Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

HIF1α mediates resistance to radiation and to KRAS inhibitors in pancreatic adenocarcinoma

  • Kevin J. Tu,

    Roles Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing

    Affiliations Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America, University of Maryland School of Medicine, Baltimore, Maryland, United States of America

  • Sanjit K. Roy,

    Roles Data curation, Formal analysis, Investigation, Methodology, Supervision, Writing – review & editing

    Affiliation Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America

  • Tami J. Kingsbury,

    Roles Investigation, Methodology

    Affiliation Department of Physiology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America

  • Hem D. Shukla

    Roles Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – review & editing

    hdshukla@som.umaryland.edu

    Affiliation Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, Maryland, United States of America

Abstract

Pancreatic ductal adenocarcinoma (PDAC) is highly treatment resistant and characterized by a hypoxic microenvironment. Here, we investigated the role of hypoxia-inducible factor 1α (HIF1α) in regulating resistance to radiation and KRAS-inhibitor. We employed CRISPR/Cas9 to knock out (KO) HIF1α from the murine KRASG12D/+; p53R172H/+ KPC and the KRASG12D/+; p53R273H; CDK2NA-/- Panc-1 human pancreatic cell lines. Compared to WT, the HIF1α KO cell lines demonstrated a shift toward an epithelial phenotype and had decreased proliferation and migration under hypoxia. HIF1α KO cell lines were less likely to survive after radiotherapy, and neutral comet assays demonstrated DNA damage four hours after treatment, suggesting that HIF1α promotes radioresistance through non-homologous end joining. When treated with a KRASG12D inhibitor, HIF1α KO cells exhibited significantly increased apoptosis due to decreased p53 degradation, likely mediated through Mdm2. Confirming this, enrichment of hypoxic signaling was associated with KRAS inhibitor resistance in a cohort of 31 KRASG12D cell lines. Our results thus suggest that inhibiting HIF1α may sensitize PDAC to radiation and KRAS inhibitors. To explore this, we conducted a drug repurposing screen and identified three HIF1α inhibitors (bakuchiol, BAY-87–2243, 2-methoxyestradiol) whose sensitivities were correlated with sensitivity to Deltarasin, a KRAS inhibitor. Our findings suggest that HIF1α inhibitors could be used to sensitize PDAC to radiotherapy and KRAS inhibitors.

Introduction

Pancreatic ductal adenocarcinoma (PDAC) has a 5-year survival rate of only 11% [1]. Currently, surgery is the only curative treatment for PDAC, but less than 20% of patients present with resectable PDAC [2]. Thus, the use of neoadjuvant radiotherapy and chemotherapy are used to shrink and limit the growth of inoperable and borderline resectable tumors. However, due to the unusually high resistance PDAC demonstrates to treatment, there is a limit on the benefit these treatments confer onto patients [3]. And escalating radiation doses to overcome this resistance is often restricted by severe off-target toxicities to vasculature of healththy tissues, necessitating novel sensitization strategies to widen the therapeutic window [46].

Treatment resistance in PDAC is modulated, in part, by both cellular signaling pathways and the local microenvironment [7]. In particular, cancer cells respond to hypoxic stress by setting off many adaptive responses including cell survival, angiogenesis, and inflammation through the stabilization and activation of the hypoxia-inducible factor (HIF) family of transcription factors [8]. HIF1α, the master-orchestrator of the hypoxic response, has been shown to regulate radioresistance in a variety of cancers through pathways involving DNA repair and apoptosis inhibition [912]. PDAC is characterized by a highly dense stroma, abundant extracellular matrix, and poor vascularization, which contributes to a severely hypoxic microenvironment that activates HIF1α [13]. Furthermore, activated HIF-1α is present in 88% of pancreatic ductal adenocarcinoma (PDAC) samples but is detected in only 16% of normal pancreatic tissue [14]. These findings suggest that HIF-1α inhibition may selectively sensitize PDAC cells while sparing the surrounding healthy pancreatic tissues, making it a promising therapeutic target.

KRAS inhibitors have demonstrated potent anti-tumor effects in PDAC, which are mediated through immune interactions within the microenvironment [15,16]. This effect can be enhanced when KRAS inhibitors are combined with immunotherapy, radiation, and chemotherapy [1618]. However, the effectiveness of these KRAS inhibitors is challenged by acquired resistance through shifting tumor ecosystems towards cell states that partially rely on hypoxic signatures [19]. Furthermore, several reports suggest that HIF1α may act as an oncogene by promoting stemness and metabolic reprogramming through pathways overlapping with mutated KRAS and p53 [2022]. These findings suggest that HIF1α may contribute to resistance against radiation and KRAS inhibitors and may potentially serve as a co-therapeutic target to improve the sensitivity of PDAC to these treatments.

Here, we investigated the role of HIF1α in promoting resistance to radiation and KRAS inhibitors using genetically engineered HIF1α KO cells. We demonstrate that HIF1α (1) promotes double-stranded DNA damage repair following radiation and (2) likely interacts with Mdm2 to degrade p53 and suppress apoptosis following KRAS inhibition. Silencing of both HIF1α and KRAS demonstrated enhanced treatment response in PDAC, and we propose several HIF1α inhibitors whose sensitivities are associated with that of a KRAS inhibitor for combination therapy.

Materials and methods

Cell culture and reagents

KPC mouse pancreatic cancer cells were obtained from The Beatson Institute for Cancer Research, Glasgow, UK. Panc-1 cells were generously provided by Dr. Zaver Bhujwalla. KPC cells were cultured and maintained in T-75 flasks (Falcon, Corning) in DMEM medium with 4.5 g/L glucose, L-glutamine, and Sodium Pyruvate (10–013-CV, Corning), 10% FBS, and 0.5% penicillin–streptomycin- amphotericin (A5995, Millipore Sigma). Panc-1 cells were grown in DMEM (Corning, USA) with 10% FBS, 0.5% pen-streptomycin. Both cell lines were grown in a humidified atmosphere in an incubator maintained at 37°C. To passage and collect cells, confluent monolayer cultures were trypsinized using 0.25% Trypsin/EDTA (25–053-CI, Corning) and centrifuged at 1000 rpm for 5 minutes. The cell pellet was resuspended in fresh medium. Hypoxic conditions were created by incubating KPC cells in 100 µM cobalt (II) chloride hexahydrate (CoCl2) for 24 hours (C8661, Millipore Sigma) and Panc-1 cells in 200 µM CoCl2 overnight [9]. Cells that were treated with BI-2852, a small-molecular inhibitor of KRASG12D (Boehringer Ingelheim, Germany), were seeded overnight at 2000 cells/well (96-well plate) and 4x105 cells/well (6-well plate). Cells were treated with various doses of BI-2852 (0, 5, 10, 25, 50 µM) for 72 hours before proceeding with downstream applications.

