Skip to main content
Advertisement
Browse Subject Areas
?

Click through the PLOS taxonomy to find articles in your field.

For more information about PLOS Subject Areas, click here.

  • Loading metrics

Molecular characterization of Rhipicephalus microplus and Haemaphysalis bispinosa ticks from cattle across Thailand: Regional identification and evidence of different genetic sub-structures between mainland and peninsular populations

  • Danai Sangthong,

    Roles Conceptualization, Investigation, Methodology, Resources, Writing – original draft

    Affiliation Department of Veterinary Technology, Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand

  • Pradit Sangthong,

    Roles Conceptualization, Investigation, Methodology, Resources

    Affiliation Department of Genetics, Faculty of Science, Kasetsart University, Bangkok, Thailand

  • Warin Rangubpit,

    Roles Data curation, Formal analysis, Software

    Affiliations Department of Veterinary Technology, Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand, Department of Chemistry, Faculty of Science, Kasetsart University, Bangkok, Thailand

  • Prapasiri Pongprayoon,

    Roles Methodology, Software, Visualization

    Affiliations Department of Chemistry, Faculty of Science, Kasetsart University, Bangkok, Thailand, Center for Advanced Studies in Nanotechnology for Chemical, Food and Agricultural Industries, KU Institute for Advanced Studies, Kasetsart University, Bangkok, Thailand

  • Eukote Suwan,

    Roles Investigation, Methodology

    Affiliation Department of Veterinary Technology, Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand

  • Kannika Wongpanit,

    Roles Investigation, Methodology

    Affiliation Department of Agriculture and Resources, Faculty of Natural Resources and Agro-Industry, Chalermphrakiat Sakon Nakhon Province Campus, Kasetsart University, Sakon Nakhon, Thailand

  • Wissanuwat Chimnoi,

    Roles Investigation, Methodology

    Affiliation Department of Parasitology, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand

  • Pacharathon Simking,

    Roles Investigation, Methodology

    Affiliation Faculty of Agricultural Technology, Rajamangala University of Technology Thanyaburi, Pathum Thani, Thailand

  • Sinsamut Sae Ngow,

    Roles Investigation, Methodology

    Affiliation Faculty of Agricultural Technology, Rajamangala University of Technology Thanyaburi, Pathum Thani, Thailand

  • Serge Morand,

    Roles Supervision, Writing – review & editing

    Affiliation IRL HealthDEEP, CNRS – Kasetsart University – Mahidol University, Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand

  • Roger W. Stich,

    Roles Validation, Visualization, Writing – review & editing

    Affiliation Knipling-Bushland United States of America Livestock Insects Research Laboratory Cattle Fever Tick Research Unit Agricultural Research Service N. Moorefield Rd., Edinburg, Texas, United States of America

  • Sathaporn Jittapalapong

    Roles Conceptualization, Funding acquisition, Project administration, Supervision, Validation, Writing – review & editing

    fvetspj@ku.ac.th

    Affiliation Department of Veterinary Technology, Faculty of Veterinary Technology, Kasetsart University, Bangkok, Thailand

Abstract

Phylogenetic and population genetic analyses were conducted on tick specimens collected from cattle in northern, northeastern, central, and southern regions of Thailand. Morphological identification indicated these ticks consisted of three species, Rhipicephalus microplus from all four regions, R. sanguineus from the northern and northeastern regions, and a Haemaphysalis species only collected from the northeastern region. Analysis of cytochrome c oxidase subunit I gene (COI) sequences identified R. microplus clades A and C, while clade B was not detected in this study. The same analysis indicated specimens morphologically identified as Haemaphysalis were H. bispinosa, confirming previous reports of their prevalence in northeastern Thailand. H. bispinosa showed low haplotype and nucleotide diversity, suggesting either a bottleneck or founder effect. Both R. microplus clades displayed high haplotype diversity and low nucleotide diversity, a pattern associated with population expansion. Genetic structural analysis revealed significant genetic differences in R. microplus clade A, especially between mainland (northern, northeastern, and central regions) and peninsular (southern region) populations, which indicated limited gene flow between these areas while suggesting movement of these ticks across the mainland. The sequence analyses described in this report enhance understanding of the natural history of ticks in Thailand and are expected to guide and strengthen tick control strategies across Southeast Asia.

Introduction

Ticks cause substantial economic losses to limited-resource farming communities, especially in tropical and subtropical regions where approximately 80% of the world’s cattle are raised [1,2]. Ixodid tick infestations cause direct damage due to feeding lesions and blood loss, and ticks transmit pathogens, including etiologic agents of four major arthropod-borne diseases of cattle, viz. anaplasmosis, cowdriosis, babesiosis, and theileriosis, which pose serious threats to both animal health and livestock productivity [3]. Thus, understanding local tick vector populations is fundamental to evaluation of tick-borne disease risks.

Rhipicephalus (Boophilus) microplus, commonly known as the “tropical cattle fever tick,” is arguably the most devastating hematophagous ectoparasite of cattle and buffaloes worldwide, in large part because it vectors agents of bovine babesiosis and anaplasmosis, which are considered the two most important vector-borne diseases of cattle worldwide [4]. Rhipicephalus microplus has been reported in Asia, including Southeast Asian countries such as Thailand [58]. Substantial losses in milk production are associated with tick infestation of dairy cows in Thailand because each engorged female tick is thought to be responsible for the loss of 8.9 ml of milk and 1 g of live weight gain [9]. Moreover, tick-borne diseases have been reported among cattle and buffaloes throughout Thailand [8,1012]. Thus, tick distributions in Thailand are expected to be indicators of tick-borne disease outbreaks and their subsequent economic impact on livestock production. However, morphologic taxonomy of R. microplus is challenging, particularly due to the difficulty in morphological differentiation at the subspecies level [13]. Conversely, molecular characterization enables distinguishing closely related, morphologically identical taxa [14].

