chan JR. The geometric and spatial constraints of the microenvironment induce oligodendrocyte differentiation. Proc Natl Acad Sci U S A. 2008;105(38):14662–7. pmid:18787118
  12. 12. Sun Y, Xu C-C, Li J, Guan X-Y, Gao L, Ma L-X, et al. Transplantation of oligodendrocyte precursor cells improves locomotion deficits in rats with spinal cord irradiation injury. PLoS One. 2013;8(2):e57534. pmid:23460872
  13. 13. Chen L-X, Ma S-M, Zhang P, Fan Z-C, Xiong M, Cheng G-Q, et al. Neuroprotective effects of oligodendrocyte progenitor cell transplantation in premature rat brain following hypoxic-ischemic injury. PLoS One. 2015;10(3):e0115997. pmid:25790286
  14. 14. Wang P, Gorter RP, de Jonge JC, Nazmuddin M, Zhao C, Amor S, et al. MMP7 cleaves remyelination-impairing fibronectin aggregates and its expression is reduced in chronic multiple sclerosis lesions. Glia. 2018;66(8):1625–43. pmid:29600597
  15. 15. Lau LW, Keough MB, Haylock-Jacobs S, Cua R, Döring A, Sloka S, et al. Chondroitin sulfate proteoglycans in demyelinated lesions impair remyelination. Ann Neurol. 2012;72(3):419–32. pmid:23034914
  16. 16. Lau LW, Cua R, Keough MB, Haylock-Jacobs S, Yong VW. Pathophysiology of the brain extracellular matrix: a new target for remyelination. Nat Rev Neurosci. 2013;14(10):722–9. pmid:23985834
  17. 17. Plemel JR, Keough MB, Duncan GJ, Sparling JS, Yong VW, Stys PK, et al. Remyelination after spinal cord injury: is it a target for repair?. Prog Neurobiol. 2014;117:54–72. pmid:24582777
  18. 18. Berghoff SA, Düking T, Spieth L, Winchenbach J, Stumpf SK, Gerndt N, et al. Blood-brain barrier hyperpermeability precedes demyelination in the cuprizone model. Acta Neuropathol Commun. 2017;5(1):94. pmid:29195512
  19. 19. Hochstrasser T, Rühling S, Hecher K, Fabisch KH, Chrzanowski U, Brendel M, et al. Stereological Investigation of Regional Brain Volumes after Acute and Chronic Cuprizone-Induced Demyelination. Cells. 2019;8(9):1024. pmid:31484353
  20. 20. Gudi V, Gingele S, Skripuletz T, Stangel M. Glial response during cuprizone-induced de- and remyelination in the CNS: lessons learned. Front Cell Neurosci. 2014;8:73. pmid:24659953
  21. 21. Lindner M, Fokuhl J, Linsmeier F, Trebst C, Stangel M. Chronic toxic demyelination in the central nervous system leads to axonal damage despite remyelination. Neurosci Lett. 2009;453(2):120–5. pmid:19356606
  22. 22. Hartley MD, Altowaijri G, Bourdette D. Remyelination and multiple sclerosis: therapeutic approaches and challenges. Curr Neurol Neurosci Rep. 2014;14(10):485. pmid:25108747
  23. 23. Lei C, Chen H, Chen K. Effects of Bone Marrow Mesenchymal Stem Cells on Myelin Repair and Emotional Changes of a Cuprizone-Induced Demyelination Model. J Integr Neurosci. 2023;22(2):40. pmid:36992584
  24. 24. Yang L, Zhou R, Tong Y, Chen P, Shen Y, Miao S, et al. Neuroprotection by dihydrotestosterone in LPS-induced neuroinflammation. Neurobiol Dis. 2020;140:104814. pmid:32087283
  25. 25. Chen Y, Balasubramaniyan V, Peng J, Hurlock EC, Tallquist M, Li J, et al. Isolation and culture of rat and mouse oligodendrocyte precursor cells. Nat Protoc. 2007;2(5):1044–51. pmid:17546009
  26. 26. Medina-Rodríguez EM, Arenzana FJ, Bribián A, de Castro F. Protocol to isolate a large amount of functional oligodendrocyte precursor cells from the cerebral cortex of adult mice and humans. PLoS One. 2013;8(11):e81620. pmid:24303061
  27. 27. Tripathi A, Parikh ZS, Vora P, Frost EE, Pillai PP. pERK1/2 Peripheral Recruitment and Filopodia Protrusion Augment Oligodendrocyte Progenitor Cell Migration: Combined Effects of PDGF-A and Fibronectin. Cell Mol Neurobiol. 2017;37(2):183–94. pmid:26993510
  28. 28. Segel M, Neumann B, Hill MFE, Weber IP, Viscomi C, Zhao C, et al. Niche stiffness underlies the ageing of central nervous system progenitor cells. Nature. 2019;573(7772):130–4. pmid:31413369
  29. 29. Madadi S, Pasbakhsh P, Tahmasebi F, Mortezaee K, Khanehzad M, Boroujeni FB, et al. Astrocyte ablation induced by La-aminoadipate (L-AAA) potentiates remyelination in a cuprizone demyelinating mouse model. Metab Brain Dis. 2019;34(2):593–603. pmid:30652255
  30. 30. Shiri E, Pasbakhsh P, Borhani-Haghighi M, Alizadeh Z, Nekoonam S, Mojaverrostami S, et al. Mesenchymal Stem Cells Ameliorate Cuprizone-Induced Demyelination by Targeting Oxidative Stress and Mitochondrial Dysfunction. Cell Mol Neurobiol. 2021;41(7):1467–81. pmid:32594382