Creation of HIF1α knockout cell lines

HIF1α was knocked out by employing synthetic single-guide RNAs (sgRNA) targeting HIF1α exon 2 (CAAGATGTGAGCTCACATTG). sgRNA were designed using the BROAD GPP Web portal [23] and purchased as synthetic sgRNAs from Synthego with chemically modified with 2’-O-methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues. Cas9 RNP complexes were generated by incubating SgRNA with SpCas9 protein (MacroLab at UC Berkeley) and then electroporated into KPC cells using an Amaxa 4D nucleofector system. Cells were plated in 96 well plates to generate single cell-derived cell lines. HIF1α editing was confirmed by PCR amplification of the gDNA encompassing the targeted domain followed by amplicon sequencing M13F primer (Genewiz) and ICE CRISPR Analysis Tool (Synthego). Bulk cell populations were confirmed >90% knockout alleles. Single cell clones were confirmed knockout lines. Experiments were conducted using sequence-confirmed independent knockout cell clones. The primers used to amplify the targeted regions for sequencing were forward primer CGAGTTAAGACAAACTAACATGTAC; and the reverse primer was GGTGCATGGACACATACACACAC.

Panc-1 CRISPR cell lines exhibiting a HIF1α KO were generated in the Translational Laboratory Shared Services CRISPR Core (University of Maryland, School of Medicine, Baltimore, USA) using the CRISPR-Cas9 mechanism with sgRNAs (Synthego, CA) (sgRNA2 sequence – AAGTCACCACAGGACAGTAC). CRISPR-Cas9 KOs were produced by nucleofection on the Lonza Amaxa™ 4D-Nucleofector platform with a complex consisting of 150 pmol sgRNA and 50 pmol Cas9-NLS protein (Synthego, CA). 2x105 Panc-1 WT cells were mixed with sgRNA/Cas9 complex in a volume of 20ul SE buffer, transfected as described above. The transfected cells were plated in a 24 well plate with 1 ml warm RPMI 1640 media and grown for 72 hours. Afterwards, the cells were seeded as single cells in each well of a 96-well plate (5 plates), 100 µl media in each well. When the cells reached 80–90% confluence, they were passed from each single well of a 96 well to each well of a 12 well plates. After reaching 80% confluence, the cells were further passed from 12-well to 6-well plates. The confluently grown cells were washed with 1x PBS, trypsinized with 300 ul 0.25% Trypsin EDTA (Corning, USA), and mixed with 2.5 ml growth media. The cell suspension was divided into three parts: two for cell frozen stock with 10% DMSO in cryo-preserve vial and one part transferred in 1.5 ml Eppendorf tube, centrifuged at 5000gx5 min and cell pellet stored at -80C for DNA isolation. DNA was prepared (Qiagen DNA kit, USA) from the cells of 1.5 ml tube and were used for PCR and Sanger sequencing (Azenta Genewiz, NJ). The subsequent DNA sequence analysis was performed using the Synthego ICE analysis platform. Among clones two clones showed HIF1α knockout. The primers used to amplify the targeted regions for sequencing were forward primer TGTAAAACGACGGCCAGTCTGGGACGCACTGTCAGAAT; and the reverse primer was GGAAACCTAGGTCAGAGTATAGAAA.

HIF1α expression and knockout were validated using Western blot (described in detail below) with an anti-mouse antibody (BD Biosciences, USA, #610959, 1:500 dilution). The cells were treated with CoCl2 at an optimal concentration and duration determined through preliminary experiments on WT cells, which involved treatments with CoCl2 at 0, 100, 200, and 500 µM for 4 hours, or at 100 and 200 µM overnight. KPC cells were treated with 100 µM CoCl2 overnight while Panc-1 cells were treated with 200 µM CoCl2 for 4 and 24 hours. As a loading control, anti-mouse beta actin antibody, 1:5000 dilution (Sigma Chemicals, USA) was used.

Clonogenic assay

Cells were seeded overnight in 6 well plates at a density of 300 cells/well. The cells in flasks were exposed to ionizing radiation with dose values of 4, 6, 8 and 10 Gy. The media was changed immediately after radiation. After 7 days of growth, the colonies were washed with PBS twice, fixed, and stained with crystal violet solution for 1 hour (0.5% crystal violet). The cells were rinsed with water to remove excess stain. Plates were then inverted and dried overnight. Colonies consisting of 50 cells or greater were counted via the ProtoCOL 3 (Synbiosis) for later statistical analysis.

Cell proliferation assay

The rate of cell proliferation was determined by using CellTiter 96® Aqueous One Solution Cell Proliferation Assay (G3582, Promega). Cells were seeded overnight at a density of 2000 cells/well. The manufacturer’s protocol instructions were followed. The absorbance of the cells was measured using an ELISA reader (Synergy, USA).

Scratch wound (wound closure) migration assays

Cell migration was measured using scratch-wound assays [24]. Cells were seeded in medium at 5 × 105 cells/well of a 6-well plate and incubated under standard conditions until 90% confluent. A linear wound was made with a p200 pipette tip. Cells were then washed with PBS and grown in cell media for 24 hours. The area of wound closure was measured using ImageJ [24]. To determine the percentage scratch closure, the cell-free space was measured using ImageJ software.

Western blot and co-immunoprecipitation

Cells were collected and lysed using x1 RIPA cell lysis buffer followed by sonication. Protein concentration was estimated using BCA protein Assay Kit (ThermoFisher Scientific, USA). 30 µg of protein isolates were electrophoresed on 4–12% Bis-Tris polyacrylamide gels at 100 V for 1 hour. The primary antibodies included RAS (1:1000 dilution, Cell Signaling Technology, USA), HIF1α (1:2000 dilution, Novus biologicals, USA), p53 (1:1000 dilution, Cell Signaling Technology, USA), Cleaved caspase 3 (1:1000 dilution, Cell Signaling Technology, USA). Actin (Cell Signaling Technology, USA) primary antibody at 1:1000 dilution was used as a loading control. The secondary antibodies were horseradish peroxidase-conjugated (Cell Signaling Technology, USA). The blot images were taken on a Chemidoc MP imaging system (BioRad, USA). For co-immunoprecipitation, HIF1α antibodies were used as bait.