Acarine mitochondrial cytochrome c oxidase subunit I gene (COI) sequences from different parts of the world have become increasingly available in GenBank, allowing more robust phylogenetic comparisons [15]. To date, three distinct COI lineage assemblages are reported within the species R. microplus. Additionally, COI was identified as a suitable genetic marker for tick species identification, with five phylogenetic clades within a putative R. microplus complex: R. annulatus, R. australis, and three R. microplus s.l. clades (A, B and C) [16]. COI sequence analysis was useful in the classification and identification of these ticks [17,18]. However, genetic information on cattle ticks in Thailand remains limited and is primarily based on COI and 16S rDNA sequences from the northeastern region of the country. Analysis of COI sequences in this area revealed R. microplus clades A and C. The results obtained with COI and the highly conserved 16S rDNA sequences underscored the advantages of COI in resolving evolutionary relationships within R. microplus [19].

To obtain more comprehensive genetic information, this study employed COI sequences to address three objectives: [1] sampling and COI sequence analysis for identification of cattle tick species from all regions across Thailand, [2] conducting molecular analyses in greater depth at the population level, and [3] estimating the demographic history of tick populations in Thailand. Possible causes of these genetic characteristics were identified and future trends predicted for these populations. These findings are expected to be useful for guiding tick and tick-borne disease control strategies across Southeast Asia.

Materials and methods

Samples

Tick specimens were collected from cattle in 32 provinces across the four geographic regions of Thailand. Ticks were thoroughly rinsed with double-distilled water (ddH₂O), air-dried, and preserved in 70% ethanol at room temperature until further processing. Morphological identification was performed to differentiate the tick species, using previous publications as references [13,2025]. All animal care and experimental procedures were approved by the Animal Experiment Committee of Kasetsart University, Thailand (Approval No. ACKU64-VTN-018), and were conducted in strict accordance with the Regulations on Animal Experiments at Kasetsart University. This field study involving vertebrate animals fully complied with these institutional regulations.

DNA extraction and PCR amplification

Ticks preserved in 70% ethanol were individually washed in ddH2O on a sterile plate before genomic DNA was isolated with the DNeasy Blood and Tissue Kit (Qiagen, Germany), and stored at −20 °C. Primers RmicCoI_parH1 (CTCAACTAATCATAAAGACATTGG) and RmicCoI_parL1 (TATAAACTTCAGGGTGGCCAA) were used to amplify the COI target sequence from each specimen. The optimized PCR consisted of 20 µL reactions containing 2 µL of 10X Taq Buffer, 1.25 mM MgCl2, 0.2 mM of each dNTP, 2 units Taq DNA polymerase (Thermo Fisher Scientific, Lithuania, EU), 0.250 µM of each primer, and 1 µL of each DNA template. The thermal cycler parameters included initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55 °C for 30 s, elongation at 72 °C for 30 s, and final elongation at 72 °C for 30 s. All PCR products were electrophoresed in 1% agarose gels. Amplicons were purified using the FavorPrep™ Gel/PCR Purification Kit (Favorgen, Taiwan) and submitted for Sanger DNA sequencing (ATGC Co.,Ltd., Thailand).

Phylogenetic analysis

COI sequences amplified from Rhipicephalus microplus (94 amplicons) and Haemaphysalis sp. (12 amplicons) were compared to 42 tick COI sequences retrieved from GenBank (S1 Table). These sequences were aligned, with Ixodes ricinus as the outgroup, using Muscle software [26]. A neighbor-joining (NJ) tree was reconstructed with 105 bootstrap replications using the program PAUP v.4 (build 169) [27].

Population genetic analysis

Population genetics were based on the northern, northeastern, central, and southern geographic regions of Thailand. To determine the genetic structure of tick populations across Thailand, the number of haplotypes (h), haplotype diversity (Hd), nucleotide diversity (Pi), analysis of molecular variance (AMOVA), pairwise fixation index (FST), and gene flow (Nm) were analyzed using Arlequin v3.5.1.2 [28]. Genetic relationships between COI haplotypes of ticks in Thailand were accessed by reconstruction of Median Joining (MJ) Network using the program Network v10.2 (https://www.fluxus-engineering.com). Neutrality indices, including Tajima’s D, Fu’s Fs, and the divergence time parameter (τ), were determined using Arlequin v3.5.1.2. Historical demographic fluctuations were elucidated using a Bayesian Skyline Plot (BSP) in BEAST 2.6.0 [29]. A mutation rate of 3.54% per million years [30] was applied using the HKY substitution model, which was identified as the best-fitting model by jModelTest software [31]. An MCMC method with 100 million iterations under a relaxed exponential clock was performed. Effective sample size (ESS) and the construction of the BSP were determined using TRACER 1.6 software [32].

Results

Morphological survey of ticks on cattle in Thailand

A total of 341 tick specimens were manually classified, using morphological keys [13,2025], into three species: Rhipicephalus microplus, R. sanguineus, and a member of the genus Haemaphysalis. Morphological keys used for species identification are summarized as follows:

  • Rhipicephalus (Boophilus) microplus: the basis capitulum was dorsally hexagonal, laterally produced, and equal in length to the mouthparts. The second palpal segments were not laterally produced but bore ridges on both the dorsal and ventral surfaces. This subgenus lacked festoons. Males possessed an adanal shield, an accessory adanal shield, and this species possessed a caudal process.
  • Rhipicephalus sanguineus: the basis capitulum was dorsally hexagonal, laterally produced, and equal in length to the mouthparts. The second palpal segments were not laterally produced and lacked ridges on both the dorsal and ventral surfaces. This subgenus had festoons, and males possessed an adanal shield and an accessory adanal shield.
  • Haemaphysalis: the second segment of the palp was laterally produced beyond the margin of the basis capitulum. The basis capitulum was rectangular in shape. This genus had festoons. Males did not possess an adanal shield, accessory adanal shield, or caudal process.