  31. 31. Kashani IR, Chavoshi H, Pasbakhsh P, Hassani M, Omidi A, Mahmoudi R, et al. Protective effects of erythropoietin against cuprizone-induced oxidative stress and demyelination in the mouse corpus callosum. Iran J Basic Med Sci. 2017;20(8):886–93. pmid:29085580
  32. 32. Mojaverrostami S, Pasbakhsh P, Madadi S, Nekoonam S, Zarini D, Noori L, et al. Calorie restriction promotes remyelination in a Cuprizone-Induced demyelination mouse model of multiple sclerosis. Metab Brain Dis. 2020;35(7):1211–24. pmid:32638202
  33. 33. DiSano KD, Linzey MR, Royce DB, Pachner AR, Gilli F. Differential neuro-immune patterns in two clinically relevant murine models of multiple sclerosis. J Neuroinflammation. 2019;16(1):109. pmid:31118079
  34. 34. Wang Z, Baharani A, Wei Z, Truong D, Bi X, Wang F, et al. Low field magnetic stimulation promotes myelin repair and cognitive recovery in chronic cuprizone mouse model. Clin Exp Pharmacol Physiol. 2021;48(8):1090–102. pmid:33638234
  35. 35. Zendedel A, Beyer C, Kipp M. Cuprizone-induced demyelination as a tool to study remyelination and axonal protection. J Mol Neurosci. 2013;51(2):567–72. pmid:23666824
  36. 36. Skripuletz T, Lindner M, Kotsiari A, Garde N, Fokuhl J, Linsmeier F, et al. Cortical demyelination is prominent in the murine cuprizone model and is strain-dependent. Am J Pathol. 2008;172(4):1053–61. pmid:18349131
  37. 37. Hussain R, Ghoumari AM, Bielecki B, Steibel J, Boehm N, Liere P, et al. The neural androgen receptor: a therapeutic target for myelin repair in chronic demyelination. Brain. 2013;136(Pt 1):132–46. pmid:23365095
  38. 38. Mason JL, Toews A, Hostettler JD, Morell P, Suzuki K, Goldman JE, et al. Oligodendrocytes and progenitors become progressively depleted within chronically demyelinated lesions. Am J Pathol. 2004;164(5):1673–82. pmid:15111314
  39. 39. Park YM, Kim JH, Lee JE. Neural stem cells overexpressing arginine decarboxylase improve functional recovery from spinal cord injury in a mouse model. Int J Mol Sci. 2022;23(24).
  40. 40. Hawryluk GWJ, Spano S, Chew D, Wang S, Erwin M, Chamankhah M, et al. An examination of the mechanisms by which neural precursors augment recovery following spinal cord injury: a key role for remyelination. Cell Transplant. 2014;23(3):365–80. pmid:23363615
  41. 41. Piao J, Major T, Auyeung G, Policarpio E, Menon J, Droms L, et al. Human embryonic stem cell-derived oligodendrocyte progenitors remyelinate the brain and rescue behavioral deficits following radiation. Cell Stem Cell. 2015;16(2):198–210. pmid:25658373
  42. 42. Nazm Bojnordi M, Ghasemi HH, Akbari E. Remyelination after Lysophosphatidyl Choline-Induced Demyelination Is Stimulated by Bone Marrow Stromal Cell-Derived Oligoprogenitor Cell Transplantation. Cells Tissues Organs. 2015;200(5):300–6. pmid:26372950
  43. 43. Fan H-B, Chen L-X, Qu X-B, Ren C-L, Wu X-X, Dong F-X, et al. Transplanted miR-219-overexpressing oligodendrocyte precursor cells promoted remyelination and improved functional recovery in a chronic demyelinated model. Sci Rep. 2017;7:41407. pmid:28145507
  44. 44. Barateiro A, Fernandes A. Temporal oligodendrocyte lineage progression: in vitro models of proliferation, differentiation and myelination. Biochim Biophys Acta. 2014;1843(9):1917–29. pmid:24768715
  45. 45. Gómez-Martín P, Macías-Castellano A, Fernández-Gómez B, Sánchez-Jiménez E, Marchena M, de Castro F. Isolation of Oligodendrocyte Precursor Cells with Immunomagnetic Beads for Their Better Viability In Vitro and In Vivo. Methods Mol Biol. 2025;2899:47–57. pmid:40067616
  46. 46. Hart IK, Richardson WD, Heldin CH, Westermark B, Raff MC. PDGF receptors on cells of the oligodendrocyte-type-2 astrocyte (O-2A) cell lineage. Development. 1989;105(3):595–603. pmid:2558873
  47. 47. Pringle N, Collarini EJ, Mosley MJ, Heldin CH, Westermark B, Richardson WD. PDGF A chain homodimers drive proliferation of bipotential (O-2A) glial progenitor cells in the developing rat optic nerve. EMBO J. 1989;8(4):1049–56. pmid:2545439
  48. 48. Kuhlbrodt K, Herbarth B, Sock E, Hermans-Borgmeyer I, Wegner M. Sox10, a novel transcriptional modulator in glial cells. J Neurosci. 1998;18(1):237–50.