The immunoprecipitation was carried out according to the protocol described by the IP beads provider (Santa Cruz Biotechnology, USA). Briefly, 500ug protein lysate was incubated with 2ug HIF1α mouse monoclonal antibody (Novus biologicals, USA) for 1 hour at 4°C with a rotator. Controls were performed using 2 µg mouse IgG with the same quantity of protein lysate. Protein G agarose (Santa Cruz Biotechnology, USA) was equilibrated with protein lysis buffer and 15 μL was added for each sample, incubated in cold room at 4°C with rotation overnight. After that, the beads were pelleted by centrifugation at 1000g and washed four times with 500 μL lysis buffer with rotation for 5 mins. After final wash, the bound protein was eluted with 30 μL 1x SDS-PAGE buffer and boiled for 10 mins. The eluted proteins were separated on 4–20% Tris Glycine SDS-PAGE and immunoblot was carried out using MDM2 (Proteintech, USA) and Tp53 antibody (Cell signaling technology, USA).

Comet assay and DNA damage quantification

DNA double-strand breaks were measured using a single-cell gel electrophoresis assay (4250–050-K, Trevigen, USA). Cells were seeded in 6-well plates at 4 x 105 cells/well, incubated under standard conditions until 60% to 70% confluent. 4 Gy radiation was then delivered, and the media was changed. Four hours after radiation, the cells were lysed, and the manufacturer’s instructions were followed to conduct a neutral comet assay. Following gel electrophoresis, the nucleic acid was visualized with SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen, S11494). The resulting gel was imaged using fluorescence microscopy. To determine the olive moment of comet tails, we used the commercially available comet assay quantitation software CometScore Pro (TriTek Corp, USA). Outliers (>3 stdev) were excluded from analysis.

Bioinformatic analysis

Clinical data was downloaded from The Cancer Genome Atlas (Firehose Legacy) project through cBioPortal and analyzed [25]. The expression and drug sensitivity cell line data was downloaded from the DepMap dataset, which is available at https://depmap.org/portal/download/all/“ [26]. Gene set enrichment analysis was completed using the Hallmark Hypoxia gene set from The Molecular Signatures Database [27]. Multiple testing correction was applied for TCGA analyses and was not performed for individual comparisons. Pearson regressions were used to associate variables. R (v4.2.2) was used to perform bioinformatic analysis of the data. Further, statistical analysis was conducted using GraphPad (v9.4.1).

Results

HIF1α induces a shift toward a proliferative mesenchymal phenotype

To examine the role of HIF1α in PDAC, the HIF1α gene was knocked out by employing CRISPR/Cas9 and sgRNAs targeting HIF1α exon 2 in KPC cells and exon 8 in Panc-1 cells (Fig 1A). HIF1α editing was confirmed by PCR amplification of the gDNA encompassing the targeted domain and it was confirmed >90% knockout alleles. Edited clones were expanded into HIF1α KO cell lines, and the knockout was further validated through western blot analysis. While hypoxia induced HIF1α expression in the WT cell lines, both KO cell lines demonstrated no HIF1α expressed under both normoxic and hypoxic conditions (Fig 1B-C). HIF1α KO cells exhibited altered morphology compared to both WT KPC and Panc-1 cells, though the effect was not as pronounced in Panc-1 cells. Namely, while the WT cells were spindle-shaped, HIF1α KO were cuboidal and demonstrated more cell-clumping (Fig 1D-E). Spindle-shaped cells with limited cell-cell adherence are characteristic of a mesenchymal phenotype, while polygonal-shaped cells that have maintained polarity represent an epithelial phenotype.

thumbnail
Fig 1. Establishment of HIF1α KO PDAC cell lines.

(A) HIF1α gene diagram with sgRNAs (red) guiding CRISPR/Cas9 to exon 2. bHLH, Basic helix–loop–helix domain for dimerizing transcription factors; PAS/PAC, Per-Arnt-Sim domain for sensing oxygen (blue). Jittered lines represent abbreviations in DNA length. (B) Validation of KPC HIF1α KO by western blot in cells under normoxia and hypoxia. (C) Validation of Panc-1 HIF1α KO by western blot in cells under normoxia and hypoxia. Images cropped from the same gels, full western blots available in supplemental content. (D) Representative image of KPC WT and KO cells. (E) Representative image of Panc-1 WT and KO cells. (F) Association of EMT marker expression (Zeb1, Snail, Twist) with HIF1a expression in TCGA PDAC samples, one-way ANOVA with Benjamini-Hochberg correction. (G) Scratch migration assay of KPC HIF1α KO cells treated under normoxia and hypoxia, error bars represent SEM, paired student’s t-test. (H) Cell proliferation assay of KPC HIF1α KO cells treated under normoxia and hypoxia, error bars represent SEM, unpaired student’s t-test. ns = not significant, * p < 0.05, ** p < 0.01.

https://doi.org/10.1371/journal.pone.0341912.g001

The observed changes in cell morphology following HIF1α deletion suggest a mesenchymal-to-epithelial transition, implying that HIF1α is associated with the epithelial-to-mesenchymal transition. To explore this, we examined the categorical expression of HIF1α in relation to EMT markers (Zeb1, Snail, Twist) using the TCGA dataset (Fig 1F). Our analysis revealed significant positive correlations, suggesting that HIF1α may contribute to promoting the EMT process, which is typically associated with increased invasive and metastatic potential. We sought to determine whether this generalization held true in HIF1α KO PDAC cells using scratch and cell proliferation assays.

Under normoxic conditions, both KPC WT and HIF1α KO cells exhibited comparable wound closure ability, consistent with their similar HIF1α protein expression levels (Fig 1B, 1G). However, under hypoxic conditions, WT cells (characterized by high HIF1α expression) demonstrated a nearly 50% increase in cell migration compared to HIF1α KO cells (Fig 1G). Cell proliferation assays revealed similar patterns between WT and KO cells. Under hypoxic conditions, WT cells displayed significantly higher proliferation compared to KO cells (Fig 1H). Together, these results highlight that HIF1α enhances both the migration and proliferation of PDAC cells. Targeting HIF1α as a therapeutic strategy may thus inhibit both tumor spread and growth, which are critical drivers of poor prognosis in PDAC patients.

HIF1α promotes radioresistance through promoting double-strand DNA damage repair

Next, we investigated HIF1α’s role in regulating radioresistance within PDAC using clonogenic survival assays conducted under normoxic and hypoxic conditions. In KPC cells, we treated both WT and HIF1α KO cells with 4, 6, 8 and 10 Gy of radiation. In Panc-1 cells, we treated both WT and HIF1α KO cells with 4 and 6 Gy of radiation. The data showed virtually no difference in percent survival in WT and HIF1α KO cells under normoxic growth conditions for both KPC and Panc-1 cells (Fig 2A-B), in line with low levels of HIF1α expression in both cell lines (Fig 1B-C). However, under hypoxic conditions, HIF1α KO KPC cells showed significantly higher cell death when treated with 8 Gy and 10 Gy of radiation (Fig 2A), and HIF1α KO Panc-1 cells exhibited increased cell death when treated with 6 Gy of radiation (Fig 2B). Our results demonstrate that the expression of HIF1α promotes radioresistance in KPC cells.

thumbnail
Fig 2. HIF1α promotes radioresistance in PDAC cells through enhanced double strand break repair.