The prevalence of different species collected indicated that R. microplus was the most common species collected from cattle (78.59%), followed by members of the genus Haemaphysalis (16.72%) and R. sanguineus (4.69%). All three species were present in the northeastern region, while R. microplus and R. sanguineus were found in the northern region and R. microplus alone was collected in the central and southern regions (Table 1).

thumbnail
Table 1. Morphological identification of tick specimens collected from cattle in the four major geographic regions across Thailand. These specimens were morphologically identified with established taxonomic keys.

https://doi.org/10.1371/journal.pone.0337052.t001

Molecular identification

Representative specimen samples were used for molecular analyses to confirm morphological identifications and to more specifically identify Haemaphysalis and R. microplus species and strains, respectively. The COI target sequence was not amplified from R. sanguineus. Details for each region, subregion and their respective provinces are presented in Table 2. Amplified COI sequences were compared to reference sequences and tree topology was clearly separated into two COI clades of Haemaphysalis and R. microplus. A monophyletic clade was formed between the samples identified morphologically as Haemaphysalis in this study and H. bispinosa (OP383037) from China, clustering separately from other Haemaphysalis spp. sequences (Fig 1). A monophyletic relationship was also observed between COI sequences of Thai ticks morphologically identified as R. microplus (Fig 1), which aligned most closely with Clades A and C. Clade A, which consisted of R. microplus sequences from all regions of Thailand, was the most common genetic lineage detected in this study. Clade B was not detected among sequences tested in this study. Clade C was only detected in samples collected from the northern region.

thumbnail
Table 2. Sampling locations of tick specimens used for COI sequence analysis. Numbers represent specimens of R. microplus and H. bispinosa collected throughout Thailand. Sources include original data from this study and previously published data [33].

https://doi.org/10.1371/journal.pone.0337052.t002

thumbnail
Fig 1. Radial phylogenetic tree of tick COI sequences.

The tree was constructed using PAUP* software under the General Time Reversible (GTR) model, incorporating a Gamma-distributed rate of evolution and a proportion of invariant sites (GTR + G + I). Rate heterogeneity among sites was modeled using a Gamma distribution (shape parameter = 0.6550), with 49.60% of sites designated as invariant (pinvar = 0.4960). The tree depicts evolutionary relationships among tick species collected from various regions of Thailand. Bootstrap support values (based on 100,000 replicates) are shown at the nodes. Phylogenetic clades identified in this study are labeled as Rhipicephalus microplus clades A, B, and C, and Haemaphysalis bispinosa, represented by green, yellow, violet, and sky blue, respectively. Geographic origins of the tick samples—northern, northeastern, central, and southern Thailand—are indicated by branch colors: red, blue, pink, and green, respectively.

https://doi.org/10.1371/journal.pone.0337052.g001

Genetic diversity

Nucleotide diversity analysis of these sequences revealed a consistent pattern of low COI nucleotide diversity among both R. microplus and H. bispinosa across all four regions surveyed, while R. microplus and H. bispinosa respectively showed low and high haplotype diversity (Fig 2). H. bispinosa from the northeastern region exhibited a haplotype diversity of 0.439 and a nucleotide diversity of 0.00105. R. microplus clade A across Thailand showed haplotype diversity ranging from 0.670 to 0.956 and nucleotide diversity ranging from 0.00151 to 0.00531. R. microplus clade C exhibited a haplotype diversity of 0.818 and a nucleotide diversity of 0.00105. Haplotype analysis of 182 sequences revealed three haplotypes for H. bispinosa, 51 for R. microplus Clade A, and seven for R. microplus Clade C. Among the 51 haplotypes of R. microplus Clade A, Hap_A03 was most common, with a frequency of 37.74%, and was found in all except the southern region of Thailand. The other 50 haplotypes consisted of 15 shared haplotypes, all present in adjacent regions, and the remaining 35 were region-specific haplotypes (S2 Table).

thumbnail
Fig 2. Median joining network of R. microplus haplotypes from Thailand based on COI sequences, constructed using Network v10.2 software.

Circle sizes represent the number of sequences belonging to each haplotype. Vertical bars on lines connecting haplotypes indicate the number of substitutions separating them. The geographic origins of each haplotype are indicated by different colors. The network relationship between R. microplus clades A and C is shown in (a). Connection details between haplotypes within clades A and C are presented in (b) and (c), respectively.

https://doi.org/10.1371/journal.pone.0337052.g002

Genetic structure

Genetic differences between tick populations from different geographic regions in Thailand were analyzed based on various hypotheses of population structure (Table 3). The AMOVA results indicated genetic structure only when applying the two-region hypothesis, which divided the regions into the mainland (northern, northeastern and central) and peninsula (southern). Genetic variation between the mainland and peninsula accounted for 33.23% of the total variation and showed significant F-statistics (FCT = 0.332, p = 0.048). Genetic differences between the mainland and peninsular populations were reassessed using pairwise FST comparisons (Table 4), which ranged from 0.162 to 0.740, all of which were significant (p ≤ 0.05). In contrast, the pairwise FST values between populations within the mainland (northern, northeastern, and central) were non-significant, ranging from −0.019 to 0.076. However, the FST comparison between the mainland and peninsula showed a significant difference (FST = 0.350, p ≤ 0.05). The Nm values among the seven geographic regions ranged from 0.176 to infinity (Table 4). Nm values between the Lower Southern population and all other populations were below 1.00, while those for the Upper Southern population were higher, ranging from 1.227 to 5.212. In contrast, Nm values among the five mainland populations ranged from 6.091 to infinity.