  49. 49. Stolt CC, Rehberg S, Ader M, Lommes P, Riethmacher D, Schachner M, et al. Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10. Genes Dev. 2002;16(2):165–70. pmid:11799060
  50. 50. Garcia-Leon JA, Kumar M, Boon R, Chau D, One J, Wolfs E, et al. SOX10 Single Transcription Factor-Based Fast and Efficient Generation of Oligodendrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 2018;10(2):655–72.
  51. 51. Liu Z, Hu X, Cai J, Liu B, Peng X, Wegner M, et al. Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms. Dev Biol. 2007;302(2):683–93. pmid:17098222
  52. 52. Wegener A, Deboux C, Bachelin C, Frah M, Kerninon C, Seilhean D, et al. Gain of Olig2 function in oligodendrocyte progenitors promotes remyelination. Brain. 2015;138(Pt 1):120–35. pmid:25564492
  53. 53. Baroti T, Zimmermann Y, Schillinger A, Liu L, Lommes P, Wegner M, et al. Transcription factors Sox5 and Sox6 exert direct and indirect influences on oligodendroglial migration in spinal cord and forebrain. Glia. 2016;64(1):122–38. pmid:26345464
  54. 54. Tepavčević V, Lubetzki C. Oligodendrocyte progenitor cell recruitment and remyelination in multiple sclerosis: the more, the merrier?. Brain. 2022;145(12):4178–92. pmid:36093726
  55. 55. Moyon S, Dubessy AL, Aigrot MS, Trotter M, Huang JK, Dauphinot L, et al. Demyelination causes adult CNS progenitors to revert to an immature state and express immune cues that support their migration. J Neurosci. 2015;35(1):4–20. pmid:25568099
  56. 56. Skripuletz T, Hackstette D, Bauer K, Gudi V, Pul R, Voss E, et al. Astrocytes regulate myelin clearance through recruitment of microglia during cuprizone-induced demyelination. Brain. 2013;136(Pt 1):147–67. pmid:23266461
  57. 57. Salim AA, AlSaimary I, Alsudany AAK, Alshewered A. 3D protein structure of chemokines in multiple sclerosis. INJ. 2025;21(5):369–74.