(A) Clonogenic survival assay of KPC cells under normoxia and hypoxia following irradiation, error bars represent SEM, unpaired student’s t-test, n = 4. (B) Clonogenic survival assay of Panc-1 cells under normoxia and hypoxia following irradiation, error bars represent SEM, unpaired student’s t-test, n = 3. (B) Quantification of comet assay olive moment with representative images of WT and KO KPC controls under hypoxia, error bars represent SEM, unpaired student’s t-test. n = 4. ns = not significant, * = p ≤ 0.05, ** p ≤ 0.01, **** = p ≤ 0.0001.

https://doi.org/10.1371/journal.pone.0341912.g002

We hypothesized that HIF1α promoted radioresistance by promoting the repair of lethal radiation-induced double stranded DNA breaks. To test this, we used a neutral comet assay, which selectively measures double-strand breaks, on lysed KPC cells to assess DNA damage 4 hours after 0 Gy (untreated control) and 4 Gy radiation. To quantify DNA damage, we used olive moment, which considers both the length of each comet’s tail and fraction of DNA in the tail [28]. As expected, there was no observable difference in DNA damage in either WT or HIF1α KO cells under hypoxia in our untreated control (Fig 2C). After treatment with 4 Gy radiation, however, there was significantly less DNA damage in WT cells compared to HIF1α KO cells (Fig 2C). Clinically, this highlights the potential of targeting HIF1α to sensitize PDAC to radiation therapy.

HIF1α degrades p53 to suppresses apoptosis induced through KRAS inhibition

KRAS inhibitors have shown strong anti-tumor effects in PDAC, but tumors often develop resistance over time due to a shift in cell populations that are partly defined by hypoxic signatures [19]. We thus hypothesized that inhibiting HIF1α may sensitize PDAC to KRAS inhibition in addition to radiation.

To test this, we treated cells under hypoxia with BI-2852, a KRAS inhibitor that targets the KRASG12D mutation in our models. Cell proliferation assays showed a significant decrease in viability for both WT and HIF1α KO cells when treated with 50 μM BI-2852, but the reduction in viability was notably greater in the HIF1α KO cells (Fig 3A). Furthermore, HIF1α KO cells exhibited a significant reduction in viability at only 25 μM BI-2852, while WT cells showed no such decrease (Fig 3A). In Panc-1 cells, HIF1α KO caused dose-dependent reductions in viability, while WT cells remained unaffected (Fig 3B). These results suggest that HIF1α plays a role in promoting resistance to KRAS inhibition.

thumbnail
Fig 3. Silencing HIF1α sensitizes PDAC to KRAS inhibition through enhanced tumor apoptosis.

(A) Cell proliferation assay of KPC WT and KO cells treated with increasing doses of BI-2852 under hypoxia, error bars represent SEM, student’s t-test. (B) Cell proliferation assay of Panc-1 WT and KO cells treated with increasing doses of BI-2852 under hypoxia, error bars represent SEM, student’s t-test. (C) Western blots of WT and KO KPC cells treated with/without BI-2852 KRAS inhibitor (50 μM) under hypoxia and normoxia, full western blots available in supplemental content. (D) Co-IP of KPC WT cells treated with hypoxia and/or BI-2852, using HIF1α as the bait, full western blots available in supplemental content. (E) Western blots of WT and KO Panc-1 cells treated with/without BI-2852 KRAS inhibitor (50 μM) under hypoxia and normoxia, full western blots available in supplemental content. * p < 0.05, *** p < 0.001.

https://doi.org/10.1371/journal.pone.0341912.g003

We sought to understand the mechanism by which HIF1α promoted resistance. Treatment of both KPC WT and HIF1α KO cells with the KRAS inhibitor led to reduced KRAS protein expression and induced apoptosis in both cell lines (Fig 3C). Notably, BI-2852 induced significantly higher levels of apoptosis in HIF1α KO compared to the WT cells, indicating that HIF1α protects against apoptosis in response to KRAS inhibition (Fig 3C). p53 levels were significantly decreased in WT cells treated with BI-2852, whereas HIF1α KO cells increased p53 levels (Fig 3C). This suggests that HIF1α plays a role in regulating the degradation of p53 to suppress apoptosis.

Previous studies suggest HIF1α interacts with Mdm2 within the nucleus to modulate p53 function in lung cancer [29]. To determine if this were also the case within PDAC, we performed co-immunoprecipitation in WT KPC cells, eluting fractions that interacted with HIF1α (IgG was used as a control). Upon treatment with BI-2852, Mdm2 was decreased while p53 was upregulated (Fig 3D). Altogether, these results suggests that HIF1α promotes resistance to KRAS inhibition by suppressing apoptosis through Mdm2-mediated degradation of p53. The significant sensitization of Panc-1 cells to KRAS inhibition upon HIF1α knockout (Fig 3E) suggests that HIF1α may confer resistance through a similar mechanism.

Candidates for drug repurposing to co-inhibit HIF1α and KRAS

Consistent with our in vitro findings that HIF1α promotes tumor growth and treatment resistance, PDAC patients in the TCGA cohort with high intra-tumoral expression of HIF1α show significantly poorer prognosis (Fig 4A). This effect may be linked to an associated increase in KRAS expression (Fig 4B). Tumors with elevated expression of both HIF1α and KRAS therefore represent a particularly challenging patient subgroup to treat. We have shown that HIF1α contributes to resistance to radiation and KRAS inhibitors in PDAC in vitro, and that HIF1α depletion reduces tumor growth while sensitizing cells to both radiation and KRAS inhibition. Based on these findings, we aimed to identify potential HIF1α and KRAS inhibitors for combination therapies to treat PDAC, especially those with high expression of both genes.

thumbnail
Fig 4. HIF1α as a prognostic marker and target to treat pancreatic cancer.

(A) Kaplan-Meier survival curve of PDAC patients, stratified by relative HIF1α expression. Patients with high (orange) HIF1α expression demonstrated significantly shorter overall survival. (B) KRAS expression within each HIF1α expression group. KRAS expression was associated with HIF1α expression, one-way ANOVA with Benjamini-Hochberg correction. (C) Correlations between HIF1α and hypoxia gene signatures and Deltarasin sensitivity in 14 PDAC KRASG12D cell lines, Pearson’s regression. (D) Correlations between three HIF inhibitors’ PRISM scores and Deltarasin PRISM scores in 14 KRASG12D PDAC cell lines or 31 KRASG12D cancer cell lines, Pearson’s regression.

https://doi.org/10.1371/journal.pone.0341912.g004

We first confirmed that targeting hypoxia would be a viable therapeutic strategy. To do this, we utilized drug sensitivity values from the PRISM Repurposing dataset in The Cancer Dependency Map, where a higher PRISM score indicates greater resistance to a given compound. We selected Deltarasin as our KRAS inhibitor because it was the only KRAS-targeting compound available in the dataset other than G12C-specific inhibitors, which are less relevant to PDAC, as KRAS G12C mutations account for only 1–2% of cases. Deltarasin functions by disrupting the interaction between KRAS and PDEδ, a chaperone protein required for KRAS membrane localization and signaling. Previous studies have demonstrated that Deltarasin is effective in KRASG12D PDAC models, supporting its use as a functional inhibitor of KRAS activity in this context [30,31]. These findings suggest that Deltarasin is a suitable proxy for KRAS inhibition in our study.