thumbnail
Table 3. Hierarchical analysis of molecular variance (AMOVA) of 4 posited genetic structures. Bold values are statistically significant.

https://doi.org/10.1371/journal.pone.0337052.t003

thumbnail
Table 4. Pairwise FST values (lower diagonal) and gene flow Nm (upper diagonal) between tick populations from different regions of Thailand. Values in the lower diagonal represent genetic differentiation (FST), while those in the upper diagonal indicate estimated gene flow (Nm) between populations. “Inf” denotes infinite gene flow. Statistically significant FST values are shown in bold.

https://doi.org/10.1371/journal.pone.0337052.t004

Demographic history

Neutrality tests based on Tajima’s D and Fu’s Fs were conducted (Table 5). Negative values of Tajima’s D and Fu’s Fs were observed for H. bispinosa, which were collected only from northern Thailand, and from all regions for R. microplus clades A and C. Significant negative values of Tajima’s D test were detected in R. microplus clade A from the northeast and central regions, while significant and highly significant values of Fu’s Fs were detected in all populations of R. microplus. Pooled population analysis of R. microplus clade A, from all regions of Thailand, showed highly significant Tajima’s D and Fu’s Fs values of −2.20001 and −27.29267, respectively. A significantly negative value of Tajima’s D test indicated purifying selection or population expansion, while a significantly negative value of Fu’s Fs directly indicated population expansion. To assess population expansion, R. microplus sequences representing both clades were further analyzed using a skyline plot, with a substitution rate of 0.0354 per site per million years. BSP analysis revealed that the effective population size of R. microplus was stable over long periods of time and initiated a sudden expansion in the last 25,000 years (Fig 3).

thumbnail
Table 5. Summary of COI diversity of H. bispinosa and R. microplus clades A and C.

https://doi.org/10.1371/journal.pone.0337052.t005

thumbnail
Fig 3. Demographic history of Rhipicephalus microplus in Thailand inferred using a Bayesian skyline plot based on COI sequences.

The x-axis represents time in thousands of years before present (x 1000 years ago) and the y-axis represents the effective population size on a logarithmic scale. The blue solid line indicates the mean estimate, while the copper-blue shaded area represents the 95% highest probability density (HPD) interval.

https://doi.org/10.1371/journal.pone.0337052.g003

Discussion

Thailand is an agricultural country with a diverse range of sectors. The livestock sector is a major industry with high market value, providing benefits to all levels of society [34,35]. However, tropical livestock production faces challenges, one of which is tick infestations [36]. At least 25 ixodid tick species have been identified in Thailand, belonging to the genera Haemaphysalis, Ixodes, Amblyomma, Dermacentor, Rhipicephalus and Nosomma [37]. In terms of threats to livestock health, particularly for cattle, only a few tick species have been reported, including R. haemaphysaloides, R. microplus, R. sanguineus and H. bispinosa [33,38,39].

Morphological identification results in this study revealed that R. microplus was prevalent throughout Thailand, suggesting R. microplus is a source of significant economic losses in livestock production due to its widespread distribution and ability to transmit pathogens such as Babesia bigemina, B. bovis and Anaplasma marginale [40]. Notably, R. microplus, R. sanguineus, and H. bispinosa, which are considered common tick species among livestock in Thailand, were identified among the specimens collected in this study. In contrast, R. haemaphysaloides was not detected in the current study, although a total of nine specimens of this species were previously reported from four of 18 provinces in the northeast region of Thailand [19]. Collectively, these reports support previous suggestions that R. haemaphysaloides was rarely found, only in the northeast region of Thailand [19], and suggests its limited presence in other regions. This distribution pattern aligns with reports of R. haemaphysaloides prevalence in Bhutan [41], China [42,43], and Sri Lanka [44]. Despite its limited distribution, R. haemaphysaloides remains a potential vector of disease agents and warrants continued surveillance [45].

Mitochondrial COI sequences were used to expand upon morphological identification of two species through molecular analysis, H. bispinosa and R. microplus. Other groups have used these sequences for specific identification of morphologically identical specimens, including a COI lineage restricted to R. microplus from China, which those authors suggested could be a cryptic species more closely related to R. annulatus [16]. In the current study, phylogenetic tree topology revealed a monophyletic clade of 12 Haemaphysalis sequences, which aligned most closely with the H. bispinosa reference sequence (OP383037). Taxonomic classification beyond the genus Haemaphysalis in Thailand, based on morphological characteristics, has been challenging. As a result, several authors reported such samples as “Haemaphysalis sp.” [46] or “Haemaphysalis spp.” [4749]. The COI analysis performed in this study, incorporating a novel pair of primers and PCR protocol, overcame the limitations of morphological identification of Haemaphysalis spp., indicating these 12 Haemaphysalis sequences were H. bispinosa and the establishment of this species in northeastern Thailand.

The phylogenetic tree demonstrated COI-based identification of R. microplus aligned with morphological findings while offering enhanced resolution to the subspecies level. All 170 R. microplus sequences analyzed in this study were distinctly grouped into two clades, 159 sequences in clade A and 11 in clade C. R. microplus clade A was the most common across the four geographic regions sampled in Thailand, corroborating previous reports of its high prevalence in specific surveillance areas, such as the northeast region [19]. R. microplus clade A has been reported as the dominant and most widely distributed clade across subtropical and tropical regions worldwide [6,5053]. Clade C, the other R. microplus lineage detected in this study, was also less frequent than clade A in other areas, including Pakistan, Myanmar, Malaysia, Bangladesh, India and Thailand [5456]. Previously, 91 and 25 specimens of R. microplus clades A and C, respectively, were reported in studies focused on the northeastern region of Thailand [19]. However, another study in the same region detected only R. microplus clade A among the 79 R. microplus specimens examined [33]. In the present study, R. microplus clade C was found only in the northern region. The distribution of R. microplus clade C in Thailand, as well as in sub-regions of other countries where clade C was identified, warrants further investigation.