  58. 58. Peng X, Luo Z, He S, Zhang L, Li Y. Blood-Brain Barrier Disruption by Lipopolysaccharide and Sepsis-Associated Encephalopathy. Front Cell Infect Microbiol. 2021;11:768108. pmid:34804998
  59. 59. Oliveira-Lima OC, Carvalho-Tavares J, Rodrigues MF, Gomez MV, Oliveira ACP, Resende RR, et al. Lipid dynamics in LPS-induced neuroinflammation by DESI-MS imaging. Brain Behav Immun. 2019;79:186–94. pmid:30716391
  60. 60. Avşar T, Çelikyapi Erdem G, Terzioğlu G, Tahir Turanli E. Investigation of neuro-inflammatory parameters in a cuprizone induced mouse model of multiple sclerosis. Turk J Biol. 2021;45(5):644–55. pmid:34803461
  61. 61. Zveik O, Rechtman A, Brill L, Vaknin-Dembinsky A. Anti- and pro-inflammatory milieu differentially regulate differentiation and immune functions of oligodendrocyte progenitor cells. Immunology. 2024;171(4):618–33. pmid:38243672
  62. 62. Miron VE, Boyd A, Zhao J-W, Yuen TJ, Ruckh JM, Shadrach JL, et al. M2 microglia and macrophages drive oligodendrocyte differentiation during CNS remyelination. Nat Neurosci. 2013;16(9):1211–8. pmid:23872599
  63. 63. Wang M-K, Sun H-Q, Xiang Y-C, Jiang F, Su Y-P, Zou Z-M. Different roles of TGF-β in the multi-lineage differentiation of stem cells. World J Stem Cells. 2012;4(5):28–34. pmid:22993659
  64. 64. Seo JH, Maki T, Maeda M, Miyamoto N, Liang AC, Hayakawa K, et al. Oligodendrocyte precursor cells support blood-brain barrier integrity via TGF-β signaling. PLoS One. 2014;9(7):e103174. pmid:25078775
  65. 65. Haroon A, Seerapu H, Fang L-P, Weß JH, Bai X. Unlocking the Potential: immune functions of oligodendrocyte precursor cells. Front Immunol. 2024;15:1425706. pmid:39044821
  66. 66. Zhang S-Z, Wang Q-Q, Yang Q-Q, Gu H-Y, Yin Y-Q, Li Y-D, et al. NG2 glia regulate brain innate immunity via TGF-β2/TGFBR2 axis. BMC Med. 2019;17(1):204. pmid:31727112
  67. 67. Søndergaard HB, Hesse D, Krakauer M, Sørensen PS, Sellebjerg F. Differential microRNA expression in blood in multiple sclerosis. Mult Scler. 2013;19(14):1849–57. pmid:23773985
  68. 68. Palazuelos J, Klingener M, Aguirre A. TGFβ signaling regulates the timing of CNS myelination by modulating oligodendrocyte progenitor cell cycle exit through SMAD3/4/FoxO1/Sp1. J Neurosci. 2014;34(23):7917–30. pmid:24899714
  69. 69. Hamaguchi M, Muramatsu R, Fujimura H, Mochizuki H, Kataoka H, Yamashita T. Circulating transforming growth factor-β1 facilitates remyelination in the adult central nervous system. Elife. 2019;8:e41869. pmid:31071011
  70. 70. Baror R, Neumann B, Segel M, Chalut KJ, Fancy SPJ, Schafer DP, et al. Transforming growth factor-beta renders ageing microglia inhibitory to oligodendrocyte generation by CNS progenitors. Glia. 2019;67(7):1374–84. pmid:30861188
  71. 71. Snaidero N, Velte C, Myllykoski M, Raasakka A, Ignatev A, Werner HB, et al. Antagonistic Functions of MBP and CNP Establish Cytosolic Channels in CNS Myelin. Cell Rep. 2017;18(2):314–23. pmid:28076777
  72. 72. Quarles RH. Myelin sheaths: glycoproteins involved in their formation, maintenance and degeneration. Cell Mol Life Sci. 2002;59(11):1851–71. pmid:12530518
  73. 73. Keough MB, Rogers JA, Zhang P, Jensen SK, Stephenson EL, Chen T, et al. An inhibitor of chondroitin sulfate proteoglycan synthesis promotes central nervous system remyelination. Nat Commun. 2016;7:11312. pmid:27115988
  74. 74. Ghorbani S, Yong VW. The extracellular matrix as modifier of neuroinflammation and remyelination in multiple sclerosis. Brain. 2021;144(7):1958–73. pmid:33889940
  75. 75. Sun Y, Deng Y, Xiao M, Hu L, Li Z, Chen C. Chondroitin sulfate proteoglycans inhibit the migration and differentiation of oligodendrocyte precursor cells and its counteractive interaction with laminin. Int J Mol Med. 2017;40(6):1657–68. pmid:29039438
  76. 76. Nori S, Khazaei M, Ahuja CS, Yokota K, Ahlfors J-E, Liu Y, et al. Human Oligodendrogenic Neural Progenitor Cells Delivered with Chondroitinase ABC Facilitate Functional Repair of Chronic Spinal Cord Injury. Stem Cell Reports. 2018;11(6):1433–48. pmid:30472009
  77. 77. Luo F, Tran AP, Xin L, Sanapala C, Lang BT, Silver J, et al. Modulation of proteoglycan receptor PTPσ enhances MMP-2 activity to promote recovery from multiple sclerosis. Nat Commun. 2018;9(1):4126. pmid:30297691
  78. 78. Jahan N, Hannila SS. Transforming growth factor β-induced expression of chondroitin sulfate proteoglycans is mediated through non-Smad signaling pathways. Exp Neurol. 2015;263:372–84. pmid:25446723
  79. 79. Alizadeh J, Kochan MM, Stewart VD, Drewnik DA, Hannila SS, Ghavami S. Inhibition of Autophagy Flux Promotes Secretion of Chondroitin Sulfate Proteoglycans in Primary Rat Astrocytes. Mol Neurobiol. 2021;58(12):6077–91. pmid:34449046