HIF1α expression alone was not significantly associated with Deltarasin sensitivity in the PRISM dataset (Fig 4C), perhaps because cancer cell lines were not cultured under hypoxic conditions—thereby narrowing the dynamic range of HIF1α expression. To address this limitation and more comprehensively capture hypoxic signaling, we performed single-sample gene set enrichment analysis (ssGSEA) using the BioCarta Hypoxia–p53 pathway gene set, which integrates known interactions between hypoxia, p53 signaling, and cellular stress responses. Notably, enrichment of this pathway was significantly and inversely correlated with sensitivity to Deltarasin (R = –0.588, Fig 4C). These results suggest that the broader hypoxia–p53 regulatory network, rather than HIF1α alone, may play a key role in modulating sensitivity to KRAS inhibition. This finding is consistent with our prior observation that knockout of HIF1α, which disrupts hypoxic signaling, enhances sensitivity to KRAS inhibition through p53-mediated increases in apoptosis. And thus, targeting the hypoxia-p53 axis may be suitable for KRAS sensitization

To extend these findings, we performed an unbiased screen of HIF1α inhibitors in the PRISM Drug Repurposing dataset to identify inhibitors whose sensitivity profiles correlated with that of Deltarasin. Bakuchiol, which has also been reported to upregulate p53 expression in KRAS-mutant cancers [32], was significantly associated with Deltarasin sensitivity both in PDAC models harboring KRASG12D mutations (R = 0.550) and across all KRAS^G12D-mutant cancer lines (R = 0.553) (Fig 4D). We also identified two selective HIF1α inhibitors—2-methoxyestradiol and BAY-87–2243—that showed weak but positive correlations with Deltarasin sensitivity (P < 0.10, R > 0.30) [3335]. These correlations may reflect limited sample size and additional mechanisms influencing KRAS inhibitor response. Broadly, these results suggest that KRASG12D tumors responsive to Deltarasin may also be sensitive to HIF1α inhibition, highlighting HIF1α inhibitors as potential sensitizers to enhance the efficacy of KRAS-targeted therapies in PDAC.

Discussion

PDAC is a deadly disease that demonstrates remarkable treatment resistance due to high levels of tumoral hypoxia. Thus, there is an urgent need to develop better treatment strategies to overcome resistance. Here, we demonstrate that HIF1α drives PDAC pathogenesis while promoting resistance to radiation and KRAS inhibitors. Our results suggest that combining HIF1α inhibitors with radiotherapy and KRAS inhibitors may enhance treatment efficacy.

Evidence from the literature suggests that the role of HIF1α in PDAC is highly context-dependent, with reports indicating it can function as both an oncogene and a tumor suppressor [13,14,36,37]. In our experimental model, the data indicate that HIF1α functions primarily as an oncogene, playing a key role in promoting multi-treatment resistance. Our findings parallel those in other resistant cancers, in which the upregulation of survival proteins downstream of HIF1α promotes radioresistance [38]. In particular, our findings suggest HIF1α promotes radioresistance through the repair of lethal double-strand DNA breaks. Notably, within our experimental timeframe of 4 hours post-irritation, the assay primarily captures non-homologous end joining (NHEJ) activity, which peaks between 2–6 hours, whereas homologous recombination typically occurs later, around 10–12 hours [39]. Together, these results suggest that HIF1α enhances the repair of radiation-induced double-strand breaks by activating the NHEJ pathway. Previous studies in other cancers suggest that HIF1α may induce both the NHEJ and homologous recombination pathways equally [40]. Future experiments should therefore quantify the relative contribution of HIF1α to each DNA repair pathway in PDAC.

We further show that HIF1α promotes resistance to KRAS inhibitors by suppressing apoptosis through p53 degradation, likely mediated by Mdm2. A limitation of this study is the absence of a functional assay to definitively establish Mdm2 as the causal mediator of p53 degradation. However, we observed degradation of Mdm2 and a corresponding increase in p53 within a complex containing HIF1α—a finding consistent with Mdm2’s well-documented role in mediating p53 degradation [4]. Moreover, prior functional studies have demonstrated that HIF1α directly regulates Mdm2-mediated p53 degradation in PDAC, consistent with our observations [5]. Together, these data suggest that HIF1α may confer resistance to KRAS inhibitors, at least in part, through modulation of the Mdm2–p53 regulatory axis.

In preliminary analyses, we observed that HIF1α knockout increased p53 protein levels and sensitized cells to KRAS inhibition through enhanced apoptosis. While these findings suggest that loss of HIF1α may stabilize mutant p53, this observation should be interpreted cautiously. Additional experiments are needed to confirm whether this effect represents a generalizable mechanism or is specific to the cellular and mutational context of our model system as, notably, our experimental model involves R172H, a structural hotspot mutant that retains similar residual apoptotic capacity when disinhibited from HIF1α-mediated signaling [41]. Our observations are broadly consistent with findings by Tiwari et al., who also knocked out HIF1α in the same PDAC cell line and similarly reported a reversion of mutant p53 toward a anti-tumor phenotype in the absence of HIF1α [42]. This parallel provides supportive, though not definitive, validation for our results and underscores the potential role of HIF1α in shaping p53 function and therapy response in PDAC. Computational tools to analyze the effects of specific point mutations on metabolic function through large cancer mutation databases could be used to interrogate this further in future work [43].

The interpretation of our findings must also consider the extensive heterogeneity of TP53 mutations in pancreatic ductal adenocarcinoma. Different TP53 variants exhibit diverse effects on protein conformation, transcriptional activity, and interaction with cellular stress pathways [4447]. Consequently, the relationship between HIF1α activity and p53-mediated apoptosis may vary across tumors, depending on the specific mutation and co-occurring genomic alterations. Clinically, this heterogeneity may influence the response to targeted therapies and combinations involving KRAS or hypoxia pathway inhibitors. For example, tumors harboring partially functional p53 mutants may retain apoptotic potential upon HIF1α inhibition, whereas those with null mutations may not. Future studies incorporating a spectrum of TP53 genotypes, patient-derived organoids, and in vivo models will be essential to define which subsets of PDAC patients are most likely to benefit from therapies that modulate the HIF1α–Mdm2–p53 axis.