R. microplus clade B, which some authorities consider a cryptic species indigenous to Southern China and Northern India, was not detected in the current study and has not been reported in Thailand [19,33]. Based on this detailed investigation into the genetic lineages of R. microplus in Thailand, clade A is most likely the primary contributor to tick-borne disease outbreaks and the associated economic losses in this country. The less frequent clade C has an uncertain prevalence in Thailand, and its impact on livestock remains unclear. However, previously reported occurrences of clades B and C suggested they could potentially pose a threat in Thailand. Clade B has been reported in several states in northern India (Rajasthan, Punjab, Uttar Pradesh, Bihar, and West Bengal states) and southern China, while clade C has been widely reported in Pakistan, India, Bangladesh, Myanmar, and Malaysia [56]. These areas have continuous live cattle trade with Thailand, which likely facilitates the spread of ticks from all genetic lineages. Therefore, although clade B is currently undetectable and clade C remains less common, they could become more important due to the trade flows of live cattle across South and Southeast Asia, because Thailand imports live cattle from the west (India, Bangladesh and Myanmar) and exports them to several regions, including to the north (China and Laos), east (Cambodia and Vietnam) and south (Malaysia) [57]. Thus, trade routes could facilitate the spread of clades B and C that originate in other countries along Thailand’s western trade routes.

Haplotype analysis revealed clear distinctions between H. bispinosa and R. microplus, as well as between R. microplus lineages A and C, without haplotypes shared between clades or species. The absence of shared haplotypes among ticks in this study indicated a lack of gene flow, suggesting that they belong to distinct reproductive groups [58,59]. Although the lack of shared haplotypes may be attributed to the small sample size in some analysis groups [60], the distinct genetic groups—between H. bispinosa and R. microplus, as well as between R. microplus clades A and C—remain supported by the results of phylogenetic inference and network analysis. The haplotype diversity and nucleotide diversity of H. bispinosa and R. microplus clades A and C, based on the samples collected in this study, represent different categories of genetic diversity. H. bispinosa exhibited low values for both haplotype diversity (Hd < 0.5) and nucleotide diversity (Pi < 0.5), suggesting this tick species recently experienced a population bottleneck or a founder effect [61]. Conversely, R. microplus clades A and C showed high values of haplotype diversity (Hd > 0.5) and low values of nucleotide diversity (Pi < 0.5), presumably due to recent expansion of this tick population [62].

Although population expansion of ticks is commonly associated with recent cattle trade flows that facilitate the spread of ticks through live cattle transfers, the skyline plot in the present study suggested an expansion began over 25,000 years ago, predating modern trade routes. The initiation of the expansion period for R. microplus was estimated to have occurred during the late Pleistocene epoch, approximately 129,000–11,700 years ago [63]. During this period, the region that is now Thailand served as a major route for human migration and the dispersal of various mammalian species [6466]. The high population density and migratory activities of both hominin and non-hominin fauna, including Artiodactyla, were likely significant factors in driving the population growth of R. microplus during this time period.

R. microplus exhibited relatively high haplotype (Hd > 0.5) and low nucleotide (Pi < 0.5) diversities in both regional and overall analyses across Thailand, suggesting the R. microplus population in Thailand is undergoing expansion. A similar pattern of genetic diversity has been observed in tick populations globally, including Malaysia [55], Brazil [50] and the Neotropical region covering Panama, Colombia, Brazil, and Argentina [18]. These observed genetic characteristics indicated these tick populations are expanding globally as well as in Thailand.

The population structure of R. microplus clade A revealed distinct differences between the peninsular (southern) and mainland populations. The lack of genetic structure and high gene flow observed among mainland populations (northern, northeastern, and central regions) in this study is likely influenced by the intensive production and movement of cattle and buffalo across these areas. Additionally, connections to adjacent countries likely contributed indirectly to increased gene flow between tick populations [67]. Limited gene flow between the southern and other regions could be due to less economic activity and thus less movement of cattle and buffalo connected to the southern region [6870]. Because genetic differences were detected between mainland and peninsular populations, further study of R. microplus indigenous to southern Thailand is warranted.

In summary, this report confirmed the utility of integrating morphological and molecular approaches for identification of tick species indigenous to Thailand. The use of mitochondrial COI sequencing not only rectified challenges of classifying morphologically similar Haemaphysalis spp. but also provided finer resolution at the subspecies level of R. microplus. These findings confirmed that R. microplus is the predominant species affecting cattle in Thailand, with clade A widespread among multiple regions and clade C limited to the north, while H. bispinosa was established in the northeast. Haplotype analyses revealed distinct genetic groups with high haplotype but low nucleotide diversities within R. microplus clades, indicating an expansion tracing back to the late Pleistocene epoch, a period marked by significant faunal migrations. Collectively, these results underscore the economic impact of tick infestations on Thailand’s livestock sector and highlight potential risks associated with live cattle trade, which may influence the distribution of R. microplus clades. Further research, particularly into lineages and regional genetic structures, is warranted to develop effective management strategies for mitigation of tick-borne diseases of livestock in Thailand.

Supporting information

S1 Table. Reference sequences of R. microplus, Rhipicephalus spp., Haemaphysalis spp. and outgroup (Ixodes ricinus).

https://doi.org/10.1371/journal.pone.0337052.s001

(DOCX)

S2 Table. Haplotype distribution of H. bispinosa and R. microplus Clades A and C in Thailand.

https://doi.org/10.1371/journal.pone.0337052.s002

(DOCX)

References

  1. 1. Jonsson NN. The productivity effects of cattle tick (Boophilus microplus) infestation on cattle, with particular reference to Bos indicus cattle and their crosses. Vet Parasitol. 2006;137(1–2):1–10. pmid:16472920
  2. 2. Rodrigues DS, Leite RC. Economic impact of Rhipicephalus (Boophilus) microplus: estimate of decreased milk production on a dairy farm. Arq Bras Med Vet Zootec. 2013;65(5):1570–2.
  3. 3. Steelman CD. Effects of external and internal arthropod parasites on domestic livestock production. Annu Rev Entomol. 1976;21:155–78. pmid:2093
  4. 4. Uilenberg G. International collaborative research: significance of tick-borne hemoparasitic diseases to world animal health. Vet Parasitol. 1995;57(1–3):19–41. pmid:7597784
  5. 5. Ghosh S, Bansal GC, Gupta SC, Ray D, Khan MQ, Irshad H, et al. Status of tick distribution in Bangladesh, India and Pakistan. Parasitol Res. 2007;101 Suppl 2:S207-16. pmid:17823830
  6. 6. Roy BC, Estrada-Peña A, Krücken J, Rehman A, Nijhof AM. Morphological and phylogenetic analyses of Rhipicephalus microplus ticks from Bangladesh, Pakistan and Myanmar. Ticks Tick Borne Dis. 2018;9(5):1069–79. pmid:29661691
  7. 7. Tanskul P, Stark HE, Inlao I. A checklist of ticks of Thailand (Acari: Metastigmata: Ixodoidea). J Med Entomol. 1983;20(3):330–41. pmid:6876093
  8. 8. Sarataphan N, Kakuda T, Chansiri K, Onuma M. Survey of benign Theileria parasites of cattle and buffaloes in Thailand using allele-specific polymerase chain reaction of major piroplasm surface protein gene. J Vet Med Sci. 2003;65(1):133–5. pmid:12576720
  9. 9. Jonsson NN, Matschoss AL. Attitudes and practices of Queensland dairy farmers to the control of the cattle tick, Boophilus microplus. Aust Vet J. 1998;76(11):746–51. pmid:9862066
  10. 10. Terkawi MA, Huyen NX, Wibowo PE, Seuseu FJ, Aboulaila M, Ueno A, et al. Spherical body protein 4 is a new serological antigen for global detection of Babesia bovis infection in cattle. Clin Vaccine Immunol. 2011;18(2):337–42. pmid:21123520
  11. 11. Cao S, Aboge GO, Terkawi MA, Yu L, Kamyingkird K, Luo Y, et al. Molecular detection and identification of Babesia bovis and Babesia bigemina in cattle in northern Thailand. Parasitol Res. 2012;111(3):1259–66. pmid:22645033
  12. 12. Rittipornlertrak A, Nambooppha B, Simking P, Punyapornwithaya V, Tiwananthagorn S, Jittapalapong S, et al. Low levels of genetic diversity associated with evidence of negative selection on the Babesia bovis apical membrane antigen 1 from parasite populations in Thailand. Infect Genet Evol. 2017;54:447–54. pmid:28807856
  13. 13. Walker AR, Bouattour A, Camicas J-L, Estrada-Pena A, Horak IG, Latif AA. Ticks of domestic animals in africa: a guide to identification of species. Edinburgh: The University of Edinburgh; 2003.
  14. 14. Coimbra-Dores MJ, Maia-Silva M, Marques W, Oliveira AC, Rosa F, Dias D. Phylogenetic insights on Mediterranean and Afrotropical Rhipicephalus species (Acari: Ixodida) based on mitochondrial DNA. Exp Appl Acarol. 2018;75(1):107–28. pmid:29605833
  15. 15. Nava S, Guglielmone AA, Mangold AJ. An overview of systematics and evolution of ticks. Front Biosci (Landmark Ed). 2009;14(8):2857–77. pmid:19273240
  16. 16. Li H-Y, Zhao S-S, Hornok S, Farkas R, Guo L-P, Chen C-F, et al. Morphological and molecular divergence of Rhipicephalus turanicus tick from Albania and China. Exp Appl Acarol. 2017;73(3–4):493–9. pmid:29181674
  17. 17. Araya-Anchetta A, Busch JD, Scoles GA, Wagner DM. Thirty years of tick population genetics: a comprehensive review. Infect Genet Evol. 2015;29:164–79. pmid:25461844
  18. 18. Díaz-Sánchez S, Hernández-Triana LM, Labruna MB, Merino O, Mosqueda J, Nava S, et al. Low Genetic Diversity of the Only Clade of the Tick Rhipicephalus microplus in the Neotropics. Pathogens. 2023;12(11):1344. pmid:38003808
  19. 19. Tantrawatpan C, Vaisusuk K, Chatan W, Pilap W, Suksavate W, Andrews RH, et al. Genetic diversity and phylogenetic analyses of ixodid ticks infesting cattle in northeast Thailand: the discovery of Rhipicephalus microplus clade C and the rarely detected R. haemaphysaloides. Exp Appl Acarol. 2022;86(4):535–48. pmid:35230584
  20. 20. Yamaguti N, Tipton VJ, Keegan HL, Toshioka S. Ticks of Japan, Korea, and the Ryukyu islands: Brigham Young University Science Bulletin, Biological Series 15: No. 1 Article 1. 1971.
  21. 21. Petney TN, Saijuntha W, Boulanger N, Chitimia-Dobler L, Pfeffer M, Eamudomkarn C, et al. Ticks (Argasidae, Ixodidae) and tick-borne diseases of continental Southeast Asia. Zootaxa. 2019;4558(1):1–89. pmid:30790915