In addition, we also demonstrated that HIF1α expression is associated with KRAS expression and poor PDAC patient prognosis. Our findings corroborate previous results showing KRAS and HIF1α signaling intersect to promote a more tumorigenic phenotype [20,42,48]. We further built upon these findings to show that HIF1α and KRAS work synergistically to create anti-apoptotic effects, and that cancer cells that are sensitive to KRAS inhibitors may be similarly sensitive to HIF1α inhibitors. Therefore, combining these inhibitors could have synergistic and enhanced anti-tumor effects, particularly in tumors where both KRAS and HIF1α are upregulated, offering a potential strategy for tailored combination therapy.

We probed this interaction using the KRAS inhibitors BI-2852 and Deltarasin. While the clinical utility of these compounds is uncertain, at the time this study was conducted, no inhibitors targeting KRAS G12D were approved for clinical use. Our selection was therefore guided by their demonstrated efficacy in relevant PDAC preclinical models. However, the therapeutic landscape is rapidly evolving, and our findings gain further translational relevance in the context of a recently approved KRAS G12D inhibitor VS-7375 for the treatment of patients with KRAS G12D–mutated locally advanced or metastatic PDAC [49]. Future studies should aim to validate our results using newer inhibitors as they become clinically available [5052] as well as conduct identify other targets or opportunities for drug repurposing through pooled genetic screens [53]. Furthermore, the strategy of dually targeting hypoxia and KRAS signaling is not limited to PDAC [54]. Therefore, combining these inhibitors could be particularly effective in tumors where both KRAS and HIF1α are upregulated such as non-small cell lung cancer.

Here, we provide evidence linking HIF1α to two distinct resistance pathways—DNA repair via NHEJ and apoptosis suppression via the p53–Mdm2 axis—within the specific context of KRAS G12D-driven PDAC. Our integration of large-scale clinical datasets and drug sensitivity screens identified compounds that may be repurposed for this triple-combination strategy. However, there are limitations to this study. These findings rely on cell line models and chemical induction of hypoxia, which may not fully recapitulate the complex metabolic and stromal interactions of the tumor microenvironment in vivo [55]. Additionally, our study utilized tool compounds (BI-2852, Deltarasin) which have distinct pharmacokinetic profiles compared to newer clinical-grade KRAS inhibitors. We also note that while significant treatment sensitization was observed in both cell lines, the specific p53 degradation mechanism was less pronounced in Panc-1 cells compared to KPC cells. Given that Panc-1 cells harbor a deleterious mutation in CDKN2A, we hypothesize they may bypass cell cycle surveillance and utilize alternative apoptotic pathways [56]. Finally, hypoxia and KRAS signaling are linked to immune evasion [57], a dynamic we were unable to model in this culture system. Future studies utilizing orthotopic models will be useful to validate the optimal dosing and timing of this combination strategy in a clinical setting.

In summary, we find that HIF1α promotes resistance to 1) radiation through NHEJ DNA repair and 2) KRAS inhibition through impaired apoptosis in PDAC. Therefore, targeting HIF1α may serve as an effective strategy to sensitize tumors to these therapies, potentially overcoming resistance and improving treatment outcomes. Integrating HIF1α inhibition into treatment regimens may also advance more personalized and effective treatment strategies for PDAC.

Supporting information

S1 File. Final Supplementary information file.

https://doi.org/10.1371/journal.pone.0341912.s001

(DOCX)

S1 Fig. Raw immunoblot data of HIF1α knockout confirmation.

https://doi.org/10.1371/journal.pone.0341912.s002

(DOCX)

S2 Fig. Raw immunoblot data of KPC cells treated with hypoxia + BI-2852 inhibitor.

https://doi.org/10.1371/journal.pone.0341912.s003

(DOCX)

S3 Fig. Raw immunoblot data of co-immunoprecipitation.

https://doi.org/10.1371/journal.pone.0341912.s004

(DOCX)

S4 Fig. Raw immunoblot data of Panc-1 cells treated with hypoxia + BI-2852 inhibitor.

https://doi.org/10.1371/journal.pone.0341912.s005

(DOCX)

S2 Table. Scratch assay migration distances.

https://doi.org/10.1371/journal.pone.0341912.s007

(DOCX)

S4 Table. Neutral comet assays olive moments.

https://doi.org/10.1371/journal.pone.0341912.s009

(DOCX)

Acknowledgments

The authors would like to thank Dr. Zaver Bhujwalla for supplying the Panc-1 cell line as well as Boehringer-Ingelheim for supplying the KRAS inhibitor used in this work. We also acknowledge the University of Maryland School of Medicine CRISPR Core Services for their support in creating the HIF1α KO cell lines.