  22. 22. Arthur DR. Ticks; a monograph of the Ixodoidae. New York: Cambridge; 1960.
  23. 23. Walker JB, Keirans JE, Horak IG. The genus Rhipicephalus (Acari, Ixodidae): A guide to the brown ticks of the world. New York: Cambridge University Press; 2000.
  24. 24. Kwak ML, Ng A. The detection of three new Haemaphysalis ticks (Acari: Ixodidae) in Singapore and their potential threat for public health, companion animals, and wildlife. Acarologia. 2022;62(4):927–40.
  25. 25. Tanskull P, Inlao I. Keys to the adult ticks of Haemaphysalis Koch, 1844, in Thailand with notes on changes in taxonomy (Acari: Ixodoidea: Ixodidae). J Med Entomol. 1989;26(6):573–601. pmid:2585453
  26. 26. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–7. pmid:15034147
  27. 27. Swofford DL. Phylogenetic analysis using parsimony (* and other methods). 4 edition. Sunderland: Sinauer Associates; 2003.
  28. 28. Excoffier L, Laval G, Schneider S. Arlequin version 3.0: An integrated software package for population genetics data analysis. Switzerland: University of Berne; 2005.
  29. 29. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLoS Comput Biol. 2019;15(4):e1006650. pmid:30958812
  30. 30. Papadopoulou A, Anastasiou I, Vogler AP. Revisiting the insect mitochondrial molecular clock: the mid-Aegean trench calibration. Mol Biol Evol. 2010;27(7):1659–72. pmid:20167609
  31. 31. Posada D. jModelTest: phylogenetic model averaging. Mol Biol Evol. 2008;25(7):1253–6. pmid:18397919
  32. 32. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst Biol. 2018;67(5):901–4. pmid:29718447
  33. 33. Thinnabut K, Rodpai R, Sanpool O, Maleewong W, Tangkawanit U. Genetic diversity of tick (Acari: Ixodidae) populations and molecular detection of Anaplasma and Ehrlichia infesting beef cattle from upper-northeastern Thailand. Infect Genet Evol. 2023;107:105394. pmid:36502740
  34. 34. Herrero M, Grace D, Njuki J, Johnson N, Enahoro D, Silvestri S, et al. The roles of livestock in developing countries. Animal. 2013;7 Suppl 1:3–18. pmid:23121696
  35. 35. Vijitsrikamol K. Economic impact evaluation of livestock research investments in Thailand. J Austrian Soc Agric Econ. 2021;17:515–27.
  36. 36. Eskezia BG, Desta AH. Review on the impact of ticks on livestock health and productivity. J Biol Agric Healthcare. 2016;6(22):1–7.
  37. 37. Takhampunya R, Sakolvaree J, Chanarat N, Youngdech N, Phonjatturas K, Promsathaporn S, et al. The Bacterial Community in Questing Ticks From Khao Yai National Park in Thailand. Front Vet Sci. 2021;8:764763. pmid:34881320
  38. 38. Chaorattanakawee S, Tachavarong W, Hananantachai H, Bunsermyos W, Chanarat N, Promsathaporn S, et al. Seasonal pattern of questing ticks and prevalence of pathogenic Rickettsia and Anaplasmataceae in Khao Yai national park, Thailand. Travel Med Infect Dis. 2024;58:102696. pmid:38360157
  39. 39. Sankar M, Kumar B, Manjunathachar HV, Parthasarathi BC, Nandi A, Neethu CKS, et al. Genetic Diversity of Rhipicephalus (Boophilus) microplus for a Global Scenario: A Comprehensive Review. Pathogens. 2024;13(6):516. pmid:38921813
  40. 40. de la Fuente J. Controlling ticks and tick-borne diseases…looking forward. Ticks Tick Borne Dis. 2018;9(5):1354–7. pmid:29656834
  41. 41. Namgyal J, Lysyk TJ, Couloigner I, Checkley S, Gurung RB, Tenzin T, et al. Identification, Distribution, and Habitat Suitability Models of Ixodid Tick Species in Cattle in Eastern Bhutan. Trop Med Infect Dis. 2021;6(1):27. pmid:33669524
  42. 42. Intirach J, Lv X, Han Q, Lv Z-Y, Chen T. Morphological and Molecular Identification of Hard Ticks in Hainan Island, China. Genes (Basel). 2023;14(8):1592. pmid:37628643
  43. 43. Li L-H, Zhang Y, Wang J-Z, Li X-S, Yin S-Q, Zhu D, et al. High genetic diversity in hard ticks from a China-Myanmar border county. Parasit Vectors. 2018;11(1):469. pmid:30107820
  44. 44. Liyanaarachchi DR, Jinadasa HRN, Dilrukshi PRMP, Rajapakse RPVJ. Epidemiological study on ticks in farm animals in selected areas of Sri Lanka. Trop Agric Res. 2015;24(4):336.
  45. 45. Diyes GCP, Apanaskevich DA, Rajakaruna RS. Lifecycle of Rhipicephalus haemaphysaloides under laboratory conditions. Med Vet Entomol. 2017;31(3):327–32. pmid:28671735
  46. 46. Rakthong P, Nooma W, Trinachartvanit W, Ahantarig A. Biodiversity and distribution of ticks in southern Thailand. Rajabhat J Sci Humanit Soc Sci. 2015;16:312–21.
  47. 47. Ahantarig A, Malaisri P. Biodiversity of ticks and tick-borne pathogens in the eastern and northeastern regions of Thailand. Bangkok, Thailand: Biodiversity Research and Training Program (BRT), Mahidol University; 2011.
  48. 48. Gogkhuntod N, Wiwatwitaya D, Duengkae P, Jittapalapong S. Diversity and ecological aspects of hard ticks (Ixodoidae) in dry evergreen forest at Sakaerat Environmental Research Station, Nakhon Ratchasima Province. Thai J Forest. 2013;32:10–9.