References

  1. 1. Rawla P, Sunkara T, Gaduputi V. Epidemiology of Pancreatic Cancer: Global Trends, Etiology and Risk Factors. World J Oncol. 2019;10(1):10–27. pmid:30834048
  2. 2. Ansari D, Gustafsson A, Andersson R. Update on the management of pancreatic cancer: surgery is not enough. World J Gastroenterol. 2015;21(11):3157–65. pmid:25805920
  3. 3. Orth M, Metzger P, Gerum S, Mayerle J, Schneider G, Belka C, et al. Pancreatic ductal adenocarcinoma: biological hallmarks, current status, and future perspectives of combined modality treatment approaches. Radiat Oncol. 2019;14(1):141. pmid:31395068
  4. 4. Tu KJ, Stewart CE, Williams NT, Ma Y, Luo L, Ghosh D. Single-fraction radiation treatment dose response in a genetically engineered mouse model of medulloblastoma. Radiat Res. 2023;200(6).
  5. 5. Gemici C, Yaprak G, Ozdemir S, Baysal T, Seseogullari OO, Ozyurt H. Volumetric decrease of pancreas after abdominal irradiation, it is time to consider pancreas as an organ at risk for radiotherapy planning. Radiat Oncol. 2018;13(1):238. pmid:30509287
  6. 6. Ryschich E, Schmidt J, Loeffler T, Eble M, Gebhard MM, Harms W. Different radiogenic effects on microcirculation in healthy pancreas and in pancreatic carcinoma of the rat. Ann Surg. 2003;237(4):515–21.
  7. 7. Seshacharyulu P, Baine MJ, Souchek JJ, Menning M, Kaur S, Yan Y, et al. Biological determinants of radioresistance and their remediation in pancreatic cancer. Biochim Biophys Acta Rev Cancer. 2017;1868(1):69–92. pmid:28249796
  8. 8. Lee P, Chandel NS, Simon MC. Cellular adaptation to hypoxia through hypoxia inducible factors and beyond. Nat Rev Mol Cell Biol. 2020;21(5):268–83. pmid:32144406
  9. 9. Jin W, Wang J, Xu S, Xiao L, Chen G, Zhang W. Radioprotective effect on HepG2 cells of low concentrations of cobalt chloride: induction of hypoxia-inducible factor-1 alpha and clearance of reactive oxygen species. J Radiat Res (Tokyo). 2013;54(2):203–9.
  10. 10. Zhao Q, Tan B-B, Li Y, Fan L-Q, Yang P-G, Tian Y. Enhancement of Drug Sensitivity by Knockdown of HIF-1α in Gastric Carcinoma Cells. Oncol Res. 2016;23(3):129–36. pmid:26931435
  11. 11. Nishimoto A, Kugimiya N, Hosoyama T, Enoki T, Li T-S, Hamano K. HIF-1α activation under glucose deprivation plays a central role in the acquisition of anti-apoptosis in human colon cancer cells. Int J Oncol. 2014;44(6):2077–84. pmid:24718784
  12. 12. Feng H, Wang J, Chen W, Shan B, Guo Y, Xu J, et al. Hypoxia-induced autophagy as an additional mechanism in human osteosarcoma radioresistance. J Bone Oncol. 2016;5(2):67–73. pmid:27335774
  13. 13. Tao J, Yang G, Zhou W, Qiu J, Chen G, Luo W, et al. Targeting hypoxic tumor microenvironment in pancreatic cancer. J Hematol Oncol. 2021;14(1):14. pmid:33436044
  14. 14. Schwartz DL, Bankson JA, Lemos R, Lai SY, Thittai AK, He Y. Radiosensitization and stromal imaging response correlates for the HIF-1 inhibitor PX-478 given with or without chemotherapy in pancreatic cancer. Molecular Cancer Therapeutics. 2010;9(7):2057–67.
  15. 15. Kemp SB, Cheng N, Markosyan N, Sor R, Kim I-K, Hallin J, et al. Efficacy of a Small-Molecule Inhibitor of KrasG12D in Immunocompetent Models of Pancreatic Cancer. Cancer Discov. 2023;13(2):298–311. pmid:36472553
  16. 16. Mahadevan KK, LeBleu VS, Ramirez EV, Chen Y, Li B, Sockwell AM. Elimination of oncogenic KRAS in genetic mouse models eradicates pancreatic cancer by inducing FAS-dependent apoptosis by CD8 T cells. Developmental Cell. 2023;58(17):1562–1577.e8.
  17. 17. Zheng Y, Liu Y, Zhang F, Su C, Chen X, Zhang M, et al. Radiation combined with KRAS-MEK inhibitors enhances anticancer immunity in KRAS-mutated tumor models. Transl Res. 2023;252:79–90. pmid:35948200
  18. 18. Singhal A, Styers HC, Rub J, Li Z, Torborg SR, Kim JY, et al. A Classical Epithelial State Drives Acute Resistance to KRAS Inhibition in Pancreatic Cancer. Cancer Discov. 2024;14(11):2122–34. pmid:38975873
  19. 19. Dilly J, Hoffman MT, Abbassi L, Li Z, Paradiso F, Parent BD, et al. Mechanisms of Resistance to Oncogenic KRAS Inhibition in Pancreatic Cancer. Cancer Discov. 2024;14(11):2135–61. pmid:38975874
  20. 20. Kang R, Hou W, Zhang Q, Chen R, Lee YJ, Bartlett DL. RAGE is essential for oncogenic KRAS-mediated hypoxic signaling in pancreatic cancer. Cell Death Dis. 2014;5(10):e1480.
  21. 21. McGinn O, Gupta VK, Dauer P, Arora N, Sharma N, Nomura A, et al. Inhibition of hypoxic response decreases stemness and reduces tumorigenic signaling due to impaired assembly of HIF1 transcription complex in pancreatic cancer. Sci Rep. 2017;7(1):7872. pmid:28801636
  22. 22. Ying H, Kimmelman AC, Lyssiotis CA, Hua S, Chu GC, Fletcher-Sananikone E, et al. Oncogenic Kras maintains pancreatic tumors through regulation of anabolic glucose metabolism. Cell. 2012;149(3):656–70. pmid:22541435
  23. 23. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016;34(2):184–91. pmid:26780180
  24. 24. Suarez-Arnedo A, Torres Figueroa F, Clavijo C, Arbeláez P, Cruz JC, Muñoz-Camargo C. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS One. 2020;15(7):e0232565. pmid:32722676
  25. 25. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269).
  26. 26. Tsherniak A, Vazquez F, Montgomery PG, Weir BA, Kryukov G, Cowley GS, et al. Defining a Cancer Dependency Map. Cell. 2017;170(3):564–576.e16. pmid:28753430
  27. 27. Liberzon A, Birger C, Thorvaldsdóttir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database Hallmark Gene Set Collection. Cell Syst. 2015;1(6):417–25.
  28. 28. Kumaravel TS, Vilhar B, Faux SP, Jha AN. Comet Assay measurements: a perspective. Cell Biol Toxicol. 2009;25(1):53–64. pmid:18040874
  29. 29. Chen D, Li M, Luo J, Gu W. Direct interactions between HIF-1 alpha and Mdm2 modulate p53 function. J Biol Chem. 2003;278(16):13595–8. pmid:12606552
  30. 30. Papke B, Murarka S, Vogel HA, Martín-Gago P, Kovacevic M, Truxius DC. Identification of pyrazolopyridazinones as PDEδ inhibitors. Nat Commun. 2016;7(1).
  31. 31. Zimmermann G, Papke B, Ismail S, Vartak N, Chandra A, Hoffmann M, et al. Small molecule inhibition of the KRAS-PDEδ interaction impairs oncogenic KRAS signalling. Nature. 2013;497(7451):638–42. pmid:23698361
  32. 32. Chen Z, Jin K, Gao L, Lou G, Jin Y, Yu Y, et al. Anti-tumor effects of bakuchiol, an analogue of resveratrol, on human lung adenocarcinoma A549 cell line. Eur J Pharmacol. 2010;643(2–3):170–9. pmid:20599920
  33. 33. Ellinghaus P, Heisler I, Unterschemmann K, Haerter M, Beck H, Greschat S, et al. BAY 87-2243, a highly potent and selective inhibitor of hypoxia-induced gene activation has antitumor activities by inhibition of mitochondrial complex I. Cancer Med. 2013;2(5):611–24. pmid:24403227
  34. 34. Helbig L, Koi L, Brüchner K, Gurtner K, Hess-Stumpp H, Unterschemmann K, et al. BAY 87-2243, a novel inhibitor of hypoxia-induced gene activation, improves local tumor control after fractionated irradiation in a schedule-dependent manner in head and neck human xenografts. Radiat Oncol. 2014;9:207. pmid:25234922
  35. 35. Ricker JL, Chen Z, Yang XP, Pribluda VS, Swartz GM, Van Waes C. 2-methoxyestradiol inhibits hypoxia-inducible factor 1alpha, tumor growth, and angiogenesis and augments paclitaxel efficacy in head and neck squamous cell carcinoma. Clin Cancer Res. 2004;10(24):8665–73. pmid:15623651
  36. 36. Nagaraju GP, Zakka KM, Landry JC, Shaib WL, Lesinski GB, El-Rayes BF. Inhibition of HSP90 overcomes resistance to chemotherapy and radiotherapy in pancreatic cancer. Int J Cancer. 2019;145(6):1529–37. pmid:30801702
  37. 37. Tang L, Wu J, Cai S, Huang Y, Zhang X, Fu W. Prolyl hydroxylase domain 3 influences the radiotherapy efficacy of pancreatic cancer cells by targeting hypoxia-inducible factor-1α. OncoTargets Ther. 2018;11:8507–15.
  38. 38. Tu KJ, Roy SK, Keepers Z, Gartia MR, Shukla HD, Biswal NC. Docetaxel radiosensitizes castration-resistant prostate cancer by downregulating CAV-1. Int J Radiat Biol. 2024;100(2):256–67. pmid:37747697
  39. 39. Karanam K, Kafri R, Loewer A, Lahav G. Quantitative live cell imaging reveals a gradual shift between DNA repair mechanisms and a maximal use of HR in mid S phase. Mol Cell. 2012;47(2):320–9. pmid:22841003
  40. 40. Wozny A-S, Gauthier A, Alphonse G, Malésys C, Varoclier V, Beuve M, et al. Involvement of HIF-1α in the Detection, Signaling, and Repair of DNA Double-Strand Breaks after Photon and Carbon-Ion Irradiation. Cancers (Basel). 2021;13(15):3833. pmid:34359734
  41. 41. Wang H, Guo M, Wei H, Chen Y. Targeting p53 pathways: mechanisms, structures, and advances in therapy. Signal Transduct Target Ther. 2023;8(1):92. pmid:36859359
  42. 42. Tiwari A, Tashiro K, Dixit A, Soni A, Vogel K, Hall B. Loss of HIF1A from pancreatic cancer cells increases expression of PPP1R1B and degradation of p53 to promote invasion and metastasis. Gastroenterology. 2020;159(5):1882–1897.e5.
  43. 43. Tu KJ, Diplas BH, Regal JA, Waitkus MS, Pirozzi CJ, Reitman ZJ. Mining cancer genomes for change-of-metabolic-function mutations. Commun Biol. 2023;6(1):1143. pmid:37950065
  44. 44. Wang L, Lin S, Yang C, Cai S, Li W. Effect of KRAS mutations and p53 expression on the postoperative prognosis of patients with colorectal cancer. Mol Genet Genomic Med. 2022;10(7):e1905. pmid:35686701
  45. 45. Aubrey BJ, Kelly GL, Janic A, Herold MJ, Strasser A. How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell Death Differ. 2018;25(1):104–13. pmid:29149101
  46. 46. Lees A, Sessler T, McDade S. Dying to Survive-The p53 Paradox. Cancers. 2021;13(13):3257.
  47. 47. McCann JJ, Vasilevskaya IA, McNair C, Gallagher P, Neupane NP, de Leeuw R, et al. Mutant p53 elicits context-dependent pro-tumorigenic phenotypes. Oncogene. 2022;41(3):444–58. pmid:34773073
  48. 48. McDonald PC, Chafe SC, Brown WS, Saberi S, Swayampakula M, Venkateswaran G, et al. Regulation of pH by Carbonic Anhydrase 9 Mediates Survival of Pancreatic Cancer Cells With Activated KRAS in Response to Hypoxia. Gastroenterology. 2019;157(3):823–37. pmid:31078621
  49. 49. Ai X, Zhou A, Wu L, Song Z, Li Z, Wu H. A first-in-human phase I/II study of GFH375, a highly selective and potent oral KRAS G12D inhibitor in patients with KRAS G12D mutant advanced solid tumors. J Clin Oncol. 2025;43(16_suppl):3013.
  50. 50. Wei D, Wang L, Zuo X, Maitra A, Bresalier RS. A small molecule with big impact: MRTX1133 targets the KRASG12D mutation in pancreatic cancer. Clin Cancer Res. 2024;30(4):655–62.
  51. 51. Veeraballi S, Aiman W, Ahmad A, Grewal N, Qirem M, Jumean S. Efficacy and safety of Kras inhibitors in pancreatic cancer: A systematic review of clinical trials. J Clin Oncol. 2023;41(16_suppl):e16297.
  52. 52. Mahadevan KK, McAndrews KM, LeBleu VS, Yang S, Lyu H, Li B, et al. KRASG12D inhibition reprograms the microenvironment of early and advanced pancreatic cancer to promote FAS-mediated killing by CD8+ T cells. Cancer Cell. 2023;41(9):1606–20.e8.
  53. 53. Tu KJ, Stewart CE, Hendrickson PG, Regal JA, Kim SY, Ashley DM, et al. Pooled genetic screens to identify vulnerabilities in TERT-promoter-mutant glioblastoma. Oncogene. 2023;42(44):3274–86. pmid:37741952
  54. 54. Arbour KC, Tawee T, Yaeger R, Parikh AR, Oberstein P, Papadopoulos KP, et al. Abstract CT019: Preliminary safety and antitumor activity of zoldonrasib (RMC-9805), an oral, RAS(ON) G12D-selective, tri-complex inhibitor in patients with KRAS G12D non-small cell lung cancer (NSCLC) from a phase 1 study in advanced solid tumors. Cancer Research. 2025;85(8_Supplement_2):CT019–CT019.
  55. 55. Calvo-Anguiano G, Lugo-Trampe JJ, Camacho A, Said-Fernández S, Mercado-Hernández R, Zomosa-Signoret V, et al. Comparison of specific expression profile in two in vitro hypoxia models. Exp Ther Med. 2018;15(6):4777–84. pmid:29805495
  56. 56. Yaeger R, Solit DB. Overcoming adaptive resistance to KRAS inhibitors through vertical pathway targeting. Clin Cancer Res Off J Am Assoc Cancer Res. 2020;26(7):1538–40.
  57. 57. Liu Y, Han J, Hsu W-H, LaBella KA, Deng P, Shang X, et al. Combined KRAS Inhibition and Immune Therapy Generates Durable Complete Responses in an Autochthonous PDAC Model. Cancer Discov. 2025;15(1):162–78. pmid:39348506