  49. 49. Tiawsirisup S, Kaewthamasorn M. Diversity and role of ticks as pathogen vectors in nature. Bangkok: Chulalongkorn University; 2021.
  50. 50. Csordas BG, Garcia MV, Cunha RC, Giachetto PF, Blecha IMZ, Andreotti R. New insights from molecular characterization of the tick Rhipicephalus (Boophilus) microplus in Brazil. Rev Bras Parasitol Vet. 2016;25(3):317–26. pmid:27579530
  51. 51. Baron S, van der Merwe NA, Maritz-Olivier C. The genetic relationship between R. microplus and R. decoloratus ticks in South Africa and their population structure. Mol Phylogenet Evol. 2018;129:60–9. pmid:30102976
  52. 52. Kanduma EG, Emery D, Githaka NW, Nguu EK, Bishop RP, Šlapeta J. Molecular evidence confirms occurrence of Rhipicephalus microplus Clade A in Kenya and sub-Saharan Africa. Parasit Vectors. 2020;13(1):432. pmid:32854747
  53. 53. Kazim AR, Low VL, Tappe D, Houssaini J, Heo CC. Rhipicephalus annulatus, R. australis or R. microplus? Discordance between morphological and genetic data among three cattle tick species. Exp Appl Acarol. 2022;87:119–31.
  54. 54. Burger TD, Shao R, Barker SC. Phylogenetic analysis of mitochondrial genome sequences indicates that the cattle tick, Rhipicephalus (Boophilus) microplus, contains a cryptic species. Mol Phylogenet Evol. 2014;76:241–53. pmid:24685498
  55. 55. Low VL, Tay ST, Kho KL, Koh FX, Tan TK, Lim YAL, et al. Molecular characterisation of the tick Rhipicephalus microplus in Malaysia: new insights into the cryptic diversity and distinct genetic assemblages throughout the world. Parasit Vectors. 2015;8:341. pmid:26104478
  56. 56. Ali A, Khan MA, Zahid H, Yaseen PM, Qayash Khan M, Nawab J, et al. Seasonal Dynamics, Record of Ticks Infesting Humans, Wild and Domestic Animals and Molecular Phylogeny of Rhipicephalus microplus in Khyber Pakhtunkhwa Pakistan. Front Physiol. 2019;10:793. pmid:31379587
  57. 57. FAO. Introduction and spread of lumpy skin disease in South, East and Southeast Asia – Qualitative risk assessment and management. Rome: FAO Animal Production and Health, Paper 183. 2020.
  58. 58. Chenoweth SF, Hughes JM, Keenan CP, Lavery S. Concordance between dispersal and mitochondrial gene flow: isolation by distance in a tropical teleost, Lates calcarifer (Australian barramundi). Hered. 1996;80:187–97.
  59. 59. Koopman WJM, Li Y, Coart E, van de Weg WE, Vosman B, Roldán-Ruiz I, et al. Linked vs unlinked markers: multilocus microsatellite haplotype-sharing as a tool to estimate gene flow and introgression. Mol Ecol. 2007;16(2):243–56. pmid:17217342
  60. 60. Fourdrilis S, Backeljau T. Highly polymorphic mitochondrial DNA and deceiving haplotypic differentiation: implications for assessing population genetic differentiation and connectivity. BMC Evol Biol. 2019;19(1):92. pmid:30999853
  61. 61. Wei D, Zheng S, Wang S, Yan J, Liu Z, Zhou L. Genetic and haplotype diversity of Manila clam Ruditapes philippinarum in different regions of China based on three molecular markers. Animals. 2023;13:2886.
  62. 62. Grant WS, Bowen BW. Shallow population histories in deep evolutionary lineages of marine fishes: insights from sardines and anchovies and lessons for conservation. J Hered. 1998;89:415–26.
  63. 63. Cohen KM, Finney SC, Gibbard PL, Fan J-X. The ICS International Chronostratigraphic Chart. Episodes. 2013;36(3):199–204.
  64. 64. Pope GG, Frayer DW, Liangchareon M, Kulasing P, Nakabanlang S. Palaeoanthropological investigations of the Thai-American expedition in Northern Thailand: an interim report. Asian Perspect. 1980;21(2):147–63.
  65. 65. Lipson M, Cheronet O, Mallick S, Rohland N, Oxenham M, Pietrusewsky M, et al. Ancient genomes document multiple waves of migration in Southeast Asian prehistory. Science. 2018;361(6397):92–5. pmid:29773666
  66. 66. Shoocongdej R, Wattanapituksakul A. Faunal assemblages and demography during the Late Pleistocene (MIS 2-1) to Early Holocene in Highland Pang Mapha, Northwest Thailand. Quater Inter. 2020;563:51–63.
  67. 67. De R, Sharma R, Singh SK, Rasteiro R, Bhaskar R, Khan I. Conservation implications of high gene flow and lack of pronounced spatial genetic structure in elephants supported by contiguous suitable habitat in north-western India. Conserv Sci Pract. 2023;6:e13075.
  68. 68. Smith P, Luthi NB, Huachun L, Oo KN, Phonvisay S, Premashthira S. Movement pathways and market chains of large ruminants in the Greater Mekong Sub-region. Thailand: World organisation for animal health; 2015.
  69. 69. Silatsa BA, Simo G, Githaka N, Mwaura S, Kamga RM, Oumarou F, et al. A comprehensive survey of the prevalence and spatial distribution of ticks infesting cattle in different agro-ecological zones of Cameroon. Parasit Vectors. 2019;12(1):489. pmid:31623642
  70. 70. Warrasuth N, Buameethup N. Network analysis of cattle and buffalo movements in Thailand, 2012-2016. Bangkok, Thailand: Department of Livestock Development; 2017.